Am J Physiol Renal Physiol 297: F639–F645, 2009.
First published July 8, 2009; doi:10.1152/ajprenal.00188.2009.
Alterations of growth plate and abnormal insulin-like growth factor I
metabolism in growth-retarded hypokalemic rats: effect of growth hormone
treatment
Helena Gil-Peña,1 Enrique Garcia-Lopez,2 Oscar Alvarez-Garcia,1 Vanessa Loredo,1
Eduardo Carbajo-Perez,3 Flor A. Ordoñez,1 Julian Rodriguez-Suarez,1 and Fernando Santos1,3
1
Hospital Universitario Central de Asturias, 2Hospital Álvarez Buylla, and 3Universidad de Oviedo, Asturias, Spain
Submitted 1 April 2009; accepted in final form 1 July 2009
tubulopathies; chondrocyte; cartilage
found in primary hypokalemic tubular disorders (32). Potential pathogenic factors of
growth impairment in these tubulopathies include maintained
metabolic acidosis, polyuria with decreased food intake and
repeated dehydration episodes, disturbed bone mineralization,
sodium deficit, and potassium depletion. In children with renal
tubular acidosis, growth retardation is common and is ameliorated or reversed after sustained correction of metabolic acidosis (29). Metabolic acidosis disturbs normal growth through
various mechanisms such as the stimulation of protein catabolism (18), interference with growth hormone (GH) action
(21), and the alteration of the structure and dynamics of growth
cartilage (5). In hypokalemic tubulopathies associated with
alkalosis, Bartter’s or Gitelman’s syndromes, the adverse effect
on growth is not well documented and the response of growth
to treatment is rather unpredictable. Growth impairment is
frequently described in Bartter’s syndrome (22). Gitelman’s
syndrome, traditionally considered as asymptomatic or responsible for mild clinical manifestations (9), has been reported to
be accompanied by short stature in over 30% of children (8).
Although clinical cases of isolated GH deficiency as well as
improvement of growth rate following administration of indomethacin have been reported in patients with Gitelman’s syndrome, the pathogenesis of stunted growth in these hypokalemic disorders is unclear (3, 17, 31). Few studies have used an
experimental rat model of chronic potassium depletion to know
the effect of potassium deficiency on the tubular sodium and
potassium transport, acid-base balance control, salt sensitivity,
and kidney growth (1, 10 –13, 15, 16, 20, 22–26, 33, 34,
36 –38). Some of these studies have found that potassium
deficiency leads to renal hypertrophy and inhibits body growth
markedly (36 –38).
As the growth plate of long bones is where longitudinal
growth takes place, the study presented here was carried out to
investigate the effect of chronic potassium depletion and subsequent GH treatment on growth cartilage metabolism. We
hypothesized that retarded growth caused by chronic potassium
deficiency should be accompanied by alterations in growth
plate morphology and in the processes of chondrocyte proliferation and maturation as well as by local and/or systemic
disturbances in the GH-insulin-like growth factor I (IGF-I)
axis. Treatment with GH might improve growth retardation
and correct the metabolic and growth plate alterations.
GROWTH RETARDATION IS FREQUENTLY
MATERIALS AND METHODS
Address for reprint requests and other correspondence: F. Santos, Pediatria,
Facultad de Medicina, C/Julian Claveria 6, 33006 Oviedo, Asturias, Spain
(e-mail: [email protected]).
Animals. Twenty-one day-old weaning female Sprague-Dawley
rats (Harlan Iberica, Barcelona, Spain) were lodged in the animal
facility building of our institution and kept under controlled conditions of light (12:12-h light-dark cycle) and temperature (21–23°C) in
individual cages. Rats received standard chow and water ad libitum
and, after 3 days of acclimation, were divided into four groups of
similar weight (n ⫽ 10): control, normal diet (17.7% protein, 3,700
kcal/kg) containing 0.36% of potassium (Harlan TD 88239) ad libitum
(initial body wt 53.29 ⫾ 5.36 g); potassium depletion (KD), potassiumdeficient diet (Harlan TD 88239) with 0.01% potassium content and
the same content of other nutrients as the normal diet ad libitum
(initial body wt 53.66 ⫾ 5.40 g); potassium depletion⫹GH treatment
(KDGH), potassium-deficient diet given ad libitum and treatment with
GH (initial body wt 53.67 ⫾ 5.51 g); and control pair-fed with the KD
group (CPF), normal diet but in the same amount as KD (initial body
wt 53.63 ⫾ 2.23 g). The study complied with current legislation on
http://www.ajprenal.org
0363-6127/09 $8.00 Copyright © 2009 the American Physiological Society
F639
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
Gil-Peña H, Garcia-Lopez E, Alvarez-Garcia O, Loredo V, CarbajoPerez E, Ordoñez FA, Rodriguez-Suarez J, Santos F. Alterations of
growth plate and abnormal insulin-like growth factor I metabolism in
growth-retarded hypokalemic rats: effect of growth hormone treatment. Am J
Physiol Renal Physiol 297: F639–F645, 2009. First published July 8, 2009;
doi:10.1152/ajprenal.00188.2009.—Hypokalemic tubular disorders may
lead to growth retardation which is resistant to growth hormone (GH)
treatment. The mechanism of these alterations is unknown. Weaning
female rats were grouped (n ⫽ 10) in control, potassium-depleted
(KD), KD treated with intraperitoneal GH at 3.3 mg 䡠 kg⫺1 䡠 day⫺1
during the last week (KDGH), and control pair-fed with KD (CPF).
After 2 wk, KD rats were growth retarded compared with CPF rats,
the osseous front advance (⫾SD) being 67.07 ⫾ 10.44 and 81.56 ⫾
12.70 ␮m/day, respectively. GH treatment did not accelerate growth
rate. The tibial growth plate of KD rats had marked morphological
alterations: lower heights of growth cartilage (228.26 ⫾ 23.58 ␮m),
hypertrophic zone (123.68 ⫾ 13.49 ␮m), and terminal chondrocytes
(20.8 ⫾ 2.39 ␮m) than normokalemic CPF (264.21 ⫾ 21.77,
153.18 ⫾ 15.80, and 24.21 ⫾ 5.86 ␮m). GH administration normalized these changes except for the distal chondrocyte height. Quantitative PCR of insulin-like growth factor I (IGF-I), IGF-I receptor, and
GH receptor genes in KD growth plates showed downregulation of
IGF-I and upregulation of IGF-I receptor mRNAs, without changes in
their distribution as analyzed by immunohistochemistry and in situ
hybridization. GH did not further modify IGF-I mRNA expression.
KD rats had normal hepatic IGF-I mRNA levels and low serum IGF-I
values. GH increased liver IGF-I mRNA, but circulating IGF-I levels
remained reduced. This study discloses the structural and molecular
alterations induced by potassium depletion on the growth plate and
shows that the lack of response to GH administration is associated
with persistence of the disturbed process of chondrocyte hypertrophy
and depressed mRNA expression of local IGF-I in the growth plate.
F640
POTASSIUM DEPLETION AND GROWTH
Table 1. Blood biochemistry, weight, and length in the 4
groups of animals
Control
KD
KDGH
CPF
pH
Bicarbonate, meq/l
Potassium, meq/l
IGF-I, ng/ml
7.41⫾0.03
7.43⫾0.04*
7.45⫾0.04*
7.40⫾0.04†‡
24.48⫾1.95
31.19⫾3.09*
35.08⫾4.13*
23.83⫾2.24†‡
3.81⫾0.41
1.78⫾0.18*
1.60⫾0.23*
3.73⫾0.33†‡
196.0⫾81.2
119.5⫾37.7*
112.3⫾34.8*
85.2⫾20.4*
Values are means ⫾ SD; n ⫽ 10 animals/group for blood analysis and 5
animals/group for serum analysis. KD, potassium depletion; KDGH,
KD⫹growth hormone treatment; CPF, control pair-fed with KD; IGF-I, insulin
like growth factor I. *Statistically different from control group. †Statistically
different from KD group. ‡Statistically different from KDGH group. All P ⱕ
0.05.
Table 2. Growth and nutrition in the 4 groups of rats
Control
KD
KDGH
CPF
Body Weight Gain, g
Cumulative Food Intake, g
Food Efficiency, g
Body Length, cm
Osseous Front Advance, ␮m/day
13.95⫾4.47
5.78⫾2.02*
10.56⫾1.78†
6.23⫾3.12*‡
60.63⫾5.21
47.90⫾4.22*
48.24⫾4.23*
47.78⫾4.23*
0.22⫾0.07
0.12⫾0.03*
0.22⫾0.04†
0.14⫾0.06*‡
26.57⫾1.15
23.64⫾1.14*
23.41⫾0.67*
24.76⫾0.66*
146.29⫾19.69*
67.07⫾10.44*
77.72⫾9.80*
81.56⫾12.70*†
Values are means ⫾ SD; n ⫽ 10 animals/group. Weight gain, cumulative food intake, and food efficiency are given for the growth hormone (GH) treatment
period (days 7–13). Body length and longitudinal growth rate, assessed by the osseous front advance over the last 3 days of the protocol, were measured at death.
*Statistically different from control group. †Statistically different from KD group. ‡Statistically different from KDGH group. All P ⱕ 0.05.
AJP-Renal Physiol • VOL
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
animal experiments by the European Union and was approved by the
Ethical Committee on Animal Research of our institution.
Experimental protocol. The experimental protocol lasted 14 days.
The study was approved by the Animal Investigation Committee of
our institution and complied with the current Spanish legislation on
animal protection for scientific purposes. The KDGH group received
recombinant human GH (provided by NovoNordisk Pharma, Madrid,
Spain) at a daily dose of 3.3 mg/kg given in two intraperitoneal
injections (9 a.m. and 5 p.m.) for 1 wk (days 7–13). Untreated groups
received solvent injections. Animals were killed under anesthesia on
day 14 of the protocol. Three days before, the rats received 30 mg/kg
of calcein (Sigma, St. Louis, MO) by an intraperitoneal route. Bromodeoxiuridine (BrdU; 100 mg/kg; Sigma-Aldrich. Madrid, Spain)
was injected intraperitoneally 1, 9, and 17 h before death. At death,
blood, liver samples, and both tibias were obtained. Liver samples and
the proximal end of right tibias were immediately frozen in liquid
nitrogen for mRNA expression studies. Left tibial proximal ends were
embedded in methyl-metacrilate as previously described (2, 19).
Samples from one-half the animals were fixed in 40% ethanol and
used for analysis of calcein and BrdU labeling. The remaining
samples were fixed in 4% paraformaldehyde (PFA; Sigma-Aldrich)
and used for histomorphometry, immunohistochemistry, and in situ
hybridization. Frontal sections of 5 ␮m were used except for calcein
labeling, which was performed on 10-␮m-thick sections.
Blood biochemistry. Potassium and acid-base balance were measured with an IRMA TRUpoint blood-analysis system from ITC
(Biomed, Madrid, Spain) in 1 ml of blood obtained under anaerobic
conditions. The remaining blood was centrifuged immediately, and
the resulting serum was stored in aliquots of 500 ␮l at ⫺20°C. IGF-I
serum concentrations were measured by ELISA with a commercial kit
(Immunodiagnostic Systems, Boldon, UK). Each sample was measured twice. Inter- and intra-assay variation coefficients were ⬍7%.
Growth and nutrition. Body weight and food intake were daily
measured with a balance Ohaus GT 2001 (Ohaus, Pine Brook, NJ).
Food efficiency was calculated as the ratio of weight gained to food
consumed (g/g) during the week of GH treatment. Snout-to-tail-tip
length of rats was measured at death. The longitudinal bone growth
rate (␮m/day) during the 3 days before death was calculated by means
of calcein labeling as previously described (2, 19).
Growth cartilage analysis. The heights of the growth plate, the
hypertrophic zone, and the three most distal chondrocytes were
measured in tibial sections stained by alcian-blue safranin (Merck,
Madrid, Spain). Osteoclasts were identified by tartrate-resistant acid
phosphatase (TRAP) reaction and quantified, as TRAP⫹positive
cells/100 terminal chondrocytes, in an area of the primary spongiosa
extending 50 ␮m beyond the distal end of the growth cartilage (2).
BrdU-labeled chondrocytes were identified by immunocytochemical
procedures as described elsewhere (2) using a monoclonal antibody to
BrdU (1:20, Dako Diagnosticos, Barcelona, Spain). Proliferative activity was expressed as the number of BrdU-positive cells/100 cells in
the proliferative zone. mRNA was extracted from the growth cartilage
of frozen right tibial samples using the Chomczynski method (6).
Samples were diluted to a 1 ␮g/␮l concentration before retrotranscription was performed with a commercial kit (Qiagen Iberia, Madrid,
Spain). IGF-I as well as GH and IGF-I receptor mRNA expression
was quantified by PCR (qPCR), using GAPDH as a housekeeping
gene for normalization, on a Sequence Detection System Step One
(Applied Biosystems. Foster City, CA) with SYBR Green (ABgene
Products, Thermo Fisher Scientific, Rockford, IL) as a fluorophore.
Primer sequences for qPCR were designed with Prime Express software (PerkinElmer Applied Biosystems) and synthesized by Invitrogen (Fisher-Invitrogen. Barcelona, Spain). The primer sequences were
as follows: IGF-I: forward TACCAGCTCGGCCACAGC, reverse
GTGGGCTTGTTGAAGTAAAAGC; IGF-IR: forward GCTGCTGGACCACAAATCG, reverse TCGCTTCCCACACACACTTG;
and GHR: forward AATTAATCCAAGCCTGAGGGAAA, reverse
GGAACGACACTTGGTGAATCG. The primers were designed to
amplify the common part of the various transcripts. The primer for the
housekeeping gene, GAPDH, was synthesized and supplied by
Qiagen (Qiagen Iberia). Results were normalized to the control group
by the Ct values method. In situ hybridization was used to define the
mRNA distribution pattern of IGF-I and receptors of IGF-I and GH in
the growth cartilage. RNA probes (IGF-I : ATCCACAATGCCCGTGTGGTGCCCTCCGAATGCTGGAGCCATAGCC; IGF-IR:
GTAGCTTCGGTAGTCCTCGGCTTGGAGAT; GHR: TCCTTTGCGGT CACAGTTGGGCAGGTACACGGCACGGGGCACCATGCG) were supplied by GeneDetect (Auckland, New Zealand).
The procedure was as already described (19) but with adjustments of
prehybridization and hybridization temperatures for each probe to that
of annealing temperature. Two parallel sections served as negative
controls. One section was hybridized with a labeled sense riboprobe,
and a second section was incubated adding a negative control probe to
the hybridization mixture. For immunohistochemical staining of IGF-I
and the IGF-I receptor, rabbit polyclonal anti-rat-specific antibodies
(Santa Cruz Biotechnology, Heidelberg, Germany) were used. The
immunohistochemical staining followed the procedure is already
described in other studies (2, 19) with minor modifications. Incubation
(30 min at 45°C) in a pepsin solution (5 mg/ml for IGF-I and 10
mg/ml for IGF-I receptor) was used for antigen retrieval. Nonspecific
binding was avoided by incubation with 20% normal goat serum in
phosphate-buffered saline for 75 min at room temperature. Primary
antibodies were used at a 1:10 dilution and incubated for 48 h at 4°C.
The anti-rabbit secondary conjugated antibody (EnVision⫹, Dako
POTASSIUM DEPLETION AND GROWTH
Diagnostics, Barcelona, Spain) was incubated for 30 min at room
temperature. The final reaction product was revealed with 3–3⬘diaminobenzidine in 50 ml of 0.05 M Tris-hydrochloric buffer plus 50
␮l of 30% hydrogen peroxide. Sections were counterstained with
methyl green.
Liver mRNA. Liver mRNA was extracted as previously described
(6), and the hepatic mRNA expression of IGF-I, GH, and IGF-I
receptor genes was measured by qPCR as described above.
Statistical analysis. The results of each group are given as means ⫾
SD. Differences between groups were assessed by ANOVA followed
by the Student-Newman-Keuls method. For two-group comparisons,
Student’s t-test was used. Statistical analysis of real-time PCR results
F641
was performed by ANOVA followed by the Student-Newman-Keuls
test for comparison of each group with the control group and with DK
group. A P value ⱕ0.05 was considered indicative of statistical
significance.
RESULTS
Blood biochemistry. As shown in Table 1, the groups receiving a low-potassium diet (KD) and low-potassium diet
with GH treatment (KDGH) were markedly hypokalemic and
had metabolic alkalosis. No differences in the degree of hypokalemia or in the severity of alkalosis were found between KD
AJP-Renal Physiol • VOL
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
Fig. 1. A: osseous front advance in the proximal tibias of the 4 groups of animals. The
distance between white lines (arrows), which
indicate the metaphiseal end of growth cartilage and the proximal end of calcein label,
represent the osseous front advance over a
3-day interval. B: heights of growth cartilage
and its hypertrophic stratum in the proximal
tibias of the 4 groups of animals. White lines
delineate both the proximal and distal ends
of growth cartilage, as well as the transition
between proliferative and hypertrophic zones
(middle line). C: proliferative activity in the
growth cartilage of the proximal tibias of the
4 groups of animals, as assessed by bromodeoxyuridine labeling (arrow). D: osteoclastic activity in the primary spongiosa of
the proximal tibiae of the 4 groups of animals, as assessed by the tartrate-resistant
acid phosphatase technique (arrow). Images
in the same column belong to the same
experimental group. KD, potassium depletion; KDGH, KD⫹growth hormone (GH)
treatment; CPF, control pair-fed with KD.
F642
POTASSIUM DEPLETION AND GROWTH
Table 4. mRNA expression of IGF-I and receptors of GH
and IGF-I, assessed by quantitative PCR, in the growth
plate of the 4 groups of animals
Control
KD
KDGH
CPF
IGF-I
IGF-I Receptor
GH Receptor
1⫾0.02
0.59⫾0.09*
0.59⫾0.07*
1.94⫾0.07*†
1⫾0.03
2.18⫾0.07*
3.15⫾0.13*†
1.00⫾0.33†
1⫾0.20
1.53⫾0.14
1.79⫾0.15*
2.75⫾0.08*†
Values are means ⫾ SD of gene fold-change in 3 groups relative to the
control animals normalized by the GAPDH housekeeping gene expression
levels; n ⫽ 5 animals/group. *Statistically different from control group.
†Statistically different from KD group. All P ⱕ 0.05.
looked more intense in the KD and KDGH groups than in
samples from normokalemic animals. The signal for GH receptor mRNA, in samples from the control, KD, and KDGH
groups, was rather uniform in the hypertrophic area with
isolated positive cells in the proliferative zone, whereas in CPF
rats the signal spread throughout the whole cartilage.
Immunohistochemistry of IGF-I and the IGF-I receptor in
growth cartilage. Immunohistochemistry for IGF-I and the
IGF-I receptor in the growth plate revealed a similar distribution pattern for both proteins. Both of them were found mostly
confined to the hypertrophic zone in the four groups of rats.
(Fig. 2, D and E).
mRNA expression of IGF-I, the IGF-I receptor, and GH
receptor in the liver as analyzed by qPCR. As shown in Table 5,
in the KD group the levels of GH receptor and IGF-I mRNA
expression did not change with respect to control, whereas the
IGF-I receptor was upregulated. In CPF rats, GH receptor and
IGF-I receptor mRNA levels were increased but the mRNA
expression of IGF-I was not modified. Treatment with GH
increased the mRNA expression of IGF-I in KDGH rats, but it
did not further stimulate the IGF-I receptor and did not change
GH receptor mRNA levels.
DISCUSSION
This study discloses the alterations in the structure and
dynamics of the long-bone growth plate in an experimental model
of potassium depletion and provides novel information on the
mRNA expression of genes of the GH-IGF-I axis in the growth
cartilage of hypokalemic animals. Furthermore, the study offers
some insight into the molecular mechanism of the resistance to
GH treatment in hypokalemia.
As shown in former experimental studies, sustained reduction in potassium intake causes hypokalemia and metabolic
alkalosis and leads to growth retardation, as confirmed in our
study by the low weight gain, length, and osseous front
advance of KD animals compared with control rats (27, 30, 37,
Table 3. Histological analysis of growth plate in the 4 groups of rats
Control
KD
KDGH
CPF
Cartilage Height, ␮m
Hypertrophic Zone Height, ␮m
Chondrocyte Height ␮m
BrdU Labeling, %
TRAP⫹Cells/100 Terminal Chondrocytes
291.83⫾28.65
228.26⫾23.58*
264.91⫾17.33†
264.21⫾21.77†
157.22⫾22.97
123.68⫾13.49*
154.61⫾12.53†
153.18⫾15.80†
23.49⫾4.85
20.80⫾2.39*
21.56⫾2.62*
24.21⫾5.86†‡
31.94⫾4.24
26.47⫾4.82*
33.15⫾3.21†
22.19⫾9.42*‡
33.40⫾2.54
24.04⫾3.86*
33.43⫾4.49†
30.80⫾2.93†
Values are means ⫾ SD; n ⫽ 10 animals/group: histomorphometry, chondrocyte proliferation, and osteoclastic activity. BrdU, bromodeoxiuridine; TRAP,
tartrate-resistant acid phosphatase. *Statistically different from control group. †Statistically different from KD group. ‡Statistically different from KDGH group.
All P ⱕ 0.05.
AJP-Renal Physiol • VOL
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
and KDGH rats. Decreased concentrations of IGF-I were found
in KD and KDGH rats and in normokalemic animals pair-fed
with the KD group (CPF).
Growth and nutrition. Data on growth and nutrition of the
four groups of animals are shown in Table 2. The KD animals
were growth retarded as demonstrated by lower weight gain,
body length, and longitudinal growth rate than those of the
control group. KD animals ate less than controls fed ad libitum,
and the anabolic use of consumed food was also lower. With
respect to the CPF group, weight gain, food efficiency, and
body length of the KD group tended to be lower, but the
differences did not reach statistical significance. The osseous
front advance of KD animals was lower than that of CPF rats
(Fig. 1A). GH treatment exerted a beneficial effect on the
nutrition of KDGH animals, as shown by greater weight gain
and food efficiency than those of KD group, but did not
improve longitudinal growth (Fig. 1A).
Growth plate cell proliferation and histomorphometry.
Growth retardation of KD rats was associated with reduced
heights of growth cartilage, hypertrophic stratum, and terminal
chondrocytes in the proximal tibia growth plate compared with
control and CPF normokalemic groups (Table 3). The percentage of proliferating chondrocytes and relative number of osteoclasts in the primary spongiosa were also depressed in KD rats.
GH treatment normalized the height of growth cartilage, the
height of the hypertrophic zones, the chondrocyte proliferation
rate, and the relative number of osteoclasts but not the height
of terminal chondrocytes (Fig. 1, B–D).
mRNA expression of IGF-I, the IGF-I receptor, and GH
receptor in growth cartilage as analyzed by qPCR. As shown
in Table 4, potassium depletion downregulated IGF-I mRNA
expression, while resulted in upregulation, over the control, of
mRNA levels of the IGF-I receptor. Upregulation of GH
receptor and IGF-I mRNAs was found in food-restricted normokalemic rats (CPF group). Modifications in the mRNA
expression of IGF-I induced by potassium depletion was not
further changed by GH treatment, but GH therapy induced
greater upregulation of the IGF-I receptor.
In situ hybridization of IGF-I, IGF-I receptor and GH
receptor in growth cartilage. In situ hybridization studies
disclosed the patterns of mRNA distribution for the three
analyzed genes in the four groups of animals (Fig. 2, A–C).
IGF-I mRNA was located all over the growth cartilage, with a
particularly intense signal in the proliferative and adjacent
hypertrophic stratum. This pattern of distribution remained
essentially unchanged in the four groups of rats. However, the
proportion of labeled cells was apparently lower in the potassium-depleted groups (KD and KDGH). IGF-I receptor mRNA
was mostly confined to the hypertrophic stratum in the four
groups of rats. In agreement with the PCR results, the signal
POTASSIUM DEPLETION AND GROWTH
F643
38). The KD rats ate less food than controls fed ad libitum.
Comparison of KD rats with the normokalemic CPF group
showed that the reduction in weight was mostly due to the low
food consumption because weight gain and food efficiency
were not significantly different between both groups. By contrast, potassium depletion decreased the osseous front advance
more in KD than in CPF rats, showing that potassium depletion
adversely impairs longitudinal growth by mechanisms not
entirely dependent on food intake reduction. The finding that
the body length of hypokalemic animals at the time of death
was not significantly lower than that of CPF animals does not
contradict the previous statement since a longer period of
potassium depletion had likely led to significant differences.
AJP-Renal Physiol • VOL
In agreement with the specific effect of potassium depletion
on longitudinal growth, the growth plate of KD animals had
structural abnormalities not found in the CPF group. Thus
potassium deficiency reduced growth cartilage height as a
result of a shorter hypertrophic stratum, but not of a decreased
chondrocyte proliferation. However, modifications in the size
of growth cartilage have a limited pathophysiological value
because variable chondrocyte column heights can be found
with different longitudinal growth velocities (7). The growth
cartilage size depends on the balance between two virtual
vectors with antagonistic sense: one that goes from epiphysis to
metaphysis and represents the production, proliferation, and
hypertrophy of chondrocytes, and another one that goes from
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
Fig. 2. A–C: representative images obtained
after in situ hybridization in the growth cartilage of the proximal tibiae of the 4 groups
of animals. Images in the same row correspond to hybridizations with the same RNA
probe (label on the right). Insulin-like
growth factor I (IGF-I) mRNA was located
all over the growth cartilage, with a particularly intense signal in the proliferative and
adjacent hypertrophic stratum. IGF-I receptor mRNA was mostly confined to the hypertrophic stratum in the 4 groups of rats.
The signal for GH receptor mRNA, in samples from control, KD, and KDGH groups,
was rather uniform in the hypertrophic area
with isolated positive cells in the proliferative zone, whereas in CPF rats the signal
spread throughout the whole cartilage. D and
E. representative images of the growth cartilage of the proximal tibiae of the 4 groups
of animals after immunohistochemical procedure to demonstrate IGF-I or IGFI-R protein pattern distribution which was mostly
confined to the hypertrophic zone in the 4
groups of rats.
F644
POTASSIUM DEPLETION AND GROWTH
Table 5. mRNA expression of IGF-I and receptors of GH
and IGF-I, assessed by quantitative PCR, in the liver of the
4 groups of animals
Control
KD
KDGH
CPF
IGF-I
IGF-I Receptor
GH Receptor
1⫾0.08
0.78⫾0.07
2.1⫾0.03*†
1.1⫾0.21
1⫾0.04
2.59⫾0.48*
2.13⫾0.33*
5.08⫾0.51*†
1⫾0.06
0.73⫾0.2
0.92⫾0.23
2.06⫾0.57*†
Values are means ⫾ SD of gene fold-change in 3 groups relative to the
control animals normalized by the GAPDH housekeeping gene expression
levels; n ⫽ 5 animals/group. *Statistically different from control group.
†Statistically different from KD group. All P ⱕ 0.05.
AJP-Renal Physiol • VOL
ACKNOWLEDGMENTS
The authors gratefully thank Lucı́a Mallada and Teresa Usı́n for expert
technical assistance. Results of this study were partially presented at the 42nd
Annual Meeting of the European Society for Paediatric Nephrology, Lyon,
France, 2008, and at the 8th Symposium of the International Pediatric Ne-
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
metaphysis to epiphysis and represents the vascular invasion
phenomenon and cartilage replacement by new bone (28). This
apposition bone vector reflects the longitudinal growth rate,
and the association of reduced growth velocity and diminished
cartilage height, as happened in the KD group, suggests that the
process of progression and hypertrophy of chondrocytes became more damaged than the rate of new bone formation. It is
also of note that the height of chondrocytes adjacent to the
metaphyseal bone was markedly decreased in the KD rats,
confirming the profound interference of potassium depletion
with the normal process of chondrocyte maturation and hypertrophy. A positive correlation between longitudinal growth
velocity and terminal chondrocyte height has formerly been
shown (4). In agreement with the reduction of growth rate, the
osteoclastic activity, as assessed by the number of TRAPpositive cells in the primary spongiosa, was markedly diminished in the KD animals. By contrast, the proliferative activity
of chondrocytes was similarly decreased in KD and CPF
animals, indicating that it was not specifically affected by the
potassium deficiency.
Our study confirms previous findings of Schaefer et al. (30)
on the dissociation of the effect of GH treatment on weight and
length in potassium-depleted rats. GH treatment resulted in a
significant anabolic effect demonstrated by increased weight
and food efficiency, but did not accelerate longitudinal growth
rate of KDGH rats compared with the KD group. It is interesting to note that, to a large extent, GH restored the morphological aspect of the growth plate because the height of the
growth cartilage and that of the hypertrophic zone, as well as
the osteoclastic and proliferative activities, were not different
from controls in the GH-treated, potassium-depleted rats. However, GH did not modify the size of the most distal chondrocytes, emphasizing the relationship of this parameter with the
growth velocity and the failure of GH to correct the hypokalemia-induced defect in the process of chondrocyte hypertrophy. This differs from the effect of GH therapy on uremic rats,
in which GH treatment has been shown to increase both
longitudinal growth rate and terminal chondrocyte height (19).
The findings of the study presented here on the mRNA
expression of the GH receptor, IGF-I receptor, and IGF-I in the
growth plate shed some light on the mechanism of growth
retardation in potassium depletion and the lack of GH effect in
this setting. As shown by qPCR, potassium depletion downregulated IGF-I mRNA expression despite simultaneous upregulation of the IGF-I receptor, likely due to a compensatory
mechanism. In situ hybridization and immunohistochemistry
provide valid information on the spatial distribution of a gene
but are not sensitive techniques for assessing quantitative
changes in tissue gene mRNA expression. Our results indicate
that IGF-I was mainly expressed in the early hypertrophic zone
in the four groups of rats, although the signal and the proportion of positive cells were visually lower in the potassiumdepleted animals. The histomorphometric and gene expression
studies suggest that potassium depletion leads to profound
disturbances in the process of growth plate chondrocyte maturation and reduced production of IGF-I by hypertrophic chondrocytes. These alterations likely play a key role in the growth
retardation of hypokalemic disorders. The administration of
GH normalized the height of the growth plate and the proliferative activity of chondrocytes but did not accelerate the
longitudinal growth rate, did not restore to normal the size of
the terminal chondrocytes, and did not increase the local
expression of IGF-I mRNA. We did not investigate whether
this resistance to GH treatment was mediated by alterations in
the GH-activated signaling pathway as it has been found in the
liver of potassium-depleted rats (30). According to Schaefer et
al. (30), the resistance to GH in potassium depletion cannot be
accounted for by alterations in the Janus-associated kinase
(JAK), signal transducers and activators of transcription
(STAT) transduction pathway and presumably arises either
because of a distal defect to the binding of STAT to DNA or,
alternatively, because of a defect in a STAT-independent
GH-activated signaling pathway.
The findings of our study on serum IGF-I and the hepatic
expression of IGF-I mRNA and its receptor allow hypothesizing on the alterations of systemic IGF-I metabolism in potassium depletion. The coexistence of normal IGF-I mRNA and
low serum IGF-I concentrations points to either a posttranscriptional defect in the synthesis of IGF-I or an accelerated
catabolism of circulating IGF-I, although a transient increase in
serum IGF-I not detected in our experiment, in which serum
for IGF-I measurement was drawn 15 h after the last GH dose,
cannot be ruled out. In addition, an increase in the lowmolecular fractions of IGF binding proteins, such as described
in potassium-depleted rats (14), might accelerate the transport
of IGF-I out of the vascular bed. However, the upregulation of
the IGF-I receptor is consistent with the already described
stimulatory action of malnutrition and low circulating IGF-I on
the mRNA expression of this receptor (39). Moreover, our
results also show that GH treatment stimulated the expression
of liver IGF-I mRNA but did not subsequently modify serum
IGF-I levels, suggesting a mechanism for GH resistance distal
to the activation of the IGF-I gene.
In summary, in an experimental model of growth retardation
secondary to potassium depletion, our study demonstrates
alterations in the structure and dynamics of the growth plate
and marked changes in systemic and growth cartilage GH and
IGF-I metabolism. It also shows that GH treatment does not
increase longitudinal growth rate or serum IGF-I. In the growth
plate, this lack of response to GH administration is associated
with the persistence of the disturbed process of chondrocyte
hypertrophy and depressed mRNA expression of local IGF-I.
POTASSIUM DEPLETION AND GROWTH
phrology Association on Growth and Nutrition in Children with Chronic Renal
Disease, Oviedo, Spain, 2009.
GRANTS
This study has been supported by grants FIS PI061730 and FICYT BP06115 and by the Fundación Nutrición y Crecimiento.
REFERENCES
AJP-Renal Physiol • VOL
19. Molinos I, Santos F, Carbajo-Perez E, Garcia E, Rodriguez J, GarciaAlvarez O, Gil H, Ordoñez FA, Loredo V, Mallada L. Catch-up growth
follows an abnormal pattern in experimental renal insufficiency and
growth hormone treatment normalizes it. Kidney Int 70: 1955–1961, 2006.
20. Muehrcke RC, Rosen S. Hypokalemic nephropathy in rat and man: a
light and electron microscopic study. Lab Invest 13: 1359 –1373, 1964.
21. Ordóñez FA, Santos F, Martı́nez V, Garcı́a E, Fernández P, Rodrı́guez J, Fernández M, Alvarez J, Ferrando S. Resistance to growth
hormone and insulin-like growth factor-I in acidotic rats. Pediatr Nephrol
14: 720 –725, 2000.
22. Peters M, Jeck N, Reinalter S, Leonhardt A, Tönshoff B, Klaus GG,
Konrad M, Seyberth HW. Clinical presentation of genetically defined
patients with hypokalemic salt-losing tubulopathies. Am J Med 112:
183–190, 2002.
23. Ray PE, Suga S, Liu XH, Huang X, Johnson RJ. Chronic potassium
depletion induces renal injury, salt sensitivity, and hypertension in young
rats. Kidney Int 59: 1850 –1858, 2001.
24. Reungjui S, Hu H, Mu W, Roncal CA, Croker BP, Patel JM, Nakagawa T, Srinivas T, Byer K, Simoni J, Wesson D, Sitprija V, Johnson
RJ. Thiazide-induced subtle renal injury not observed in states of equivalent hypokalemia. Kidney Int 72: 1483–1492, 2007.
25. Reungjui S, Roncal CA, Sato W, Glushakova OY, Croker BP, Suga S,
Ouyang X, Tungsanga K, Nakagawa T, Johnson RJ, Mu W. Hypokalemic nephropathy is associated with impaired angiogenesis. J Am Soc
Nephrol 19: 125–134, 2008.
26. Rohan RM, Unterman TG, Liu L, Hise MK. Expression of the insulinlike growth factor system in the hypokalemic rat kidney. Am J Physiol
Renal Physiol 272: F661–F667, 1997.
27. Romanelli RJ, LeBeau AP, Fulmer CG, Lazzarino DA, Hochberg A,
Wood TL. Insulin-like growth factor type-I receptor internalization and
recycling mediate the sustained phosphorylation of Akt. J Biol Chem 282:
22513–22524, 2007.
28. Santos F, Carbajo-Pérez E, Rodrı́guez J, Fernández-Fuente M, Molinos I, Amil B, Garcı́a E. Alterations of the growth plate in chronic renal
failure. Pediatr Nephrol 20: 330 –334, 2005.
29. Santos F, Chan JC. Renal tubular acidosis in children. Diagnosis,
treatment and prognosis. Am J Nephrol 6: 289 –295, 1986.
30. Schaefer F, Yoon SA, Nouri P, Tsao T, Tummala P, Deng E, Rabkin
R. Growth hormone-mediated janus associated kinase-signal transducers
and activators of transcription signaling in the growth hormone-resistant
potassium-deficient rat. J Am Soc Nephrol 15: 2299 –2306, 2004.
31. Schoof E, Marx M, Doerr HG. A boy presenting with familial short
stature-diagnosis Gitelman syndrome. J Pediatr Endocrinol Metab 12:
891– 894, 1999.
32. Shaer AJ. Inherited primary renal tubular hypokalemic alkalosis: a review
of Gitelman and Bartter syndromes. Am J Med Sci 322: 316 –332, 2001.
33. Suga SI, Phillips MI, Ray PE, Raleigh JA, Vio CP, Kim YG, Mazzali
M, Gordon KL, Hughes J, Johnson RJ. Hypokalemia induces renal
injury and alterations in vasoactive mediators that favor salt sensitivity.
Am J Physiol Renal Physiol 281: F620 –F629, 2001.
34. Suga S, Yasui N, Yoshihara F, Horio T, Kawano Y, Kangawa K,
Johnson RJ. Endothelin a receptor blockade and endothelin B receptor
blockade improve hypokalemic nephropathy by different mechanisms.
J Am Soc Nephrol 14: 397– 406, 2003.
35. Thissen JP, Ketelslegers JM, Underwood LE. Nutritional regulation
of the insulin-like growth factors. Endocr Rev 15: 80 –101, 1994.
36. Tolins JP, Hostetter MK, Hostetter TH. Hypokalemic nephropathy in
the rat. Role of ammonia in chronic tubular injury. J Clin Invest 79:
1447–1458, 1987.
37. Tsao T, Fawcett J, Fervenza FC, Hsu FW, Huie P, Sibley RK, Rabkin
R. Expression of insulin-like growth factor-I and transforming growth
factor-beta in hypokalemic nephropathy in the rat. Kidney Int 59: 96 –105,
2001.
38. Unwin R, Capasso G, Giebisch G. Potassium and sodium transport along
the loop of Henle: effects of altered dietary potassium intake. Kidney Int
46: 1092–1099, 1994.
39. Werner H, Hernández-Sánchez C, Karnieli E, Leroith D. The regulation of IGF-I receptor gene expression. Int J Biochem Cell Biol 27:
987–994, 1995.
297 • SEPTEMBER 2009 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.2 on July 31, 2017
1. Ahn KY, Park KY, Kim KK, Kone BC. Chronic hypokalemia enhances
expression of the H⫹-K⫹-ATPase alpha 2-subunit gene in renal medulla.
Am J Physiol Renal Fluid Electrolyte Physiol 271: F314 –F321, 1996.
2. Alvarez-Garcia O, Carbajo-Pérez E, Garcia E, Gil H, Molinos I,
Rodriguez J, Ordoñez FA, Santos F. Rapamycin retards growth and
causes marked alterations in the growth plate of young rats. Pediatr
Nephrol 22: 954 –961, 2007.
3. Bettinelli A, Rusconi R, Ciarmatori S, Righini V, Zammarchi E,
Donati MA, Isimbaldi C, Bevilacqua M, Cesareo L, Tedeschi S,
Garavaglia R, Casari G. Gitelman disease associated with growth hormone deficiency, disturbances in vasopressin secretion and empty sella: a
new hereditary renal tubular-pituitary syndrome? Pediatr Res 46: 232–
238, 1999.
4. Breur GJ, VanEnkevort BA, Farnum CE, Wilsman NJ. Linear relationship between the volume of hypertrophic chondrocytes and the rate of
longitudinal bone growth in growth plates. J Orthop Res 9: 348 –359,
1991.
5. Carbajo E, López JM, Santos F, Ordóñez FA, Niño P, Rodrı́guez J.
Histologic and dynamic changes induced by chronic metabolic acidosis in
the rat growth plate. J Am Soc Nephrol 12: 1228 –1234, 2001.
6. Chomczynski P, Sacchi N. The single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction: twentysomething years on. Nat Protoc 1: 581–585, 2006.
7. Cobo A, López JM, Carbajo E, Santos F, Alvarez J, Fernández M,
Weruaga A. Growth plate cartilage formation and resorption are differentially depressed in growth retarded uremic rats. J Am Soc Nephrol 10:
971–979, 1999.
8. Coto E, Rodriguez J, Jeck N, Alvarez V, Stone R, Loris C, Rodriguez
LM, Fischbach M, Seyberth HW, Santos F. A new mutation (intron
9 ⫹1 G⬎T) in the SLC12A3 gene is linked to Gitelman syndrome in
Gypsies. Kidney Int 65: 25–29, 2004.
9. Cruz DN, Shaer AJ, Bia MJ, Lifton RP, Simon DB, Yale Gitelman’s
and Bartter’s Syndrome Collaborative Study Group. Gitelman’s syndrome revisited: an evaluation of symptoms and health-related quality of
life. Kidney Int 59: 710 –717, 2001.
10. Elger M, Bankir L, Kriz W. Morphometric analysis of kidney hypertrophy in rats after chronic potassium depletion. Am J Physiol Renal Fluid
Electrolyte Physiol 262: F656 –F667, 1992.
11. Flyvbjerg A, Dørup I, Everts ME, Orskov H. Evidence that potassium
deficiency induces growth retardation through reduced circulating levels
of growth hormone and insulin-like growth factor I. Metabolism 40:
769 –765, 1991.
12. Flyvbjerg A, Marshall SM, Frystyk J, Rasch R, Bornfeldt KE, Arnqvist H, Jensen PK, Pallesen G, Orskov H. Insulin-like growth factor I
in initial renal hypertrophy in potassium-depleted rats. Am J Physiol Renal
Fluid Electrolyte Physiol 262: F1023–F1031, 1992.
13. Hochberg Z, Amit T, Flyvbjerg A, Dørup I. Growth hormone (GH)
receptor and GH-binding protein deficiency in the growth failure of
potassium-depleted rats. J Endocrinol 147: 253–258, 1995.
14. Hsu FW, Tsao T, Rabkin R. The IGF-I axis in kidney and skeletal
muscle of potassium deficient rats. Kidney Int 52: 363–370, 1997.
15. Kaufman AM, Kahn T. Potassium-depletion alkalosis in the rat. Am J
Physiol Renal Fluid Electrolyte Physiol 255: F763–F770, 1988.
16. Kimura T, Nishino T, Maruyama N, Hamano K, Kubo A, Iwano M,
Shiiki H. Expression of Bcl-2 and Bax in hypokalemic nephropathy in
rats. Pathobiology 69: 237–248, 2001.
17. Liaw LC, Banerjee K, Coulthard MG. Dose related growth response to
indomethacin in Gitelman syndrome. Arch Dis Child 81: 508 –510, 1999.
18. Mitch WE. Metabolic and clinical consequences of metabolic acidosis. J
Nephrol 19: 70 –75, 2006.
F645