Calcif Tissue Int (2009) 84:138–145
DOI 10.1007/s00223-008-9202-x
The Schneiderian Membrane Contains Osteoprogenitor Cells:
In Vivo and In Vitro Study
S. Srouji Æ T. Kizhner Æ D. Ben David Æ M. Riminucci Æ
P. Bianco Æ E. Livne
Received: 15 September 2008 / Accepted: 17 November 2008 / Published online: 9 December 2008
Ó Springer Science+Business Media, LLC 2008
Abstract Recent studies successfully demonstrated
induction of new bone formation in the maxillary sinus by
mucosal membrane lifting without the use of any graft
material. The aim of this work was to test the osteogenic
potential of human maxillary sinus Schneiderian membrane (hMSSM) using both in vitro and in vivo assays.
Samples of hMSSM were used for establishment of cell
cultures and for histological studies. Flow cytometry
analysis was performed on P0, P1, and P2 cultures using
established mesenchymal progenitor cell markers (CD 105,
CD 146, CD 71, CD 73, CD 166), and the ability of
hMSSM cells to undergo osteogenic differentiation in
culture was analyzed using relevant in vitro assays. Results
showed that hMSSM cells could be induced to express
alkaline phosphatase, bone morphogenic protein-2, osteopontin, osteonectin, and osteocalcin and to mineralize their
extracellular matrix. Inherent osteogenic potential of
hMSSM-derived cells was further proven by in vivo
experiments, which demonstrated the formation of histology-proven bone at ectopic sites following transplantation
of hMSSM-derived cells in conjunction with an
S. Srouji (&) T. Kizhner D. Ben David E. Livne
Department of Anatomy and Cell Biology, Faculty of Medicine,
Technion – Israel Institute of Technology, P.O. Box 9649, Haifa
32000, Israel
e-mail: [email protected]
D. Ben David
e-mail: [email protected]
S. Srouji
Department of Oral & Maxillofacial Surgery, Carmel Medical
Center, Haifa 34354, Israel
M. Riminucci P. Bianco
Department of Experimental Medicine and Pathology,
La Sapienza University, Rome, Italy
123
osteoconductive scaffold. This study provides the biological background for understanding the observed clinical
phenomena in sinus lifting. Our results show that a genuine
osteogenic potential is associated with the hMSSM and can
contribute to development of successful sinus augmentation techniques.
Keywords Mesenchymal stem cells Bone histology
and histomorphometry Dental clinical studies Dental matrix biology Ectopic calcification
Inadequate alveolar bone in the maxilla is a common limitation for inserting dental implants in the posterior maxilla
[2, 11]. Several sinus augmentation techniques designed to
allow insertion of simultaneous or delayed dental implants
have been based on the insertion of different materials
between the host bone and the sinus membrane [7, 21, 22,
31] (Fig. 1). The osteoconductive activity of various bone
substitutes has been tested by the quality and quantity of
newly formed bone in the augmented area [1, 8, 10, 16, 19,
20, 23]. In addition, recent clinical studies have shown that
bone augmentation can be achieved by simply elevating the
maxillary Schneiderian sinus membrane (MSSM), without
any graft materials [14, 15, 26, 29]. Likewise, a few case
reports have described enhanced bone formation following
cyst and tooth removal from the maxillary sinus, again, in
the absence of any implanted osteoconductive material [24,
27]. Taken together, these studies suggest an inherent, latent
osteogenic activity of the Schneiderian membrane.
The cellular basis for this putative activity, however, is
unclear. Osteogenesis requires viable active osteoblasts
(bone forming cells), which are derived from mesenchymal
progenitors [4, 5]. Such progenitors are found in the bone
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
139
Fig. 1 Schematic presentation
and histological section of the
maxillary sinus Shneiderian
membrane (MSSM). a
Schematic representation
showing the pseudostratified
epithelium, lamina propria, and
periosteum-like components of
the MSSM. b Light microscope
micrograph of histological
paraffin section stained with
Masson’s Trichrome technique.
Note the blood vessels in the
lamina propria (arrows). Scale
bar = 200 lm
marrow stroma and periosteum, where they have been
extensively characterized, and possibly at other sites such
as adipose tissue and microvascular walls [4, 9, 13, 32].
Osteogenic progenitors from the bone marrow stroma
express markers including STRO-1, CD105, CD146, CD
166, CD 71, and CD 73 [6]. Their osteogenic potential can
be directly probed in vitro (through the demonstration of
expression of characteristic proteins of bone cells or bone
matrix, upon specific differentiation induction conditions).
However, direct demonstration of bone-forming capacity
in vivo represents the gold standard for identification of
osteoprogenitor cells. To obtain such evidence, cells isolated from the bone marrow stroma or periosteum need to
be grown in culture and then transplanted into ectopic sites
in immunocompromised animals, in conjunction with osteoconductive carriers [3].
The virtual lack of biological studies of the putative
osteogenic potential associated with the Schneiderian
membrane has shrouded the debate about its potential
significance in clinical application with uncertainty. Gruber
et al. [18] showed that cells derived from the porcine sinusassociated mucosa express STRO-1, a marker of osteoprogenitors, and respond to BMP-6 and BMP-7. However,
no study has demonstrated direct osteogenic capacity in
human MSSC (hMSSC) either in vitro or in vivo.
The present study investigates whether hMSSM contain
an osteogenic progenitor cell population capable of forming bone by utilizing in vitro and in vivo assays.
Materials and Methods
Samples of hMSSM were obtained according to ethical
guidelines of the Carmel Medical Center, Haifa, Israel. The
samples were obtained with informed consent from
patients, aged 18–25 (n = 5), who suffered from posterior
or total maxillary excess undergoing posterior or total
maxillary superiorly impaction for orthognathic surgery.
Smokers or patients with skeletal disorders and syndromatic diseases were excluded. Bone segment was removed
from the posterior maxilla (lateral wall of the maxillary
sinus) prior to the impaction. The hMSSM in the medial
side of the segment was separated and collected during
surgery, then placed in phosphate-buffered saline (PBS)
supplemented with antibiotics. The samples were used (a)
for histological analysis, (b) for establishment of in vitro
culture of hMSSM-derived cells, (c) for analysis of the
in vitro differentiation potential of such cells, and (d) for
in vivo transplantation in immunocompromised mice
(Fig. 2).
Fresh Tissue Histology
For histology, tissue samples were fixed in 4% neutral
buffered formaldehyde (NBF), dehydrated in graded ethanols, and embedded in paraffin. Tissue sections (6 lm
thick) were stained using Masson’s Trichrome and hematoxylin and eosin (H&E) technique.
Isolation of Human Maxillary Sinus Schneiderian
Membrane Progenitor Cells (hMSSMPCs)
For isolation of cells in culture, samples of the hMSSM
were extensively rinsed with PBS solution supplemented
with antibiotics, then cut into small pieces, which were
used to establish explants cultures. Explants were plated in
culture with a-minimal essential medium (MEM) containing 10% fetal calf serum (FCS), 2 mM L-glutamine, and
Pen-Strep (both 100 U/ml) (Biological Industries, Beith
Haemek, Israel) (nonosteogenic medium). Cells migrating
out of the explants were grown until confluent, trypsinized,
counted, and passaged. Fluorescence-activated cell sorting
(FACS) analysis for the expression of osteoprogenitor cell
markers was performed on samples from primary cells
(P0), passage 1 (P1) cultures, and passage 2 (P2) cultures
cultured in nonosteogenic medium.
123
140
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
Fig. 2 Light microscopy of
primary human maxillary sinus
Shneiderian membrane (MSSM)
culture. a Explant of the sinus
membrane tissue in osteogenic
medium. b Sinus cell clusters in
osteogenic medium (4 weeks),
P1. Scale bars = 500 lm
To induce osteogenic differentiation, P1 cultures were
cultured for 4 additional weeks in a-MEM containing 10%
FCS, 2 mM L-glutamine, Pen-Strep (both 100 U/ml),
100 g/ml ascorbic acid, 10 mM sodium-glycerophosphate,
and 10-8 M dexamethasone (osteogenic medium).
FACS Analysis
For FACS analysis, confluent P0, P1, and P2 primary cultures of hMSSM-derived cells cultured in nonosteogenic
medium were detached with trypsin/EDTA and labeled
with the following monoclonal antibodies: CD105 (266;
BD PharMingen), CD146-FITC (MAB16985F; Chemicon), CD166-FITC (3A6; Serotec), CD71 (sc-7327; Santa
Cruz), CD73 (AD2; BD PharMingen), and CD34 class III
(K3; Dako). Acquisition and analysis were performed on a
FACSCalibur flow cytometer (Becton Dickinson, USA).
All antibodies were used at a concentration of 0.5 lg/106
cells in a volume of 100 ll unless otherwise recommended
by the manufacturer. Isotype-specific negative control
antibodies were purchased from Dako.
Reverse Transcription-Polymerase Chain Reaction
(RT-PCR)
Total RNA was prepared from cells (P1) cultured in osteogenic medium and collected using a SV Total RNA
Isolation kit (Promega, Madison, WI, USA) and according
to the manufacturer’s instructions. RT was carried out
employing a final concentration of 0.5 lg random primers
(Promega)/1 lg RNA, 500 lM dNTP mix, 10 U RNase
inhibitor, 40 U M-MuLV reverse transcriptase (RT) and its
accompanying buffer (25-ll final volume). The RT program consisted of heating the mRNA and random primers
(final volume, 15 ll) for 5 min at 70°C followed by 5 min
at 0°C. A mixture of buffer, enzymes, and dNTPs was
added and heated to 39°C (1 h) followed by 90°C (10 min).
Each PCR was accomplished using 100 ng cDNA,
400 nM each of sense and antisense primers (Table 1),
123
200 lM dNTP mix, 0.4 U/reaction Taq polymerase and its
accompanying buffer (final volume, 25 ll). The PCR
program consisted of 5 min of 94°C denaturization, followed by 29 cycles of 94°C (3 min), annealing (45 s),
elongation (1 min), and terminating with 5 min elongation.
Both RT and PCR were carried out in PTC-100 Thermal
Control (MJ Research, USA). PCR products were resolved
on 1.5% agarose gels containing ethidium bromide.
In Vitro Assay for Osteogenesis
Cultures (P1) of hMSSM cells exposed to osteogenic
medium were rinsed twice in PBS fixed in NBF (10 min)
and stained with Von Kossa to determine evidence of
calcium deposition by the cells. Additional cell cultures
used for the demonstration of alkaline phosphatase enzyme
Table 1 CDNA primer sequences
Primer name
Sequence (5’–3’)
Bone sialoprotein
Sense
atttccagttcagggcagtag
Antisense
acactttcttcttccccttct
BMPII
Sense
gtgtccccgcgtgcttcttag
Antisense
actcctccgtggggatagaac
Alkaline phosphatase
Sense
gggggtggccggaaatacat
Antisense
gggggccagaccaaagatagagtt
Osteonectin
Sense
cctggagacaaggtgctaacat
Antisense
cgagttctcagcctgtgaga
Osteocalcin
Sense
Antisense
tcacactcctcgccctattgg
tcacactcctcgccctattgg
Osteopontin
Sense
agaccccaaaagtaaggaagaag
Antisense
gacaaccgtgggaaaacaaataag
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
activity were washed twice with PBS, fixed with 4%
formaldehyde in phosphate buffer, pH 7.4, and reacted for
alkaline phosphatase using Naphthol AS phosphate as
substrate and Fast Blue BB as coupler. Naphthol AS
phosphate was dissolved in N,N’-dimethylformamide
(30 mg in 0.5 ml) and added to a 0.1% solution of Fast
Blue BB salt in 0.1% boric acid/sodium tetraborate buffer,
pH 9. Cultures were incubated in the ALP substrate solution for 20 min at 37°C. Additional cultures plates were
similarly rinsed, fixed, and processed for immunostaining
with osteocalcin (OC4-30; Novus Biologicals), a marker
for mature osteoblasts. The samples were incubated with
3% hydrogen peroxide in methanol for 30 min to inhibit
endogenous peroxidase activity. After having been washed
with PBS, they were further preceded according to the
manufacturer’s instructions for the Histostain SP kit
(Zymed Laboratories Inc., USA). Samples were incubated
with osteocalcin antibody (OCN) at a 1:100 dilution for 1 h
at room temperature.
To assess mineral deposition by electron dispersive
spectroscopy (EDS), similar cultures were fixed with 4%
glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, washed
intensively with DDW, dehydrated in graded alcohols (70,
95, and 100%; three changes, 10 min each), and vacuumdried. Culture samples were carbon sputter-coated and
subsequently examined utilizing a Jeol JSM-35 C scanning
electron microscope (SEM) at 15 kV with an attached
Kevex energy dispersive spectrophotometer (ThermoNORAN, Middleton, WI, USA).
In Vivo Transplants in Athymic Nude Mice
Eight-week-old athymic nude mice were used for in vivo
transplantation [28]. All animals received care in compliance with the guidelines of the local Animal Care and Use
Committee following National Institutes of Health Guidelines. Confluent cultures (P2) were trypsinized, then
washed with PBS, and 2 9 106 cells were mixed with
40 mg of ceramic hydroxyapatite/tricalcium phosphate
(HA/b-TCP) ceramic powder (particle size, 0.5-1.0 mm;
Zimmer Inc., USA) and rotated gently in the incubator
(37°C, 1 h). The particles with attached cells were collected by brief centrifugation and further mixed with
mouse fibrinogen (15 ll; 3.2 mg/ml in PBS) and with
mouse thrombin (15 ll; 25 U/ml in 2% CaCl2) to form
fibrin clots, prior to their subcutaneous transplantation in
athymic nude mice. Under anesthesia (xylazine:ketamine,
1:1) a midsagittal incision was performed in the back area
and cell-ceramic fibrin clots were subcutaneously implanted in five animals. Five additional animals received
similarly prepared control clots of cell-free ceramic (HA/bTCP) particles mixed with equal volumes of mouse
fibrinogen (15 ll) and mouse thrombin (15 ll) (control).
141
After surgery, the skin was carefully sutured and topically
dressed with antibiotic ointment (3% syntomycin). All
mice recovered well from surgery, were housed separately
in plastic cages, and were followed for up to 8 weeks, with
food and water supplied ad libitum.
The animals were euthanized 8 weeks after transplantation. The harvested transplants were fixed with NBF,
decalcified in 10% EDTA (5 days, room temperature),
dehydrated in graded ethanols (70–100%), and embedded
in paraffin. Serial sections (6 lm thick) were stained with
H&E and with Masson’s Trichrome stain to distinguish
cells from surrounding connective tissue. Immunohistochemical staining was performed with rat anti-human
procollagen I primary antibody (M-58; Chemicon; dilution,
1:100). According to the manufacturer’s instructions, citrate buffer epitope retrieval was performed prior to
antibody administration. For visualization, the DakoCytomation Envision ? System-HRP (DAB; Dako, Carpinteria,
CA, USA) kit was utilized, according to the manufacturer’s
instructions.
Results
Histology
Histological examination of the explanted samples
revealed an intact Schneiderian membrane, showing a
pseudostratified columnar ciliated epithelium facing the
sinus cavity with a richly vascularized lamina propria and a
deeper layer of periosteum-like connective tissue lacking
any evidence of the presence of osseous mineralization
(Fig. 1a, b).
Cell Culture
Cells grown out of the explants in osteogenic differentiation medium (Fig. 2a) reached confluence, and after an
additional 4 weeks in osteogenic medium the culture
showed typical osteogenic cluster formation (Fig. 2b).
FACS Analysis
Representative flow cytometric analysis of P0, P1, and P2
cultures cultured in nonosteogenic medium revealed that
cells were positive for multiple mesenchymal progenitor
cell (MPC) markers (Fig. 3). Expression of CD 105, CD
73, and CD 166 remained almost constant in P0, P1, and P2
cultures, although the CD 105 signal showed a slight
increase from P0 to P1 (64.51% to 73.25%, respectively)
and a slight decrease (72.71%) in P3. The CD 73 signal
showed a slight decrease from P0 (91.48%) to P1 (87.91%),
followed by an increase in P3 (91.85%), and the CD 166
123
142
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
signal showed a slight increase from P0 (44.23%) to P1
(54.12%), followed by a slight decrease in P3 (42.17%). A
constant decrease was observed in the signal of CD 146
from P0 (55.2%) to P1 (44.77%) to P2 (17%) and in CD 71
from P0 (72.11%) to P1 (62.19%) to P3 (23.5%), whereas
CD 34, an endothelial cell hematopoietic marker, was
almost completely negative through P0 and P1 except for a
slight increase (4.17%) in P2.
Osteogenic Differentiation in Culture
Results showed that cultured cells showed positive alkaline
phospatase reactivity, were positively immunostained
stained for osteocalcin, and were positively stained with
von Kossa, indicating osteogenic differentiation and mineral deposition in culture (Fig. 4a–c). Furthermore, RTPCR results indicated that cell cultures exposed to the ostegenic medium expressed multiple osteogenic markers
including alkaline phosphatase, bone morphogenic protein
2 (BMP-2), osteopontin, osteonectin, and osteocalcin
(Fig. 4d). Mineral deposition including calcium and phosphate ions was shown by EDS (Fig. 4e).
encased in the newly deposited bone matrix. In contrast, no
bone was observed in control cell-free transplants, in
which only host-derived connective tissue was associated
with the carrier particles (Fig. 5c, d). Mouse subcutis
transplants were examined by immunohistochemistry with
rat anti-human procollagen I antibody to determine the
donor origin of the cells contributing to the new bone
formation in the grafts. Positively stained cells were
observed in the bony trabeculae (Fig. 5f), indicating that
hMSSM-derived cells observed in the new bone were of
human origin. No positive staining was observed in control
sections where the primary antibody had been omitted
(Fig. 5e).
Discussion
hMSSMPC-HA/TCP constructs transplanted in the subcutaneous tissue of the back of immunocompromised mice
were harvested at 8 weeks. Histological analysis revealed
new bone formation over the surface of the carrier particles
as shown by H&E and Masson’s Trichrome stain, demonstrating the in vivo bone formation capacity of the
hMSSMPC-derived cells (Fig. 5a, b). Similar to native
bone tissue, newly formed bone contained osteocytes
It was shown in the present study that cells derived from
explants of hMSSM can be grown in culture, express
markers of osteoprogenitor cells, be induced to osteogenic
differentiation, and be transplanted in vivo, with histological evidence of new bone formation at the site of
transplantation. The data accrued from this investigation
show evidence for the presence of osteoprogenitor cells
within the Schneiderian membrane. Histological study of
the explants from which osteoprogenitor cells were isolated
indicated the absence of associated bone fragments, dispelling the possibility that the osteoprogenitor cells may be
carried over from the maxillary bone underlying the sinus
membrane; the surgical procedure to harvest the sinus
membrane samples was accomplished by a simple lifting of
the membrane, and did not involve breaking or scraping of
the underlying maxillary bone of the sinus.
Fig. 3 Representative flow cytometric analysis of P0, P1, and P2
cultures of human maxillary sinus Shneiderian membrane progenitor
cells (hMSSMPCs) using classic surface markers for mesenchymal
progenitors (CD 105, CD 73, CD 166, CD 146, CD 71) and the
hematopoietic marker (CD 34). Black lines indicate isotype-matched
mouse IgG antibody control staining
Bone Formation In Vivo
123
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
143
Fig. 4 The osteogenic potential of human maxillary sinus Shneiderian membrane (MSSM) culture (P1) following exposure to
osteogenic medium. a Alkaline phosphatase reactivity. b Von Kossa
stain, specific for mineral deposition. c Immunohistochemistry stain
showing positive osteocalcin in the culture. Scale bars = 500 lm. d
RT-PCR analysis of osteogenic markers. e Electron disperssive
spectroscopy demonstrating calcium and phosphate in the culture dish
The Schneiderian membrane is composed of a few
layers including the epithilial lining, the lamina propria,
and the maxillary bone interface. From the data presented
in this investigation it is difficult to determine the precise
location of the assayable osteoprogenitor cells within the
cellular compartments of the Schneiderian membrane. The
Schneiderian membrane includes a richly vascularized
lamina propria; a number of studies have suggested that
osteoprogenitor cells may be associated with cells, pericytes, within the microvascular walls [13], or in the bone
marrow, as adventitial subendothelial cells [30]. Our data
show that markers associated with microvascular mesenchymal progenitors, such as CD 146, are also expressed in
cells grown in culture from hMSSM explants, raising the
possibility that microvascular cells may represent one, or
even the main, contributor to the osteogenic cell population
present in the Schneiderian membrane.
It should be noted, however, that the populations of cells
are heterogeneous and some populations or markers
changed with passage. Most of the markers tested in MPCs
were unchanged with passage, nevertheless, a constant
decrease was observed in the signal of CD 146 and of CD
71, a cell proliferation marker [12] through passage P0, to
P1 and to P2, a feature that could possibly indicate reduced
proliferative activity of the MPCs. The CD 34 negative
signal expression remained almost constant except for an
unexplained slight increase in P2. Taken together, these
findings may indicate that the cellular population is not
homogeneous with respect to these markers. The possibility that the microvasculature of the Schneiderian
membrane includes osteoprogenitors remains, however, to
be experimentally tested through a procedure that would
allow the direct sorting of phenotype-defined, vesselassociated progenitors.
The deep portion of the hMSSM represents an interface
with the underlying bone and could be equated to a periosteum. Thus it is reasonable to state that the deeper
portion of the sinus membrane may provide an outer lining
for the underlying bone and, in this sense, could be seen as
a periosteum-like structure. It is entirely possible that the
assayable osteogenic progenitors revealed from our data
could have originated from this deep aspect of the explanted tissue. Recent studies have shown that the
periosteum of the maxillary bone does include osteoprogenitor cells that can be isolated in culture and successfully
transplanted in vivo to produce ectopic bone formation
[12]. It is therefore reasonable to assume that a periosteumlike membrane also lines the maxillary bone forming the
sinus floor at the site where this interfaces with the maxillary sinus mucosa, and that lifting of the sinus mucosa
results in lifting of this periosteum-like membrane as well.
This would explain the osteogenic response associated with
sinus lifting in clinical settings.
Regardless of the precise origin of osteogenic cells
within the Schneiderian membrane, our study demonstrates
an inherent osteogenic capacity of hMSSM-derived cells.
123
144
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
Fig. 5 Histological
examination of the obtained
transplants. a, b Histological
sections of hydroxyapatite/
tricalcium phosphate (HA-TCP)
and human maxillary sinus
Shneiderian membrane
progenitor cell (hMSSMPC)
transplants. a Hematoxylin/
eosin (H&E) stain; b Masson’s
Trichrome technique. Scale
bar = 500 lm. A substantial
amount of newly formed bone
(b) is seen around the ceramic
particles (c). c, d Histological
sections of control HA-TCP
transplants. c H&E stain; d
Masson’s Trichrome technique.
Scale bar = 500 lm. No bone
formation is observed in control
implants without cells; only
connective tissue (ct) is seen
surrounding the implanted
ceramic particle. e, f
Immunohistochemical analysis
of the transplants with rat antihuman procollagen I antibody. e
Immunohistochemical control
(the primary antibody was
omitted). f Procollagen I
immunohistochemistry of
hydroxyapatite/tricalcium
phosphate (HA-TCP) and
human maxillary sinus
Shneiderian membrane
progenitor cell (hMSSMPC)
transplants. The bone trabeculae
contained cells that appear to be
of human origin that were
stained positively with
procollagen I. Scale
bar = 50 lm
By providing in vivo evidence of new bone formation at
the site of the transplanted construct of hMSSMPCs ?
HA/TCP, one can eliminate nonspecific bone formation
associated with the expression of biological markers of
osteogenesis under artificial in vitro conditions [17, 25,
28]. In the present study, the histological analysis of the
in vivo subcutaneous transplants of hMSS-derived cells
showed evidence of bone trabecula formation at an ectopic
transplantation site. The human origin of the cells in the
newly formed bone was further substantiated by the
immunohistochemical presence of positive stained cells for
human procollagen I in the newly formed bone trabeculae.
From a clinical point of view, the sinus augmentation
procedure was introduced more than 20 years ago [7, 31],
but still there is no consensus on the function of the
maxillary sinus membrane in this routinely used dental
123
surgery. The original results of in vitro and in vivo
experiments provide new biological insight for understanding the Schneiderian membrane osteogenic potential.
Exact characterization and localization of the sinus-derived
osteoprogenitors and elucidation of their role in sinus lifting should be studied and identified further.
References
1. Artzi Z, Nemcovsky CE, Tal H, Dayan D (2001) Histopathological morphometric evaluation of 2 different hydroxyapatite-bone
derivatives in sinus augmentation procedures: a comparative
study in humans. J Periodontol 72:911–920
2. Asai S, Shimizu Y, Ooya K (2002) Maxillary sinus augmentation
model in rabbits: effect of occluded nasal ostium on new bone
formation. Clin Oral Implants Res 13:405–409
S. Srouji et al.: The Schneiderian Membrane Contains Osteoprogenitor Cells
3. Bianco P, Kuznetsov SA, Riminucci M, Robey PG (2006) Postnatal skeletal stem cells. Methods Enzymol 419:117–148
4. Bianco P, Riminucci M, Gronthos S, Robey PG (2001) Bone
marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 19:180–192
5. Bianco P, Robey PG (2001) Stem cells in tissue engineering.
Nature 414:118–121
6. Bianco P, Robey PG (2004) Skeletal stem cells. In: Lanza RP
(ed) Handbook of adult and fetal stem cells. Academic Press, San
Diego, CA, pp 415–424
7. Boyne PJ, James RA (1980) Grafting of the maxillary sinus floor
with autogenous marrow and bone. J Oral Surg 38:613–616
8. Boyne PJ, Lilly LC, Marx RE, Moy PK, Nevins M, Spagnoli DB,
Triplett RG (2005) De novo bone induction by recombinant
human bone morphogenetic protein-2 (rhBMP-2) in maxillary
sinus floor augmentation. J Oral Maxillofac Surg 36:1693–1707
9. Bruder SP, Fink DJ, Caplan AI (1994) Mesenchymal stem cells in
bone development, bone repair, and skeletal regeneration therapy.
J Cell Biochem 56:283–294
10. Cammack GV 2nd, Nevins M, Clem DS 3rd, Hatch JP, Mellonig
JT (2005) Histologic evaluation of mineralized and demineralized freeze-dried bone allograft for ridge and sinus
augmentations. Int J Periodont Restor Dent 25:231–237
11. Cawood JI, Howell RA (1991) Reconstructive preprosthetic
surgery. I. Anatomical considerations. Int J Oral Maxillofac Surg
20:75–82
12. Cicconetti A, Sacchetti B, Bartoli A, Michienzi S, Corsi A, Funari A, Robey PG, Bianco P, Riminucci M (2007) Human
maxillary tuberosity and jaw periosteum as sources of osteoprogenitor cells for tissue engineering. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod 104:618
13. Doherty MJ, Ashton BA, Walsh S, Beresford JN, Grant ME,
Canfield AE (1998) Vascular pericytes express osteogenic
potential in vitro and in vivo. J Bone Miner Res 13:828–838
14. Ellegaard B, Baelum V, Kolsen-Petersen J (2006) Non-grafted
sinus implants in periodontally compromised patients: a time-toevent analysis. Clin Oral Implants Res 17:156–164
15. Ellegaard B, Kolsen-Petersen J, Baelum V (1997) Implant therapy involving maxillary sinus lift in periodontally compromised
patients. Clin Oral Implants Res 8:305–315
16. Froum SJ, Wallace SS, Elian N, Cho SC, Tarnow DP (2006)
Comparison of mineralized cancellous bone allograft (Puros) and
anorganic bovine bone matrix (Bio-Oss) for sinus augmentation:
histomorphometry at 26 to 32 weeks after grafting. Int J Periodont Restor Dent 26:543–551
17. Goshima J, Goldberg VM, Caplan AI (1991) Osteogenic potential
of culture-expanded rat marrow cells as assayed in vivo with
porous calcium phosphate ceramic. Biomaterials 12:253–258
18. Gruber R, Kandler B, Fuerst G, Fischer MB, Watzek G (2004)
Porcine sinus mucosa holds cells that respond to bone morphogenetic protein (BMP)-6 and BMP-7 with increased osteogenic
differentiation in vitro. Clin Oral Implants Res 15:575–580
19. Haas R, Baron M, Donath K, Zechner W, Watzek G (2002)
Porous hydroxyapatite for grafting the maxillary sinus: a comparative histomorphometric study in sheep. Int J Oral Maxillofac
Implants 17:337–346
145
20. Hallman M, Cederlund A, Lindskog S, Lundgren S, Sennerby L
(2001) A clinical histologic study of bovine hydroxyapatite in
combination with autogenous bone and fibrin glue for maxillary
sinus floor augmentation. Results after 6 to 8 months of healing.
Clin Oral Implants Res 12:135–143
21. Hallman M, Sennerby L, Zetterqvist L, Lundgren S (2005) A 3year prospective follow-up study of implant-supported fixed
prostheses in patients subjected to maxillary sinus floor augmentation with a 80:20 mixture of deproteinized bovine bone and
autogenous bone. Clinical, radiographic and resonance frequency
analysis. Int J Oral Maxillofac Surg 34:273–280
22. Hatano N, Shimizu Y, Ooya K (2004) A clinical long-term
radiographic evaluation of graft height changes after maxillary
sinus floor augmentation with a 2:1 autogenous bone/xenograft
mixture and simultaneous placement of dental implants. Clin Oral
Implants Res 15:339–345
23. Hurzeler MB, Quinones CR, Kirsch A, Gloker C, Schupbach P,
Strub JR, Caffesse RG (1997) Maxillary sinus augmentation
using different grafting materials and dental implants in monkeys.
Part I. Evaluation of anorganic bovine-derived bone matrix. Clin
Oral Implants Res 8:476–486
24. Jung YS, Chung SW, Nam W, Cho IH, Cha IH, Park HS (2007)
Spontaneous bone formation on the maxillary sinus floor in
association with an extraction socket. Int J Oral Maxillofac Surg
36:656–657
25. Krebsbach PH, Kuznetsov SA, Satomura K, Emmons RV, Rowe
DW, Robey PG (1997) Bone formation in vivo: comparison of
osteogenesis by transplanted mouse and human marrow stromal
fibroblasts. Transplantation 63:1059–1069
26. Lundgren S, Andersson S, Gualini F, Sennerby L (2004) Bone
reformation with sinus membrane elevation: a new surgical
technique for maxillary sinus floor augmentation. Clin Implant
Dent Relat Res 6:165–173
27. Lundgren S, Andersson S, Sennerby L (2003) Spontaneous bone
formation in the maxillary sinus after removal of a cyst: Coincidence or consequence? Clin Implant Dent Relat Res 5:78–81
28. Muraglia A, Martin I, Cancedda R, Quarto R (1998) A nude
mouse model for human bone formation in unloaded conditions.
Bone 22:131S–134S
29. Palma VC, Magro-Filho O, de Oliveria JA, Lundgren S, Salata
LA, Sennerby L (2006) Bone reformation and implant integration
following maxillary sinus membrane elevation: an experimental
study in primates. Clin Implant Dent Relat Res 8:11–24
30. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S,
Saggio I, Tagliafico E, Ferrari S, Robey PG, Riminucci M, Bianco P (2007) Self-renewing osteoprogenitors in bone marrow
sinusoids can organize a hematopoietic microenvironment. Cell
131:324–336
31. Tatum H Jr (1986) Maxillary and sinus implant reconstructions.
Dent Clin North Am 30:207–229
32. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H,
Alfonso ZC, Fraser JK, Benhaim P, Hedrick MH (2002) Human
adipose tissue is a source of multipotent stem cells. Mol Biol Cell
13:4279–4295
123
本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。
学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，
提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。
图书馆致力于便利、促进学习与科研，提供最强文献下载服务。
图书馆导航：
图书馆首页
文献云下载
图书馆入口
外文数据库大全
疑难文献辅助工具