Bioscience Reports, Vol. 6, No. 7, 1986
Isolation of Repetitive Clones from Human
Muscle cDNA Library
Eva Bober, Surjit Singh, Dharam P. Agarwal and
H. Werner Goedde*
Received July 6, 1986
KEY WORDS: musclecDNA; cDNA library; fetal tissues; Northern blots; sequencing;/Lmyosin.
Human fetal muscle cDNA library was screened with a fl-myosin heavy chain gene
fragment containing Alu sequences. Two cDNA clones AI and BII with 1.8 and 3 kb
inserts respectively were chosen for further characterization by means of RNA and
DNA hybridization procedures and sequencing. The clones appeared to contain
repetitive sequences as well as single copy regions. They are actively transcribed in
different stages of myogenic development but not in the liver. DNA sequence analysis
of short stretches from both clones revealed no sequence homology to any other
published DNA sequences.
INTRODUCTION
Recently a new hypothesis concerning a possible regulative role of Alu-like
sequences in the control of tissue specific gene activation was postulated (Houck et aI.,
1979; Jelinek and Schmid, 1982; Adeniyi~ones and Zasloff, 1985). A common Alu-like
sequence was found to be specifically transcribed in neural tissues and was regarded to
specify a tissue specific identifying signal ("ID-sequences") during the differentiation
(Sutcliffe et al., 1984). We looked for comparable sequences in human myogenic tissues
in order to investigate their possible role in muscle gene activation. By screening a
human fetal muscle cDNA library with a muscle specific fl myosin heavy chain gene
fragment containing Alu repeats (courtesy of Dr Vosberg, Heidelberg), we have
isolated and characterized two repetitive cDNA clones which showed specific
hybridization to muscle tissue and human myogenic cells in Northern blot analysis.
Institute of Human Genetics, Universityof Hamburg, Butenfeld32, D-2000 Hamburg 54, FRG.
* To whom reprint requests should be sent.
633
0144-8463/86/0700-0633505,00/0 9 1.986Plenum Publishing Corporation
634
Bober, Singh, Agarwal, and Goedde
MATERIAL AND METHODS
Establishing the eDNA Library
Human skeletal muscle tissue derived from abortion material (22nd week of
gestation) was frozen in liquid nitrogen and subsequently stored at - 70~ Total RNA
was prepared by the LiCl/urea method (Auffray and Rougeon, 1979). Poly A RNA was
isolated by two passages through oligo dT cellulose (Aviv and Leder, 1972) and 10 #g
used for cDNA synthesis, cCNA was synthesized according to the Gubler and
Hoffman protocol (Gubler and Hoffman, 1983) with slight modifications, mRNA was
heated for 2 rain at 70~ and then chilled in ice prior to synthesis. The second strand
synthesis was carried out over-night at 14~ in a 200 #1 volume in 20 mM Tris, pH 7.5,
5 m M MgCl2, 10raM (NH4) 2 SO4, 100raM KC1, 10raM DTT, 3# RNase H, 38U
polymerase I, 0.4U T4 ligase. All enzymes used were purchased from Boehringer
Mannheim. The dscDNA was d(G) tailed and annealed to EcoRV cut d(C) tailed
pBR322. Frozen competent DH1 cells were used for the transformation according to
Hanahan (1983).
Characterization of cDNA Clones
Restriction mapping was done by standard methods (Maniatis et al., 1982). DNA
sequences were achieved by chemical cleavage method (Maxam and Gilbert, 1977).
RNA glyoxal agarose gels and Northern analysis were performed in general as
described by Thomas (1983).
Direct DNA-gel hybridization was performed according to Meinkoth and Wahl
(1984).
RESULTS AND DISCUSSION
Heating of the mRNA and prolonged incubation of the second strand synthesis
reaction resulted in increased size of the dscDNA ranging up to 7 kb (Fig. 1). The yield
of dscDNA synthesis was about 70%. The transformation efficiency was t0 s to 106
colonies per #g DNA, with an average insert length of about 0.8 kb. This cDNA library
can therefore be used for isolation of muscle sequences specific for human fetus at this
stage of development.
By screening about 2000 cDNA clones, 50 clones were detected, which gave
positive hybridization signals in repeated colony blots as well as in direct gel
hybridization (Fig. 2). DNA from two of these clones, AI and BII, hybridized only to
muscle RNA and not to liver RNA as seen in Northern blot hybridization (Fig. 4).
These clones were further characterized by means of restriction mapping and
sequencing (Fig. 3). Although they have not any sequence homology to known MHC
sequences, their transcription patterns showed some interesting features. In Northern
blot analysis both clones gave smears when hybridized to total RNA isolated from fetal
skeletal muscle and fetal heart. They also hybridized to adult skeletal muscle RNA.
With the total fetal liver RNA, however, no hybridization signal could be detected
Repetitive Muscle cDNA
635
Fig. 1. Products of the first and second strand cDNA
synthesis, DNAs were treated with 0.5 M glyoxal for
45 min at 56~ and separated on 1% agarose gel. The
gel was dried and autoradiographed for 2 h. a. length
marker--Hind III digest of lambda DNA; b. first
strand; c. second strand synthesis product.
Fig, Z, Direct gel hybridization: A, (left) agarose gel, stained with ethidium
bromide; DNA of positive reacting clones in colony blots was cut with Bam
HI. B. (right) the same gel dried and hybridized to nick translated ~ myosin
gene fragment, a. clone AI. b. clone BII. c./~-myosin subclone.
636
Bober, Singh, Agarwal, and Goedde
A
9
,__
,$
9
0
1
,V_,
2 o-->
0
1 ,e-o
2
~,V
3
B
9
Barn HI
~' B91 ~
V PstI
A
~
~
pBR sequences
sequenced
I0
20
30
40
50
60
70
80
G~GAGCAGCAAACCATACCGAAS~AAGTCGAGGCCAAGGGTTG~TAATTCCGCTCAATGTACTAGGGGTACAA~ACGTTT
90
100
]10
I20
130
140
150
160
TTCGCCAACAAGAGCCAGGCGCACGCCACACGCGCACA
B
10
2O
30
4O
50
60
70
80
GGGGGGAGGGGGTTGAAAGTTCAATCGACGTAAATCACTAAACGAAGATTCTGTACATTTTTGTTTTTATTTTGTTTTAT
TTCTTGTcgOTAcTTTTIOOTTTTGAGIIOAAAAGACACTGG
Fig. 3.
120
130
140
150
160
Restriction map and sequences: A. clone AI; B. clone BII.
(Fig. 4e). Slightly weaker hybridization was obtained when a polyA fraction of fetal
skeletal muscle was used (Fig. 4d), which can be explained by hybridization to hrRNA
present in the total RNA preparation. Consequently no hybridization to polyA fetal
liver RNA could be observed (Fig. 4t"). Hybridization of the same clones with total
RNA isolated from human muscle cell culture showed, additionally to the smears
Fig. 4. Northern blot analysis. AI DNA was nick
translated and hybridized to RNAs blotted on
nitrocellulose filter (10 #g total and 2 pg poly A RNA
per lane), a. fetal skeletal muscle total RNA, b. fetal
heart total RNA, c. adult skeletal muscle total RNA,
d. poly A fetal skeletal muscle RNA, e. fetal liver total
RNA, f. poly A fetal liver RNA.
Repetitive MusclecDNA
637
Fig. 5. Hybridizationof nick translated AI (5.A.)
and BII DNA (5.B.) to total RNA isolated from
human muscle cell culture, a. myoblast RNA, b.
myotube RNA.
observed in tissue RNA blots (Fig. 4), strongly hybridizing small RNA species (5-7S)
with increased hybridization intensity with differentiated myotube-RNA as compared
to undifferentiated myoblast-RNA (Fig. 5). Comparable observations in rat myogenic
L6 cells were very recently made by the group of Anna Starzinski-Powitz (Herget et al.,
1986). The increased hybridization intensity in differentiated myotubes suggests
enhanced transcription of these sequences during the myotube formation, reflecting a
particular role in muscle cell development. On the basis of this observation we assume
that the highest transcription level correlates with the onset of differentiation
processes. The relative high transcription level observed in adult muscle (Fig. 4c) could
indicate that production of new muscle fibres is not restricted only to the fetal
development, but also takes place in the adult muscle. This possibility has already been
discussed by Helen Blau (Blau et al., I983). Further investigations are needed to
establish the mechanisms and real function of these types of sequences in muscle
differentiation.
ACKNOWLED GEMENTS
We are grateful to the Boehringer Ingelheim Fonds and BMFT for financial
support.
We thank the Frauenklinik of the Universiditskrankenhaus Eppendorf for the
abortion material.
We are indebted to Dr Anna Starzinski-Powitz for supporting us with human
myoblast- and myotube RNA blots.
638
Bober, Singh, Agarwal, and Goedde
REFERENCES
Adeniyi-Jones, S. and Zasloff, M. (1985). Nature 317:81-84.
Auffray, C., and Rougeon, F. (1979). Eur. J. Biochem, 107:303-308.
Aviv, H., and Leder, P. (1972). Proc. Natl. Acad. Sci. 69:1408-1412.
Blau, H. M., Webster, C., and Pavlath, G. K. (1983). Proc. Nat. Acad. Sci. 80:4856-4860.
Hanahan, D. (1983). J. Mol. Biol. 166:557-580.
Herget, T., Reich, M., Stiiber, K., and Starzinski-Powitz, A. (1986). EMBO J. 5:659-664.
Gubler, U., and Hoffman, B. J. (1983). Gene 25:263-269.
Houck, C. M., Reinhart, F. P., and Schmid, C. W. (1979). J. Molec. Biol. 132:289-306.
Jelinek, W. R., and Schmid, C. W. (1982). Ann. Rev. Biochem. 51:813-844,
Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). In: Molecular Cloning: A Laboratory Manual, Cold
Spring Harbour Laboratory Press, New York.
Maxam, A. M., and Gilbert, W. (1977). Proc. Natl. Acad. Sci. 74:560-564.
Meinkoth, J., and Wahl, G. (1984). Anal. Biochem. 138:267-284.
Sutcliffe, J. G., Milner, R. J., Gottesfeld, J. M., and Lerner, R. A. (1984). Nature 308:237-241.
Thomas, P. S. (1983). Methods in Enzymolooy 100:255-267.