Plant Mol Biol (2007) 64:575–587
DOI 10.1007/s11103-007-9177-4
AtCYT-INV1, a neutral invertase, is involved in osmotic
stress-induced inhibition on lateral root growth in Arabidopsis
Xiaopeng Qi Æ Zhongchang Wu Æ Jinhui Li Æ
Xiaorong Mo Æ Shihua Wu Æ Jun Chu Æ Ping Wu
Received: 23 November 2006 / Accepted: 24 April 2007 / Published online: 17 May 2007
Springer Science+Business Media B.V. 2007
Abstract Neutral/Alkaline invertases are unique to plant
and photosynthetic bacteria. The function of Neutral/
Alkaline invertases in plant development is not clear so far.
In this study, we isolated an Arabidopsis (Col-0) mutant
insensitive to osmotic stress-induced inhibition on lateral
root growth. Map-based cloning reveals that a neutral
invertase gene (AtCYT-INV1) was point-mutated. The
mutant Atcyt-inv1 showed short primary root, smaller size
of leaves and siliques, and promotion of the reproductive
compared to the wild type (WT). Carbohydrate measurement showed that sucrose is accumulated and glucose is
reduced in the mutant Atcyt-inv1 under normal and 3%
mannitol treatments. Taken together, AtCYT-INV1 plays
multiple roles in plant development and is involved in
osmotic stress-induced inhibition on lateral root growth by
controlling the concentration of hexose in cells.
Keywords ABA AtCYT-INV1 Lateral root Neutral invertase Osmotic stress
Introduction
Sugar is not only as a substrate of carbon and energy
metabolism, but also acts as a signal molecule in plant
Electronic supplementary material The online version of this
article (doi:10.1007/s11103-007-9177-4) contains supplementary
material, which is available to authorized users.
X. Qi Z. Wu J. Li X. Mo S. Wu J. Chu P. Wu (&)
The State Key Laboratory of Plant Physiology and Biochemistry,
College of Life Sciences, Zhejiang University,
Hangzhou 310058, PR China
e-mail: [email protected]
development (Rolland et al. 2002). As a major transported
form of sugar, sucrose is transported from source tissues to
sink tissues through phloem and cleaved for utilization in
sink tissues (Kühn et al. 1999). Sucrose cleavage is catalyzed by sucrose synthases or invertases, which regulate
the entry of sucrose into distinct biochemical pathways
(Koch 2004). Most plant species contain acid invertase
with optimum pH 4.5–5.5 to cleave sucrose on cell wall
and vacuole, and neutral/alkaline invertases with optimum
pH from 6.8 to 8.0 (Lee and Sturm 1996). The sequences of
neutral/alkaline invertases are different from acid invertase, and have been found only in photosynthetic bacteria
and plants. Neutral/alkaline invertases were mostly accumulated in the cytoplasm. In rice, they also were found to
localize in plant organelles, mitochondria and plastids
(Murayama and Handa 2007). Unlike acid invertase, neutral/alkaline invertases appear to be sucrose-specific
(Gallagher and Pollock 1998; Vargas et al. 2003).
Acid invertases are also calledb-fructofuranosidases
because they can hydrolyze sucrose and other b-Fru-containing oligosaccharides (Sturm 1999). Transgenic plants
expressing yeast-derived invertases showed necrotic regions in leaves (Sonnewald et al. 1991). Antisense
repression of acid invertase alters soluble sugar composition, sucrose partitioning, fruit size, early plant development and flowering (Weber et al. 1998; Tang et al. 1999;
Heyer et al. 2004). Function-loss of the vacuolar invertase
gene and cytosolic invertase gene both can reduce primary
root length in Arabidopsis (Sergeeva et al. 2006; Lou et al.
2007). But the knowledge about function of neutral/alkaline invertases is still largely unknown.
Sugar, as a signal molecule, regulates gene expression
and developmental processes in plants including germination, seedling growth, root and leaf differentiation, floral
transition, fruit ripening, embryogenesis, and senescence
123
576
(León and Sheen 2003). Hexokinase (HXK) has been reported as a glucose sensor and three distinct glucose signal
transduction pathways in plants have been demonstrated,
including HXK-dependent pathway, glycolysis-dependent
pathway and HXK-independent pathway (Xiao et al.
2000). Characterization of sugar responsive mutants in
Arabidopsis has unravelled interaction between sugar and
ABA signalling. Some of the gin (glucose insensitive)
mutants are allelic to the genes for ABA biosynthesis or
ABA signalling that are raised by glucose (Finkelstein and
Gibson 2001; Rook et al. 2001; Brocard et al. 2002; Cheng
et al. 2002; Rolland et al. 2002).
Sugar signals also play vital roles in response to environmental stresses. Osmotic and salt stress induces accumulation of soluble carbohydrate, including sucrose,
glucose, and fructose (Kerepesi and Galiba 2000; Valentovič et al. 2006). Activities of sucrose synthase and acid
invertase were also induced upon dehydration (Zrenner
et al. 1996; Pelah et al. 1997). Glucose treatment can induce expression of ABA biosynthesis genes, such as ABA1,
ABA3 and NCED3, as osmotic stress (Iuchi et al. 2001;
Xiong et al. 2001, 2002; Chen et al. 2006). Several lines of
evidence indicate that ABA signalling response to sugars
and osmotic stress is mediated by distinct mechanisms.
High glucose but not mannitol level results in developmental arrest with no cotyledon expansion or greening
(Arenas-Huertero et al. 2000; Moore et al. 2003). Expressions of ABA responsive genes ABI3, ABI4, and ABI5 are
regulated differently by glucose and mannitol (Brocard
et al. 2002; Cheng et al. 2002).
High concentrations of KNO3, KCl, and mannitol can
mimic osmotic stress to repress lateral root formation, and
ABA-deficient mutants aba2 and aba3 were less sensitive
to mannitol repression. Furthermore, high KNO3 inhibition
effect was significantly reduced in ABA-insensitive mutants abi4 and abi5 (Signora et al. 2001; Smet et al. 2003;
Deak and Malamy 2005; Malamy 2005). ABA-mediated
signalling pathway interacted with sugar-mediated signalling is involved in osmotic stress-induced repression of
lateral root formation, while the detailed molecular mechanism underlying this repression is still unclear.
In this study, we isolated an Arabidopsis mutant from
Columbia (Col-0) mutant library mutagenized by ethyl
methane sulphonate (EMS). The mutant showed insensitivity to osmotic stress-induced inhibition on lateral root
growth. Map-based cloning and enzyme catalyse assay
in vitro revealed that the mutated gene encodes a neutral
invertase that cleaves sucrose into glucose and fructose,
that the mutant is designated as Atcyt-inv1 (CYToplasmic
INVertase 1). The activity of AtCYT-INV1 is sucrose
specific. AtCYT-INV1 regulates multiple tissue development including primary root elongation, root hair growth,
leaf, silique and floral transition. AtCYT-INV1 is also
123
Plant Mol Biol (2007) 64:575–587
involved in osmotic stress-induced lateral root inhibition.
This is the first time to characterize the function of neutral
invertase in plant development and stress response.
Materials and methods
Plant growth conditions and isolation of mutants
The Arabidopsis seeds were surface-sterilized for 5 min in
10% (v/v) Chloros bleach, and followed by six rinses with
sterile distilled water. Seeds were plated onto the 1/2MS
solid medium (1.5% sucrose, 0.05% MES, and 1% AgarAgar [Fisher Scientific, UK], pH 5.7), vernalized in darkness for 2 days at 4C and then transferred to biological
incubators at 22C under 16 h-light/8 h-dark photoperiod.
Approximately 10000 M2 seeds (ecotype Columbia)
that had been mutagenized with EMS were planted on 1/
2MS medium supplemented with 40 mM KNO3. At
12 days, plants that produced four or more lateral roots
were transferred to soil. Progeny were then re-tested under
similar conditions. Eight mutants were isolated; characterization of one of these mutants is presented here.
Mannitol, ABA, glucose, and fructose treatments
For mannitol treatment, WT seeds and Atcyt-inv1 seeds
were transferred on 1/2MS medium. Two days after germination, seedlings were transferred to the 1/2MS media
containing 1%, 2%, or 3% mannitol for another 10 days.
For glucose, fructose, and ABA treatments, 2 DAG seedlings were transferred to the media containing 1%, 2%, and
3% glucose (fructose) or 20, 50, 100, and 500 nM ABA for
another 10 days, respectively.
For mannitol with addition of glucose, fructose, or ABA
treatments, WT seeds and Atcyt-inv1 seeds were transferred
on 1/2MS medium. Two days after germination, seedlings
were transferred to 1/2MS media containing mannitol with
addition of 1% glucose (fructose) or 50 nM ABA for another 10 days, respectively.
Phenotypic analysis of Atcyt-inv1 mutant
and Map-Based cloning of AtCYT-INV1
The primary and lateral root length of 12 DAG WT and
Atcyt-inv1 mutant seedlings were measured using a scanner
connected to an image-analysis system WinRhizo (Regent
Canada).
Microscopic analysis of lateral root initiation and
development, all tissues were cleared by incubating
sequentially in (i) 20% methanol with 0.25 N hydrochloric
acid, 57C, 15–20 min; (ii) 7% NaOH in 60% ethanol,
room temperature, 15 min. Tissues were then re-hydrated
Plant Mol Biol (2007) 64:575–587
by 5 min incubations in 40%, 20%, and 10% ethanol, and
then infiltrated for 10 min in 50% glycerol/5% ethanol.
Cleared tissues were then mounted in 50% glycerol and
visualized using a Zeiss Axivert 200 microscope (Zeiss,
USA).
Genetic analysis and mapping, Atcyt-inv1 mutant was
crossed with Ler, and F2 progenies showing Atcyt-inv1
mutant phenotype were selected. Markers used in the initial
mapping analysis were selected from TAIR (http://
www.arabidopsis.org). Nine new markers (SSLP) were
developed between Cer464658 and CIW1 markers on
chromosome 1 based on differences between Col and Ler.
The closest two markers were M1311 and M1312 (M1311
primers, 5¢AGCACTACCTCCGTTTGTGG3¢ and 5¢TAG
ATCAAGAACCCGGTTCA3¢; M1312 primers, 5¢GA
ATGATAATTGTCAAACAT3¢ and 5¢TAGAAAATAA
CGACTTTACA3¢).
Construction of various vectors and plant
transformation
For complementation, AtCYT-INV1 genomic sequence
(4.9 kb), covering its putative native promoter and coding
sequence, was amplified by PCR (primers, 5¢-ACTAGTG
ATCTTAATTGGCTTAT-3¢ and 5¢-ATCGTGGCAAAT
ATTAGAAC-3¢), confirmed by sequencing, and cloned
into a binary vector (pCAMBIA1300) containing a NOS
terminator in the multiple clone sites and a HYG gene
(hygromycin resistant) as selectable marker.
For Promoter fused GUS gene, AtCYT-INV1 promoter
sequence (2.1 kb) was obtained by PCR from the genomic
sequence using the following primers with HindIII (the
enzyme site of HindIII locates in the upstream of promoter
sequence) and underlined BamHI sites (5¢ACTAGTG
ATCTTAATTGGCTTAT3¢ and 5¢AAAGGATCCAACAC
TAAACCAAGATCTAAAATC3¢), respectively. The promoter was cloned into binary vactor (pBIN121) with the
sites HindIII and BamHI, respectively, and sequencing
confirmed.
Agrobacteria containing complementation and promoter
fused GUS gene vectors were transformed into Arabidopsis
through floral infiltrating of 4-week old seedlings (Ye et al.
1999). Seeds from the transgenic plants were collected and
screened for hygromycin or kanamycin resistance.
RT-PCR analysis
For RT experiments, 5 lg of total RNA was denatured at
65C for 5 min followed by quick chill on ice in a 14 ll
reaction containing 1 ll oligo (dT)12–18 (500 lg/ml) primer, and 1 ll of 10 mM dNTP mixture (10 mM each
dATP, dGTP, dCTP, and dTTP at neutral pH). After
addition of 4 ll 5· reaction buffer (Promega), the reaction
577
was incubated at 37C for 2 min, 1 ll (200 units) of
M-MLV RTa (Promega) was added in the reaction
and incubated at 42C for another 50 min. After terminating, the reaction was heated at 70C for 15 min for
inactivating.
Full-length cDNA of At1g35570 and At1g35580 were
obtained by PCR from Atcyt-inv1 mutant cDNA using the
following primers. At1g35570 cDNA primers were 5¢AA
AGTCAGAAGACAGACATGC3¢ and 5¢TTCCGAGTTT
GTTTGTCTATT3¢; At1g35580 cDNA primers were 5¢AT
GGAAGGTGTTGGACTAAG3¢ and 5¢ATCGTGGCAAA
TATTAGAAC3¢. PCR parameters were: 94C 4 min, followed by 30 cycles of 94C 30 s, 58C 30 s, 72C 2 min,
and a final elongation step at 72C for 5 min.
Semi-quantitative RT-PCR analyses of ABA biosynthesis and response pathway marker genes involved the
following primers. ABA1 primers were 5¢CAAATACAG
AGCAACGCTTTA3¢ and 5¢CCGTGTAACAAGTGTAG
CCT3¢; ABA3 primers were 5¢TTACTCAAGTCGCTTACACCT3¢ and 5¢ATGCCCAGCCTCTACAT3¢; AtNCED3
primers were 5¢ACTCAGCCGCCATTATCGTC3¢ and
5¢CGGCGATCTGAACACTAGGAT3¢; ABI1 primers
were 5¢ GCTCATTTCTTCGGTGTTTAC 3¢ and 5¢CGCT
TCTTCATCCGTCATTAC3¢; ABI3 primers were 5¢TTT
CCTTGCCTCCTTACTCAC3¢ and 5¢CCGAAAGTCTC
CATCATATCA3¢; ABI4 primers were 5¢TCAACTTCCTC
CGCTCAACGCAAAC3¢ and 5¢ACGGCGGTGGATGA
GTTATTGAT3¢; ABI5 primers were 5¢CAATAAGAGA
GGGATAGCGAACGAG3¢ and 5¢CGGGTTTGGATTA
GGTTTAGGAT3¢. ACTIN primers were 5¢TCTCTAT
GCCAGTGGTCGTA3¢ and 5¢CCTCAGGACAACGGAA
TC3¢. At1g35580 primers were 5¢ACGCCTCTTTCTTCT
GCTAGA3¢ and 5¢GAAATCCGCAACAATGTTATC3¢.
PCR parameters were: 94C 4 min, followed by 30 cycles
of 94C 30 s, 58C 30 s, 72C 30 s, and a final elongation
step at 72C for 5 min.
Expression in E. coli and enzyme assays
The ORF of AtCYT-INV1 was isolated by PCR with
primers
5¢ATAGAATTCGGAAGGTGTTGGACTAAGAGC3¢ and 5¢ATAGTCGACGAGTTGTGGCCAAGACGCAG3¢ (underlined EcoRI and SalI sites) from fulllength cDNA clone pda06259 (At1g35580, ordered from
RIKEN, Japan). The PCR product was ligated after
cleavage with EcoRI and SalI into the respective sites of
expression vector pET29-b, and defined as pET29-b-AtCYT-INV1. pET29-b-AtCYT-INV1 and pET29-b (negative control) were transformed into E. coli BL21 (DE3;
Stratagene, La Jolla, CA), and grown on LB medium.
Overnight cultures were inoculated into fresh medium at
1:100 dilution and grown at 37C until the density was 0.6
A600/ml, and 0.5 mM IPTG was added to the cultures,
123
578
followed by another 2 h of incubation at 28C. The cells
were collected by centrifugation, suspended in one-twentieth culture volume of sonication buffer (50 mM Trisacetate, 10 mM EDTA, and 5 mM DTT, pH 7.5), and
sonicated on ice for 4 min (1 s on, 2 s off). Cell lysates
were centrifuged at 12,000 rpm for 10 min and analysed
using SDS-PAGE. Supernatant and precipitates of pET29b-AtCYT-INV1 and pET29-b were separated by SDSPAGE using a 7.5% acrylamide gel, respectively. Protein
concentrations were determined by Bradford assays
(Bradford 1976).
For invertase assays, 10 lg supernatant protein of
pET29-b-AtCYT-INV1 and pET29-b was incubated for
30 min with 1% sucrose at 37C. Then added equal volume
of DNS reagent (27.6 mM DNS, 0.5 M NaOH, 0.64 M
C4H4O6KNa, 53.1 mM C6H5OH, 39.7 mM Na2SO3) at
100C for 3 min, followed by a quick chill to room temperature, and analysed the OD540 nm. The pH dependence
of the sucrose cleaving activity was determined in solutions
of 0.5 M potassium phosphate with pH values between 4
and 11. For determination of Km value, different sucrose
concentrations were added to the incubation mixture (pH
7.0) for 12 min at 37C, followed by reaction with DNS
reagent and analysing OD540. AtCYT-INV1 substrate
specificity was tested with 1% sucrose, 1% trehalose, 0.1%
lactose, and 0.1% maltose in pH 7.0 reaction solution for
30 min, followed procedures as described above.
Plant Mol Biol (2007) 64:575–587
form:isoamyl alcohol (24:1) and filtered through a 0.2-lm
or 0.4-lm microfuge spin filter before HPLC analysis.
Sugars were identified and quantified by chromatography
on an Aminex carbohydrate column (300*7.8 mm) and
detected with a refractive index detector (Altex 156).
Concentrations were calculated from peak heights using
Glucose, Fructose, and Sucrose standards (Klann et al.
1993).
Phylogenetic analysis and multiple sequence alignment
The Swiss-Prot and EMBL database (http://www.cn.expasy.org/tools/blast/) were used to blast for full-length protein sequence homologs with AtCYT-INV1. Phylogenetic
tree analysis was performed using Clustalx, PHYLIP, and
TreeView softwares. Multiple sequence alignment was
performed using ClustalW with default parameters set as
in the ClustalW web server at IBI-ZJU (http://www.
ibi.zju.edu.cn/clustalw/index.html) and GENEDOC32.
GUS staining
Histochemical GUS staining was performed by incubating
the plant tissues in GUS staining buffer containing 50 mM
sodium phosphate (pH 7.0), 0.5 mM potassium ferrocyanide, 10 mM EDTA, 0.1% (v/v) Triton X-100, 2% (v/v)
dimethyl sulfoxide, and 1 mM 5-bromo-4chloro-3-indolylb-D-glucuronide at 37C for 4 h.
Protein enzyme assays
Twelve-day-old WT and Atcyt-inv1 mutant (control and
mannitol treated) were homogenized in the extraction
buffer (50 mM Tris-acetate, pH 7.5; 10 mM EDTA; 5 mM
DTT). The homogenates were directly used for invertase
assays (Weber et al. 1998), and protein concentrations
were determined by Bradford assays. For invertase assays,
100 lg total protein of the WT and Atcyt-inv1 mutant were
incubated for 30 min with 1% sucrose in 50 mM potassium
phosphate, pH 7.0, at 37C, respectively, and followed by
reacting with DNS reagent and analysing OD540.
Carbohydrate measurements
Carbohydrate was extracted from 100 to 300 mg of Arabidopsis seedlings in a microtube with 0.5 ml of 80%
ethanol and boiled for 20 min. following centrifugation
(10,000 rpm, 5 min); the ethanol supernatant was transferred to a fresh tube. The residue was re-extracted with
0.5 ml of boiling 80% ethanol, and the ethanol supernatants were pooled. For soluble sugar analysis, the 80%
ethanol extract was evaporated under vacuum to dryness,
and the residue was dissolved in 200 ll of H2O. This
aqueous fraction was extracted twice with chloro-
123
Results
Isolation and characterization of the mutant
We isolated an Arabidopsis mutant insensitive to high
concentrations of KNO3, KCl, or mannitol repression on
lateral root development. Both the wild type and the mutant
produced similar number of visible lateral roots at Day 12
after germination under normal growth condition. Lateral
roots were inhibited in the WT, but not in the mutant on the
medium containing 40 mM KNO3, KCl, or 3% mannitol,
respectively (Fig. 1A).
Primary and lateral root lengths were measured in the
WT and the mutant. On the control medium, primary root
length of the mutant was about 60% of the WT, but the
lateral roots length was longer than the WT. On the medium containing 40 mM KNO3, 40 mM KCl, or 3% mannitol, total lateral roots length of the WT was reduced by
about 87%, 85%, and 94%, respectively; while that of the
mutant was reduced by about 45%, 42%, and 37%,
respectively. Average lateral root length of the WT was
reduced by about 83%, 71%, and 88%, respectively, while
that of the mutant was induced by about 24%, 30%, and
Plant Mol Biol (2007) 64:575–587
579
Fig. 1 The root traits of the
mutant. (A) 2 DAG seedlings
grown on 1/2MS medium were
transferred to the 1/2MS
containing 40 mN KNO3,
40 mM KCl, 1%, 2%, and 3%
mannitol for 10 days,
respectively. w, wild type (WT);
m, the mutant. Bar = 1 cm. (B)
Osmotic repression of root
development was quantified by
measuring primary root length,
total lateral roots length, and
average lateral root length. WT,
wild type; Atcyt-inv1, the
mutant; PRL, primary root
length; LRL, lateral root length;
ALRL, average lateral root
length. 12 DAG seedlings were
analysed, and the values of 15
seedlings were averaged
13%, respectively (Fig. 1B). The reduction of primary root
length by osmotic stress was not distinct between the WT
and the mutant.
The number of lateral root primordia (less than 0.1 mm
size, Fig. 2AI) and visible lateral roots (Fig. 2AII) were
measured. The total lateral root density, including primordia and visible lateral roots, was not distinct between
the WT and the mutant under control and 3% mannitol
treatment. Mannitol treatment clearly reduced visible lateral root density in the WT, but not in the mutant (Fig. 2B).
Furthermore, root hair length and density of the mutant
were higher than that of the WT either under both control
and mannitol treatment (Fig. 2C).
To examine the pattern of mitotic activity in primary
root meristem, lateral root primordial, and lateral root
meristem of the WT and the mutant, The mutant was
crossed with the transgenic lines carried GUS reporter gene
controlled by CycB1;1 promoter (Colón-Carmona et al.
1999). GUS staining was analysed in F2 progenies under
control and 3% mannitol treatment. Under control, mitotic
activity of the mutant was slightly reduced in primary root
meristem compared with the WT (Fig. 3A,D). In lateral
root meristem, activity of the mutant was slightly stronger
than that of the WT (Fig. 3C,F). GUS staining in the WT of
lateral root primordium was similar as in the mutant
(Fig. 3B,E). Under 3% mannitol treatment, mitotic activity
of primary root meristem was not significantly different
between the WT and the mutant (Fig. 3G,J), while mitotic
activities of lateral root primordium and lateral root meristem were reduced in both of the WT and the mutant.
Mitotic activity of lateral root primordium in the WT was
weaker than that in the mutant (Fig. 3H,K). Mannitol
treatment almost completely repressed the visible lateral
root formation in the WT, even if in the very few lateral
roots meristem, the mitotic activity was weaker than that of
the mutant (Fig. 3I,L).
The mutant showed earlier floral transition, smaller rosette leaves and siliques compared to the WT (Fig. 4A–E).
Under growth room condition, floral transition in the mutant was 5–7 days earlier than that of the WT. At 25 DAG,
the mutant had a 2–3 cm length of inflorescence, but the
WT was still at the vegetative growth stage (Fig. 4A). At
40 DAG, the size of rosette leaves and siliques of the
mutant were about 40% and 53% of that of the WT,
respectively (Fig. 4B,C), but no distinct difference in
flowers (Fig. 4D). At 70 DAG, the whole shoot growth of
the mutant was retarded to about half of the WT (Fig. 4E).
Cloning of the gene for the mutation traits
The gene was mapped on chromosome 1 flanked by
Cer464658 and CIW12 markers based on F2 mutants
insensitive to osmotic stress-induced inhibition on lateral
root growth derived from a cross between the mutant (Col0) and the Ler accession of Arabidopsis. For fine mapping,
we generated nine new SSLP (simple sequence length
polymorphism) markers on the flanked region, and the gene
was localized between markers M1311 and M1312. Two
genes At1g35570 and At1g35580 were found on this region. By comparing the sequences of the coding regions of
123
580
Fig. 2 Difference of mannitol induced inhibition on lateral root
growth in the WT and the mutant. (A) Lateral roots were classified
into two classes (primordium [I, less than 0.1 mm] and visible lateral
roots [II, longer than 0.1 mm]) according to the lateral root length
(Smet et al. 2003). Bar = 50 lm. (B) Lateral root density was
compared in the WT and the mutant. WT, wild type; Atcyt-inv1, the
mutant; LR, lateral root including root primordia (class I) and visible
lateral root (class II); VLR, visible lateral root. Values of 12 seedlings
were averaged. Asterisks indicate significant differences. (C) Root
hair of the WT and the mutant. a and c were control, b and d were 3%
mannitol treatment. Bar = 100 lm
the two genes of the WT to the mutant, a single mucleotide
G deletion at position 990 of At1g35580 coding sequence
was found, which encodes a putative neutral invertase,
designated as AtCYT-INV1. This deletion caused a frameshift and an early stop codon at position 1023 (Fig. 4F).
AtCYT-INV1 gene contained five exons and five introns
including a 5¢-UTR intron (Fig. 4F). This frameshift
mutation induced the fourth and fifth exons deletion.
To confirm AtCYT-INV1 mutation is responsible for
the phenotype of the mutant. Complementation was performed through transformation of a 4.9-kb genomic clone
123
Plant Mol Biol (2007) 64:575–587
Fig. 3 GUS staining of transgenic lines of CycB1;1-GUS fused gene
in the WT and the mutant. 12 DAG seedlings were analysed. (A–C)
GUS staining of the WT grown on 1/2MS medium in primary root
meristem (A), lateral root primordium (B), and lateral root meristem
(C). (D–F) GUS staining of the mutant grown on 1/2MS medium in
primary root meristem (D), lateral root primordium (E), and lateral
root meristem (F). (G–I) GUS staining of the WT grown on 1/2MS
medium containing 3% mannitol in primary root meristem (G), lateral
root primordium (H), and lateral root meristem (I). (J–L) GUS
staining of the mutant grown on 1/2MS medium containing 3%
mannitol in primary root meristem (J), lateral root primordium (K),
and lateral root meristem (L). WT, wild type; Atcyt-inv1, the mutant;
Bar = 50 lm
of AtCYT-INV1 including its 2.5-kb putative native promoter. Four independent lines were selected based on
antibiotic resistance and PCR test. Primary root length, 3%
mannitol-induced inhibition on lateral root growth, and
shoot development of mature seedlings were complemented in the transformed lines (Fig. 4G–J), then we
named the mutant as Atcyt-inv1. The primary root length of
Plant Mol Biol (2007) 64:575–587
581
Fig. 4 Developmental alterations in shoots of the WT and the
mutant, cloning of AtCYT-INV1 gene and complementation of the
mutant. (A) 25 DAG seedlings of the WT and Atcyt-inv1 mutant.
(B–D) The alteration of 40 DAG seedlings of the WT and Atcyt-inv1
mutant in the seventh rosette leaves (B), siliques (C), and flowers
(D). (E) 70 DAG seedlings of the WT and Atcyt-inv1 mutant.
Bar = 1 cm. (F) Structure of AtCYT-INV1 gene and position of
AtCYT-INV1mutation. Positions were relative to the translation
initiation codon. Black rectangles indicate exons, and white
rectangles indicate introns. (G–J) Four individual complemented
lines (I, II, III, and IV) were grown on 1/2MS medium for 12 days
(G), on 1/2MS medium containing 3% mannitol for 12 days (H), in
soil for 45 days (I). PCR test of HYG marker gene (J). Bar = 1 cm
T-DNA insertion mutant of At1g35580 also was reduced
(Lou et al. 2007), which was consistent with our results.
expressing an AtCYT-INV1 promoter-GUS fused gene.
GUS staining was observed in radicle after germination
(Fig. 5A), in hypocotyl and root of 2 day-old seedlings
(Fig. 5B). In 10 day-old seedlings, AtCYT-INV1 was
highly expressed in vasculature of leaf, shoot stipules, root
tip, and vascular cylinder (Fig. 5C–F). Under 3% mannitol
treatment, GUS staining was induced in root epidermal
AtCYT-INV1 expression pattern
To study the spatial and temporal expression pattern of
AtCYT-INV1, we analyzed transgenic Arabidopsis plants
Fig. 5 Expression of AtCYT-INV1 gene promoter. (A) GUS staining
of AtCYT-INV1 promoter fused GUS transgenic seedlings at 12 h
after germination. (B) GUS staining of 2 DAG transgenic seedlings
of. (C–F) GUS staining of 10 DAG transgenic seedlings grown on 1/
2MS medium in vasculature of leaf (C), shoot stipules (D), primary
root tip (E), and vascular cylinder (F). (G–H) GUS staining of 10
DAG transgenic seedlings grown on 1/2MS medium containing 3%
mannitol in primary root tip (G) and primary root (H). Bar = 100 lm
for (A–H). (I–M) GUS staining of 40 DAG transgenic seedlings in
trichomes (I), stem (J), stigma apex (K), young silique (L), and
mature silique (M). Bar = 1 mm for (I–M)
123
582
cells and primary root tip (Fig. 5G,H). In mature plants,
GUS staining was also detected in trichomes, stem, stigma
apex, apex, base of young siliques, and base of mature
siliques (Fig. 5I–M).
Phylogenetic analysis of neutral invertase superfamily
Based on BLAST search, we identified 43 full protein sequences of neutral/alkaline invertase family from 11
organisms. To determine the evolutionary relationships of
these genes, a phylogenetic analysis was performed using
the full protein sequences. These proteins were divided into
five clades (Fig. 6). The first and second clades (Fig. 6I,II)
comprise neutral/alkaline invertases from Photosynthetic
bacteria. Neutral/alkaline invertases of higher plants were
classified into the other three clades (Fig. 6III, IV, and V).
AtCYT-INV1 was classified into the clade III, and sequence
Plant Mol Biol (2007) 64:575–587
alignment of four Rice genes (Os|7XQN9, Os|Q69T31,
Os|Q53PH5, and Os|Q6Z2N4), five Arabidopsis genes
(At1g35580, At4g09510, At4g34860, At1g22650, and
At1g72000), one Lotus gene (Lj|Q684K1), one Carrot
gene (Ca|Q9ZR47), and one Lolium gene (Lt|O49890)
showed that the invertase domain was conserved among
them sharing about 38–83% identity between each other
(Fig. 7). Clade V was exceptive in this phylogenetic tree.
Two Rice neutral invertases were phylogenetically more
closely related to photosynthetic bacteria than higher
plants (Fig. 6), suggesting that these two neutral invertases may be from algae genome and further evolutionary
in remote antiquity.
AtCYT-INV1 is a neutral invertase and sucrose specific
The AtCYT-INV1 cDNA includes an open reading frame
(ORF) encoding a neutral invertase domain-containing
protein of 551 amino acids with a predicted molecular mass
of 62.8 kD. To verify whether AtCYT-INV1 can catalyse
sucrose cleavage, prokaryotic expressed AtCYT-INV1 was
purified (Fig. 8A). A pH profile for the invertase activity of
AtCYT-INV1 was investigated. AtCYT-INV1 was found
to be catalytically active in the pH range 7–10 with optimal
pH at 7.0 (Fig. 8B). The Km was about 18.4 mM
(y = 18.246x + 0.9927) at pH 7.0. The substrate specific to
AtCYT-INV1 was determined by incubation with sucrose,
trehalose, lactose, and maltose. Enzyme activity was observed only when sucrose was used as a substrate
(Fig. 8C,D), while the content of reducing sugar in product
were not increased when lactose and maltose as substrate.
The results indicate that AtCYT-INV1 enzymatic activity
is sucrose specific.
Composition of hexose and sucrose was altered
in Atcyt-inv1 mutant
Fig. 6 Phylogenetic tree of neutral/alkaline invertase superfamily.
The accession numbers except Arabidopsis genes were from
UniProtKB (Swiss-Prot + TrEMBL). Rh, Rhodoferax ferrireducens;
Pm, Prochlorococcus marinus; Sy, Synechocystis; Np, Nostoc
punctiforme; An, Anabaena; Os, Oryza sativa; Lj, Lotus japonicus;
Ca, carrot; Ip, Ipomoea trifida; Bv, Beta vulgaris; Lt, Lolium
temulentum. At1g35580, AtCYT-INV1; Ca|Q9ZR47, a carrot neutral
invertase (Sturm et al. 1999); Lt|O49890, a lolium temulentum
neutral/alkaline invertase (Gallagher and Pollock 1998); the three
genes were arrowhead
123
To determine whether neutral invertase activity was altered
in Atcyt-inv1 mutant, neutral invertase protein levels of
Atcyt-inv1 mutant and the WT seedlings under control and
3% mannitol treatment were analysed. Neutral invertase
activity of Atcyt-inv1 mutant were reduced by 20% and
13% compared to the WT under control and 3% mannitol
treatment, respectively, and enzyme activity of neutral
invertase in the WT and Atcyt-inv1 mutant were induced by
3% mannitol (Fig. 8E). Under control, sucrose concentration in Atcyt-inv1 mutant was 6.7 times higher than that of
the WT, while glucose and fructose were not significantly
changed (Fig. 8F). Mannitol treatment induced sucrose,
glucose, and fructose accumulation was found in Atcyt-inv1
mutant and the WT (Fig. 8F). Sucrose of Atcyt-inv1 mutant
was about 1.6 times higher than that of the WT, but glucose
of Atcyt-inv1 mutant was about 75% of the WT. No
Plant Mol Biol (2007) 64:575–587
significant difference in fructose was found between Atcytinv1 mutant and the WT (Fig. 8F).
Glucose and ABA can restore Atcyt-inv1 mutant
AtCYT-INV1 mutation altered the composition of hexose
and sucrose, and the concentration of glucose in Atcyt-inv1
mutant was lower than that in the WT under 3% mannitol
treatment. Glucose also can induce ABA biosynthesis
(León and Sheen 2003). To investigate whether insensitivity to osmotic stress-induced inhibition on lateral root
growth in Atcyt-inv1 mutant was attributed to the lower
concentration of hexose, we tested the effect of exogenous
glucose, fructose, and ABA on lateral root growth. The
results showed that exogenous glucose, fructose or ABA
can inhibit lateral root development in the WT and Atcytinv1 mutant which showed more sensitive to glucose,
fructose or ABA inhibition than the WT (Fig. 9A,B and
Supplemental figure). Three percentage of mannitol with
583
addition of exogenous glucose, fructose, or ABA can inhibit Atcyt-inv1 mutant lateral root development (Fig. 9C).
Mannitol added with glucose, fructose, or ABA did not
significantly reduce total lateral root density of Atcyt-inv1
mutant compared with 3% mannitol alone. But the visible
lateral root density was highly reduced by 3% mannitol
with glucose, fructose, or ABA (Fig. 9D).
ABA is involved in the osmotic stress-induced inhibition on lateral root growth (Smet et al. 2003; Deak and
Malamy 2005). To investigate the difference in ABA response pathway between Atcyt-inv1 mutant and the WT,
the expression patterns of the genes for ABA biosynthesis
and ABA signalling responsive to mannitol, synergistic
effects of mannitol and glucose or ABA were determined
by RT-PCR analysis. Both NCED3 and ABA3 are important ABA biosynthesis genes (Iuchi et al. 2001; Xiong
et al. 2001). NCED3 expression was up-regulated in the
WT and Atcyt-inv1 mutant under mannitol or two synergistic effects treatments, while the expression of ABA3 was
Fig. 7 Protein sequence
alignment of AtCYT-INV1 and
its homologs from other
organisms. The 12 sequences
comprise of Clade III in this
figure, Ca|Q9ZR47, and
Lt|O49890. Gray and black
shading indicate conserved and
identical residues, respectively
123
584
not clearly altered. The expression of NCED3 and ABA3 in
Atcyt-inv1 mutant was lower than that in the WT under
control and the three treatments (Fig. 10). Induction of
ABI3 and ABI4 (León and Sheen 2003) were more sensitive
to synergistic effects of mannitol and glucose or ABA in
Atcyt-inv1 mutant than that in the WT (Fig. 10). AtCYTINV1 transcription was also induced under mannitol or two
synergistic effects treatments in both the WT and Atcytinv1 mutant, but lower in Atcyt-inv1 mutant (Fig. 10). The
expressions of ABA1, ABI1, ABI5, and ACTIN were not
significantly influenced under mannitol or synergistic effects treatments (Fig. 10).
Discussion
Neutral/Alkaline invertases are unique to photosynthetic
bacteria and plants, and their amino acid sequences showed
Fig. 8 AtCYT-INV1 enzyme activity analysis, neutral invertase
activity and carbohydrate concentration analysis in the WT and
Atcyt-inv1 mutant. (A) Coomassie-stained gel showing bacterially
expressed AtCYT-INV1 proteins. The second and third lines were
supernatant proteins; the right two lines were precipitate proteins. CK,
negative control of pET29-b transformed bacteria; AtCYT-INV1,
pET29-b-AtCYT-INV1 transformed bacteria. (B) Effect of pH on
AtCYT-INV1 activity. (C) Enzyme kinetics of AtCYT-INV1. At the
indicated time points, aliquots of the reaction were stopped. (D)
123
Plant Mol Biol (2007) 64:575–587
no similarity with that of acid invertase. In contrast to acid
invertase, neutral/alkaline invertases appear to be sucrose
specific (Sturm 1999; Vargas et al. 2003). Our results
showed that AtCYT-INV1 only catalyses sucrose cleavage
at neutral and slightly alkaline range, and the maximum
enzyme activity was detected at pH 7.0 (Fig. 8). Km value
for sucrose of AtCYT-INV1 was about 18.4 mM, among
the range of 10–30 mM, which is the range of neutral/
alkaline invertases (Vargas et al. 2003). Sequence alignment showed that AtCYT-INV1 has a large conserved
invertase domain not hallmarks of acid invertases (Fig. 7).
Taken together, our results indicate that AtCYT-INV1 is a
neural/alkaline invertase and consistent with Lou’s results
(Lou et al. 2007).
High concentrations of KNO3 and KCl can produce
osmotic potential like mannitol to inhibit lateral root
development from primordia (Signora et al. 2001; Deak
and Malamy 2005). Atcyt-inv1 mutant showed insensitivity
Substrate specificity of AtCYT-INV1. Suc, sucrose; Tre, trehalose;
Lac, lactose; Mal, maltose. (E, F) 12 DAG seedlings of the WT and
Atcyt-inv1 mutant were analysed. (E) Neutral invertase activity of the
WT and Atcyt-inv1 mutant. CK, seedlings grown 1/2MS medium;
man, seedlings grown on 1/2MS containing 3% mannitol. (F)
Carbohydrate concentration in the WT and Atcyt-inv1 mutant. man,
3% mannitol treatment. Each bar was a mean of three independent
experiments
Plant Mol Biol (2007) 64:575–587
585
to high concentrations of KNO3, KCl, or mannitol induced
inhibition on lateral root growth. CycB1;1-GUS transgenic
lines indicated that the mitotic activities of lateral root
meristems and lateral root primordia in Atcyt-inv1 mutant
are higher than those of the WT under osmotic stress.
Osmotic stress can induce soluble carbohydrate accumulation, such as sucrose, glucose, and fructose (Kerepesi
and Galiba 2000; Valentovič et al. 2006). Sucrose, glucose,
and fructose are important signalling molecules in plants.
In many cases, glucose and fructose are considered as direct signal molecules, and sucrose is converted to its hexose components before it becomes the signal (Koch 2004).
It has been reported that sucrose as a signal controls the
post-transcription of ATB2, a leucine zipper transcription
factor (Rook et al. 1998). In general, hexose favors cell
division and expansion, whereas sucrose favors differentiation and maturation (Koch 2004). In this case, primary
root length and the activity of neutral invertases were reduced and sucrose accumulation was induced in Atcyt-inv1
mutant (Figs. 1, 8), but hexose concentration was not
changed (Fig. 8). Under osmotic stress conditions, soluble
sugar concentration increased in both Atcyt-inv1 mutant
and the WT, but hexose concentration in Atcyt-inv1 mutant
was lower than that of the WT (Fig. 8F). These results
suggest that the insensitivity to osmotic stress of Atcyt-inv1
mutant would be attributed to the sucrose accumulation and
hexose scarcity. The significantly different steady state of
glucose and fructose in the WT or Atcyt-inv1 mutant would
be attributed to that glucose was the direct product of
photosynthesis (Fig. 8F). Both glucose and fructose could
be raised under high light conditions, and the concentration
of glucose was higher than that of fructose (Moore et al.
2003). In addition, sucrose can promote flowering and plant
maturation (Roldán et al. 1999), that early floral transition
of Atcyt-inv1 mutant may be caused by the sucrose accumulation (Fig. 4). The pleiotropic alterations in the mutant
plants indicate that AtCYT-INV1 plays multiple functions
in plant growth and development (Figs. 4, 5).
Glucose can induce ABA biosynthesis, and activate
ABA signalling pathway. The expression of ABA biosynthesis genes NCED3 and ABA3 in Atcyt-inv1 mutant was
lower than that in the WT. The ABA responsive genes
ABI3 and ABI4 were more sensitive to synergistic effects in
Atcyt-inv1 mutant (Fig. 10). These results together with
that Atcyt-inv1 mutant is more sensitive to glucose and
ABA in lateral root growth (Fig. 9), suggest that ABA
signaling in Atcyt-inv1 mutant may be attenuated. ABA
deficient mutant aba2 and aba3 show growth retardation in
roots and shoots (Xiong et al. 2001; Cheng et al. 2002).
Synergistic effects can restore the sensitive to osmotic
stress in Atcyt-inv1 mutant, which provides additional
evidence that the sensitivity of Atcyt-inv1 mutant to osmotic stress-induced inhibition on lateral root growth is
caused by glucose and ABA scarcity.
Fig. 9 Synergistic effects of mannitol and glucose, fructose or ABA
on the WT and Atcyt-inv1 mutant. (A) Effect of glucose on lateral root
development. Two DAG seedlings of the WT and Atcyt-inv1 mutant
grown on 1/2MS medium were transferred to the medium with
different concentration of glucose for another 10 days. (B) Effect of
ABA on lateral root development. Two DAG seedlings of the WT and
Atcyt-inv1 mutant grown on 1/2MS medium were transferred to the
medium with different concentration of ABA for another 10 days. (C)
Glucose, fructose, and ABA can restore the sensitive to mannitol in
Atcyt-inv1 mutant in term of lateral root inhibition. Two DAG
seedlings of the WT and Atcyt-inv1 mutant grown on 1/2MS medium
were transferred to 1/2MS medium containing 3% mannitol, 3%
mannitol with 1% glucose, 1% fructose, or 50 nM ABA, respectively,
for another 10 days. man, 3% mannitol; man+glc, 3% mannitol with
1% glucose; man + ABA, 3% mannitol with 50 nM ABA; man + fru,
3% mannitol with 1% fructose. w, wild type (WT); m, Atcyt-inv1
mutant. Bar = 1 cm. (D) Lateral root density was compared in the
WT and Atcyt-inv1 mutant. LR, lateral root including primordium
(class I) and visible lateral root (class II); VLR, visible lateral root.
Values of 12 seedlings were averaged. Asterisks indicate significant
difference
123
586
Plant Mol Biol (2007) 64:575–587
Fig. 10 RT-PCR analysis for
transcription of the genes for
ABA biosynthesis and
signalling pathway. (A) 2 DAG
seedlings of the WT and Atcytinv1 mutant grown on 1/2MS
medium were transferred to 1/
2MS medium containing 3%
mannitol, 3% mannitol with 1%
glucose or 50 nM ABA,
respectively, for another
10 days. (B) Statistic analysis of
relative expression ratio for (A),
each value was the band
intensity (quantified with 1D
Gel Analysis Software, Gel-Pro
Analyzer 4.0) relative to the
band of its expression in the WT
under 1/2MS medium. Each bar
was a mean of three
independent experiments.
Asterisks indicate significant
difference. CK, 1/2MS medium;
man, 1/2MS medium containing
3% mannitol; man + glc, 1/2MS
medium containing 3%
mannitol and 1% glucose;
man + ABA, 1/2MS medium
containing 3% mannitol and
50 nM ABA
Under osmotic stress conditions, AtCYT-INV1 may
function to cleave sucrose into two molecules of hexose,
which results in osmotic potential, thereby activating sugar
signaling pathway. Therefore the cytoplasmic invertase,
AtCYT-INV1, may play a vital role in the interaction of
osmotic stress and sugar signal transduction. AtCYT-INV1
gene expression is induced by osmotic stress (Fig. 10), but
reduced in Atcyt-inv1 mutant. This supports the conclusion
that function loss of AtCYT-INV1 reduces the osmotic potential in cells because of the reduction of concentration of
hexose. However, osmotic stress signal of AtCYT-INV1 and
its relationship with other neutral/alkaline and acid invertases keep largely unknown. It is of great importance for us
to investigate further.
Acknowledgements We thank Dr Peter Doerner for generous gifts
of the transgenic Arabidopsis seeds expressing CycB1 promoter-GUS.
This research was supported by the National Basic Research Program
of China (973) (No. 2005CB120901).
References
Arenas-Huertero F, Arroyo A, Zhou L, Sheen J, León P (2000)
Analysis of Arabidopsis glucose insensitive mutants, gin5 and
gin6, reveals a central role of the plant hormone ABA in the
regulation of plant vegetative development by sugar. Genes Dev
14:2085–2096
123
Bradford M (1976) A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of
protein-dye binding. Anal Biochem 72:248–254
Brocard IM, Lynch TJ, Finkelstein RR (2002) Regulation and
role of the arabidopsis abscisic acid-insensitive 5 gene in
abscisic acid, sugar, and stress response. Plant Physiol 129:
1533–1543
Chen Y, Ji FF, Xie H, Liang JS, Zhang JH (2006) The regulator of Gprotein signaling proteins involved in sugar and abscisic acid
siganling in Arabidopsis seed geimination. Plant Physiol
140:302–310
Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P,
Nambara E, Asami T, Seo M, Koshiba T, Sheen J (2002) A
unique short-chain dehydrogenase/reductase in Arabidopsis
glucose signaling and abscisic acid biosynthesis and functions.
Plant Cell 14:2723–2743
Colón-Carmona A, You R, Haimovitch-Gal T, Doerner P (1999)
Spatio-temporal analysis of mitotic activity with a labile cyclinGUS fusion protein. Plant J 20:503–508
Deak KI, Malamy J (2005) Osmotic regulation of root system
architecture. Plant J 43:17–28
Finkelstein RR, Gibson SI (2001) ABA and sugar interactions
regulating development: cross-talk or voices in a crowd? Curr
Opin Plant Biol 5:26–32
Gallagher JA, Pollock CJ (1998) Isolation and characterization of a
cDNA clone from Lolium temulentum L. encoding for a sucrose
hydrolytic enzyme which shows alkaline/neutral invertase
activity. J Exp Bot 49:789–795
Heyer AG, Raap M, Schroeer B, Marty B, Willmitzer L (2004) Cell
wall invertase expression at the apical meristem alters floral,
architectural, and reproductive traits in Arabidopsis thaliana.
Plant J 39:161–169
Plant Mol Biol (2007) 64:575–587
Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata
S, Kakubari Y, Yamaguchi-Schinozaki K, Shinozaki K (2001)
Regulation of drought tolerance by gene manipulation of 9-cisepoxycarotenoid dioxygenase, a key enzyme in abscisic acid
biosynthesis in Arabidopsis. Plant J 27:325–333
Kerepesi I, Galiba G (2000) Osmotic and salt stress-induced alteration
in soluble carbohydrate content in wheat seedlings. Crop Sci
40:482–487
Klann EM, Chetelat RT, Bennett AB (1993) Expression of acid
invertase gene controls sugar composition in tomato fruit. Plant
Physiol 103:863–870
Koch K (2004) Sucrose metabolism: regulatory mechanisms and
pivotal roles in sugar sensing and plant development. Curr Opin
Plant Biol 7:235–246
Kühn C, Barker L, Bürkle L, Frommer WB (1999) Update on sucrose
transport in higher plants. J Exp Bot 50:935–953
Lee HS, Sturm A (1996) Purification and characterization of neutral
and alkaline invertase from carrot. Plant Physiol 112:1513–1522
León P, Sheen J (2003) Sugar and hormone connections. Trends Plant
Sci 8:110–116
Lou Y, Gou JY, Xue HW (2007) PIP5K9, and Arabidopsis
phosphatidylinositol monophosphate kinase, interacts with a
cytosolic invertase to negatively regulate sugar-mediated root
growth. Plant Cell 19:163–181
Malamy JE (2005) Intrinsic and environmental response pathways
that regulate root system architecture. Plant Cell Environ 28:67–
77
Moore B, Zhou L, Rolland F, Hall Q, Cheng WH, Liu YX, Hwang I,
Jones T, Sheen J (2003) Role of the Arabidopsis glucose sensor
HXK1 in nutrient, light, and hormonal signalling. Science
300:332–336
Murayama S, Handa H (2007) Genes for alkaline/neutral invertase in
rice: alkaline/neutral invertases are located in plant mitochondria
and also in plastids. Planta 225:1193–1203
Pelah D, Wang W, Altman A, Shoseyov O, Bartels D (1997)
Differential accumulation of water stress-related proteins,
sucrose synthase and soluble sugars in Populus species that
differ in their water stress response. Physiol Plant 99:153–159
Roldán M, Gómez-Mena C, Ruiz-Garcı́a L, Salinas J, Martı́nezZapater M (1999) Sucrose availability on the aerial part of the
plant promotes morphogenesis and flowering of Arabidopsis in
the dark. Plant J 20:581–590
Rolland F, Moore B, Sheen J (2002) Sugar sensing and signaling in
plants. Plant Cell 14:S185–S205
Rook F, Corke F, Card R, Munz G, Smith C, Bevan MW (2001)
Impaired sucrose-induction mutants reveal the modulation of
sugar-induced starch biosynthetic gene expression by abscisic
acid signaling. Plant J 26:421–433
Rook F, Gerrits N, Kortstee A, Kampen M, Borrias M, Weisbeek P,
Smeekens S (1998) Sucrose-specific signaling represses transla-
587
tion of the Arabidopsis ATB2 bZIP transcription factor gene.
Plant J 15:253–263
Sergeeva LI, Keurentjes JJB, Bentsink L, Vonk J, van der Plas LKW,
Koornneef M, Vreugdenhil D (2006) Vacuolar invertase regulate
elongation of Arabidopsis thaliana roots as revealed by QTL and
mutant analysis. Proc Natl Acad Sci USA 103:2994–2999
Signora L, Smet ID, Foyer CH, Zhang H (2001) ABA plays a central
role in mediating the regulatory effects of nitrate on root
branching in Arabidopsis. Plant J 28:655–662
Smet ID, Signora L, Beeckman T, Inzé D, Foyer CH, Zhang H (2003)
An abscisic acid-sensitive checkpoint in lateral root development
of Arabidopsis. Plant J 33:543–555
Sonnewald U, Brauer M, Schaewen A, Stitt M, Willmitzer L (1991)
Transgenic tobacco plants expressing yeast-derived invertase in
either the cytosol, vacuole or apoplast: a powerful tool for
studying sucrose metabolism and sink/source interactions. Plant J
1:95–106
Sturm A (1999) Invertase. Primary structures, functions, and roles in
plant development and sucrose partitioning. Plant Physiol 121:1–7
Tang GQ, Luscher M, Sturm A (1999) Antisense repression of
vacuolar and cell wall invertase in transgenic carrot alters early
plant development and sucrose partitioning. Plant Cell 11:
177–189
Valentovič P, Luxová M, Kolarovič L, Gašparı́ková O (2006) Effect
of osmotic stress on compatible solutes content, membrane
stability and water relations in two maize cultivars. Plant Soil
Environ 52:186–191
Vargas W, Cumino A, Salerno GL (2003) Cyanobacterial alkaline/
neutral invertases. Origin of sucrose hydrolysis in the plant
cytosol? Planta 216:951–960
Weber H, Heim U, Golombek S, Borisjuk L, Manteuffel R, Wobus U
(1998) Expression of a yeast-derived invertase in developing
cotyledons of Vicia narbonensis alters the carbohydrate state and
affects storage functions. Plant J 16:163–172
Xiao W, Sheen J, Jang JC (2000) The role of hexokinase in plant
sugar signal transduction and growth and development. Plant
Mol Biol 44:451–461
Xiong L, Ishitani M, Lee H, Zhu JK (2001) The Arabidopsis LOS5/
ABA3 locus encodes a molybdenum cofactor sulfurase and
modulates cold stress- and osmotic stress-responsive gene
expression. Plant Cell 13:2063–2083
Xiong L, Lee H, Ishitani M, Zhu JK (2002) Regulation of osmotic
stress-responsive gene expression by the LOS6/ABA1 locus in
Arabidopsis. J Biol Chem 277:8588–8596
Ye GN, Stone D, Pang SZ, Creely W, Gonzalez K, Hinchee M (1999)
Arabidopsis ovule is the target for Agrobacterium in planta
vacuum infiltration transformation. Plant J 19:249–257
Zrenner R, Schuler K, Sonnewald U (1996) Soluble acid invertase
determines the hexose-to-sucrose ratio in cold-stored potato
tubers. Planta 198:246–252
123