doi:10.1006/jmbi.2001.4892 available online at http://www.idealibrary.com on
J. Mol. Biol. (2001) 311, 503±514
DNA Cleavage Reactions by Type II Restriction
Enzymes that Require Two Copies of their
Recognition Sites
Michelle L. Embleton1, Virginijus Siksnys2 and Stephen E. Halford1*
1
Department of Biochemistry
University of Bristol, Bristol
BS8 1TD, UK
2
Institute for Biotechnology
Graiciuno 8, Vilnius
2028, Lithuania
Several type II restriction endonucleases interact with two copies of their
target sequence before they cleave DNA. Three such enzymes, NgoMIV,
Cfr10I and NaeI, were tested on plasmids with one or two copies of their
recognition sites, and on catenanes containing two interlinked rings of
DNA with one site in each ring. The enzymes showed distinct patterns
of behaviour. NgoMIV and NaeI cleaved the plasmid with two sites faster
than that with one site and the catenanes at an intermediate rate, while
Cfr10I gave similar steady-state rates on all three substrates. Both Cfr10I
and NgoMIV converted the majority of the substrates with two sites
directly to the products cut at both sites, while NaeI cleaved just one site
at a time. All three enzymes thus synapse two DNA sites through threedimensional space before cleaving DNA. With Cfr10I and NgoMIV, both
sites are cleaved in one turnover, in a manner consistent with their tetrameric structures, while the cleavage of a single site by NaeI indicates that
the second site acts not as a substrate but as an activator, as reported
previously. The complexes spanning two sites have longer lifetimes on
catenanes with one site in each ring than on circular DNA with two sites,
which indicates that the catenanes have more freedom for site juxtaposition than plasmids with sites in cis.
# 2001 Academic Press
*Corresponding author
Keywords: DNA communication; restriction endonuclease; Cfr10I; NaeI;
NgoMIV
Introduction
Type II restriction endonucleases cleave DNA at
speci®c sequences, usually palindromes 4-8 bp
long, in reactions that require Mg2‡ as a cofactor.1
The orthodox type II enzymes, such as EcoRV and
BamHI, are dimeric proteins that interact symmetrically with their palindromic targets, so that one
active site in the dimer is positioned to cleave a
speci®ed phosphodiester bond in one strand of the
DNA and the other active site the equivalent bond
in the complementary strand.2 The orthodox
enzymes catalyse independent reactions at each
target site in the DNA, though sometimes they act
Abbreviations used: SC, supercoiled; OC, open circle;
FLL, full-length linear; LL, linear form of the large ring;
CL, circular form of total large ring; LS, linear form of
the small ring; CS, circular form of the small ring; K1/2,
substrate concentration that gives half maximal reaction
velocity.
E-mail address of the corresponding author:
[email protected]
0022-2836/01/030503±12 $35.00/0
processively and cleave two or more sites during a
single DNA-binding event; ®rst cutting one site
and then translocating to another site before
departing from the DNA molecule.3,4 However, a
number of restriction enzymes cleave DNA only
after interacting with two copies of their recognition sequence at the same time;5,6 for example,
Cfr10I, NgoMIV and NaeI. Crystal structures have
been determined for Cfr10I and NaeI in the absence
of DNA, and for NgoMIV bound to DNA.7 ± 10
NgoMIV and Cfr10I belong to a subset of restriction endonucleases, called the type IIf enzymes,
that was initially represented by S®I.11 Like S®I,12,13
Cfr10I and NgoMIV are tetramers of identical subunits with two DNA-binding surfaces on the opposite sides of the protein, each made from two
subunits.8,10 S®I is inactive unless both surfaces are
®lled with cognate DNA.14 Proteins that interact
with two DNA sites prefer sites in cis, in the same
molecule of DNA, over sites in trans, in separate
molecules, because the effective concentration of
one site in the vicinity of another is higher when
both sites are in the same chain than when the
# 2001 Academic Press
504
sites are in separate chains.15 ± 17 S®I conforms to
this pattern and generally cleaves plasmids with
two S®I sites more rapidly than plasmids with one
site.11,18 Moreover, it usually cleaves plasmids with
two S®I sites straight to the ®nal products cut at
both sites; only a small fraction of the DNA cut at
one site is liberated during the reaction. However,
the difference in cleavage rates on plasmids with
one or two sites varies with reaction conditions.19
The complex of S®I with two sites in cis is more
stable than that with sites in trans,13 but at low
ionic strength the trans complex is still formed
readily enough to give the same rate of DNA cleavage as the cis complex. At high ionic strength,
only the cis complex is formed in suf®cient yield to
give the maximal rate of substrate utilisation and a
lower rate is observed for the reaction in trans, but
at high ionic strength, a larger fraction of the twosite DNA is liberated from the enzyme after cutting
one site than is the case at low ionic strength.19
NaeI, along with EcoRII, exempli®es another subset of restriction enzymes that need two copies of
their recognition sites, the type IIe enzymes.5 Both
EcoRII and NaeI fail to cleave DNA substrates in
which their recognition sites occur infrequently,
but they can be activated to cleave these substrates
by the addition of a second DNA that has the
requisite recognition sequence.20-22 Duplex oligonucleotides with the recognition sequence for NaeI
can, depending on the ¯anking sequence, be susceptible substrates for DNA cleavage and poor
activators, or poor substrates and effective activators, or effective in both respects.23 The activation
of the type IIe enzymes thus seems to require the
binding of cognate DNA to a site that is distinct
from the catalytic site.24,25 In contrast to the tetrameric type IIf enzymes,8,10,11 NaeI and EcoRII are
dimers of identical subunits.26,27 The crystal structure of NaeI shows that its subunit interface has
two clefts with the potential for binding DNA: the
N-terminal cleft is similar to the active-site cleft in
the orthodox type II enzyme EcoRV, whereas the
C-terminal cleft resembles the active site of a type I
topoisomerase.9 A single amino acid substitution
in NaeI can generate a protein with no nuclease
activity but which functions as a type I topoisomerase on DNA with NaeI sites.28
In one scheme for interactions with two DNA
sites, the protein binds ®rst to one site and then
tracks along the DNA until it reaches the second
site, by a 1D process following the DNA contour.
If the protein remains bound to the initial site, the
adjacent DNA is pulled into a loop. The type I and
type III restriction enzymes operate by this
scheme.29 In another scheme, the conformational
¯exibility of DNA leads to the juxtaposition of the
sites in 3D space, which then allows the protein to
bind to both sites and to trap the intervening DNA
in a loop. Loops have been detected by electron
microscopy on the binding of Cfr10I or NaeI to
DNA with two or more copies of their recognition
sites,8,30 but this technique cannot reveal whether
the loops originate from a 1D process, as with type
Restriction Cleavage at Two DNA Sites
I restriction enzymes,31 or a 3D process. However,
1D and 3D schemes can be distinguished by using
catenanes containing two interlinked rings of DNA
with one target site in each ring.15 The sites on the
separate rings cannot be connected by a 1D process
that starts from one site and then progresses along
the DNA contour,32 but the interlinking of the
rings holds the sites in proximity to each other and
thus facilitates their juxtaposition in 3D space. Suitable catenanes can be constructed from plasmids
that have two target sites for the enzyme under
examination interspersed with two directlyrepeated res sites for site-speci®c recombination by
a resolvase from the Tn3 family of transposons.
The resolvase converts the plasmid into a singly
interlinked catenane with one target site in each
ring.33 When this strategy was applied to S®I, the
catenane with a S®I site in each ring was cleaved
faster than the uncatenated circles of DNA and
almost as rapidly as the parental plasmid with two
sites in cis.18 Hence, S®I interacts with two recognition sites through 3D space.
Here, the reactions of NgoMIV, Cfr10I and NaeI
were studied on plasmids with either one or two
copies of their respective recognition sites and on
catenanes with one site in each ring. To date, kinetic studies on the type IIe enzymes, NaeI and
EcoRII, have focused primarily on their reactions in
trans, using substrates with a single site in the presence of an activator DNA.22,23 Reactions of Cfr10I
and NgoMIV on one-site and two-site plasmids
have been described, but only under single-turnover conditions with the enzyme in excess of the
DNA.8,10 In a single turnover, the cleaved DNA
observed during the reaction may still be bound to
the enzyme or it may have been liberated from the
enzyme. To identify the form of the DNA released
at the end of each turnover, the reactions were carried out here under steady-state conditions, with
the enzyme at lower concentrations than the substrate so that only a small fraction of the DNA is
enzyme-bound. In the accompanying paper,34 the
DNA looping interactions of these enzymes are
compared to those with S®I.
Results and Discussion
Experimental strategy
The reaction pro®les of a type II restriction
enzyme on plasmids that have one or two copies
of the recognition site provide a diagnostic test for
the mode of action of the enzyme.35,36 On a plasmid with one target site, the enzyme will cleave
the supercoiled (SC) DNA at that site: ®rst in one
strand to yield the open-circle (OC) DNA; then in
the other strand to yield the full-length linear form
(FLL) of the DNA (Figure 1(a)). However, in many
cases, the rate for cutting the second strand is faster than the dissociation of the enzyme from the
DNA. The OC form then exists only as a transient
enzyme-bound intermediate and the ®rst product
liberated from the enzyme is FLL DNA.3,37,38 The
Restriction Cleavage at Two DNA Sites
Figure 1. Reaction schemes. Reactions of a type II
restriction enzyme at its recognition site(s) (noted by
hatch mark(s)) on duplex DNA (noted as parallel lines)
are depicted. (a) A supercoiled (SC) circle of DNA with
one site is cleaved at the recognition site, ®rst in one
strand to open-circle (OC) DNA (which may exist only
as an enzyme-bound intermediate), and then in the
second strand to full-length linear (FLL) DNA. (b) A SC
DNA with two sites is cleaved ®rst at one site to FLL
DNA and then in a separate reaction at the other site to
two linear products (L1 and L2); in an alternative pathway (curved arrow), the SC DNA is cleaved concertedly
at both sites to yield directly L1 and L2. (c) A catenane
(Cat) containing two rings of unequal size, with a site in
each ring, is cleaved ®rst at a site in one ring, to give
either LL and CS or LS and CL, and then in a separate
reaction at the site in the intact ring, to convert either CS
to LS or CL to LL; in an alternative pathway (curved
arrow), Cat is cleaved concertedly at both sites to yield
directly LL and LS.
OC form accumulates during a steady-state reaction only if the enzyme dissociates from the DNA
before cutting the second strand.
A plasmid with two target sites will be cleaved
by an orthodox type II enzyme ®rst at one site to
yield, via an OC intermediate, FLL DNA and then,
in a separate reaction at the second site, the two
®nal products, L1 and L2 (Figure 1(b)). If each site
is cut at the same rate, then during the course of a
steady-state reaction, the amount of FLL DNA will
rise to a maximum of 40 % of the total DNA before
declining to zero.35 A peak in the yield of FLL
DNA at <40 % may be due to processive action by
an orthodox enzyme that ®rst cuts one site and
then proceeds to the other site by an intramolecu-
505
lar pathway.4 Alternatively, concerted action by a
type IIf restriction enzyme can convert a substrate
with two sites directly to the products cut at both
sites.11,12 The latter mechanism may, but not
always,19 result in a faster rate of utilisation of the
two-site substrate than the one-site substrate, while
processive action by an orthodox enzyme will give
the same rate of substrate utilisation on the
one-site and the two-site DNA. These schemes can
be distinguished with catenated substrates
(Figure 1(c)).18 A catenane containing two rings of
unequal size, with one target site in each ring, will
be cleaved by an orthodox enzyme ®rst in one
ring, to yield as initial products equal amounts of
the linear form of the large ring (LL) and the circular form of the small ring (CS), and vice versa (LS
and CL); and then in the remaining ring, converting CS and CL to the corresponding linear species.
In contrast, the initial products from concerted
action at two DNA sites will be the linear forms,
LS and LL. The degree of concertedness, the fraction of turnovers in which both sites are cleaved
relative to those in which only one site is cleaved,
can be evaluated from the difference between the
initial rates for forming the linear and the circular
products. In theory, diminished yields of the two
circular products from the catenane could arise
from processivity. During the processive cleavage
of two sites by EcoRV, the transfer from one site to
the other occurs through 3D space rather than
along the 1D DNA contour.4 Nevertheless, since
the ef®ciency of transfer varies inversely with the
separation of the sites in 3D space, processivity
will be inef®cient on a catenane: the mean distance
between sites in the separate rings of a catenane is
longer than that between sites in the same ring.39
This study required plasmids with one and with
two recognition sites for NgoMIV, Cfr10I and NaeI,
and which could be converted to catenanes. NgoMIV and NaeI have the same recognition sequence,
GCCGGC, though they cleave it at different positions: NgoMIV between the ®rst and second bases;
NaeI between the third and fourth.1 Cfr10I recognises the degenerate sequence, RCCGGY (where R
is either G or A and Y either C or T), and cleaves it
between the ®rst and second bases.40 Cfr10I sites
can thus be coincident to or distinct from NgoMIV/NaeI sites; the coincident sites are those
where the R is a G and the Y a C. Suitable plasmids were constructed from pMDS2a,18 a derivative of pUC19 carrying two res sites from Tn21 in
directly repeated orientation but also two NgoMIV/NaeI/Cfr10I sites in one of the DNA segments between the res sites and a further Cfr10I
site, with the sequence ACCGGT, in the other segment (Figure 2). The ®rst construct, pMLE1, has
only the latter Cfr10I site and no NgoMIV/NaeI
site. The second, pMLE2, has this Cfr10I site and a
second Cfr10I site, with the GCCGGC sequence
that also constitutes the NgoMIV/NaeI site, in the
opposite segment between the res sites. The third,
pMLE3, has two copies of the latter sequence, one
in each segment. In pMLE2 and pMLE3, the Tn21
506
Restriction Cleavage at Two DNA Sites
larger circle (3145 bp in 2Cat, 3171 bp in 3Cat) that
also has one copy of the requisite target site.
In the experiments described below, the substrates for Cfr10I were pMLE1 and pMLE2 as
plasmids with one or two recognition sites, respectively, and 2Cat as the catenane with one site in
each ring. The equivalent substrates for NgoMIV
and NaeI were pMLE2, pMLE3 and 3Cat. The substrates for Cfr10I incorporate alternative versions of
its degenerate recognition sequence ¯anked by dissimilar sequences, and thus necessitate communications between different rather than identical
sites. (The variations at the degenerate positions
have only two- to threefold effects on Cfr10I
activity; V.S., unpublished results.) However, as
the ¯anking sequence around an NaeI site determines whether the site acts as a substrate or an
activator for DNA cleavage, the NaeI/NgoMIV
sites had identical ¯anking sequences for 54 bp
either side of the site. The ¯anking sequences chosen (duplexes B and C, see Materials and Methods)
should result in NaeI sites that are effective as both
substrates and activators.23 In pMLE2, the two
Cfr10I sites are separated by 1848 (or 1931) bp,
while the two NaeI/NgoMIV sites in pMLE3 are
separated by 968 (or 2837) bp. This difference is
not signi®cant. Monte-Carlo and Brownian
dynamic simulations of supercoiled DNA indicate
that both the rate and the probability of site juxtaposition are virtually unaltered as the length of
DNA between the sites is increased from one-®fth
to one-half of the overall length of the DNA.41,42
The experiments in the accompanying paper show
that, on supercoiled DNA, the equilibrium constants for looping by S®I vary little with the length
of DNA between the sites.34
Figure 2. Construction of plasmids. The plasmid
pMDS2a 18 has two Tn21 res sites in directly repeated
orientation, marked by grey arrowheads, and various
restriction sites at the positions shown (sequence numbering follows that for its precursor, pUC19). A linear
DNA was generated from pMDS2a by reverse PCR; the
primers, denoted by half arrows, anneal to pMDS2a at
the positions shown, within the short arc between the
res sites, and initiate DNA synthesis in the direction
indicated. The PCR product was ligated to duplex A
(which carries a ClaI site) prior to re-circularisation to
yield pMLE1. A ClaI digest of pMLE1, followed by ligation to duplex B (which has the GCCGGC sequence for
NgoMIV, NaeI and Cfr10I) yielded pMLE2. An A¯III
digest of pMLE2, followed by ligation to duplex C
(which also has the GCCGGC sequence) yielded
pMLE3. All three constructs retain the two res sites from
pMDS2a. The sequences of duplexes A, B and C are
noted in Materials and Methods.
res sites are separated by 660 bp. Incubation of
these plasmids with Tn21 resolvase converted
>98 % of the SC DNA into catenanes (data not
shown). The catenanes, 2Cat from pMLE2 and
3Cat from pMLE3, contain a small circle (660 bp)
with one copy of the target site interlinked to a
NgoMIV reactions
The reactions of the NgoMIV endonuclease on
plasmids with one and with two NgoMIV sites,
and on the catenane with one site in each ring,
were studied under steady-state conditions, with
the tetrameric form of the enzyme at a 20-fold
lower concentration than the DNA (Figure 3). For
each substrate, rates were measured from the
decline in the concentration of the substrate with
time and these rates were compared to that from
the reaction on the plasmid with one site (Table 1).
The steady-state rate for the utilisation of the plasmid with one site was slower than that for the
plasmid with two sites. These reactions also
showed that the product(s) liberated from the NgoMIV enzyme at the end of each turnover on the
plasmid with one site differ from those on the twosite plasmid. Its reaction on the SC plasmid with
one site liberated mainly OC DNA cut in just one
strand; only a small fraction of the DNA was cut
in both strands to give the FLL form (Figure 3(a)).
In contrast, the products liberated from NgoMIV
on the two-site plasmid were primarily (though
not exclusively) the linear species, L1 and L2, generated by cutting both strands at both sites
Restriction Cleavage at Two DNA Sites
Figure 3. NgoMIV reactions. The reactions at 37 C
contained 0.5 nM NgoMIV endonuclease and 10 nM 3Hlabelled DNA in 33 mM Tris-acetate (pH 7.9), 10 mM
magnesium acetate, 66 mM potassium acetate. For (a)
and (b), the DNA was pMLE2 (with one NgoMIV site)
and pMLE3 (with two NgoMIV sites), respectively. For
(c), the DNA was 3Cat (a catenane with one NgoMIV
site in each ring). Samples were removed from the reactions at timed intervals, mixed immediately with stopmix and then subjected to electrophoresis through agarose prior to determining the concentrations of the following forms of the DNA by scintillation counting. In
(a) and (b): (*) supercoiled substrate (SC); (*) open-circle DNA (OC); (~) full-length linear DNA (FLL); (~)
only in (b), total DNA in the products cut at both sites
507
(Figure 3(b)); substantially less of the DNA cut at
just one site, the FLL form, was produced during
the time-course than would have arisen if NgoMIV
had cleaved the two sites in separate turnovers
with equal velocities.
The catenated substrate, with one NgoMIV site
in each ring, was consumed at a rate between
those for the one-site and two-site plasmids
(Table 1) but the reaction on the catenane yielded
almost exclusively the linearised forms of both
rings, LL and LS; virtually none of either the large
(CL) or the small (CS) rings, that would have arisen
if NgoMIV had cut its recognition site in just one
ring, were released during the reaction
(Figure 3(c)). The fraction of turnovers of the NgoMIV enzyme that liberate, as an initial product, the
DNA cut at two recognition sites is thus higher on
the catenane than on the plasmid with two sites in
cis. It is therefore highly unlikely that the absence
of singly cut DNA from the catenane is due to a
processive mechanism involving the transfer of the
enzyme from one site to the other through 3D
space.
In the crystal structure of the NgoMIV-DNA
complex, the tetrameric protein is bound to two
segments of DNA.10 The steady-state kinetics of
NgoMIV suggest that the enzyme may have no
activity when bound to one copy of its recognition
sequence and that it has to bind to two sites before
cleaving DNA. If so, the slow cleavage of the DNA
with one NgoMIV site would be due to interactions
in trans, between sites in separate molecules of the
plasmid, which are intrinsically disfavoured to
interactions in cis.16 The lifetime of the complex
between NgoMIV and two DNA sites from separate DNA molecules is then too short to allow for
the cleavage of more than one phosphodiester
bond (Figure 3(a)). Its complex with two sites, on
either the same DNA molecule or on interlinked
circles of DNA, has a much longer lifetime, long
enough for the enzyme to often cleave four phosphodiester bonds before dissociating from the
DNA (Figure 3(b) and (c)). This scheme also
accounts for why the catenane is cleaved faster
than the one-site plasmid but not quite as fast as
the two-site plasmid (Table 1). The local concentration of one DNA site in the vicinity of another
will be higher for two sites in circular DNA molecules held together by catenation than for sites in
separate rings, but it will be higher still for two
sites in the same circle of DNA.39
On the other hand, the single-turnover reactions
of NgoMIV suggest that it has a low rather than
zero activity when bound to one recognition site.10
(L1, L2). In (c): (*) catenane substrate (Cat); (^) intact
large circle liberated from the catenane (CL); (}) intact
small circle from the catenane (CS); ( & ) linear form of
the large ring (LL); (&) linear form of the small ring
(LS). The three panels show representative data from
one set of parallel experiments.
508
Restriction Cleavage at Two DNA Sites
Table 1. Relative reaction velocities
Substrate
Enzyme
NgoMIV
Cfr10I
NaeI
One-site plasmid
ÿ1
1 (0.13 min )
1 (1.6 minÿ1)
1
Two-site plasmid
Catenane
6.6
1.1
50
3.5
0.95
30
Initial rates for substrate utilisation were measured from reactions of NgoMIV on pMLE2, pMLE3 and 3Cat (Figure 3), from the
reactions of Cfr10I on pMLE1, pMLE2 and 2Cat (Figure 4), and from the reactions of NaeI on pMLE2, pMLE3 and 3Cat (Figure 5).
In each case, the reaction velocities are cited relative to a value of 1 for the one-site plasmid. The values in parentheses for NgoMIV
and Cfr10I on the one-site plasmid note the absolute rates for these reaction in terms of mol. DNA consumed per mol. enzyme per
minute. An absolute rate cannot be given for NaeI, since its concentration was speci®ed in terms of units of activity.
With the enzyme at a 20-fold excess over the DNA,
it might seem more likely that the cleavage of a
one-site plasmid is due to NgoMIV tetramers
bound to solitary sites than to tetramers spanning
two sites. But if this was the case, then a 20-fold
excess of enzyme over the two-site substrate
should again result in a tetramer at each site and
thus a cleavage rate that is only twice as fast as
that for the one-site substrate. Yet the single-turnover reactions of NgoMIV gave more than tenfold
faster rates for product formation from a two-site
plasmid than a one-site plasmid. On the other
hand, if the tetramers of NgoMIV bound to each
site on a two-site substrate had no activity, then a
large excess of enzyme over the DNA should prohibit the cleavage reaction, as seen with S®I.14,18
The single-turnover and steady-state kinetics can,
however, be reconciled by proposing that NgoMIV
binds co-operatively to two copies of its recognition site, so that the doubly bound enzyme is
favoured over the singly bound species even with
a large excess of enzyme over DNA. Co-operative
binding to two DNA sites occurs with the S®I
endonuclease,13,14 but just a tenfold excess of
enzyme over DNA is suf®cient to favour the singly
bound species over the doubly bound.18,34 The
degree of co-operativity would have to be higher
for NgoMIV than for S®I. Whether the NgoMIV tetramer bound to a single site has zero or low
activity cannot be distinguished at present.
Cfr10I reactions
Steady-state reactions with the Cfr10I endonuclease were carried out as above, on plasmids with
one and with two Cfr10I sites and on a catenane
with one site in each ring (Figure 4). In contrast to
NgoMIV (Figure 3), Cfr10I gave the same steadystate velocities, as measured from the decline in
the concentration of substrate with time, on all
three substrates (Table 1). However, the nature of
the products released at the end of each turnover
of Cfr10I were generally similar to those liberated
from NgoMIV. On the one-site plasmids, Cfr10I
acted in a more concerted fashion than NgoMIV.
While NgoMIV cleaved its one-site plasmid almost
exclusively in one strand per turnover (Figure 3(a)),
about half of the turnovers of Cfr10I on its one-site
plasmid yielded the OC DNA cut in one strand
and about half the FLL DNA cut in both strands.
On the two-site plasmids, Cfr10I acted much like
NgoMIV (Figure 3(b)), in converting the majority of
the DNA directly to the two ®nal products, L1 and
L2, with only a minor fraction being liberated after
cutting one site (Figure 4(b)). On the catenane,
Cfr10I behaved exactly like NgoMIV (Figure 3(c)),
in generating as initial products the linearised
forms of both rings to the virtual exclusion of
either ring in its circular form (Figure 4(c)).
One interpretation of the reaction pro®les of
Cfr10I on the one-site and the two-site plasmids
(Figure 4(a) and (b)) is that Cfr10I is an orthodox
restriction enzyme capable of cleaving DNA at
individual recognition sites, but which can act
processively on a DNA with two sites. This would
explain both its equal turnover rates on one-site
and two-site substrates, and the diminished yield
of the singly cut product from the two-site DNA.
However, the crystal structure of Cfr10I, showing a
tetramer with two DNA-binding clefts, and other
studies on this enzyme indicate that it can bind
simultaneously to two copies of its recognition
site.8 The accompanying paper provides further
evidence for Cfr10I looping out the DNA between
two recognition sites.34
In single-turnover reactions, Cfr10I cleaves a
plasmid with two sites more rapidly than DNA
with one site.8 The difference between the previous
single-turnovers and the current steady-state
experiments is not due to the different plasmids
used here compared to the previous studies (the
former have alternative versions of the degenerate
recognition sequence for Cfr10I), nor to any difference in reaction conditions. In exact repeats of the
experiments shown in Figure 4(a) and (b), except
with Cfr10I concentrations raised to equal the
DNA, the rate of utilisation of the two-site substrate was faster than that for the one-site plasmid
(data not shown). The single-turnover data thus
indicate that Cfr10I interacts with two copies of its
recognition site before cleaving DNA, preferably
with sites in cis.8 The apparent discrepancy
between identical steady-state rates and non-identical single-turnover rates on the one-site and twosite substrates is probably due to the rate-limiting
step in the turnover of Cfr10I being its dissociation
from the cleaved DNA, as is often the case with
restriction enzymes.3,12,37,38 The single-turnover
Restriction Cleavage at Two DNA Sites
Figure 4. Cfr10I reactions. The reactions at 37 C contained 0.5 nM Cfr10I endonuclease and 10 nM 3Hlabelled DNA in 10 mM Tris-HCl (pH 8.0), 10 mM
MgCl2, 100 mM NaCl, 0.02 % (v/v) Triton X-100. For (a)
and (b), the DNA was pMLE1 (with one Cfr10I site) and
pMLE2 (with two Cfr10I sites), respectively. For (c), the
DNA was 2Cat (a catenane with one Cfr10I site in each
ring). Samples were removed from the reactions at
timed intervals and analysed as in Figure 3 to determine
the concentrations of the following forms of the DNA.
In (a) and (b): (*) supercoiled substrate (SC); (*) opencircle DNA (OC); (~) full-length linear DNA (FLL); (~)
only in (b), total DNA in the products cut at both sites
(L1, L2). In (c): (*) catenane substrate (Cat); (^) intact
large circle liberated from the catenane (CL); (}) intact
509
rates may denote the rapid formation of the
enzyme-bound product(s) and the steady-state
rates the slow release of the product(s) from the
enzyme.
The reaction pro®le of Cfr10I on the catenane
(Figure 4(c)) show that this enzyme interacts with
two copies of its recognition site concurrently
rather than consecutively, and thus excludes the
possibility that Cfr10I is an orthodox type II
enzyme that acts processively on a DNA with two
sites. Despite showing the same turnover rate on
the catenane as the one-site plasmid, essentially all
of the reactions of Cfr10I on the catenane must
involve two sites, and these sites must be in the
interlinked rings of a single catenane. If Cfr10I had
cleaved the DNA after binding to a solitary site in
one ring, the initial products from its reaction on
the catenane would have been a mixture of linear
and circular species, either LS and CL or LL and CS
(Figure 1(c)). Alternatively, if Cfr10I had, for
example, bridged its sites in the small rings of two
separate molecules of the catenane, it would have
linearised the small rings of both catenanes and liberated two large rings. Yet Cfr10I released as free
circles virtually none of either the small or the
large rings during its reaction on the catenane
(Figure 4(c)).
The cleavage of the plasmid with one Cfr10I site
is thus most likely due to reactions in trans, involving two Cfr10I sites in separate molecules of the
plasmid. Reactions in trans are usually slower than
those in cis, but this will not always be so. If an
enzyme interacts with two DNA sites, it will have
a higher K1/2 (the substrate concentration that
gives one half of its maximal reaction velocity,
regardless of whether the velocities vary with substrate concentration in sigmoidal or hyperbolic
fashions) for DNA with one site than for DNA
with two sites. This is because the local concentration of one site in the vicinity of another will
always be lower for sites in trans compared to sites
in cis.17 However, if the reactions employ substrate
concentrations above the K1/2 for the one-site
DNA, the one-site and two-site substrates may be
cleaved at the same rate. For example, the S®I
endonuclease cleaves substrates with two S®I sites
more rapidly than substrates with one site in reactions containing 550 mM NaCl but in the absence
of NaCl, conditions that strengthen S®I binding to
its recognition site,13,14 it gives the same turnover
rates on one-site and two-site substrates.19 In their
respective reaction buffers (Figures 3 and 4), Cfr10I
behaves like S®I in the absence of NaCl while NgoMIV behaves like S®I in the presence of NaCl.
small circle from the catenane (CS); ( & ) linear form of
the large ring (LL); (&) linear form of the small ring
(LS). The three panels show representative data from
one set of parallel experiments.
510
Restriction Cleavage at Two DNA Sites
NaeI reactions
Figure 5. NaeI reactions. The reactions at 37 C contained 100 units/ml NaeI endonuclease and 10 nM 3Hlabelled DNA in 10 mM Tris-HCl (pH 7.0), 10 mM
MgCl2, 25 mM NaCl, 1 mM dithiothreitol. For (a) and
(b), the DNA was pMLE2 (with one NaeI site) and
pMLE3 (with two NaeI sites), respectively. For (c), the
DNA was 3Cat (a catenane with one NaeI site in each
ring). Samples were removed from the reactions at
timed intervals and analysed as in Figure 3 to determine
the concentrations of the following forms of the DNA.
In (a) and (b): (*) supercoiled substrate (SC); (*) opencircle DNA (OC); (~) full-length linear DNA (FLL); (~)
only in (b), total DNA in the products cut at both sites
(L1, L2). In (c): (*) catenane substrate (Cat); (^) intact
large circle liberated from the catenane (CL); (}) intact
Homogeneous samples of NgoMIV and Cfr10I
were used in the above studies at known molarities, so steady-state conditions ([E] < [S]) could be
established unambiguously. However, the following studies on NaeI used commercial preparations
whose concentrations were given in terms of units
of enzyme activity rather than molarity. When the
number of units of NaeI per millilitre of reaction
was either increased or decreased from that in
Figure 5, a corresponding increase or decrease in
reaction velocity was observed (data not shown).
Hence, the NaeI reactions described here were
probably with [E] < [S]: otherwise, it is unlikely
that the rates would have varied with the number
of units of NaeI.
Like NgoMIV but unlike Cfr10I, the rate of substrate utilisation by NaeI, as measured from the
decline in the concentration of the substrate with
time as opposed to the appearance of the end-products of the reaction, was slower on a plasmid
with one NaeI site than that on a plasmid with two
sites, while its rate of utilisation of a catenane with
one NaeI site in each ring was considerably faster
than the one-site plasmid but not quite as fast as
the two-site plasmid (Figure 5, Table 1). However,
the ratio of the rates on the one-site and two-site
plasmids was larger with NaeI than with NgoMIV,
50-fold instead of sixfold. In addition, the nature of
the products liberated at the end of each turnover
of NaeI differed from those with NgoMIV.
The initial product from the NaeI reaction on the
one-site plasmid was the FLL form cut in both
strands (Figure 5(a)), whereas NgoMIV had
released the OC form cut in just one strand
(Figure 3(a)). On the plasmid with two sites, NgoMIV had acted in a partially concerted manner at
the two sites, as evidenced by the liberation of less
of the FLL form than expected for an enzyme catalysing independent reactions at individual sites
(Figure 3(b)). In contrast, NaeI converted almost all
of this SC substrate ®rst to the FLL form cut at just
one site and only later was the FLL form cleaved
at its remaining site to yield the ®nal products, L1
and L2 (Figure 5(b)). The maximal level of FLL
DNA produced during the NaeI reaction on the
two-site plasmid is greater than that expected for
consecutive cleavages at equal rates.35 The SC substrate is thus converted to the FLL form at a faster
rate than that for FLL DNA to L1 and L2. This
could be due to NaeI preferring one site in pMLE3
over the other, even though the sites are ¯anked
by identical sequences (Figure 2). To examine this
possibility, a NaeI reaction on pMLE3 was stopped
at the time when the yield of FLL DNA was at its
small circle from the catenane (CS); ( & ) linear form of
the large ring (LL); (&) linear form of the small ring
(LS). The three panels show representative data from
one set of parallel experiments.
511
Restriction Cleavage at Two DNA Sites
maximum and the site of cleavage was mapped by
further restriction digests. No preference was
detected; about 50 % of the FLL form had been
produced by cutting the NaeI site at position 941
and 50 % at the site at position 1909 (data not
shown).
NgoMIV and NaeI also generated different products from the catenane with one NgoMIV/NaeI
site in each ring (Figures 3(c) and 5(c)). In the NaeI
reaction on the catenane, the yields of the two circular products (CL and CS) were similar to those
for the two linear species (LL and LS), whereas NgoMIV had liberated as initial products only the linear species, to the exclusion of the circular species.
Hence, NaeI cleaved most of the catenated DNA at
just one site: either the site in the large ring to produce LL and CS, or, with equal probability, the site
in the small ring to produce LS and CL. Only a
small fraction of the DNA was cleaved at both
sites, as judged from the difference in the initial
rates for forming the circular and linear products.
NaeI thus cleaves circular DNA with one copy of
its recognition site much more rapidly when two
such circles are held together in a catenane, yet its
principal product from the tethered circles is DNA
cleaved in just one circle.
While NaeI failed to cleave the circular products
from the catenane (Figure 5(c)), it cleaved, albeit
slowly, its remaining recognition site on the FLL
DNA from the plasmid with two NaeI sites
(Figure 5(b)). This can be explained by the fact that
reactions in trans, involving target sites in two separate molecules of DNA, occur less readily when
both DNAs are supercoiled than when either one
or both of the molecules are in their linear form.11
The reaction pro®les of NaeI noted here support
the previously proposed scheme for the mode of
action of the type IIe restriction enzymes: namely,
that these enzymes have to interact with two
copies of the relevant recognition sequence before
they can cleave DNA but that one site functions as
an activator for the DNA cleavage reaction at the
other site and is not itself cleaved.20-27 From the
crystal structure of NaeI,9 the cleavage of one site
presumably occurs in the DNA-binding cleft that
resembles EcoRV but this would seem to be inactive unless another copy of the recognition
sequence is bound in the cleft that resembles the
active site of a type I topoisomerase.
Conclusions
Enzymes acting at two sites
The reaction pro®les of the three enzymes examined here, NgoMIV, Cfr10I and NaeI, differ in terms
of their relative velocities on the three substrates
against which they were tested (Table 1), and/or
in terms of the reaction products that were liberated from the enzymes (Figures 3-5). Nevertheless,
a feature common to all three enzymes is that they
need to interact with two copies of their respective
recognition sites before displaying their optimal
DNA cleavage activities, and that their interactions
with two DNA sites occur through 3D space rather
than along the 1D DNA contour, the latter being
veri®ed by their reactions on the catenated substrates. However, the three distinct pro®les seem to
arise from two rather than three distinct mechanisms. Both Cfr10I and NgoMIV are tetrameric proteins, capable of binding two segments of DNA,8,10
that act similarly to S®I (see Figure 4(a) of the
accompanying paper34). Like S®I,11 ± 14 both Cfr10I
and NgoMIV cleave DNA with two sites that are
tethered to each other, either covalently in a twosite plasmid or topologically in a catenane, to liberate primarily the products cut in both strands at
both sites. On the other hand, NaeI clearly differs
from Cfr10I and NgoMIV. The products from the
NaeI reaction on the catenane (Figure 5(c)), and the
rate of this reaction compared to that on circular
DNA with one NaeI site (Table 1), show that, even
though NaeI has to interact with two sites before
cleaving DNA, it cleaves only one site per turnover.
In previous efforts to identify restriction
enzymes needing two copies of their recognition
sites,35,36 some enzymes were found to cleave plasmids with one or two copies of the relevant recognition sequence at the same rate but to give less of
the singly cut DNA from the two-site substrate
than expected for independent reactions at individual sites, in essentially the same manner as Cfr10I
on its one-site and two-site substrates (Figure 4(a)
and (b)): for example AscI and Tth111I. These
enzymes were thus considered to act processively
rather than showing concerted action at two sites
but they were not tested against catenated substrates, the strategy that revealed concerted action
by Cfr10I. Hence, the number of type II restriction
enzymes that need two sites for their DNA cleavage reactions may be higher than is currently
thought. Indeed, it has been shown recently that
Sau3AI, an enzyme previously considered to be an
orthodox type II enzyme, also requires two sites.43
Site-juxtaposition in catenanes
Both NgoMIV and NaeI cleaved the catenated
DNA more rapidly than the plasmid with one recognition site but not quite as fast as the plasmid
with two sites in cis. As noted above, this is as
expected: in a catenane with one site in each ring,
the local concentration of one site in the vicinity of
the other will be higher than that for sites in separate rings but not as high as that for two sites in the
same ring.39 Hence, the concurrent binding of an
enzyme to two DNA sites will occur more readily
on a plasmid with sites in cis than on a catenane
with a site in each ring. However, virtually all of
the catenane was cleaved by NgoMIV at both sites
before the enzyme dissociated from the DNA, but
a fraction of its reactions on the two-site plasmid
ended with its dissociation from the DNA
after cutting just one site. This implies12 that the
complex between NgoMIV and two recognition
512
sites has a shorter lifetime on the two-site plasmid
than on the catenane. Cfr10I, on the other hand,
gave the same steady-state rates on its one-site and
two-site plasmids, so the same velocity also pertained to the catenane. Yet Cfr10I again formed a
longer-lived complex with the catenane than with
its two-site plasmid, as judged from the fraction of
turnovers in which it cleaved all four of its target
phosphodiester bonds. A further factor, in addition
to the local concentration effect noted above, seems
to determine the stability of the bridging interaction between two DNA sites in one ring relative
to that between the rings of a catenane.
In a supercoiled DNA, the juxtaposition of two
well-separated sites occurs most often across the
axis of the superhelix: collisions between separate
segments of the superhelix are relatively rare.42
However, if a protein is to bind to two sites, both
sites need to position the appropriate face of the
DNA towards the protein, the major groove in the
case of NgoMIV,10 and the angle between the helical axes of the DNA at each site needs to match
that between the two DNA-binding sites in the
protein, 60 for NgoMIV.10 The angle between the
DNA segments bound to NgoMIV matches the preferred angle between the helical axes of the interwound segments in a highly supercoiled DNA.41
Nevertheless, the acquisition of this precise geometry between two sites located opposite each other
across the superhelix may require the distortion of
the local structure of the DNA into a strained con®guration. In contrast, each ring within a singly
interlinked catenane is free to move both along
and around the other ring (though this would be
less favourable in a multiply interlinked catenane).
It should then be possible to juxtapose the sites in
the requisite geometry for the bridging interaction
without distorting the DNA into a strained con®guration. This, in turn, could enhance the lifetime
of the bridging interaction between the sites in the
separate rings of a singly interlinked catenane relative to that in a single ring with two sites.
Given the scheme for DNA looping in the
accompanying paper,34 it seems that the rate constant for the breakdown of the complex spanning
the two sites (ku) is smaller for the catenane than
for the two-site plasmid, but that the equilibrium
constant for the bridging interaction (kl/ku, where
kl is the rate constant for forming the complex
across two sites) is also smaller with the catenane.
The rate constant for forming the looped complex
(kl) would thus have to be considerably higher
with the two-site plasmid than with the catenane,
but this is as expected, since it will be driven by
the local concentration effect noted above.
Materials and Methods
Proteins
The Cfr10I endonuclease was puri®ed to homogeneity,
and its concentration determined by measuring absorbance at 280 nm, as described.8 Similar procedures were
Restriction Cleavage at Two DNA Sites
used for the puri®cation of NgoMIV and for determining
its concentration (R. Skirgaila & V. S., unpublished
results). The molarities of Cfr10I and NgoMIV are given
for their tetrameric forms. Samples of NaeI endonuclease,
containing a known number of units of enzyme activity
(as speci®ed by the supplier), were purchased from New
England Biolabs: concentrations of NaeI are given here in
terms of units of enzyme activity/ml. The resolvase from
the transposon Tn21 was puri®ed as described and its
concentration recorded in terms of its dimeric state.44
Enzymes for other DNA manipulations were purchased
from commercial suppliers and used as advised.
DNA
The DNA manipulations shown in Figure 2 were carried out by standard procedures or minor modi®cations
thereof.45 The duplexes used in these manipulations
were made by heating equimolar amounts of two complementary oligodeoxriboynucleotides (from MWG Biotech Ltd., Milton Keynes) to 95 C followed by cooling
overnight to room temperature to give the following
duplexes:
Duplex A; ACTATCGATAGT
TGATAGCTATCA
Duplex B; CGTAAGTACTGGGCGCCGGCGTTGAT
ATTCATGACCCGCGGCCGCAACTAGC
Duplex C; CATGTCATATGGGGCGCCGGCGTTGA
AGTATACCCCGCGGCCGCAACTCATC
The ClaI site in duplex A and the NgoMIV/NaeI/Cfr10I
site in duplexes B and C are underlined. The validity of
each plasmid was con®rmed by DNA sequencing across
the relevant restriction sites (L. Hall, University of
Bristol). The monomeric forms of the plasmids pMLE1,
pMLE2 and pMLE3 were used to transform Escherichia
coli HB101.45 The transformants were grown in M9 minimal medium containing 37 MBq/l [methyl-3H]thymidine
and the plasmids puri®ed by CsCl density-gradient centrifugations in the presence of ethidium bromide.11,37
Typically, 85-95 % of the DNA in these preparations was
the supercoiled monomeric plasmid and 5-15 % either
the nicked or the dimeric form of the plasmid. DNA concentrations were determined by measuring absorbance at
260 nm.
To make the catenanes, 250-300 mg of pMLE2 (for
2Cat) or pMLE3 (for 3Cat) was incubated at 37 C with a
fourfold molar excess of Tn21 resolvase over resolvasebinding sites in the DNA (each res site has three binding
sites for the cognate resolvase44), in 500 ml of 10 mM
Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM potassium
glutamate, 5 mM b-mercaptoethanol. After four hours,
25 mg of proteinase K was added and the incubation continued for 25 minutes. The sample was then washed
with phenol/chloroform and the DNA precipitated with
ethanol. To determine the fraction of the DNA that had
undergone recombination by resolvase, aliquots from the
incubation were treated with BpmI, an enzyme that
cleaves 2Cat and 3Cat into fragments that differ from
those from the parental plasmids, pMLE2 and pMLE3,
respectively. The fragments originating from the catenanes were separated from those arising from the unrecombined plasmids, by electrophoresis through agarose,
and the concentrations of each were measured by scintillation counting.11,37 Essentially all (>98 %) of the supercoiled DNA in the plasmid preparations was converted
to catenane but resolvase has no activity on nicked
DNA. Hence, whenever the plasmid preparations contained >10 % nicked DNA, the covalently closed form of
513
Restriction Cleavage at Two DNA Sites
the catenane was puri®ed from the nicked form of the
unrecombined plasmid by density-gradient centrifugation.18
7.
Reactions
DNA cleavage reactions were carried out by adding
the restriction enzyme, diluted to give the requisite ®nal
concentration in the appropriate dilution buffer for the
enzyme in question, to 10 nM 3H-labelled DNA in, typically, 200 ml of reaction buffer at 37 C. The reaction buffers used for NgoMIV (Figure 3), Cfr10I (Figure 4) and
NaeI (Figure 5) are those commonly used for DNA cleavage reactions by these enzymes.1 An aliquot (20 ml) was
removed from the reaction mixture before the addition
of the enzyme, to act as the zero time-point. Further aliquots were removed at timed intervals after adding the
enzyme and immediately vortex mixed with 10 ml of
stop-mix (0.1 M EDTA, 0.1 M Tris-HCl (pH. 8.0), 40 %
(w/v) sucrose, 100 mg/ml bromophenol blue). The DNA
in the aliquots was analysed by electrophoresis through
agarose under conditions chosen for each substrate so as
to separate all of the cleavage products that could arise
from that substrate (Figure 1) from each other and from
the substrate itself. The electrophoretic mobilities of the
various linear and circular products from the catenated
substrates (Figure 1(c)) were established by using as
markers the DNA from restriction digests of the catenanes, with one enzyme that cleaves only the small ring
and another that cleaves only the large ring. The segments of agarose that encompassed each form of the
DNA at each time-point were excised from the gel, and
the level of radioactivity in each measured by scintillation counting.18,33 With catenated DNA, the segments
that included the intact catenane (two covalently closed
rings of DNA) and the nicked catenanes (in either the
large or the small ring) were counted together.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Acknowledgements
We thank Lucy Daniels, Niall Gormley, Susan Milsom,
Giedrius Sasnauskas, Remigijus Skirgaila and Mark
Szczelkun for aid and advice. This work was funded by
the Wellcome Trust and by the Biotechnology and Biological Sciences Research Council. V.S. is a Howard
Hughes Medical Institute International Research Scholar.
17.
18.
19.
References
1. Roberts, R. J. & Macelis, D. (2001). REBASE - restriction enzymes and methylases. Nucl. Acids Res. 29,
268-269.
2. Aggarwal, A. K. (1995). Structure and function of
restriction endonucleases. Curr. Opin. Struct. Biol. 5,
11-19.
3. Terry, B. J., Jack, W. E. & Modrich, P. (1987). Mechanism of speci®c site location and DNA cleavage by
EcoRI endonuclease. Gene Amplif. Anal. 5, 103-118.
4. Stanford, N. P., Szczelkun, M. D., Marko, J. F. &
Halford, S. E. (2000). One- and three-dimensional
pathways for proteins to reach speci®c DNA sites.
EMBO J. 19, 6546-6557.
5. Bickle, T. A. & KruÈger, D. H. (1993). Biology of
DNA restriction. Microbiol. Rev. 57, 434-450.
6. Halford, S. E., Bilcock, D. T., Stanford, N. P.,
Williams, S. A., Milsom, S. E., Gormley, N. A. et al.
20.
21.
22.
23.
(1999). Restriction endonuclease reactions requiring
two recognition sites. Biochem. Soc. Trans. 27, 696699.
Bozic, D., Grazulis, S., Siksnys, V. & Huber, R.
(1996). Crystal structure of Citrobacter freundii restricÊ resolution. J. Mol.
tion endonuclease Cfr10I at 2.15 A
Biol. 255, 176-186.
Siksnys, V., Skirgaila, R., Sasnauskas, G., Urbanke,
C., Cherny, D., Grazulis, S. et al. (1999). The Cfr10I
restriction enzyme is functional as a tetramer. J. Mol.
Biol. 291, 1105-1118.
Huai, Q., Colandene, J. T., Chen, Y., Luo, F., Zhao,
Y., Topal, M. D. & Ke, H. (2000). Crystal structure
of NaeI - an evolutionary bridge between DNA
endonucleases and topoisomerases. EMBO J. 19,
3110-3118.
Deibert, M., Grazulis, S., Sasnauskas, G., Siksnys, V.
& Huber, R. (2000). Structure of the tetrameric
restriction endonuclease NgoMIV in complex with
cleaved DNA. Nature Struct. Biol. 7, 792-799.
Wentzell, L. M., Nobbs, T. J. & Halford, S. E. (1995).
The S®I restriction endonuclease makes a 4-strand
DNA break at two copies of its recognition
sequence. J. Mol. Biol. 248, 581-595.
Nobbs, T. J., Szczelkun, M. D., Wentzell, L. M. &
Halford, S. E. (1998). DNA excision by the S®I
restriction endonuclease. J. Mol. Biol. 281, 419-432.
Watson, M. A., Gowers, D. M. & Halford, S. E.
(2000). Alternative geometries of DNA looping: an
analysis using the S®I endonuclease. J. Mol. Biol.
298, 461-475.
Embleton, M. L., Williams, S. A., Watson, M. A. &
Halford, S. E. (1999). Speci®city from the synapsis of
DNA elements by the S®I endonuclease. J. Mol. Biol.
289, 785-797.
Adzuma, K. & Mizuuchi, K. (1989). Interaction of
proteins located at a distance along DNA: mechanism of target immunity in the Mu DNA strandtransfer reaction. Cell, 57, 41-47.
Schleif, R. (1992). DNA looping. Annu. Rev. Biochem.
61, 199-223.
Rippe, K., von Hippel, P. H. & Langowski, J. (1995).
Action at a distance: DNA-looping and initiation of
transcription. Trends Biochem. Sci. 20, 500-506.
Szczelkun, M. D. & Halford, S. E. (1996). Recombination by resolvase to analyse DNA communications by the S®I restriction endonuclease. EMBO J.
15, 1460-1469.
Nobbs, T. J. & Halford, S. E. (1995). DNA cleavage
at two recognition sites by the S®I restriction endonuclease: salt dependence of cis and trans interactions between distant DNA sites. J. Mol. Biol. 252,
399-411.
KruÈger, D. H., Barcak, G. J., Reuter, M. & Smith,
H. O. (1988). EcoRII can be activated to cleave
refractory DNA recognition sites. Nucl. Acids Res.
16, 3997-4008.
Conrad, M. & Topal, M. D. (1989). DNA and
spermine provide a switch mechanism to regulate
the activity of restriction endonuclease NaeI. Proc.
Natl Acad. Sci. USA, 86, 9707-9711.
Gabbara, S. & Bhagwat, A. S. (1992). Interaction of
EcoRII endonuclease with DNA substrates containing single recognition sites. J. Biol. Chem. 267, 1862318630.
Yang, C. C. & Topal, M. D. (1992). Nonidentical
DNA-binding sites of endonuclease NaeI recognize
different families of sequences ¯anking the recognition site. Biochemistry, 31, 9657-9664.
514
Restriction Cleavage at Two DNA Sites
24. Pein, C.-D., Reuter, M., Meisel, A., Cech, D. &
KruÈger, D. H. (1991). Activation of restriction endonuclease EcoRII does not depend on the cleavage of
stimulator DNA. Nucl. Acids Res. 19, 5139-5142.
25. Conrad, M. & Topal, M. D. (1992). Modi®ed DNA
fragments activate NaeI cleavage of refractory sites.
Nucl. Acids Res. 20, 5127-5130.
26. Baxter, B. K. & Topal, M. D. (1993). Formation of a
cleavasome: enhancer DNA stabilizes an active conformation of NaeI dimer. Biochemistry, 32, 8291-8298.
27. Reuter, M., Kupper, D., Meisel, A., Schroeder, C. &
KruÈger, D. H. (1998). Cooperative binding properties
of restriction endonuclease EcoRII with DNA recognition sites. J. Biol. Chem. 273, 8294-8300.
28. Jo, K. & Topal, M. D. (1998). Step-wise DNA relaxation and decatenantion by NaeI-43 K. Nucl. Acids
Res. 26, 2380-2384.
29. Rao, D. N., Saha, S. & Krishnamurthy, V. (2000).
ATP-dependent restriction enzymes. Prog. Nucl.
Acids. Res. Mol. Biol. 64, 1-63.
30. Topal, M. D., Thresher, R. J., Conrad, M. & Grif®th,
J. (1991). NaeI endonuclease binding to pBR322
DNA induces looping. Biochemistry, 30, 2006-2010.
31. Yuan, R., Hamilton, D. L. & Burckhardt, J. (1980).
DNA translocation by the restriction enzyme from
E. coli K. Cell, 20, 237-244.
32. Szczelkun, M. D., Dillingham, M. S., Janscak, P.,
Firman, K. & Halford, S. E. (1996). Repercussions of
DNA tracking by the type IC restriction endonuclease EcoR124I on linear, circular and catenated
substrates. EMBO J. 15, 6335-6347.
33. Parker, C. N. & Halford, S. E. (1991). Dynamics of
long range interactions on DNA: the speed of
synapsis during site-speci®c recombination by resolvase. Cell, 66, 781-791.
34. Milsom, S. E., Halford, S. E., Embleton, M. L. &
Szczelkun, M. D. (2001). Analysis of DNA looping
by type II restriction enzymes that require two
copies of their recognition sites. J. Mol. Biol. 311,
515-527.
35. Bilcock, D. T., Daniels, L. E., Bath, A. J. & Halford,
S. E. (1999). Reactions of type II restriction endonucleases with 8-base pair recognition sites. J. Biol.
Chem. 274, 36379-36386.
36. Gormley, N. A., Bath, A. J. & Halford, S. E. (2000).
Reactions of BglI and other type II restriction endonucleases with discontinuous recognition sites. J. Biol.
Chem. 275, 6928-6936.
37. Erskine, S. G., Baldwin, G. S. & Halford, S. E.
(1997). Rapid reaction analysis of plasmid DNA
cleavage by the EcoRV restriction endonuclease.
Biochemistry, 36, 7567-7576.
38. Sasnauskas, G., Jeltsch, A., Pingoud, A. & Siksnys,
V. (1999). Plasmid DNA cleavage by MunI restriction enzyme: single-turnover and steady-state kinetic
analysis. Biochemistry, 38, 4028-4036.
39. Levene, S. D., Donahue, C., Boles, T. C. &
Cozzarelli, N. R. (1995). Analysis of the structure of
dimeric DNA catenanes by electron microscopy.
Biophys. J. 69, 1036-1045.
40. Janulaitis, A., Stakenas, P. S. & Berlin, Y. A. (1983).
A new site-speci®c endodeoxyribonuclease from
Citrobacter freundi. FEBS Letters, 161, 210-212.
41. Vologodskii, A. & Cozzarelli, N. R. (1996). Effect of
supercoiling on the juxtaposition and relative orientation of DNA sites. Biophys. J. 70, 2548-2556.
42. Huang, J., Schlick, T. & Vologodskii, A. (2001).
Dynamics of site juxtaposition in supercoiled DNA.
Proc. Natl Acad. Sci. USA, 98, 968-973.
43. Friedhoff, P., Lurz, R., LuÈder, G. & Pingoud, A.
(2001). Sau3AI - a monomeric type II restriction
endonuclease that dimerizes on DNA and thereby
induces DNA loops. J. Biol. Chem. 271, 23581-23588.
44. Ackroyd, A. J., Avila, P., Parker, C. N. & Halford,
S. E. (1990). Site-speci®c recombination by mutants
of Tn21 resolvase with DNA recognition functions
from Tn3 resolvase. J. Mol. Biol. 216, 633-643.
45. Sambrook, J. C., Fritsch, E. F. & Maniatis, T. (1989).
Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Edited by J. Karn
(Received 20 April 2001; received in revised form 29 June 2001; accepted 29 June 2001)