Indian Journal of Biotechnology
Vol 11, January 2012, pp 16-22
Molecular cloning and structural characterization of HMG-CoA reductase
gene from Catharanthus roseus (L.) G. Donn. cv. Albus
M Z Abdin1*, U Kiran2 and S Aquil1
1
Department of Biotechnology, Faculty of Science and 2Faculty of Interdisciplinary Research Studies
Jamia Hamdard, New Delhi 110 062, India
Received 14 September 2010; revised 15 January 2011; accepted 10 August 2011
The 3-hydroxy-3-methyl glutaryl-CoA reductase (HMGR) catalyzes the conversion of HMG-CoA to mevalonate, the
first committed step in isoprenoid biosynthesis pathway in plants. HMG-CoA reductase gene was amplified from the
Catharanthus roseus (L.) G. Donn. cv. Albus by polymerase chain reaction (PCR) with primers designed using published
sequence of HMG-CoA reductase c-DNA of C. roseus cv. Little Delicata (Acc. No. M96068). PS2 SERVER was used to
generate three dimensional (3-D) structure of the enzyme using human HMG-CoA reductase as template. The structure was
evaluated at various web interfaced servers, i.e., PROCHEK, Profunc and PDBsum, for checking the stereo interfaced
quality of the structure in terms of bonds, bond angles, dihedral angles, structural as well as functional domains. The
generated model was visualized using the Rasmol. The results of these studies revealed that HMG-CoA reductase gene from
cv. Albus had 99% sequence homology with hmgr cDNA of cv. Little Delicata. The amino acid sequence of the HMGR
protein of cv. Albus was found closely related to the members of the family Solanaceae and distantly related to the members
of the families Euphorbiaceae and Brassicaceae. The enzyme has N-terminal transmembrane domain and a C-terminal
catalytic domain with active sites that can bind to HMG-CoA and NADPH2. The fold of the substrate domain is unique and
resembles the prism with 28-residue helix forming the central core. The homology model of enzyme generated in the present
study, hence, could be used in determining the mechanistic function of this important class of proteins.
Keywords: Catharanthus roseus, HMG-CoA reductase, isoprenoid biosynthesis, mevalonate pathway, PS2 Server,
secondary plant metabolites
Introduction
Isoprenoids are produced in all organisms but are
especially abundant and diverse in plants. Isoprenoid
biosynthetic pathway in plants leads to a number of
unique products, including growth regulators
(cytokinins, gibberelins and abscisic acid),
photosynthetic pigments, phytotoxins and a variety of
specialized terpenoids, such as, monoterpenes,
sesquiterpenes, polyterpenes etc1. The initial steps of
the isoprenoid pathway [acetate/mevalonate (MVA)
pathway] involve the fusion of 3 molecules of
acetyl-CoA to produce 3-hydroxy-3-methylglutarylcoenzyme A (HMG-CoA). The key enzyme of the
classical mevalonate pathway in plants was identified
as HMG-CoA reductase (HMGR, EC 1.1.1.34). It
catalyzes the formation of mevalonate by two
successive reductions of HMG-CoA, using two
entities of NADPH as cofactor. Genome sequencing
has identified hmgr genes in organisms from all three
———————
*Author for correspondence:
Tel: 91-11-26059688 Ext. 5583, 5581: Fax: 91-11-26059663
E-mail: [email protected]
domains of life, and over 150 HMGR sequences are
recorded in public databases. Higher animals, archaea
and eubacteria have only a single hmgr gene, whereas
the plants, which use both MVA-dependent
and MVA-independent pathways to synthesize
isoprenoids, have multiple HMGR isozymes that
appear to have arisen by gene duplication and
subsequent sequence divergence2.
Several studies have shown that HMG-CoA
reductase is an important control point for the
mevalonate synthesis in plants as well as in animals.
It regulates the carbon flux from primary to the
secondary metabolism for biosynthesis of secondary
plant metabolites. The regulation of this enzyme
leading to the increased production of isoprenoids
has, thus, been reported in a range of plant species3-5.
Catharanthus roseus (L.) G. Donn. (Madagascar
periwinkle) plants are the sole source of bisindole
alkaloids, vinblastine and vincristine, the two
medically important antitumor agents used in the
chemical treatment of human cancers6,7. Since the
concentration of both vinblastine and vincristine
present in the plant has been very low (0.0005% dry wt),
ABDIN et al: CHARACTERIZATION OF HMG-CoA REDUCTASE GENE FROM C. ROSEUS (L.) G. DONN. cv. ALBUS
attempts were made to produce these dimers or their
direct monomeric precursors, catharanthine and
vindoline, in C. roseus tissue cultures8,6. However,
production of both alkaloids by de novo synthesis
using the callus or the suspension cultured cell of C.
roseus could not enhance the alkaloid concentration9,10.
Research on vinblastine and vincristine metabolic
engineering showed that overexpressing a key
enzyme in isopeprenoid biosynthesis could elevate the
level of these alkaloids11. On this basis, it is
hypothesized that vinblastine and vincristine
biosynthesis and their accumulation in C. roseus plant
can be increased through modulation of HMGR
activity and MVA level.
Although genes encoding HMGR have been
isolated and characterized from several plant
species including tomato12, potato13,14, raddish15,
Arabidopsis16, tobacco17, C. roseus cv. Little
Delicata18, wheat19 and the Hevea rubber tree20, no
attempts were made to clone and characterize hmgr
gene from C. roseus cv. Albus (CrAHMGR). In view
of the potential medicinal and insecticidal importance
of this species, an attempt has been made to isolate
and elucidate the 3-D structure of HMGR of C. roseus
by homology modeling. Knowledge gained from its
3-D structure with functionally important domains
and structural features would give much more insight
to understand the function and regulatory mechanism
of the enzyme at molecular level as well as to identify
the target for metabolic engineering to enhance
biosynthesis of alkaloids.
Materials and Methods
Chemicals and Plant materials
C. roseus cv. Albus plants were obtained from
the herbal garden of Jamia Hamdard, New Delhi.
Bacterial strain used in present study was Escherichia
coli DH5-α. All chemicals were purchased from
M/s Sigma Chemicals Company (USA) and enzymes
from M/s MBI Fermentas, unless otherwise specified.
Gene Isolation
Genomic DNA was isolated from leaves of
C. roseus cv. Albus using modified Doyle and Doyle
method21 and hmgr gene was amplified by
polymerase chain reaction (PCR) using gene-specific
primers. The primers were designed using the
published c-DNA sequence of C. roseus cv. Little
Delicata (Acc. No. M96068)18. The sequences of
PCR primers were as follows: forward primer5'GGGGATCCATGGACTCTCGCCGGCGATC3'
17
and reverse primer- 5'GGGTCGACTCATCAC
TCTCTAACTGAGAG3'. PCR was performed in a
reaction mixture (50 µL) consisting of 1× reaction
buffer, 0.2 mM dNTPs, 20 pmoles of each primer
DNA, 0.5 µg template DNA and 1unit of Taq DNA
polymerase. Reaction mixture was heated at 94°C for
4 min for melting of template DNA, followed by
32 cycles at 94°C for 1 min, annealing at 60°C for 1
min and extension at 72°C for 1 min. At the end of
32 cycles, additional final extension at 72°C for 5 min
was carried out to extend any premature synthesis of
DNA. Following electrophoresis, the desired DNA
fragment of 3 kb from C. roseus cv. Albus was
isolated and purified using QIA quick® Gel
Extraction Kit (Qiagen).
Cloning and Sequencing
The isolated product eluted from gel was ligated
with pBluescript SK+ plasmid (Stratagene). The
competent cells of E. coli DH5-α prepared by CaCl2
treatment were transformed with the recombinant
vector. Recombinants were selected through bluewhite screening on Luria agar containing 1 µg/mL
ampicillin. Presence of the insert in single white
colonies was confirmed by PCR with the same primer
combination and sequenced using T7 primer at the
automated DNA sequencing service, Bangalore
Genei, India. The sequence was submitted to NCBI
(Acc. No. AY623812).
Similarity Search and Physiochemical Characterization
The mRNA and amino acid sequences for hmgr
genes from various plant species available in the
databank of National Centre for Biotechnology
Information (NCBI) (http://www.ncbi.nlm.nih.gov)
were used to locate conserved boxes by multiple
sequence alignment through CLUSTAL W 1.8.
Theoretical analysis of the nucleotide sequence
and deduced amino acid sequence was carried
out using various algorithms available on
the ExPasyServer (http://www.expasy.org/tools).
Physicochemical properties of the selected proteins
were determined using the ProtParam tool22. The
hydropathy profile of the predicted C. roseus cv.
Albus (CrA) HMGR was calculated using TMHMM
2.0 (http://www.cbs.dtu.dk/ services/TMHMM-2.0/).
Homology Modeling
The structural homologue to CrAHMGR protein
sequence was found using BLAST-p against PDB
database at www.ncbi.nlm.nih.gov/BLAST. Human
HMG-COA reductase was taken as a reference
18
INDIAN J BIOTECHNOL, JANUARY 2012
template (PDB ID: 1DQ8) after BLAST-p analysis.
The similarity between the two sequences was
calculated using CLUSTAL W. The 3-D structure
was generated by submitting the deduced amino acid
sequences of CrAHMGR protein to the PS2 Server23.
Thus generated 3-D structure was visualized by
Rasmol. The functional domains of CrAHMGR were
obtained by submitting 3-D structure to Profunc server
at http://www.ebi.ac.uk. Prediction of secondary
structure using 3-D model was done at Pdbsum,
http://www.ebi.ac.uk. The stereo chemical quality of
the structure was analyzed using PROCHECK and
WHAT IF serve24. The Ramchandran map25 was
generated to check peptide bond planarity, bond
lengths, bond angles, and hydrogen bond geometry
and side chain conformations of protein structures as
a function of atomic resolution.
Results
Isolation, Cloning and Sequencing of HMGR
HMGR gene (3 Kb) was amplified from genomic
DNA isolated from the leaves of C. roseus cv. Albus
(CrA), cloned in pBluescript SK+ plasmid and
subsequently confirmed by sequencing (Fig. 1a).
The sequence was submitted to NCBI (Acc. No.
AY623812). The complete sequence of the gene was
found to be of 3095 bases with 58.90% AT and
41.10% GC content. The ORF search result showed
that CrAHMGR gene contained a 1803 bp-ORF
encoding a 601 amino acid protein. The exons are
from 1-1019 bp, 1638-1813 bp, 1915-2261 bp and
2832-3095 bp (Fig. 1b).
Characterization of Deduced CrAHMGR Protein
The comparison between gene sequences of
HMGR from the two varieties of C. roseus (Acc. Nos
AY623812 & M96068) showed difference in 8
nucleotides ( at 258, 295, 976, 999, 1014, 1042, 1092,
1534, 1549 & 1774). The comparison between the
predicted translation products of the two varieties of
C. roseus (Acc. Nos AAT52222.1 & Q03163) showed
99% homology with difference in 6 amino acids
(at 99, 326, 348, 512, 517 & 592). The theoretical pI
value and theoretical mol wt of CrAHMGR was 5.93
and of 64 kDa, respectively.
Protein-protein BLAST and sequence alignment
analysis showed that the deduced CrAHMGR amino
acid sequence had high homology with HMGR
sequences from other plant species, such as, C. roseus
cv. Little Delicata (99%), Artemisia annua (68%),
Solanum tuberosum (80%), Datura stramonium
(83%), Camptotheca acuminate (73%), Hevea
brasiliensis (74%), Nicotiana tabacum (77%),
Lycopersicon esculentum (74%), Ginkgo biloba
(64%). The N-terminal end of plant HMGRs were
quite diverse in both length and composition, whereas
the C-terminal catalytic domain showed high
similarity (Fig. 2, Table 1).
Homology Modeling
BLAST-p analysis of CrAHMGR amino acid
sequence against PDB database revealed the
maximum sequence identity to human HMGR (Class I)
(56%; PDB: 1DQ8A) and minimal to HMGR from
Pseudomonas mevalonii (Class II) (17%; PDB:
1R7IA), suggesting that it belongs to class I HMGRs.
The 3-D structure was generated by submitting the
deduced amino acid sequences of CrAHMGR protein
to the PS2 Server, using human HMGR crystal
Fig. 1 (a &b)—a. PCR amplification of HMG Co-reductase gene
from C. roseus cv. Albus [Lane 1: DNA ladder (1 kb), & lanes 2
and 3: Gene amplification (3 kb)]; b. Schematic representation of
HMG Co-reductase gene from C. roseus cv. Albus.
Fig. 2—Phylogenetic tree showing diversity among various plant
hmgr genes.
ABDIN et al: CHARACTERIZATION OF HMG-CoA REDUCTASE GENE FROM C. ROSEUS (L.) G. DONN. cv. ALBUS
19
Table 1—Comparison of C-terminal (a) the catalytically active residues and the phosphorylation (b) site residue
Acc. No.
Plant name
gi|AAT52222
gi|167488
gi|169485
gi|2654423
gi|2246450
gi|12082120
gi|4704615
AAQ11737
AAB69726
gi|52858428
gi|6554470
gi|51599128
gi|75221430
gi|75266529
gi|75221431
Catharanthus roseus cv. Albus
C. roseus cv. Little Delicata
Solanum tuberosum
Nicotiana tabacum
Lycopersicum esculentum
S. tuberosum
Capsicum annuum
Datura stramonium
Camptotheca acuminata
Ginkgo biloba
Arabidopsis thaliana
Hevea brasiliensis
Artemisia annua
A. annua
A. annua
Catalytically active residue site
(a)
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
TEGCLVAS
structure as template. Comparison of CrAHMGR
protein with human HMGR revealed 56% identity,
which was good for homology-based modeling.
The amino acid sequence of CrAHMGR showed
the presence of two major domains: N-terminal
transmembrane domain and C-terminal catalytic
domain. The primary sequence of the initial 179
amino acid residues present at the N-terminus did
not show any significant sequence homology to the
template protein (1DQ8) sequence deposited at the
PDB data bank; therefore, these sequence were
excluded during the modeling. This initial sequence
however, showed the presence of two transmembrane
regions (Pro41-Leu63 & Leu84-Val106).
The PDB Sum results of 3-D structure of
CrAHMGR showed the predominance of α-helix (19)
and ß-strands (10) arranged in two sheets with 3 ßhairpins, 5 ß-bulges, 20 helix-helix interfaces, 27 ßturns and 1 γ-turn in CrAHMGR. The Profunc results
suggest the presence of two major domains, substrate
(HMG-CoA) binding domain and co-factor (NADPH)
binding domain. The fold of substrate domain showed
the presence of three domains; N-terminal ‘Ndomain’, large ‘L-domain’ and small ‘S-domain’. The
N-domain is the smallest of the three domains and is
α-helical. The fold of the L-domain (residues 242-304
& 408-585) is unique to HMGRs and its architecture
resembles a prism, with 28-residue helix forming
the central core (Fig. 3). The S-domain (residues
306-381) is inserted into the L-domain and probably
forms the binding site for NADP(H). Detailed
alignment analysis showed four catalytically active
residues E273GC, DK405K, GQD481, H579 and one
phosphorylation site NRS555.
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCADKKATA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
FCSDKKPAA
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
GQDPAQN
Phosphorylation site
(b)
HMKY
HMKY
HMKY
HMKY
HMKY
HMKY
HMKY
---------HMKY
HMKY
HMKY
HMKY
HMKY
HMKY
HMKY
NRSSKD
NRSSKD
NRSIKD
NRSSKD
NRSTKD
NRS--NRSTKD
-----------NRSSRD
NRSSRD
NRSSKD
NRSSRD
NRSSKD
NRSSRD
NRSSRD
Fig. 3—Major domains of catalytic domain of CrAHMGR: N
domain in red, L domain in green and S domain in purple. The L
domain resembles prism with 27-residue α-helix forming the
central element. Results were obtained from Profunc server and
visualized with RASMOL (cartoon).
The models validated by PROCHECK, essentially
satisfy the stereo-chemical parameters with wellrefined structures, at similar resolutions. The
distribution of residues in the most favoured regions
of the Ramachandran plot for CrAHMGR is 94%.
Discussion
Plants synthesize over 22,000 known isoprenoid
compounds26, which are involved in their growth and
development. The enzyme HMG-CoA reductase
catalyzes the conversion of HMG-CoA to mevalonate.
There are several studies showing a strong correlation
between HMG-CoA reductase and biosynthesis of
isoprenoid compounds, as HMG-CoA reductase
20
INDIAN J BIOTECHNOL, JANUARY 2012
regulates the carbon flux from primary to secondary
metabolism leading to the synthesis of these
compounds27-29,4.
The sequence of the amplified 3 Kb CrAHMGR
gene (Acc. No. AY623812) was found to be of 3095
bases with more of adenine and thymine bases. The
ORF search result showed that CrAHMGR gene
contained 1803 bp-ORF with four exons, encoding a
601 amino-acid protein (Fig. 1b). The gene and the
translated amino acid sequences of HMGR from
the two varieties of C. roseus differed only by
8 nucleotides and 6 amino acids, respectively. The
physicochemical analysis of CrAHMGR suggest a
theoretical pI value of 5.93 and mol wt of 64 kDa,
which was very similar to the previously reported
C. roseus cv. Little Delicata18.
Protein-protein BLAST and sequence alignment
analysis showed that the deduced CrAHMGR amino
acid sequence had high homology with HMGR
sequences from other plant species, suggesting that
the predicted protein belongs to the HMGR family.
The N-terminal end of plant HMGRs were quite
diverse in both length and composition, whereas the
C-terminal catalytic domain showed high similarity
(Fig 2, Table 1). The alignment results further suggest
that CrAHMGR amino acid sequence is closely
related to the members of family Solanaceae and is
distinct and distantly related to the groups comprising
of Euphorbiaceae (Hevea) and Brassicaceae
(Arabidopsis).
According to the sequence, HMGRs are classified
into two distinct classes: eukaryotic HMGRs (class I)
and prokaryotic HMGRs (class II)30. BLAST-p
analysis of CrAHMGR amino acid sequence against
PDB database revealed that it belongs to class I
HMGRs and has highest sequence identity to human
HMGR. The domain structure of plant, animal and
fungal HMGRs is made up of a C-terminal catalytic
domain and N-terminal transmembrane domain,
connected by linker region31. The amino acid
sequence of CrAHMGR showed the presence of two
major domains: N-terminal transmembrane domain
that anchors the protein molecule to the endoplasmic
reticulum membrane and C-terminal catalytic domain,
which contains the active site that resides in the
cytosol. The results suggested the presence of two
transmembrane regions and it is in accordance of
earlier reports where plant HMGRs were shown to
belong class I HMGRs and contained two membrane
spanning helices31.
The 3-D structure of CrAHMGR showed
3 domains; N-terminal ‘N-domain’, large ‘L-domain’
and small ‘S-domain’. The N-domain is the smallest
of the three domains and is α-helical. It connects the
catalytic portion of HMGR to the membrane domain
in full length protein. The fold of the L-domain
(residues 242-304 & 408-585) is unique to HMGRs31.
Its architecture resembles a prism, with 28-residue
helix forming the central core (Fig. 3). The S-domain
(residues 306-381) is inserted into the L-domain and
probably forms the binding site for NADP(H).
Detailed analysis shows four catalytically active
residues E273GC, DK405K, GQD481 and H579. It is
proposed that the catalytic lysine form a hydrogen
bond-linked network with aspartate and glutamate
that interacts with the carbonyl group of HMG-CoA.
The active-site aspartate participates in both reductive
stages of the overall reaction is central to the
hydrogen bond network, and may be part of a proton
shuttle32. The active-site glutamate participates in the
second reductive stage of the reaction32,33, and the
active-site lysine appears to stabilize the mevaldylCoA intermediate34. Further, it is proposed that the
histidine protonates the departing CoA thioanion32.
HMG-CoA reductase activity is regulated at
transcriptional and post-transcriptional levels35,36. In
addition, HMG-CoA reductase enzyme activity is
modulated directly by reversible phosphorylation
of the protein by the AMP-activated protein kinase37.
In human HMGR-CoA, serine is located close to
the catalytically important residue histidine at
phosphorylation site in the primary structure and its
phosphorylation reduces the activity of the enzyme31.
The presence of S in the conserved sequence NRS555
suggests that C. roseus HMGR may also be regulated
in a similar manner.
Based on the results obtained in this study, it can
be concluded that the nucleotide sequence of
CrAHMGR has 99% homology with the C. roseus cv.
Little Delicata HMG-CoA reductase cDNA.
Phylogenetic analysis of the CrAHMGR amino acid
sequence showed that it is closely related to the
members of family Solanaceae and is distinct and
distantly related to the groups comprising of the
members of families Euphorbiaceae (Hevea) and
Brassicaceae (Arabidopsis).
The analysis of structure build through homology
modeling reveals that the C. roseus cv. Albus HMGR
protein consists of two major domains: N-terminal
transmembrane domain that probably anchors the
ABDIN et al: CHARACTERIZATION OF HMG-CoA REDUCTASE GENE FROM C. ROSEUS (L.) G. DONN. cv. ALBUS
protein molecule to the endoplasmic reticulum
membrane and C-terminal catalytic domain, which
contains the active sites and probably resides in the
cytosol where the sterol biosynthesis occurs. Further,
the 3-D structure generated shows the presence of a
substrate (HMG-CoA) binding domain and co-factor
(NADPH) binding domain. The fold of substrate
domain is unique and resembles a prism, with
28-residue helix forming the central core. The
homology model, thus generated in this study, could
aid in determining the mechanistic function of this
important class of proteins.
Acknowledgement
The authors are thankful to the Jamia Hamdard,
New Delhi, India, for providing the infrastructure and
financial assistance. We are also thankful to Dr P
Ananda Kumar, NRC on Plant Biotechnology, Indian
Agricultural Research Institute, New Delhi, India, for
providing laboratory facilities to clone the HMGR
gene from C. roseus cv. Albus.
10
11
12
13
14
15
16
References
1 Lange B M, Rujan T, Martin W & Croteau R, Isoprenoid
biosynthesis: The evolution of two ancient and distinct
pathways across genomes, Proc Natl Acad Sci USA, 97
(2000) 13172-1377.
2 Laule O, Furholz A, Chang H S, Zhu T, Wang X et al,
Crosstalk between cytosolic and plastidial pathways of
isoprenoid biosynthesis in Arabidopsis thaliana, Proc Natl
Acad Sci USA, 100 (2003) 6866-6871.
3 Schaller H, Grausem B, Benveniste P, Chye M L, Tan C T
et al, Expression of the Hevea brasiliensis (H.B.K.) Mull.
Arg. 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 in
tobacco results in sterol overproduction, Plant Physiol, 109
(1995) 761-770.
4 Chappell J, Wolf F, Proulx J, Cuellar R & Saunders C, Is the
reaction catalyzed by 3-hydroxy-3-methylglutaryl coenzyme
A reductase a rate-limiting step for isoprenoid biosynthesis in
plants? Plant Physiol, 109 (1995) 1337-1343.
5 Ram M, Khan M A, Jha P, Khan S, Kiran U et al, HMGCoA reductase limits artemisinin biosynthesis and
accumulation in Artemisia annua L. plants, Acta Physiol
Plant, 32 (2010) 859-866 (DOI: 10.1007/s11738-010-0470-5).
6 Cragg G M & Newman D J, Plants as a source of anti-cancer
agents. J Ethnopharmacol, 100 (2005) 72-79.
7 Srivastava V, Negi A S, Kumar J K, Gupta M M & Khanuja
S P S, Plant-based anticancer molecules: A chemical and
biological profile of some important leads, Bioorg Med
Chem, 13 (2005) 5892-5908.
8 Stern K R, Bidlack J, Jansky S & Stern K, Introductory plant
biology (McGraw-Hill Companies Inc, USA) 2000, 238-247.
9 Mujib A, Ilah A, Gandotra N & Abdin M Z, In vitro
application to improve alkaloid yield in Catharanthus
roseus, in Biotechnology and genetic engineering,
vol IV: Recent progress in medicinal plants, edited by J N
17
18
19
20
21
22
23
24
25
21
Govil, P Ananda Kumar & V K Singh (Sci Tech Publishers,
Houston, USA) 2003, 415-440.
Mukherjee A K, Basu S, Sarkar N & Ghosh A C, Advances
in cancer therapy with plant based natural products, Curr
Med Chem, 8 (2001) 1467-1486.
Ayora-Talavera T, Chappell J, Lozoya-Gloria E & LoyolaVargas V M, Overexpression in Catharanthus roseus hairy
roots of a truncated hamster 3-hydroxy-3-methylglutarylCoA reductase gene, Appl Biochem Biotechnol, 97 (2002)
135-145.
Park H, Denbow C J & Cramer C L, Structure and nucleotide
sequence of tomato HMG2 encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase, Plant Mol Biol, 20 (1992)
327-331.
Choi D, Ward B L & Bostock R M, Differential induction
and suppression of potato 3-methylglutaryl coenzyme A
reductase genes in response to Phytophthora infestans and to
its elicitor arachidonic acid, Plant Cell, 4 (1992) 1333-1344.
Stermer B A, Bianchini G M & Korth K L, Regulation of
HMG Co A reductase activity in plants, J Lipid Res, 35
(1994) 1133-1140.
Ferreret A, Aparicio A, Nogués N, Wettstein A, Bach T J
et al, Expression of catalytically active radish 3-hydroxy-3methylglutaryl coenzyme A reductase in Escherichia coli,
FEBS Lett, 266 (1990) 67-71.
Enjuto M, Balcells L, Campos N, Caelles C, Arro M et al,
Arabidopsis thaliana contains two differentially expressed 3hydroxy-3-methylglutaryl-CoA reductase genes, which
encode microsomal forms of the enzyme, Pro Natl Acad Sci
USA, 91 (1994) 927-931.
Genschik P, Criqui M C, Parmentier Y, Marbach J, Durr A
et al, Isolation and characterization of a cDNA encoding a
3-hydroxy-3-methylglutary coenzyme A reductase from
Nicotiana sytvestris, Plant Mol Biol, 20 (1992) 337-341.
Maldonado-Mendoza I E, Burnett R J & Nessler C L,
Nucleotide sequence of a cDNA encoding 3-hydroxy-3methylglutaryl coenzyme A reductase from Catharanthus
roseus, Plant Physiol, 100 (1992) 1613-1614.
Aoyagi K, Beyou A, Moon K, Fang L & Urich T, Isolation
and charactrization of cDNAs encoding wheat 3-hudroxy-3methylglutarul coenzyme A reductase, Plant Physiol, 102
(1993) 623-628.
Chye M L, Kush A, Tan C T & Chua N H, Characterization
of cDNA and genomic clones encoding 3-hydroxy-3methylgutaryl-coenzyme A reductase in Hevea brasiliensis,
Plant Mol Biol, 16 (1991) 567-577.
Doyle J J & Doyle J I, Isolation of plant DNA from fresh
tissue, Focus, 12 (1990) 13-15.
Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins M
R et al, Protein identification and analysis tools on the
ExPASy Server, in The proteomics protocols handbook,
edited by John M Walker (Humana Press Inc., New Jersey,
USA) 2005, 571-607.
Chen C C, Hwang J K & Yang J M, (PS)2: Protein structure
prediction server, Nucleic Acids Res, 34 (2006) W152-W157.
Laskowski R A, MacArthur M W, Moss D S & Thornton J
M, PROCHECK: A program to check the stereo chemical
quality of protein structures, J Appl Crystallogr, 26 (1993)
283-291.
Ramachandran G N & Sasisekharan V, Conformation
of polypeptides and proteins, Adv Protein Chem, 23 (1968)
283-438.
22
INDIAN J BIOTECHNOL, JANUARY 2012
26 Connolly J D & Hill R A, Dictionary of terpenoids
(Chapman and Hall, New York, USA) (1992)
27 Narita J O & Gruissem W, Tomato hydroxymethylglutarylCoA reductase is required early in fruit development but not
during ripening, Plant Cell, 1 (1989) 181-190.
28 Bach T J, Hydroxymethylglutaryl-coenzyme A reductase, a
key enzyme in photosterol synthesis, Lipids, 21 (1986) 82-88.
29 Gondet L, Weber T, Maillot-Vernior P, Benveniste P & Bach
T J, Regulatory role of microsomal 3-hydroxy-3methylglutary coenzyme A reductase in tobacco mutant that
over produces sterols, Biochem Biophys Res Commun, 186
(1992) 888-893.
30 Bochar D A, Freisen J A, Stauffacher C V & Rodwell V W,
Biosynthesis of mevalonic acid from acetyl-CoA, in
Comprehensive natural products chemistry, vol 2:
Isoprenoids including carotenoids and steroids, edited by
D Barton & K Nakanishi (Elsevier Science Ltd., London)
1999, 15-44.
31 Istvan E S, Palnitkar M, Buchanan S K & Deisenhofer J,
Crystal structure of the catalytic portion of human HMGCoA reductase: Insights into regulation of activity and
catalysis, EMBO J, 19 (2000) 819-830.
32 Frimpong K & Rodwell V W, Catalysis by Syrian hamster 3hydroxy-3-methylglutaryl-coenzyme A reductase. Proposed
roles of histidine 865, glutamate 558, and aspartate 766,
J Biol Chem, 269 (1994) 11478-11483.
33 Wang Y, Darnay B G & Rodwell V W, Identification of the
principal catalytically important acidic residue of 3-hydroxy3-methylglutaryl coenzyme A reductase, J Biol Chem, 265
(1990) 21634-21641.
34 Tabernero L, Bochar D A, Rodwell V W & Stauffacher C V,
Substrate-induced closure of the flap domain in the ternary
complex structures provides insights into the mechanism of
catalysis by 3-hydroxy-3-methylglutaryl-CoA reductase,
Proc Natl Acad Sci USA, 96 (1999) 7167-7171.
35 Goldstein J L & Brown M S, Regulation of the mevalonate
pathway, Nature (Lond), 343 (1990) 425-430.
36 Hampton R, Dimstor-Denmk D & Rine J, The biology of
HMG-CoA reductase: The pros of contra regulation, Trends
Biol Sci, 21 (1996) 140-145.
37 Hardie D G, Carling D & Sim A T R, The AMP-activated
protein kinase: A multisubstrate regulator of lipid
metabolism, Trends Biochem Sci, 14 (1989) 20-23.