Police seek suspect CASE: Police released surveillance image of the suspect. Police are looking for a people who robbed a convenience laboratory while wearing mask early Sunday morning. He killed a medical student who was shot multiple times in the face and back. A police press release did not specify the weapons used. Police described the suspect as a male in his early 20s standing perhaps 6 feet tall with a slim build and light complexion who wore a mask, gray jeans and black hooded shirt. "These animals need to be taken off the streets and hanged," sad the security guard who found the body. The incident, which happened a week after a schoolgirl was abducted, murdered and her body dumped on a roadside has drawn widespread condemnation. Investigators took blood samples from 5 suspects. MISSION: Your task is to investigate the new crime scene and to compare the samples with the other ones. „People lie but evidence doesn’t lie” Types of evidences: - indirect (e.g. photo) - direct (e.g. hair) - „cold evidence” (hair, textile) - „hot evidence” (DNA) Practical tasks: 0. Sample collection on the crime scene 1. DNA extraction 2. DNA amplification (PCR) 3. DNA staining (gel electrophoresis) 4. Analysis of samples 1. task: DNA preparation from lymphocytes • • • • • • • • • • • • sample: blood on a piece of textile - cut a half blood patch out and take it in the Eppendorf-tube add 1000 ul sterile water to the prepared sample vortex incubation at room temperature for a few minutes vortex spin with 1500 rpm at 2 min pipette out 950 ul add 150 ul of 1% Chelex solution + 50 ul ProtK enzyme to the textile sample incubate the tube in your hand for a few minutes vortex 65 Co 2 minutes, ProtK inactivated store on ice ORGANIC SDS, DTT, EDTA and Blood stain proteinase K DNA-extraction protocols Filter Paper CHELEX Blood stain Apply blood to paper and allow stain to dry Water INCUBATE (56 oC) PUNCH Centrifuge INCUBATE (ambient) Phenol, chloroform, isoamyl alcohol Centrifuge REMOVE supernatant VORTEX 5% Chelex Centrifuge TRANSFER aqueous (upper) phase to new tube REMOVE supernatant INCUBATE (56 oC) TE buffer WASH Multiple Times with extraction buffer PCR Reagents INCUBATE (100 oC) Centrifuge CONCENTRATE sample (Centricon/Microcon-100 or ethanol precipitation) Centrifuge QUANTITATE DNA QUANTITATE DNA PERFORM PCR PERFORM PCR Figure 3.1, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition © 2005 Elsevier Academic Press (NO DNA QUANTITATION TYPICALLY PERFORMED WITH UNIFORM SAMPLES) PERFORM PCR 2. PCR Add the following components to 5 ul DNA sample: • 31,5 ul of water • 5 ul PCR buffer mix (dNTP included) • primer 1 (forward) 2.5 ul • primer 2 (reverse) 2.5 ul • 2,5 ul MgCl2 finally: • 1 ul Ultra Fast DNA Polymerase (store on ice) RUN THE PCR REACTION. PCR Program: CSI 1. 95 Co 2 minutes 2. 95 Co 10 sec 3. 55 Co 15 sec 4. 72 Co 20 sec • 30x: step2-step4 • 1 min 72 Co • 4 Co (total time: ca. 30 min) PROBLEM 1. THE UPPER SEQUENCE IS WILD TYPE (+), THE LOWER IS MUTANT (-). FIND THE THE MUTATION WHAT TYPE OF MUTATION IS THIS? (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT.................. CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA..................... CTA GCG CCA TCC CTT CTA ACT THE UPPER SEQUENCE IS WILD TYPE (+), THE LOWER IS MUTANT (-). FIND THE THE MUTATION WHAT TYPE OF MUTATION IS THIS? MISSENSE POINT MUTATION (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT.................. CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA..................... CTA GCG CCA TCC CTT CTA ACT THE UPPER SEQUENCE IS WILD TYPE (+), THE LOWER IS MUTANT (-). FIND THE THE MUTATION WHAT TYPE OF MUTATION IS THIS? MISSENSE POINT MUTATION WHAT METHOD DO YOU KNOW FOR FINDING POINT MUTATIONS AND SINGLE NULEOTID POLYMORPHISMS? (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT.................. CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA..................... CTA GCG CCA TCC CTT CTA ACT THE UPPER SEQUENCE IS WILD TYPE (+), THE LOWER IS MUTANT (-). FIND THE THE MUTATION WHAT TYPE OF MUTATION IS THIS? MISSENSE POINT MUTATION WHAT METHOD DO YOU KNOW FOR FINDING POINT MUTATIONS AND SINGLE NULEOTID POLYMORPHISMS? AS-PCR (ALLELESPECIFIC) (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT.................. CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA..................... CTA GCG CCA TCC CTT CTA ACT THE UPPER SEQUENCE IS WILD TYPE (+), THE LOWER IS MUTANT (-). FIND THE THE MUTATION WHAT TYPE OF MUTATION IS THIS? MISSENSE POINT MUTATION WHAT METHOD DO YOU KNOW FOR FINDING POINT MUTATIONS AND SINGLE NULEOTID POLYMORPHISMS? AS-PCR (ALLELESPECIFIC) DESIGN PRIMERS FOR ALLELESPECIFIC AMPLIFICATION OF THE SEQUENCES BELOW (+) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT.................. CTA GCG CCA TCC CTT CTA ACT (-) CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA..................... CTA GCG CCA TCC CTT CTA ACT PRIMER ARRANGEMENT (+) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT GAT CGC GGT AGG GAA GAT TGA 5’ PRIMER SEQUENCES 5’ ATG CCG GGA TCG GTT CTT AAT 3’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ (+) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAT........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA3’ GAT CGC GGT AGG GAA GAT TGA 5’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ PCR PRODUCTS 5’ ATG CCG GGA TCG GTT CTT AAT 3’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ (+) 5’ ATG CCG GGA TCG GTT CTT AAT........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ TAC GGC CCT AGC CAA GAA TTA GAT CGC GGT AGG GAA GAT TGA 5’ (-) 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA........... CTA GCG CCA TCC CTT CTA ACT 3’ 3’ GGA CTG AAA TCG TAC GGC CCT AGC CAA GAA TTT 5’ CCT GAC TTT AGC ATG CCG GGA TCG GTT CTT AAA3’ GAT CGC GGT AGG GAA GAT TGA 5’ 5’ AGT TAG AAG GGA TGG CGC TAG 3’ GEL ELECTROPHORESIS OF THE PCR PRODUCTS +/+ -/- +/- Capillary electrophoresis of SNPs amplified with ASA (A) Sample 1 TT CT Sample 2 CC (B) CT CT TT CC TT (TTTTT)–primer1(chromosome 20)-ddT/ddT (TTTTT)–(TTTTT)-primer2(chromosome 6)-ddC/ddT (TTTTT)–(TTTTT)–(TTTTT)-primer3(chromosome 14)-ddC/ddT (TTTTT)–(TTTTT)–(TTTTT)–(TTTTT)-primer4(chromosome 1)-ddC/ddC Figure 8.2, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition © 2005 Elsevier Academic Press (A) Simultaneous amplification of three allels on a DNA template of homologous chromosomes Deletion of Locus B Locus C Locus A Locus A Locus C Locus B (B) Multiplex PCR products with size-based separation method in capillary electrophoresis: instead of bands: peaks are the PCR products (RFU) A B C How does the chromatogram appear? 10min 15 min small large 50 bp RFU: relative fluorescence unit t: time (t) 70 bp Modified Figure 4.3 J.M. Butler (2005) Forensic DNA Typing, 2nd Edition © 2005 Elsevier Academic Press PCR product size (bp) Figure A7.1, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition © 2005 Elsevier Academic Press (A) Direct comparison of STRs with related objects DNA profile from mass disaster victim DNA profile from direct reference (toothbrush believed to have belonged to the victim) D5S818 D7S820 D13S317 CSF1PO D16S539 Penta D (B) Indirect comparison: kinship analysis victim ? D5S818 D13S317 11,13 8,12 11,13 Predicted victim profile mass disaster victim profile wife son D7S820 D16S539 CSF1PO 8,12 8,9 10,12 8,10 wife 8,14 8,9 9,13 10,10 9,10 son 11,? or ?,13 ?,14 9,? ?,13 ?,10 9,? victim (father) 12,13 11,14 9,9 11,13 10,10 9,12 actual profile Figure 24.1, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition © 2005 Elsevier Academic Press Penta D 3. Gelelectrophoresis • add 5 ul PCR sample to the prepared 5 ul blue loading dye • load the entire sample (10 ul) into the GelRed stained agarose gel • run it for 30 min, with 100V PRACTICAL TASK: VNTR ANALYSIS AMPLIFICATION AND ANALYSIS OF THE ”FGA” VNTR LOCUS USED BY THE FBI. THE REPEATED SEQUENCE UNIT IS 4 bp LONG, ITS SEQUENCE IS: TTTC. THE NUMBER OF THE REPEATS IS 5-250, THE EXPECTED DNA FRAGMENTS ARE IN THE 60-1040 bp RANGE. DNA WAS ISOLATED FROM 5 MEMBERS OF the suspects. The PCR primers were designed to the flanking sequences at both sides of the repeats. 1 2 3 4 5 Primer P1: gctagtaacggcattaccag Primer P2: catcgcataagaatttcacg PRACTICAL TASK: VNTR ANALYSIS DETERMINE THE REPEAT NUMBERS IN THE AMPLIFIED VNTR ALLELES! 1 2 3 4 5 1900 770 620 760 340 360 336 340 420 340 270 272 180 152 140 120 100 90 THE NUMBER OF TANDEM REPEATS: 75 180 58 74 75 75 80 28 25 15 CALCULATION OF REPEAT NUMBERS: Subtract the lenght of the primers (40bp) from the size of the DNA fragments, divide the remaining by 4. Explain the basis of paternity testing! D1 = biological daughter of both parents D2 = child of mother & former husband S1 = couple’s biological son S2 = adopted son All humans have some VNTRs and VNTRs come from the genetic information donated by parents – can have VNTRs from mother, father or a combination – will not have a VNTR that is from neither parent PRACTICAL TASK 2. Evelyn and her daughter Jenna visits the forensic department. Evelyn would like to know who is the real father of Jenna. The possible fathers are all members of the rock band Happiness. You perform VNTR analysis and determine the identity of the father. Who is he? Why? Why VNTR locus B is peculiar? VNTR Evelyn Jenna James Lars Kirk Jason Chris A 7 & 8 2 & 7 3 & 7 2 & 7 2 & 8 3 & 7 3 & 2 B 4 & 5 6 & 4 7 6 4 6 C 11 & 8 11 & 9 9 & 10 13 & 8 10 9 & 12 9 & 13 D 7 & 19 21 & 7 21 & 7 7 & 9 21 & 7 15 & 8 21 & 15 E 10 & 6 12 & 6 6 & 9 12 & 9 17 & 10 6 & 12 17 & 12 4 PRACTICAL TASK 2. VNTR Evelyn Linda James Lars Kirk Jason Chris A 7 & 8 2 & 7 3 & 7 2 & 7 2 & 8 3 & 7 3 & 2 B 4 & 5 6 & 4 7 6 4 6 4 C 11 & 8 11 & 9 9 & 10 13 & 8 10 9 & 12 9 & 13 D 7 & 19 21 & 7 21 & 7 7 & 9 21 & 7 15 & 8 21 & 15 E 10 & 6 12 & 6 6 & 9 12 & 9 17 & 10 6 & 12 17 & 12 Evelyn and her daughter Jenna visits the forensic department. Evelyn would like to know who is the real father of Jenna. The possible fathers are all members of the rock band Happiness. You perform VNTR analysis and determine the identity of the father. Who is he? CHRIS Why? Why VNTR locus B is peculiar? X-LINKED SNP SNP Determine the putative eye and hair colour of the suspect, if the following SNPs are detected in the sample: Gene/SNP HAIR EYE Blue/green Brown Blond/red Brown AA/TT GG/CC AA/TT GG/CC AA/TT GG/CC HERC2 Rs12913832 GG/CC Oca2 rs1800407 AA/TT Tyr Rs1393350 AA/TT GG/CC AA/TT GG/CC TT/AA CC/GG TT/AA CC/GG GG/CC CC/GG GG/CC CC/GG AA/TT CC/GG AA/TT CC/GG IRF4 rs12203592 SLC24A5 rrs16891982 ExoC2 rs49592270 The HIrisPlex system for simultaneous prediction of hair and eye colour from DNA Forensic Science International: Genetics Volume 7, Issue 1, January 2013, Pages 98–115 IrisPlex: A Sensitive DNA Tool for Accurate Prediction of Blue and Brown Eye Colour in the Absence of Ancestry Information Journal: Results of sequencing: Rs12913832: Rs1800407: Rs1393350: Rs12203592: Rrs16891982: Rs49592270: AA GG GG CT CC AC Compare the reference samples with the amplified samples and determine the number of repeats in the amplified samples. Reference Gel suspects 1 2 3 victim marker 1900 620 272 336 340 152 360 420 340 270 180 120 140 100 90 1 2 3 Who is probably the perpetrator? Reference Gel suspects 1 2 victim 3 marker 360 500 340 336 272 250 152 120 100 100
© Copyright 2024 Paperzz