Am J Physiol Endocrinol Metab
280: E203–E208, 2001.
Age effect on transcript levels and synthesis rate
of muscle MHC and response to resistance exercise
PRABHAKARAN BALAGOPAL,1 JILL COENEN SCHIMKE,1
PHILIP ADES,2 DEBORAH ADEY,1 AND K. SREEKUMARAN NAIR1
1
Endocrinology Division, Mayo Clinic, Rochester, Minnesota 55905;
and 2University of Vermont, Burlington, Vermont 05405
Received 28 December 1999; accepted in final form 27 September 2000
myosin heavy chain; messenger ribonucleic acid; aging; muscle; protein synthesis
has dramatically changed during this
century, resulting in an increase of the elderly population in our society (38). Muscle wasting and associated
impairment of muscle functions and consequent disabilities are rapidly becoming a major public health
problem (9, 10). Because muscle is a major metabolic
organ, especially in disposing of orally administered
carbohydrates, decreased muscle mass can contribute
to the reduced glucose disposal that is observed in
elderly people (12). Decreased muscle mass and muscle
function can also cause a decrease in energy expenditure, which in turn leads to obesity and insulin resis-
LIFE EXPECTANCY
Address for reprint requests and other correspondence: K. Sreekumaran Nair, Mayo Clinic and Foundation, 200 First St., Joseph
5–194, Rochester, MN 55905 (E-mail: [email protected]).
http://www.ajpendo.org
tance (19, 21). The mechanism of this age-related muscle change remains to be clearly defined. Several
studies have reported that synthetic rates of mixed
muscle proteins and myosin heavy chain (MHC), the
main protein in muscle contractile apparatus, and of
mitochondrial protein decrease with age (5, 30, 36, 39).
The synthesis rate of MHC was correlated to muscle
strength, suggesting that muscle strength is related to
the ability to synthesize MHC (39). The current study
sought to determine whether the decrease in MHC
synthesis occurred because of changes at the transcriptional or posttranscriptional level. To accomplish this,
we measured the steady-state transcript levels of MHC
isoforms (MHCI, MHCIIa, and MHCIIx) in skeletal
muscle biopsy samples obtained from young, middleaged, and older people. In addition, we determined the
effect of 3 mo of resistance exercise on MHC synthesis
rate and the transcript levels of MHC isoforms.
METHODS
Subjects
We studied 39 subjects, 19 of middle age (46–60 yr, 52 ⫾
0.8 yr) and 20 older (65–79 yr, 71 ⫾ 1 yr). Because of limited
sample availability, 26 of these subjects (12 of middle age and
14 older) were used for the measurement of MHC isoform
transcript levels. Seven young subjects (20–27 yr, 24 ⫾ 1 yr)
were also added to determine the effect of age on MHC
transcript levels. Some aspects of the study, including agerelated changes in mitochondrial protein (30) and MHC synthesis (5), were previously reported. The body mass index
(kg/m2) values of the young (23 ⫾ 1), middle-aged (25.4 ⫾
0.8), and older subjects (25.8 ⫾ 0.8) were similar. The muscle
mass, based on urinary creatinine output, was lower in the
middle-aged (26.9 ⫾ 1.7 kg; P ⬍ 0.05) and older (23 ⫾ 1.4 kg;
P ⬍ 0.01) than in the young subjects (30.6 ⫾ 1.8 kg). All
subjects were determined to be healthy on the basis of physical examination and blood tests. Subjects who exercised
regularly for ⱖ2 days/wk and women taking hormone replacement were excluded from the study.
Study Protocol
The protocol was approved by the Institutional Review
Boards of the University of Vermont and Mayo Clinic and
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
0193-1849/01 $5.00 Copyright © 2001 the American Physiological Society
E203
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
Balagopal, Prabhakaran, Jill Coenen Schimke,
Philip Ades, Deborah Adey, and K. Sreekumaran Nair.
Age effect on transcript levels and synthesis rate of muscle
MHC and response to resistance exercise. Am J Physiol
Endocrinol Metab 280: E203–E208, 2001.—Experimental evidence indicates that a lower synthesis rate of muscle contractile protein myosin heavy chain (MHC) occurs in agerelated muscle wasting and weakness. To determine the
molecular mechanism of this lower synthesis of MHC, we
measured transcript levels of isoforms of MHC (MHCI,
MHCIIa, and MHCIIx) in muscle biopsy samples of 7 young
(20–27 yr), 12 middle-aged (47–60 yr), and 14 older (⬎65 yr)
people. We further determined the effect of 3 mo of resistance
exercise training (exercise) vs. nonintervention (control) on
transcript levels of MHC isoforms on these subjects and the
fractional synthesis rate (FSR) of MHC in 39 people aged
46–79 yr. MHCI mRNA levels did not significantly change
with age, but MHCIIa decreased 38% (P ⬍ 0.05) from young
to middle age and further decreased 50% (P ⬍ 0.05) from
middle to old age. MHCIIx decreased 84% (P ⬍ 0.05) from
young to middle age and 48% from middle to old age (P ⬍
0.05). Exercise increased FSR of MHC by 47% (P ⬍ 0.01) and
mixed muscle protein by 56% (P ⬍ 0.05). Exercise training
results in an increase (85%) in transcript levels of MHCI and
a decrease in the transcript levels of MHCIIa and MHCIIx. In
conclusion, an age-related lowering of the transcript levels of
MHCIIa and MHCIIx is not reversed by exercise, whereas
exercise results in a higher synthesis rate of MHC in association with an increase in MHCI isoform transcript levels.
E204
AGE AND EXERCISE EFFECT ON MYOSIN ISOFORMS
Isotope Infusions and Muscle Biopsy Studies
Exercise Training Program
FSR of MHC and MMP was calculated using the following
equation (14, 27)
Subjects exercised three times weekly and completed three
sets of eight repetitions of the following exercises with Universal Gym apparatus: squat, bench press, lateral pull-down,
leg extension, leg curl, arm extension, and arm curl. The
subjects were instructed to raise the weight for over 2 s and
to resist the lowering of the weight over 4 s. Initially, the
resistances were set at a level that represented 50% of the
subject’s one repetition maximum strength (1RM). The
weight lifted was increased on a progressive basis until by
the start of the 9th wk the subjects were exercising at ⬃80%
of their current 1RM. 1RM strengths were reassessed during
the 4th, 7th, and 10th wk of the training session. All exercises were completed under the supervision of a qualified
exercise physiologist.
Measurement of Muscle Strength
1RM represents the maximum amount of weight that a
subject can lift once (13). After a warm-up and instruction
regarding proper techniques for completing the movement,
subjects were asked to lift progressively heavier weights
until they reached a weight they could not lift. The selection
of weights and the rate of increase were chosen to ensure that
the maximum capacity of the subject was reached in four to
six lifts. 1RM tests were performed in this fashion for bench
press and leg extension.
Muscle Mass from Urinary Creatinine Output
During the last 3 days (days 4, 5, and 6) of a meat-free diet,
muscle mass was computed on the basis of a ratio of 20 kg
muscle mass 䡠 g urinary creatinine⫺1 䡠 day⫺1 (18). The approach is based on the fact that creatinine is derived almost
exclusively from creatinine phosphate in muscle.
The study was performed after an overnight fast on the 6th
day. The last meals of the day were given at 10 PM on all 5
days to accustom subjects to the meal regimen and to minimize the overnight fast on the study day. An intravenous line
for infusion was inserted before 10 PM on day 5, and the line
was kept patent by saline (0.9 N) infusion. At 1:30 AM, the
infusion was changed to isotope administration, which consisted of a primed (7.5 ␮mol 䡠 kg⫺1 䡠 h⫺1) continuous infusion of
13
⫺1
L-[1- C]leucine (7.5 ␮mol 䡠 kg
䡠 h⫺1), as previously described (27), for 10 h. Muscle biopsies were performed from
the vastus lateralis under local anesthesia with a percutaneous needle, as previously described (27), at 5 h (6 AM) and
10 h (11 AM) (27). Muscle samples [150 mg for MHC, 50 mg
each for mRNA and mixed muscle protein (MMP)] were
immediately frozen in liquid nitrogen and kept at ⫺80°C
until analysis.
Measurement of Muscle Protein Synthesis
MMP in the biopsy sample (25–50 mg) was separated and
hydrolyzed as described previously (5, 7, 28). MHC purification was performed using 100- to 150-mg muscle samples as
previously described (2–4). Both MHC and MMP were hydrolyzed, and amino acids were purified as previously described (2, 28). Isotopic enrichment in leucine was measured
as previously described (2). Muscle tissue fluid leucine enrichment was also measured as previously described (25).
FSR of Muscle Protein
FSR ⫽ (E f ⫺ E i /E p ⫻ t) ⫻ 100
where Ef and Ei represent the enrichments as atom percent
excess of 13C derived from decarboxylation of leucine from
MHC and MMP at the final and initial muscle biopsies. Ep is
the precursor pool (plasma ␣-ketoisocaproic acid) enrichment, and t represents the time interval (5 h) between initial
and final biopsies in hours.
RNA Isolation and cDNA Synthesis
Total RNA was extracted from skeletal muscle tissue (⬃10
mg) by the guanidinium method (TriReagent, Molecular Research Center, Cincinnati, OH). One microgram of total RNA
was treated with DNase (Life Technologies, Gaithersburg,
MD) and then reverse transcribed using the TaqMan Reverse
Transcription Reagents (PE Biosystems, Foster City, CA)
according to the manufacturer’s instruction.
Real-Time PCR
Primers and probes were selected using the Primer Express software (PE Biosystems) and screened for mispriming
of other MHC isoforms by use of the Oligo Primer Analysis
Software v.5.0 (National Biosciences, Plymouth, MN). The
internal probe was labeled at the 5⬘ end with a reporter dye
FAM (6⬘-carboxyfluorescein) and at the 3⬘ end with a
quencher dye TAMRA (6⬘-carboxytetramethyl-rhodamine)
and was phosphate-blocked at the 3⬘ end to prevent extension. The 28S probe was constructed identically, with the
exception that the 5⬘ end of the probe was labeled with a
fluorescent dye (PE Biosystems). The reporter and quencher
dyes are in close proximity on the probe, resulting in suppression of reporter fluorescence by Forster energy transfer
(24). The probe hybridizes to a specific sequence within the
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
Foundation. Informed consent was obtained from the volunteers before the study. The first part of the study was to
determine the effect of age on transcript levels of MHC
isoforms. The second part of the study was to determine
whether 3 mo of resistance exercise stimulates MHC synthesis rate and transcript levels of MHC isoforms in the middleaged and older people (⬎46 years), who are reported to have
decreased synthesis rate of MHC (5). In the first part of the
study, we compared the results of MHC isoform transcripts
obtained in the 7 young subjects with those obtained in the
12 middle-aged and 14 older subjects. In the second part of
the study, we randomly assigned the 39 middle-aged and
older people (46–79 yr) to either a resistance exercise program or a nonintervention (control) program for 3 mo. Muscle
strength, fractional synthesis rate (FSR) of MHC, and mRNA
levels of isoforms of MHC were measured at baseline and at
the end of 3 mo.
The baseline studies and the study at the end of 3 mo were
performed in an identical manner. All subjects were given a
weight-maintaining diet (protein-fat-carbohydrate ⫽ 15:30:
55) for 5 days before the study at the General Clinical
Research Center. Subjects followed the diet for 2 days as
outpatients and were admitted as inpatients on the evening
of day 2. Twenty-four-hour urine samples were collected on
days 4, 5, and 6 to determine the average 24-h urinary
creatinine excretion (18). Muscle strength tests were performed on either day 1 or day 2. The muscle protein synthesis
tests and biopsies for mRNA measurements were performed
on day 6.
AGE AND EXERCISE EFFECT ON MYOSIN ISOFORMS
E205
Statistics
ANOVA was used to detect differences among the three
age groups in the mRNA levels of MHC isoforms and muscle
mass. When a difference (age effect) was observed, unpaired
t-tests were performed to determine the differences between
the specific groups. Multivariate repeated-measures ANOVA
with two response variables (exercise and age) was applied
for determining training effect. In addition, we determined
whether the different pre- and postexercise parameters between middle and older age people are significant by use of
ANOVA.
Fig. 1. Age effect on mRNA levels of myosin heavy chain (MHC)
isoforms in 7 young, 12 middle-aged, and 14 older subjects. Level of
isoform MHCIIa was lower in middle-aged group than the young
(*P ⬍ 0.05) and lower in the older group than in the middle-aged
group (#P ⬍ 0.04). MHCIIa was also lower in the older group than in
the young (*P ⬍ 0.001). MHCIIx mRNA in the middle-aged group
was lower than in the young (*P ⬍ 0.03) and was lower in the older
group than in the middle-aged group (#P ⬍ 0.04). The older group
has much lower levels of MHCIIx than the young (P ⬍ 0.02). MHCI
mRNA showed a tendency to be lower in the older age groups, but the
differences did not reach statistical significance (P ⬎ 0.05).
RESULTS
control group. There was no interaction between age
and exercise effects.
FSR. Figure 2 shows the FSR of MHC and MMP,
demonstrating an exercise effect (P ⬍ 0.01). The control group showed no change in FSR of either MHC or
MMP after exercise. In contrast, in the exercise group
there was an increase in FSR of MHC (average 47%;
P ⬍ 0.01) and MMP (56%; P ⬍ 0.05). There was no age
effect on any of the responses to exercise.
Transcript levels of MHC isoforms. Figure 3 shows
the exercise effect on the mRNA levels of MHC isoforms in middle-aged and older subjects. MHCI mRNA
levels significantly increased after 3 mo of exercise.
MHCIIa and MHCIIx mRNA levels decreased significantly postexercise. The control group showed no
change in trancript levels of MHCI, MHCIIa, and
MHCIIx.
Part I: Age Effect
We measured the transcript levels of MHC isoforms.
Figure 1 shows mRNA levels of MHCI, MHCIIa, and
MHCIIx in young (20–27 yr), middle-aged (47–54 yr),
and older (64–79 yr) people. As noted in Fig. 1, a
significant age effect was evident for MHCIIa and
MHCIIx. For both MHCIIa and MHCIIx, there was
progressive decrease from young to middle and older
age groups.
Part II: Exercise Effect
Muscle strength. There was an exercise effect on
muscle strength (P ⬍ 0.001). Whereas in the exercise
group leg extension (91 ⫾ 8 lbs to 125 ⫾ 11, P ⬍ 0.01),
leg curl (35 ⫾ 4 lbs to 54 ⫾ 6, P ⬍ 0.01), and bench
press (75 ⫾ 7 lbs to 91 ⫾ 8, P ⬍ 0.01) showed increased
strength, no significant changes in leg extension (68 ⫾
8 lbs to 70 ⫾ 8), leg curl (24 ⫾ 4 lbs to 25 ⫾ 3), and
bench press (60 ⫾ 6 lbs to 63 ⫾ 7) occurred in the
DISCUSSION
The current study demonstrated for the first time
that, in humans, there is generalized age-related low-
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
PCR product. The 5⬘-to-3⬘ exonuclease activity of the Taq
DNA polymerase allows for separation of the reporter from
the close proximity of the quencher dye, resulting in fluorescence of the reporter dye (17). The resulting fluorescence was
measured at each cycle of amplification on the ABI Sequence
Detection System (PE Biosystems). The primers were not
labeled.
The following primer and probe sequences were used.
MHCI (GeneBank Accession no. M21665) forward primer:
AAGGTCAAGGCCTACAAGC; reverse primer: CGGAACTTGGACAGGTTGGT; probe: TGGCTTGCTCCTCCGCCTCCT.
MHCIIa (GeneBank Accession no. AF111784) forward
primer: CAATCTAGCTAAATTCCGCAAGC; reverse primer:
TCACTTATGACTTTTGTGTGAACCT; probe: TTCACCCGCAGTTTGTTCACCTGGGA. MHCIIx (GeneBank Accession
no. AF111785) forward primer: GGAGGAACAATCCAACGTCAA; reverse primer: TGACCTGGGACTCAGCAATG; probe:
CAAATTCCGGAGGATCCAGCACGA. 28S (GeneBank
Accession no. M11167) forward primer: TGGGAATGCAGCCCAAAG; reverse primer: CCTTACGGTACTTGTTGACTATCG; probe: TGGTAAACTCCATCTAAGGCTAAATACCGGCA.
We applied this highly sensitive and reproducible realtime PCR method to quantify MHC mRNA. The signal for
28S ribosomal RNA was used to normalize against differences in RNA isolation and RNA degradation and in the
efficiencies of the reverse transcription and PCR reactions.
All samples were run in triplicate and quantitated by normalizing the MHC signal with the 28S signal. The final
quantitation was achieved by a relative standard curve (29).
E206
AGE AND EXERCISE EFFECT ON MYOSIN ISOFORMS
ering of transcript levels of MHC isoforms, with significant changes occurring only for MHCIIa and MHCIIx.
A 3-mo resistance exercise program increased muscle
strength and stimulated synthesis rate of MHC. The
resistance exercise increased mRNA levels of MHCI
and further decreased those of MHCIIa and MHCIIx.
Effect of Age on MHC Isoform Transcript Levels
The mechanism of senescence remains to be clearly
defined. One of the leading hypotheses is that senescence results from a progressive accumulation of damage to DNA and tissues caused by free oxygen radicals
(15). In support of this hypothesis, it has been observed
that there are age-related deletions and mutations of
mitochondrial DNA (26, 32), presumably due to the
constant exposure to free oxygen radicals generated in
mitochondria during electron chain transport. Studies
in rodents demonstrated that a decrease in mitochondrial DNA copy numbers occurs with age (6), a reflection of possible cumulative DNA damage. It is believed
that damage to mitochondrial DNA results in a decrease in mitochondrial protein synthesis (30). It is
unclear whether similar age-related changes in nuclear DNA also occur. The results from the current
study demonstrate that the transcript levels of muscle
proteins encoded by the nuclear DNA are also diminished with age. These results are in contrast to the
hypothesis that the decrease in synthesis rate of MHC
(5) occurs because of posttranscriptional changes (34).
The current study demonstrates a substantial reduction in transcript levels of MHCIIa and MHCIIx in the
older people compared with the younger people. Even
MHCI tends to decrease with age, although this decrease did not reach statistical significance. There is
certainly an overall reduction in transcript levels of
MHC isoforms. These results suggest that the decreased synthesis rate of MHC in older people (5)
Fig. 3. Exercise effect on RNA levels of MHC isoforms expressed in
arbitrary units (A. U.). MHCI increased after 3 mo of exercise (P ⬍
0.01), whereas MHCIIa (P ⬍ 0.04) and MHCIIx (P ⬍ 0.01) decreased
after exercise. The control group showed no change in mRNA levels
of all MHC isoforms assayed.
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
Fig. 2. Effect of exercise (vs. control) on the fractional synthesis rate
(FSR) of myosin heavy chain (MHC) and mixed muscle protein in 39
subjects (aged 46–79 yr). Exercise increased FSR of MHC (P ⬍ 0.05)
and FSR of mixed muscle protein (P ⬍ 0.05). Measurements did not
change in the control group.
occurs because of decreased transcript availability of
the adult isoforms of MHC. It is therefore possible that
the decreased protein synthesis with age is due either
to defects at the transcription level or to DNA damage.
However, direct evidence for this will be forthcoming
only if synthetic rates of isoforms of MHC are measured and the precise level of defect (DNA or transcription or both) has been demonstrated. Currently, such
measurements are not feasible by use of needle biopsy
samples.
It has previously been demonstrated that there is a
decrease in the total number of muscle fibers in older
people and that the relative decrease of type II fiber
size is more pronounced than that of type I fibers in the
elderly (23). Lexell (22), on the basis of an extensive
review of publications in this area, concluded that the
age-related reduction in fiber number of vastus lateralis muscle affects both types of fibers, although type I
fibers are relatively higher in number. It is now well
known that the fiber classification based on myosin
ATPase histochemistry depends on the differences in
myosin ATPase activity of various isoforms of MHC
(11, 31, 33). Human muscle fibers are composed of
MHCI, MHCIIa, and MHCIIb (8) in different stoichiometric ratios. Because the dominant MHC isoforms
determine fiber type on the basis of the ATPase staining technique, the fiber classification is not sufficiently
sensitive to demonstrate the changes in muscle MHC
isoforms in skeletal muscle, especially in elderly people
(1). Analysis of vastus lateralis muscle samples from
the elderly subjects demonstrated that younger subjects had a higher proportion of fibers containing only
MHCI and MHCIIa than the older subjects (20). The
current study demonstrated that the underlying molecular mechanism of this was the lower transcript
levels of these two isoforms of MHC in older than in
younger people. The maximal difference was noted for
AGE AND EXERCISE EFFECT ON MYOSIN ISOFORMS
MHCIIx transcript levels, which may explain a substantial reduction in fiber type IIb in the older people
(23). There are many potential functional changes that
could occur with the changes in the composition of
MHC isoforms that occur with aging. The lower levels
of MHCIIa and MHCIIx that are noted with aging
could be the cause of lower fast-twitch muscle fibers in
the elderly people.
Effect of Exercise on Age-Induced Changes in
Transcript Levels, MHC Isoforms, and MHC
Synthesis Rate
In summary, the current study demonstrated that
the transcript levels of MHCIIa and MHCIIx mRNA
become lower progressively with age. These observations may explain the molecular basis of metabolic and
functional changes that occur in human muscle with
advancing age. Although a 3-mo resistance-training
program increased muscle strength and synthesis rate
of MHC, it did not reverse the decrease in transcript
levels of MHCIIa and MHCIIx that we observed in the
middle-aged and older subjects. However, resistance
training increased MHCI transcript levels and may
explain why older people have relatively higher
amounts of type I fibers in their skeletal muscle.
We thank the volunteers for participating in this study. We are
grateful to Dawn Morse, Jane Kahl, Carole Berg, Mai Persson, and
Charles Ford for their skilled technical assistance; Monica Davis for
secretarial support; Maureen Bigelow, Jody Utton, and Dr. Doug
Ballor for support in conducting the studies and compiling the data;
and Drs. Robert Rizza, Kevin Short, and Rocco Barazzoni for useful
comments.
This study was supported by National Institutes of Health Grants
RO1-AG-09531, RR-00585, and RR-109.
Current addresses: P. Balagopal, Bioanalytical Lab, Research 9th
Floor, PO Box 5988, The Nemours Childrens Hospital, 807 Nira St.,
Jacksonville, FL 32247; D. Adey, Renal Transplant Service, M884,
Box 0116, University of California, San Francisco, CA 94143.
REFERENCES
1. Andersen JL, Terzis G, and Kryger A. Increase in the degree
of coexpression of myosin heavy chain isoforms in skeletal muscle fibers of the very old. Muscle Nerve 22: 449–454, 1999.
2. Balagopal P, Ford GC, Ebenstein DB, Nadeau DA, and
Nair KS. Mass spectrometric methods for determination of
[13C]leucine enrichment in human muscle protein. Anal Biochem 239: 77–85, 1996.
3. Balagopal P, Ljungqvist O, and Nair KS. Skeletal muscle
myosin heavy-chain synthesis rate in healthy humans. Am J
Physiol Endocrinol Metab 272: E45–E50, 1997.
4. Balagopal P, Nair KS, and Stirewalt WS. Isolation of myosin
heavy chain from small skeletal muscle samples by preparative
continuous elution gel electrophoresis: application to measurement of synthesis rate in humans and animal tissue. Anal
Biochem 221: 72–77, 1994.
5. Balagopal P, Rooyackers OE, Adey DB, Ades PA, and Nair
KS. Effects of aging on in vivo synthesis of skeletal muscle
myosin heavy-chain and sarcoplasmic protein in humans. Am J
Physiol Endocrinol Metab 273: E790–E800, 1997.
6. Barazzoni R, Short KR, and Nair KS. Effects of aging on
mitochondrial DNA copy number and cytochrome c oxidase gene
expression in rat skeletal muscle, liver, and heart. J Biol Chem
275: 3343–3347, 2000.
7. Baumann PQ, Stirewalt WS, O’Rourke BD, Howard D, and
Nair KS. Precursor pools of protein synthesis: a stable isotope
study in a swine model. Am J Physiol Endocrinol Metab 267:
E203–E209, 1994.
8. Biral D, Betto R, Danieli-Betto D, and Salviati G. Myosin
heavy chain composition of single fibres from normal human
muscle. Biochem J 250: 307–308, 1988.
9. Dutta C and Hadley EC. The significance of sarcopenia in old
age. J Gerontol 50A: 1–4, 1996.
10. Dutta C, Hadley EC, and Lexell J. Sarcopenia and physical
performance in old age: overview. Muscle Nerve Suppl 5: S5–S9,
1997.
11. Ennion S, Pereira JSA, Sargeant AJ, Young A, and Goldspink G. Characterization of human skeletal muscle fibres according to the myosin heavy chains they express. J Muscle Res
Cell Motil 16: 35–43, 1995.
12. Fink RI, Kolterman OG, Griffin J, and Olefsky JM. Mechanisms of insulin resistance in aging. J Clin Invest 71: 1523–
1535, 1983.
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
The current study demonstrated that resistance exercise stimulated MHC synthesis rate in the middleaged and older subjects. These results are consistent
with the demonstration of increased synthesis rate of
MMP reported previously in the elderly people after a
2-wk resistance training program (39). Another study
failed to see this stimulatory effect on myofibrillar
protein synthesis rate in the elderly people after 3 mo
of resistance exercise (37). A recent study by the same
group found a stimulation of myofibrillar protein synthesis on 3 days of exercise over a week, but this was
not associated with any changes in gene transcript
concentrations (35). Recently, another study (16) demonstrated that a 2-wk resistance training program increases MHC synthesis rate. The current study demonstrated that this increased MHC synthesis persists
even after 3 mo. In addition, the current study demonstrated that the observed changes are not simply timerelated changes, because there were no changes in
MHC synthesis rate in the placebo group after 3 mo of
nonintervention. As we previously noted (5), muscle
strength may be related to the ability to synthesize
MHC. The current study demonstrated that this increased MHC synthesis occurs by increasing transcript
levels of MHCI. It is beyond the scope of the current
paper to determine whether increased MHC synthesis
occurred exclusively for MHCI or other isoforms. It is,
however, likely that the observed increase in MHC
synthesis rate is due to increased transcription of
MHCI, so the decreased transcriptional levels of
MHCIIa and MHCIIx that occur with aging cannot be
reversed by resistance exercise alone. Two previous
reports represent average measures of synthesis rates
of several muscle proteins (35, 39). The present study
also demonstrated that resistance training-induced increase in MMP synthesis occurs primarily by increasing the synthesis rate of MHC. We originally hypothesized that the age-related changes in muscle protein
synthesis might be due to changes in lifestyle (5). A
resistance exercise program increased the synthesis
rate of MHC in the middle-aged and older people, but
this increase only made them equal to the sedentary
young subjects (5). The current study also demonstrated that an exercise program does not reverse all
the changes occurring at a transcriptional level with
aging. It remains to be determined whether resistance
training in the older people decreases synthesis rates
of the isoforms MHCIIa and MHCIIx.
E207
E208
AGE AND EXERCISE EFFECT ON MYOSIN ISOFORMS
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
DNA rearrangements in aging human skeletal muscle. Nucleic
Acids Res 23: 4122–4126, 1995.
Nair KS. Assessment of protein metabolism in diabetes. In:
Clinical Research in Diabetes and Obesity, Part I: Methods,
Assessment, and Metabolic Regulation, edited by B Draznin and
R Rizza. Totowa, NJ: Humana, 1997, p. 137–170.
Nair KS, Halliday D, and Griggs RC. Leucine incorporation
into mixed skeletal muscle protein in humans. Am J Physiol
Endocrinol Metab 254: E208–E213, 1988.
PE Biosystems. Relative Quantitation of Gene Expression. Foster City, CA: PE Biosystems, 1997, p. 1–3. (User Bull no. 2)
Rooyackers OE, Adey DB, Ades PA, and Nair KS. Effect of
age in vivo synthesis rates of mitochondrial protein in human
skeletal muscle. Proc Natl Acad Sci USA 93: 15364–15369, 1996.
Smerdu V, Karsch-Mizrachi I, Campione M, Leinwand L,
and Schiaffino S. Type IIx myosin heavy chain transcripts are
expressed in type IIb fibers of human skeletal muscle. Am J
Physiol Cell Physiol 267: C1723–C1728, 1994.
Sohal RS and Weindruch R. Oxidative stress, caloric restriction, and aging. Science 273: 59–63, 1996.
Wagner PD. Formation and characterization of myosin hybrids
containing essential light chains and heavy chains from different
muscle myosins. J Biol Chem 256: 2493–2498, 1981.
Welle S, Bhatt K, and Thornton C. Polyadenylated RNA,
actin mRNA, and myosin heavy chain mRNA in young and old
human skeletal muscle. Am J Physiol Endocrinol Metab 270:
E224–E229, 1996.
Welle S, Bhatt K, and Thornton CA. Stimulation of myofibrillar synthesis by exercise is mediated by more efficient translation of mRNA. J Appl Physiol 86: 1220–1225, 1999.
Welle S, Thornton C, Jozefowicz R, and Statt M. Myofibrillar protein synthesis in young and old men. Am J Physiol
Endocrinol Metab 264: E693–E698, 1993.
Welle S, Thornton C, and Statt M. Myofibrillar protein synthesis in young and old human subjects after three months of
resistance training. Am J Physiol Endocrinol Metab 268: E422–
E427, 1995.
Wickelgren I. New populations of old add to poor nations’
burdens. Science 273: 46–50, 1996.
Yarasheski KE, Zachwieja JJ, and Bier DM. Acute effects of
resistance exercise on muscle protein synthesis rate in young
and elderly men and women. Am J Physiol Endocrinol Metab
265: E210–E214, 1993.
Downloaded from http://ajpendo.physiology.org/ by 10.220.32.247 on July 31, 2017
13. Frontera WR, Meredith CN, O’Reilly KP, Knuttgen HG,
and Evans WJ. Strength conditioning in older men: skeletal
muscle hypertrophy and improved function. J Appl Physiol 64:
1038–1044, 1988.
14. Halliday D and McKeran RO. Measurement of muscle protein synthetic rate from serial muscle biopsies and total body
protein turnover in man by continuous intravenous infusion of
L-[1-N-15]lysine. Clin Sci Mol Med 49: 581–590, 1975.
15. Harman D. The aging process. Proc Natl Acad Sci USA 78:
7124–7128, 1981.
16. Hasten DL, Pak-Loduca J, Obert KA, and Yarasheski KE.
Resistance exercise acutely increases MHC and mixed muscle
protein synthesis rates in 78–84 and 23–32 yr olds. Am J Physiol
Endocrinol Metab 278: E620–E626, 2000.
17. Heid CA, Stevens J, Livak KJ, and Williams PM. Real time
quantitative PCR. Genome Res 6: 986–994, 1996.
18. Heymsfield SB, Arteaga C, McManus C, Smith J, and Moffitt S. Measurement of muscle mass in humans: validity of the
24-hour urinary creatinine. Am J Clin Nutr 37: 478–494, 1983.
19. Holloszy JO and Kohrt WM. Exercise. In: Handbook of Physiology. Aging. Bethesda, MD: Am. Physiol. Soc., 1995, sect. 11,
chapt. 24, p. 633–666.
20. Klitgaard H, Zhou M, Schiaffino S, Betto R, Salviati G, and
Saltin B. Ageing alters the myosin heavy chain composition of
single fibres from human skeletal muscle. Acta Physiologica
Scand 140: 55–62, 1990.
21. Kohrt WM, Kirwan JP, Staten MA, Bourey RE, King DS,
and Holloszy JO. Insulin resistance in aging is related to
abdominal obesity. Diabetes 42: 273–281, 1993.
22. Lexell J. Human aging, muscle mass, and fiber type composition. J Gerontol 50A: 11–16, 1995.
23. Lexell J, Taylor CC, and Sjostrom M. What is the cause of the
ageing atrophy? Total number, size and proportion of different
fiber types studied in whole vastus lateralis muscle from 15- to
83-year-old men. J Neurol Sci 84: 275–2954, 1988.
24. Livak KJ, Flood SJA, Marmaro J, Giusti W, and Deetz K.
Oligonucleotides with fluorescent dyes at opposite ends provide a
quenched probe system useful for detecting PCR product and
nucleic acid hybridization. PCR Methods Appl 4: 357–362, 1995.
25. Ljungqvist O, Persson M, Ford GC, and Nair KS. Functional
heterogeneity of leucine pools in human skeletal muscle. Am J
Physiol Endocrinol Metab 273: E564–E570, 1997.
26. Melov S, Shoffner JM, Kaufman A, and Wallace DC.
Marked increase in the number and variety of mitochondrial