Journal of Plant Physiology 167 (2010) 996–1002
Contents lists available at ScienceDirect
Journal of Plant Physiology
journal homepage: www.elsevier.de/jplph
Cloning and functional analysis of the peanut iron transporter AhIRT1 during
iron deficiency stress and intercropping with maize
Hong Ding 1 , Lihong Duan 1 , Jing Li, Huifeng Yan, Meng Zhao, Fusuo Zhang, Wen-Xue Li ∗
Key Laboratory of Plant and Soil Interactions, Ministry of Education, College of Resources and Environmental Sciences, China Agricultural University, Beijing 100193, China
a r t i c l e
i n f o
Article history:
Received 13 August 2009
Received in revised form 4 December 2009
Accepted 4 December 2009
Keywords:
Iron deficiency
Intercropping
Iron-regulated transporter
Maize
Peanut
a b s t r a c t
In previous research, iron-deficiency symptoms in peanut (Arachis hypgaea) were alleviated during anthesis by intercropping with maize. This benefit was associated with increased phytosiderophore secretion
by maize and increased Fe(III)-chelate reductase activity by peanut. In the present study, we isolated
the full-length cDNA of AhIRT1 (iron-regulated transporter 1) from peanut and characterized how iron
deficiency and intercropping affected its iron-transporting ability. Functional complementation with
AhIRT1 restored normal growth of the yeast mutant fet3fet4 (defective in both high- and low-affinity
iron-uptake systems) under iron-deficiency conditions. Based on transient expression analysis, AhIRT1
was determined to be a membrane protein, which was consistent with a function in iron uptake. In
peanut, transcript levels of AhIRT1 increased in both root and shoot under iron-deficiency conditions. In
a pot experiment, AhIRT1 transcript levels in intercropped peanut were 10 times greater during anthesis than pre-anthesis, and transcript levels during anthesis were 40% greater in intercropped than in
monocropped peanut.
© 2010 Elsevier GmbH. All rights reserved.
Introduction
As the co-factors for many important enzymatic reactions, iron
is essential for plant growth. Iron is abundant in soil, but it often
precipitates into insoluble Fe(III) oxides. The concentration of free
Fe(III) is limited to about 10−17 M in the physiological pH range
under aerobic conditions, whereas the iron concentration required
for the normal growth of plants and microbes ranges from 10−9 to
10−4 M (Guerinot and Yi, 1994). Because high pH and high bicarbonate content reduce the availability of iron, iron deficiency is the
most common micronutrient deficiency of crops growing in calcareous and alkaline soils. In addition to reducing crop productivity,
low iron availability in soil can reduce the iron content of plantderived food and thereby increase childhood mortality.To reduce
the adverse effects of iron deficiency, plants have evolved different
response mechanisms related to iron uptake, transport, and storage (Hell and Stephan, 2003). All plants except the graminaceous
monocots absorb iron in three successive steps. First, they acidify
the rhizosphere (most likely with enzymes of the AHA family) to
increase the solubility of Fe(III) (Palmgren, 2001; Santi and Schmidt,
2009). Next, they reduce soluble Fe(III) to Fe(II) by the ferric-chelate
reductase FRO2 (Robinson et al., 1999). Finally, plants transport
∗ Corresponding author at: Department of Plant Nutrition, China Agricultural University, Yuanmingyuan West Road 2#, 100193 Beijing, PR China.
E-mail address: [email protected] (W.-X. Li).
1
These authors contributed equally to the article.
0176-1617/$ – see front matter © 2010 Elsevier GmbH. All rights reserved.
doi:10.1016/j.jplph.2009.12.019
Fe(II) across the root plasma membrane by the metal transporter
IRT1 (Eide et al., 1996).
AtIRT1, which belongs to the ZIP family (Zrt/Irt-like protein),
encodes the major transporter responsible for high-affinity metal
uptake at the root surface in Arabidopsis under iron-deficiency
conditions (Henriques et al., 2002; Vert et al., 2002). AtIRT1
was identified by functional complementation of the fet3fet4
mutant defective in both high- and low-affinity iron-uptake systems in yeast (Eide et al., 1996). IRT1 mRNA was detectable in
the roots of Arabidopsis 24 h after transfer to an iron-deficient
medium and was undetectable 12 h after transfer back to an
Fe-sufficient condition (Connolly et al., 2002). The irt1 mutant contained reduced Fe content and exhibited phenotypes of chlorosis
and severe growth defects (Henriques et al., 2002; Vert et al.,
2002). When AtIRT1 was overexpressed in Arabidopsis, however,
the iron levels showed no obvious difference between 35S::IRT1
and wild type under iron-deficient conditions (Connolly et al.,
2002). In contrast to this result, overexpression of OsIRT1 under
the control of the maize ubiquitin promoter led to enhanced
iron accumulation in rice, even under iron-deficient conditions
(Lee and An, 2009). The latter finding showed that genetic
engineering for the correction of iron deficiency problems was
practical.
In addition to genetic engineering, conventional agricultural
technologies could be useful for avoiding or reducing iron deficiency. Zuo et al. (2000) reported that iron deficiency-induced
chlorosis in peanut growing in calcareous sandy soil was alleviated when peanut was intercropped with maize. We also reported
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
the improvement of iron nutrition of peanut by intercropping with
maize in pot experiments (Ding et al., 2009), suggesting that adjustment in agricultural practices, such as intercropping, may be a
practical way to improve the iron content of food crops. Our results
also showed that Fe(III)-chelate reductase activity of peanut and the
transcript levels of AhFRO1 were higher in the intercropped than in
the monocropped peanuts (Ding et al., 2009).
In Arabidopsis, both AtFRO2 and AtIRT1 were expressed in
the epidermal cells of iron-deficient roots. The transcripts were
detected within 24 h and peaked 3 days after plants were transferred from iron-sufficient to iron-deficient conditions (Connolly
et al., 2002, 2003), demonstrating that AtFRO2 and AtIRT1 messages were coordinately regulated in response to iron (Colangelo
and Guerinot, 2004). The co-function of FRO2 and IRT1 prompted
us to compare the transcription of AhIRT1 in intercropped vs.
monocropped peanut. In the present study, we found that the
transcript levels of AhIRT1 were higher in intercropped than
in monocropped peanuts during anthesis, which coincides with
increasing phytosiderophore secretion from maize and increasing
Fe(III)-chelate reductase activity of peanut. These results indicate
that the strong ability of maize to solubilize Fe(III) from soil and
the high capacity of peanut to uptake Fe(II) function together
to improve the iron nutrition of peanut when intercropped with
maize.
997
Table 1
Primers used in this study.
DF1
DR1
GSP1
GSP2
IRTF1
IRTR1
IRTF2
IRTR2
IRTF3
IRTR3
Actin1
Actin2
GG(T/G)TT(T/C)ATGCA(C/T)GT(A/T)(C/T)T(T/A/G)CCTGA
CCTTC(A/G)AACATTTGATG(A/G)AA(A/G)CAAAG
TGGTGTTGGTGTTGTTCTTCTCAAT
GTCAACCAGTGCCATGTAGATTAAAAGCCCAGCTG
ATGGGTACTAATTCAGAAGTAAAACA
TTAATTCCATTTTGCCATGACA
ACGCGGGGGAGCTTCATATATAA
CACTAACAACAACACCCATCTCTTG
AAGATGGAGACACACAACTCGTGC
GCCAAGACCAATGCCTTCAAACAT
GCTACCAGATGGACAGGTTATCAC
ACCACCACTCAAGACAATGTTACC
ously, using the CTAB method described by Whitelam et al. (1993).
DNA (20 ␮g) was digested overnight with EcoRI or HindIII and
electrophoresed on a 1.0% agarose gel before being transferred
to a Hybond-N+ membrane (Amersham Biosciences). Hybridization was carried out at 65 ◦ C with PerfectHybTM Plus Hybridization
Buffer (Sigma–Aldrich). Probes were labeled with 32 P-dCTP by use
of a Ready-To-Go DNA labeling kit (Amersham Biosciences). After
being sequentially washed in 2× SSC/0.1%SDS, 1× SSC/0.1%SDS, and
0.5× SSC/0.1%SDS for 15 min, the blot was exposed to a PhosphorImager screen (Kodak) for 48 h. PhosphorImager exposures was
used for quantification.
Materials and methods
Expression of AhIRT1 in yeast
Cloning the full-length cDNA of AhIRT1
RNA from peanuts grown in hydroponic culture was used to
clone the full-length cDNA of AhIRT1. For hydroponic culture,
seeds of uniform size were surface sterilized in 10% H2 O2 for
20 min, placed in saturated CaSO4 for 6 h and then germinated
in coarse quartz sand at room temperature. The seedlings were
then transferred to 2-L pots supplied with modified half-strength
Hoagland’s nutrient solution for 3 days and then supplied with
Hoagland’s nutrient solution, which consists of the following nutrients: 0.75 mM K2 SO4 , 0.65 mM MgSO4 ·7H2 O, 0.25 mM KH2 PO4 ,
0.1 mM KCl, 2 mM Ca(NO3 )2 ·4H2 O, 0.1 mM Fe-EDTA, 0.01 mM
H3 BO3 , 1 ␮M MnSO4 ·H2 O, 1 ␮M ZnSO4 ·7H2 O, 0.5 ␮M CuSO4 ·5H2 O,
0.005 ␮M (NH4 )6 Mo7 O24 ·4H2 O. The nutrient solution was replaced
with fresh solution every 2 days. Plants were kept in a growth
chamber with a light intensity of 300 ␮E m−2 s−1 , 60–70% relative
humidity, and a 26/15 ◦ C day/night temperature regime. After they
had grown for 2 weeks, seedlings were supplied with iron-free
nutrient solutions to simulate iron-deficiency conditions.
Total RNA was extracted from the roots of 20-day-old Fedeficient peanut with Trizol reagent (Invitrogen). A 2-␮g portion
of total RNA was reversed with an anchored oligo dT primer and
SuperScript III first-strand synthesis supermix (Invitrogen) in a
reaction volume of 20 ␮l according to the manufacturer’s instructions. The AhIRT1 cDNA fragment was cloned by the primers of
DF1 and DR1. The single PCR product was subcloned into pMD18T (TaKaRa, Japan) and sequenced. The cDNA fragment sequence
was used to design the forward gene-specific primer GSP1 and the
reverse gene-specific primer GSP2 for 3 -RACE and 5 -RACE PCR
(Clontech, USA), respectively (Table 1). In conjunction with the Universal Adapter Primer in this kit, overlapped 5 and 3 fragments
were cloned and sequenced. Forward (IRTF1) and reverse (IRTR1)
primers were used to amplify the entire IRT1 coding sequence
(Table 1).
DNA gel blot analysis
Genomic DNA was isolated from 3-week-old peanut leaves
from peanuts grown in hydroponic culture, as described previ-
The full-length AhIRT1 coding region was subcloned into a
yeast expression vector pDR195. The plasmids were transformed
into DEY1453 (fet3-2::HIS3/fet3-2::HIS3, fet4-1::LEU2/fet4-1::LEU2,
ade2/+ura3/ura3 trp1/trp1 leu2/leu2 his3/his3 can1/can1) with the
lithium acetate method following the manufacturer’s manual
(Invitrogen). The transformants were grown on a synthetic defined
(SD) medium as described by Eide et al. (1996), containing amino
acid supplements without uracil and 2% glucose. In complementation assays, 5 ␮l drops of overnight-culture transformed yeast cells
diluted to an optical density at 600 nm of 0.2, 0.02, and 0.002 were
spotted onto the SD medium, which contained 5 to 200 ␮M Fe3+ citrate. After 3 days at 30 ◦ C, the yeast cells were photographed and
their growth was assessed.
Localization of AhIRT1
The full-length AhIRT1 coding region was cleaved with
EcoRI/BamHI and subcloned into pEZS-NL to generate the AhIRT1GFP expression plasmid. A 1.5-␮g quantity of the plasmid was
transformed to onion epidermal cells by the Biolistic PDS-1000/He
Particle Delivery System (Bio-Rad, USA), and the AhIRT1-GFP fusion
protein in transformed onion cells was microscopically detected
with a Nikon Eclipse TE2000-E confocal microscope. Images were
analyzed using EZ-C1 software.
Effect of intercropping with maize on the active iron
concentration in peanut
A pot experiment was used to determine how intercropping
with maize affected iron concentrations (and AhIRT1 mRNA abundance in peanut; see last paragraph in Methods section). For the pot
experiment, four germinated seeds were planted in a pot filled with
8 kg of alkaline soil (pH 8.05) containing 3.61 mg kg−1 available
iron. Four seeds of peanut (cultivar Nongda 818 was used throughout this study) were used for the monocropping treatment, and two
seeds of peanut and two seeds of maize were used for the intercropping treatment. Each of the treatments was replicated four times.
To support normal growth of maize and peanut throughout the
998
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
experiment, N (150 mg kg−1 ), P (150 mg kg−1 ), K (100 mg kg−1 ), Mg
(50 mg kg−1 ), Zn (5 mg kg−1 ), and Cu (5 mg kg−1 ) were mixed into
the soil as powders. The plants grew under ambient glasshouse conditions except that evaporative cooling and shade cloth were used
to prevent excessively high temperatures on sunny days.
Two weeks after anthesis, the young leaves of peanut were sampled and analyzed for active iron concentration, as an index of iron
nutritional status better than total iron content (Pierson and Clark,
1984). Ten leaves per plant were sampled from each of peanut plant
growing with and without maize. The young leaves were weighed,
cut into pieces, and then extracted in 1 mol L−1 HCl for 5 h (the ratio
of leaves to HCl was 1–10) (Takkar and Kaur, 1984). The iron concentration in the solution was determined by inductively coupled
argon plasma spectrometry (ICP, OPTIMA 3300 DV).
pled to isolate RNA. First-strand cDNA was synthesized from total
RNA treated with RNase-free DNase I using SuperScript II reverse
transcriptase (Invitrogen). The primers used for Q-PCR are shown
in Table 1 (IRTF3 and IRTR3; Actin1 and Actin2). Quantitative realtime PCR was carried out in an ABI 7500 system using the SYBR
Premix Ex TaqTM (perfect real time) kit (TaKaRa Biomedicals). PCR
included a preincubation at 95 ◦ C for 5 min followed by 40 cycles of
denaturation at 95 ◦ C for 10 s, annealing at 60 ◦ C for 15 s, and extension at 72 ◦ C for 45 s. Each experiment was replicated three times.
The comparative Ct method was applied.
Results
Isolation and sequence analysis of the AhIRT1 gene
Quantitative real-time PCR
The plants in the pot experiment (described above) were used
to quantify expression of AhIRT1. About 2 weeks before or after
anthesis, the monocropped and intercropped peanuts were sam-
We first isolated the full-length cDNA of the iron-regulated
transporter from peanut. Using degenerated primers DF1 and DF2,
we amplified a 460-bp cDNA fragment by RT-PCR, and then used
5 - and 3 -RACE were to isolate a 1375-bp cDNA clone containing
the full-length open reading frame of the Fe(II)-uptake transporter.
Fig. 1. AhIRT1 amino acid sequence. (A) The alignment with AtIRT1 and PsIRT1. Positions with identical amino acids have a black background and conservative residues have
a gray background. The nine potential transmembrane domains predicted by TMHMM program version 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) are underlined and
numbered I–IX. The black box between transmembrane domains IV and V indicates a variable region rich in histidine. (B) Phylogenetic analysis of IRTs. Multiple sequence
alignment was performed using Clustal W 1.83, and TreeView version 1.6.6. was used for graphical output. At: Arabidopsis thaliana (AtIRT1, accession number U27590;
AtIRT2, accession number T04324; AtIRT3, accession number NP 564766); Le: Lycopersicon esculentum (LeIRT1, accession number AF246266); Ps: Pisum sativum (PsIRT1,
accession number AFO65444); Os: Oryza sativa (OsIRT1, accession number AB070226; OsIRT2, accession number AB126086); TC: Thlaspi caerulescens (TcIRT1, accession
number AJ320253); Hv: Hordeum vulgare (HvIRT1, accession number EU545802).
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
999
We designated this gene as AhIRT1 (iron-regulated transporter
1). Sequence analysis revealed that there was one in-frame stop
codons upstream of the proposed ATG, and a 12-base polyA tail at
the 3 -untranslated region.
The AhIRT1 cDNA from peanut encoded a predicted polypeptide of 363 amino acids with a molecular mass of 38.88 kDa.
It had a close relationship to previously identified Fe(II)-uptake
transporter AtIRT1, showing 60% identity at the amino-acid
level (Fig. 1A). The hydrophobicity analysis based on TMHMN
(http://www.cbs.dtu.dk/services/TMHMM) revealed that AhIRT1
had nine putative transmembrane domains (TM) with a “variable
region” between domains IV and V (Fig. 1A). As in most known ZIP
family members, the variable region was rich in histidine (shown
in box), and included a putative metal-binding site. Within TM VI,
AhIRT1 possesses the fully conserved histidine residue common to
all the ZIP family members, which might be responsible for the formation of an intra-membranous heavy metal-binding site during
transport (Rogers et al., 2000).
Clustal analysis of AhIRT1 with three Arabidopsis IRT proteins
(AtIRT1-3), OsIRT1, OsIRT2, TcIRT1, LeIRT1, PsIRT1, and HvIRT1
revealed that the two fabaceous IRT (pea and peanut) were closely
related (Fig. 1B).
AhIRT1 restores the growth of yeast mutants defective in iron
uptake under iron-limited conditions
The high sequence homology between AhIRT1 and other IRTs
indicated that AhIRT1 might function as a Fe(II) transporter. To
investigate the role of AhIRT1 in iron uptake in plants, we carried out a complementation assay using the yeast double mutant
fet3fet4 (strain DEY1453) with inactivation of both high- and
low-affinity iron-uptake systems and with extreme sensitivity to
iron deficiency (Dix et al., 1994; Eide et al., 1996). In this assay,
fet3fet4 yeast was transformed with the AhIRT1-expressing plasmid pDR195 under the control of ATPase promoter. As a negative
control, yeast was also transformed with pDR195 alone. No significant difference was observed between AhIRT1 transformants
and the negative control when growing on SD medium supplied
with 200 ␮M iron citrate (Fig. 2). On the medium containing limited
iron (5, 7.5, or 10 ␮M iron citrate), however, the negative control
grew poorly, whereas the AhIRT1 transformants grew well (Fig. 2).
These results indicated that, like AtIRT1, AhIRT1 is a functional iron
transporter.
DNA and RNA analysis of AhIRT1
To examine the expression pattern of AhIRT1, total RNA was
isolated from roots and shoots of 3-week-old peanut grown hydroponically under iron-sufficient and deficient conditions. Unlike
AtIRT1 and OsIRT1, whose expression was exclusively expressed
in the roots under iron deficiency (Eide et al., 1996; Bughio et
al., 2002), the expression of AhIRT1 was detected in both roots
and shoots of peanut by quantitative RT-PCR whether the peanut
was grown under iron-sufficient or iron-deficient conditions. The
AhIRT1 mRNA was more abundant under iron-deficient than ironsufficient conditions (Fig. 3A). The genomic DNA (1089 bp) of
AhIRT1 was amplified by PCR and sequenced. Compared with the
cDNA sequence, AhIRT contains 1 exon and no introns.
To estimate the gene copy number of AhIRT1 in peanut, DNA gel
blot analysis of genomic DNA digested with EcoRI or HindIII was
performed using 32 P-labeled 5 probe (574-bp fragment amplified
with the primer pair of IRTF2 and IRTR2 as shown in Table 1). The
probe sequence contained a HindIII restriction site, and four corresponding bands were detected, indicating that the peanut genome
contains more than one copy of the AhIRT1 gene. Two strong bands
and three weak bands were detected in genomic DNA digested
Fig. 2. Complementation by AhIRT1 of fet3fet4 yeast mutant strains defective in
iron uptake. Serial dilutions (0.2, 0.02, and 0.002 OD600) of fet3fet4 yeast cells
transformed with the empty vector pDR195 and AhIRT1-pDR195 were spotted on
a selective medium with different concentrations of iron. Plates were incubated for
3 days at 30 ◦ C.
with EcoRI (Fig. 3B). Because the probe sequence lacked an EcoRI
restriction site, the result indicates that the peanut genome contains two copies of the AhIRT1 gene and three other homogenous
genes related to AhIRT1.
AhIRT1 is a membrane protein
The Psort I program (http://psort.ims.u-tokyo.ac.jp/) predicted
a plasma membrane localization of AhIRT1 with 64% certainty. To
determine the subcellular localization of AhIRT1 protein, AhIRT1GFP under the control of the 35S promoter of cauliflower mosaic
virus was transformed into onion epidermis cells by bombardment. As a control, pEZS-NL alone was also introduced into onion
cells. A strong fluorescent signal derived from the GFP alone was
observed in the cytoplasm and in the nuclei (Fig. 4A and B), while
the transformed cells carrying AhIRT1-GFP showed a strong green
fluorescence signal around the plasma membrane, indicating that
AhIRT1 is a membrane protein.
AhIRT1 expression is regulated by iron deficiency
To investigate the relationship between AhIRT1 mRNA level and
iron availability, a time-course experiment was carried out using
plants grown in hydroponic culture as described previously. The
peanut were transferred to iron-deficient medium for 0, 1, 2, 3
or 6 days and then resupplied with iron for 0.5, 1, 2, 3 or 6 days.
AhIRT1 mRNA level increased approximately 70-fold by 6 days after
peanuts were transferred to the iron-deficient medium, and the
AhIRT1 transcript decreased rapidly when the plants were transferred from iron-deficient to iron-sufficient medium (Fig. 5), which
is consistent with the expression of AhFRO1 (Ding et al., 2009).
1000
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
Fig. 5. The response of AhIRT1 to iron deficiency. Real-time PCR assay of the accumulation of AhIRT1 gene transcript in roots in response to iron stress of peanuts
growing in hydroponic culture. The expression levels were normalized to Actin, and
the level of AhIRT1 transcript in the controls was set at 1.0. Error bars represent SE
for three independent experiments.
Fig. 3. DNA and RNA analysis of AhIRT1 from peanut grown hydroponically with
sufficient iron or without iron. (A) Quantitative RT-PCR assay revealed localization
and upregulation of AhIRT1 by iron deficiency (without iron supply for 6 days). The
Actin gene was used as a positive internal control. (B) DNA gel blot analysis of AhIRT1.
Blot probed with a radiolabeled 574-bp fragment amplified with the primer pair of
IRTF2 and IRTR2. Each lane contains 20 ␮g of peanut genomic DNA digested with
EcoRI and HindIII. Asterisks indicate the bands that are detected.
Intercropping with maize increases the active iron concentration
of peanut
In the pot experiment, chlorosis appeared frequently in young
peanut leaves during anthesis under monocropping, but not under
intercropping with maize (data not shown). The lack of iron-
deficiency symptoms was not the result of reduced biomass of the
intercropped peanut, because shoot dry weights were similar for
intercropped and monocropped peanut (Fig. 6A). The active iron
concentration was quantified by ICP in the young peanut leaves
during anthesis to determine whether the chlorosis was caused by
iron deficiency and whether intercropping increased the active iron
concentration in the peanut leaves. The active iron concentration
in young leaves of the peanut growing with maize was 27% higher
than the peanut growing without maize (Fig. 6B), showing that iron
deficiency of peanut was alleviated by intercropping with maize.
AhIRT1 mRNA abundance are affected by cropping pattern
The coordination of AtIRT1 and AtFRO1 prompted us to describe
the possible role of AhIRT1 during this anthesis, when irondeficiency symptoms of peanuts always appeared (Ding et al.,
2009). Peanut roots from the pot experiment were analyzed for
AhIRT1 transcript levels before and during anthesis, with and
without maize intercropping (Fig. 6C). Before anthesis, when no
iron-deficiency symptoms of peanuts were apparent, the tran-
Fig. 4. Location of AhIRT1:GFP fusion protein. Subcellular localization of GFP alone (A) and AhIRT1:GFP (C). (B and D) show the combination of the bright field for the
morphology of the cells and the yellow fluorescence.
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
Fig. 6. The effects of intercropping on the shoot biomass and active iron concentration of peanut and the response of AhIRT1 to cropping pattern. (A) The shoot
biomass of monocropped and intercropped peanut plants 50 days after sowing and
(B) the active iron concentration in young leaves of monocropped and intercropped
peanut plants. The young leaves of peanut 2 weeks after anthesis were sampled and
analyzed; (C) real-time PCR assay of the accumulation of AhIRT1 gene transcript in
roots in response to cropping pattern in pot experiment. The expression levels were
normalized to Actin, and the level of AhIRT1 transcript in the controls was set at 1.0.
Error bars represent SE for four independent experiments.
script level of AhIRT1 was about 50% less in intercropped than
in monocropped peanut. During anthesis, when iron-deficiency
symptoms of peanuts had appeared, the transcript level of AhIRT1 in
intercropped peanut was about 10 times greater than it was before
anthesis and was about 40% greater than in monocropped peanut
(Fig. 6C).
Discussion
Although IRT homologies have been identified from many plants
species, including Arabidopsis, tomato, and pea (Vert et al., 2002;
Eckhardt et al., 2001; Pedas et al., 2008), to our knowledge no fulllength IRT homology has been previously identified from peanut.
1001
In this study, we isolated the full-length cDNA of AhIRT1 by RACE.
AhIRT1 is closely related to PsIRT1, LeIRT1 and AtIRT1. AhIRT1
belongs to ZIP family with the ZIP signature in the fifth TM: [LIVFAM] [GAS] [LIVMD] [LIVSCG] [LIVFAS] H [SAN] [LIVFA] [LIVFMAT]
[LIVDE] G [LIVF] [SANG] [LIFVFM] [GS] (Pedas et al., 2008). Like
OsIRT1 and AtIRT1 (Vert et al., 2002; Ishimaru et al., 2006), AhIRT1
is a plasma membrane protein, and the location in the plasma
membrane is consistent with its key role in iron uptake. AhIRT1
mRNA was expressed constitutively regardless of iron status, not
only in roots, but also in shoots, suggesting that in addition to its
role in iron uptake, AhIRT1 might be involved in iron distribution
elsewhere in peanut. The transcript level of AhIRT1 was significantly influenced by Fe deficiency, as has been reported for OsIRT1,
PsIRT1 and AtIRT1 (Bughio et al., 2002; Cohen et al., 1998; Eide et
al., 1996). The response of AhIRT1 to iron deficiency was similar to
that of AhFRO1: the expression of both increased to a peak 6 days
after peanuts were transferred to the iron-deficient medium and
decreased rapidly after iron was resupplied, suggesting that the
functions of AhIRT1 and AhFRO1 are coordinated (Ding et al., 2009).
Coordination has also been demonstrated in Arabidopsis (Colangelo
and Guerinot, 2004).
As Strategy I plants, peanuts are susceptible to iron deficiency
when growing in calcareous soil. The previous results of our group
have clearly demonstrated that the iron nutrition of peanut was
significantly improved by intercropping with maize on a calcareous soil (Zuo et al., 2000, 2003; Zuo and Zhang, 2008; Ding et al.,
2009). This beneficial effect of intercropping could be attributed,
at least in part, to rhizosphere interactions between peanut and
maize, which has also been demonstrated by other groups (Inal
et al., 2007; Inal and Gunes, 2008). Iron deficiency would enhance
reductase activity and proton release from the roots of Strategy
I plants, but the high pH and large bicarbonate buffer capacity
would diminish the effects of this response (Marschner et al., 1987).
Maize, as a Strategy II plant, increases its access to iron by enhanced
secretion of mugineic acid-family phytosiderophores into the rhizosphere to solubilize Fe(III); the quantity of phytosiderophores
released was strongly and positively related to the resistance of
Strategy II plants to iron deficiency (Zhang et al., 1990). We previously reported that during anthesis, which is the critical stage for
iron nutrition of peanuts, maize roots secreted almost two times
the phytosiderophores when intercropped with peanut relative to
monocropping (Ding et al., 2009). When peanut and maize are
intercropped, peanut is a stronger competitor than maize during
anthesis (Zuo et al., 2000), perhaps because of the increased availability of Fe for peanut. Moreover, peanut produces more lateral
roots when intercropped with maize than when grown in monoculture, and the root tips of the young branch roots of peanut
under intercropping showed more Fe reduction activity and proton extrusion (Römheld and Marschner, 1983). The latter result
is explained by both the higher Fe(III)-chelate reductase activity and higher transcript levels of AhFRO1 in intercropped than
in monocropped peanut during anthesis (Ding et al., 2009). After
reduction, the Fe(II) might be transported across the root plasma
membrane by the metal transporter AhIRT1 or its homologous
counterpart. In the present research, we found that the transcript
levels of AhIRT1 in the roots were 40% higher in intercropped than
in monocropped peanut during anthesis. We conclude that high
Fe(II)-uptake capacity, together with high Fe(III)-chelate reductase
activity during anthesis, alleviates iron deficiency chlorosis when
peanut is intercropped with maize.
Acknowledgements
This work was supported by the National Science Foundation
of China (Grant number 30500308, 30970221, to W.X.) and the
Innovative Group Grant of NSFC (Grant number 30821003, to F.S.).
1002
H. Ding et al. / Journal of Plant Physiology 167 (2010) 996–1002
References
Bughio N, Yamaguchi H, Nishizawa NK, Nakanishi H, Mori S. Cloning an ironregulated metal transporter from rice. J Exp Bot 2002;53:1677–82.
Cohen CK, Fox TC, Garvin DF, Kochian LV. The role of iron-deficiency stress
responses in stimulating heavy-metal transport in plants. Plant Physiol
1998;116:1063–72.
Colangelo EP, Guerinot ML. The essential basic helix–loop–helix protein FIT1 is
required for the iron deficiency response. Plant Cell 2004;16:3400–12.
Connolly EL, Campbell NH, Grotz N, Prichard CL, Guerinot ML. Overexpression of
the FRO2 ferric chelate reductase confers tolerance to growth on low iron and
uncovers posttranscriptional control. Plant Physiol 2003;133:1102–10.
Connolly EL, Fett JP, Guerinot ML. Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell
2002;14:1347–57.
Ding H, Duan L, Wu H, Yang R, Ling H, Li WX, et al. Regulation of AhFRO1, an Fe(III)chelate reductase of peanut, during iron deficiency stress and intercropping with
maize. Physiol Plantarum 2009;136:274–83.
Dix DR, Bridgham JT, Broderius MA, Byersdorfer CA, Eide D. The FET4 gene encodes
the low affinity Fe(II) transport protein of Saccharomyces cerevisiae. J Biol Chem
1994;269:26092–9.
Eckhardt U, Marques AM, Buckhout TJ. Two iron-regulated cation transporters
from tomato complement metal uptake-deficient yeast mutants. Plant Mol Biol
2001;45:437–48.
Eide DJ, Broderius M, Fett J, Guerinot ML. A novel iron-regulated metal transporter
from plants identified by functional expression in yeast. Proc Natl Acad Sci USA
1996;93:5624–8.
Guerinot ML, Yi Y. Iron: nutritious, noxious, and not readily available. Plant Physiol
1994;104:815–20.
Hell R, Stephan UW. Iron uptake, trafficking and homeostasis in plants. Planta
2003;216:541–51.
Henriques R, Jasik J, Klein M, Martinoia E, Feller U, Schell J, et al. Knock-out of Arabidopsis metal transporter gene IRT1 results in iron deficiency accompanied by
cell differentiation defects. Plant Mol Biol 2002;50:587–97.
Inal A, Gunes A, Zhang F, Cakmak I. Peanut/maize intercropping induced changes
in rhizosphere and nutrient concentrations in shoots. Plant Physiol Biochem
2007;45:350–6.
Inal A, Gunes A. Interspecific root interactions and rhizosphere effects on
salt ions and nutrient uptake between mixed grown peanut/maize and
peanut/barley in original saline-sodic-boron toxic soil. J Plant Physiol 2008;165:
490–503.
Ishimaru Y, Suzuki M, Tsukamoto T, Suzuki K, Nakazono M, Kobayashi T, et al.
Rice plants take up iron as an Fe3+ -phytosiderophore and as Fe2+ . Plant J
2006;45:335–46.
Lee S, An G. Over-expression of OsIRT1 led to increased iron and zinc accumulations
in rice. Plant Cell Environ 2009;32:408–16.
Marschner H, Römheld V, Kissel M. Localization of phytosiderophore release and of
iron uptake along intact barley roots. Physiol Plantarum 1987;71:157–62.
Palmgren MG. Plant plasma membrane H+ -ATPases: power-houses for nutrient
uptake. Annu Rev Plant Physiol Plant Mol Biol 2001;52:817–45.
Pedas P, Ytting CK, Fuglsang AT, Jahn TP, Schjoerring JK, Husted S. Manganese efficiency in barley: identification and characterization of the metal ion transporter
HvIRT1. Plant Physiol 2008;148:455–66.
Pierson EE, Clark RB. Ferrous iron determination in plant tissue. J Plant Nutr
1984;7:106–7.
Robinson NJ, Procter CM, Connolly EL, Guerinot ML. A ferric-chelate reductase for
iron uptake from soils. Nature 1999;397:694–7.
Römheld V, Marschner H. Mechanism of iron uptake by peanut plants. I.
Fe(III) Reduction, chelate splitting, and release of phenolics. Plant Physiol
1983;71:949–54.
Rogers EE, Eide DJ, Guerinot ML. Altered selectivity in an Arabidopsis metal transporter. Proc Natl Acad Sci USA 2000;97:12356–60.
Santi S, Schmidt W. Dissecting iron deficiency-induced proton extrusion in Arabidopsis roots. New Phytol 2009;183:1072–84.
Takkar PN, Kaur NP. HCl method for Fe2+ estimation to resolve iron chlorosis in
plants. J Plant Nutr 1984;7:81–90.
Vert G, Grotz N, Dédaldéchamp F, Gaymard F, Guerinot ML, Briat JF, et al. IRT1,
an Arabidopsis transporter essential for iron uptake from the soil and for plant
growth. Plant Cell 2002;14:1223–33.
Whitelam GC, Johnson E, Peng J, Carol P, Anderson ML, Cowl JS, et al. A null
mutants of Arabidopsis display a wild-type phenotype in white light. Plant Cell
1993;5:757–68.
Zhang F, Treeby M, Römheld V, Marschner H. Mobilization of iron by phytosiderophores as affected by other micronutrients. Plant Soil 1990;130:173–8.
Zuo Y, Zhang F, Li X, Cao Y. Studies on the improvement in iron nutrition of peanut
by intercropping with maize on a calcareous soil. Plant Soil 2000;220:13–25.
Zuo Y, Zhang F. Effect of peanut mixed cropping with gramineous species on
micronutrient concentrations and iron chlorosis of peanut plants grown in a
calcareous soil. Plant Soil 2008;306:23–36.
Zuo Y, Li X, Zhang F, Christie P. Iron nutrition of peanut enhanced by mixed cropping
with maize: role of root morphology and rhizosphere microflora. J Plant Nutr
2003;26:2093–110.