Molecular Ecology Resources (2014) 14, 458–468
doi: 10.1111/1755-0998.12195
The D1-D2 region of the large subunit ribosomal DNA as
barcode for ciliates
T. STOECK,* E. PRZYBOS† and M . D U N T H O R N *
*Department of Ecology, University of Kaiserslautern, 67663 Kaiserslautern, Germany, †Institute of Systematics and Evolution of
Animals, Polish Academy of Sciences, 31-016 Krakow, Poland
Abstract
Ciliates are a major evolutionary lineage within the alveolates, which are distributed in nearly all habitats on our
planet and are an essential component for ecosystem function, processes and stability. Accurate identification of
these unicellular eukaryotes through, for example, microscopy or mating type reactions is reserved to few specialists.
To satisfy the demand for a DNA barcode for ciliates, which meets the standard criteria for DNA barcodes defined
by the Consortium for the Barcode of Life (CBOL), we here evaluated the D1-D2 region of the ribosomal DNA large
subunit (LSU-rDNA). Primer universality for the phylum Ciliophora was tested in silico with available database
sequences as well as in the laboratory with 73 ciliate species, which represented nine of 12 ciliate classes. Primers
tested in this study were successful for all tested classes. To test the ability of the D1-D2 region to resolve conspecific
and congeneric sequence divergence, 63 Paramecium strains were sampled from 24 mating species. The average conspecific D1-D2 variation was 0.18%, whereas congeneric sequence divergence averaged 4.83%. In pairwise genetic
distance analyses, we identified a D1-D2 sequence divergence of <0.6% as an ideal threshold to discriminate Paramecium species. Using this definition, only 3.8% of all conspecific and 3.9% of all congeneric sequence comparisons had
the potential of false assignments. Neighbour-joining analyses inferred monophyly for all taxa but for two Paramecium octaurelia strains. Here, we present a protocol for easy DNA amplification of single cells and voucher deposition. In conclusion, the presented data pinpoint the D1-D2 region as an excellent candidate for an official CBOL
barcode for ciliated protists.
Keywords: Ciliophora, D1-D2 region, DNA barcode, LSU-rDNA, single-cell PCR, voucher deposition
Received 24 June 2013; revision received 20 October 2013; accepted 21 October 2013
Introduction
Despite an increased importance of species identification
for much biological research (Hebert et al. 2003a), there
is a worldwide shortage of essential taxonomic training
and information (Schander & Willassen 2005; GuerraGarcıa et al. 2008). To countervail this taxonomic impediment, biological identifications through DNA barcodes
have been introduced (Hebert et al. 2003a,b). DNA barcoding uses short, standardized gene regions as internal
species tags to provide rapid identifications (Hebert &
Gregory 2005). By facilitating taxonomy, DNA-barcoding
approach has found numerous initiatives that have
mainly targeted multicellular organisms; for example,
fish (April et al. 2011), insects (Burns et al. 2005), birds
(Hebert et al. 2004), mammals (Borisenko et al. 2008),
plants (Kress et al. 2005) and fungi (Seifert et al. 2007).
Correspondence: T. Stoeck, Fax: +49-631-2052496;
E-mail: [email protected]
Microbial eukaryotes (protists) have thus far largely
been ignored in large collaborative barcoding initiatives
and projects, although they are more diverse than multicellular eukaryotes (Patterson 1999; Pawlowski et al.
2012), distributed in nearly all habitats (Epstein & L
opezGarcıa 2008) and are an essential component for ecosystem processes and stability (Corliss 2002). One major
reason for this lack of barcodes in nonphotosynthetic
microbial eukaryotes is that they are not monophyletic;
rather, they are distributed in all super groups in the
eukaryotic tree of life (Simpson & Roger 2004; Koonin
2010; Adl et al. 2012; Pawlowski et al. 2012). Their genomic diversities are too divergent to find a single locus
that serves as a barcode for all of them. This lack of
protists in DNA-barcoding initiatives becomes evident
from the bibliography of International Barcode of Life
Project (http://ibol.org/barcoding-bibliography), which
lists 1236 peer-reviewed DNA-barcoding publications
between the years 2003 and 2012, only a negligible
proportion (<2%) of which target protists.
© 2013 John Wiley & Sons Ltd
D1-D2 REGION AS CILIATE BARCODE
Given this, under the empowerment of the International Nucleotide Sequence Database Collaboration
(Cochrane et al. 2011), the Consortium for the Barcode of
life (CBOL) established the Protist Working Group
(ProWG) with the ultimate objective to establish universal criteria for barcode-based species identification in
protists (Pawlowski et al. 2012). ProWG proposed a twostep pipeline: first, use the hyper-variable V4 region of
the small subunit ribosomal DNA (SSU-rDNA) locus to
assign an isolate to a major taxonomic group (e.g. Bacillariophyceae, Cercozoa, Ciliophora, and Dinoflagellata);
second, apply a group-specific barcode, which is
acknowledged and accepted by the scientific community
working with this taxonomic group (Pawlowski et al.
2012). Reliable and promising barcode regions for some
protist groups are already established; for example, helix
37 of the SSU-rDNA for foraminifera (Pawlowski &
Lecroq 2010). Most protist taxa, though, are still awaiting
an adequate DNA barcode.
Here, we suggest a barcode marker that shows high
potential for identifying ciliate species. Ciliates are a
large protist clade that is recognized by the presence of
micronuclei and macronuclei within each cell (Lynn
2008). Many species can be identified morphologically
(Lynn 2008), which can serve as the basis for DNA barcoding, even though cryptic species are also known (Sonneborn 1937, 1957; Nanney 1999; Simon et al. 2008). Up
to 40 000 estimated ciliates species (Nanney 2004; Foissner et al. 2008) are central players in the microbial loop
in most ecosystems (Azam et al. 1983; Finlay & Fenchel
1996; Corliss 2002).
The most frequently used barcode for ciliates is COI
(Lynn & Str€
uder-Kypke 2006; Chantangsi et al. 2007;
Gentekaki & Lynn 2009; Str€
uder-Kypke & Lynn 2010;
Kher et al. 2011; Greczek-Stachura et al. 2012). Other
genes have been analysed for their potential as DNA barcodes for ciliates: for example, nuclear ribosomal internal
transcribed spacer regions (Barth et al. 2006; Gentekaki &
Lynn 2009; Greczek-Stachura et al. 2012); nuclear histone
H4 (Greczek-Stachura et al. 2012), and the mitochondrial
cytochrome b (Lynn & Str€
uder-Kypke 2006; Barth et al.
2008; Przybos et al. 2010)—none of which, however, met
CBOL’s approval criteria for non-COI barcodes (http://
barcoding.si.edu/pdf/dwg_data_standards-final.pdf).
These criteria include (i) ease of DNA extraction and
sequencing; (ii) primer and gene universality; (iii) the
presence of a barcode gap; and (iv) voucher deposition
with type species, or tissue sample.
Recently, Santoferrara et al. (2013) suggested the
D1-D2 region of the large subunit ribosomal DNA (LSUrDNA) as barcode for tintinnids, an important and
abundant clade of planktonic ciliates (Dolan et al. 2013).
Using the tintinnids as a test clade, the D1-D2 region of
LSU-rDNA was able to better distinguish among species
© 2013 John Wiley & Sons Ltd
459
than SSU-rDNA, and the hyper-variable V4 and V9
regions of SSU-rDNA (Santoferrara et al. 2013). In this
study, we further analyse the D1-D2 region of the LSUrDNA to evaluate whether this gene region meets the criteria for a general ciliate barcode marker as defined by
the Consortium for the Barcode of Life.
Materials and methods
In silico analyses to test PCR-primer specificities
As an initial test of the ability to amplify the D1-D2
region from a broad range of taxa, LSU-rDNA sequences
of available ciliates were downloaded from GeneBank’s
nucleotide (nr) database using the search operator ‘[Ciliophora(Organism)] AND (LSU OR 28S) NOT (ITS1 OR
internal OR protein OR 16S OR 18S OR mitochondrial
OR 5.8S)’ and aligned with Muscle (Edgar 2004) as
implemented in SEAVIEW v. 4 (Gouy et al. 2010) against
the PCR primers used in this study, specific for the
D1-D2 region of the LSU-rDNA for all eukaryotes
[forward primer: 5′- AGCGGAGGAAAAGAAACTA-3′;
and reverse primer 5′- ACGATCGATTTGCACGTCAG3′) (Sonnenberg et al. 2007)]. The number of sequences in
the alignment was 65, representing the ciliate classes
Colpodea, Heterotrichea, Litostomatea, Nassophorea,
Oligohymenophorea, Plagiopylea, Prostomatea and
Spirotrichea (Table S1, Supporting information). Only
four classes (Armophorea, Cariacotrichea, Karyorelictea
and Phyllopharyngea) were not represented in this data
set. The total length for this alignment was 4276 positions
(longest sequence = Ichthyophthirius multifiliis, GenBank
Accession no. EU185635.1 with 2677 bp).
Laboratory experiments to test primer specificities
We tested primer universality in PCRs with DNA from
49 different ciliates from seven of 12 major ciliate clades
(sensu Adl et al. 2012) (Table 1). DNAs originated from
taxa collected and provided by Wilhelm Foissner
(University Salzburg, Austria) and Bettina Sonntag
(University Innsbruck, Austria) and previously
sequenced for the SSU-rDNA locus at the Department of
Ecology, University of Kaiserslautern, for phylogenetic
analyses. The PCR mix included dNTPs (10 lmol each,
200 lM final, Axon, Germany), 100 lmol/lL of a Fw1
and Rev2 primers from Sonnenberg et al. (2007) (each
0.5 lM final), 0.5 lL HotStar Taq (5 U/lL, 2.5 U final,
Qiagen, Germany) and 5 lL of 109 Coralbuffer (19 final,
Qiagen). The reaction mix was filled with sterile water to
a final volume of 50 lL. The PCR protocol comprised an
initial denaturation at 95 °C for 5 min, followed by 30
identical amplification cycles of denaturation at 95 °C for
1 min, annealing at 64 °C for 1 min, and extension at
460 T . S T O E C K , E . P R Z Y B O S a n d M . D U N T H O R N
Table 1 Ciliates from seven different classes that were tested in PCR for the D1-D2 region of the LSU rDNA (Sonnenberg et al. 2007)
Taxon name
Class
Collected and identified
Bryometopus sp.
Bursaria sp. 1
Bursaria sp. 2
Colopda henneguyi
Colpoda maupasi
Colpoda minima
Isiella palustris
Maryna umbrellata
Pseudomaryna sp.
Woodruffides metabolicus
Spirostomum ambiguum
Spirostomum teres
Stentor coeruleus
Stentor muelleri
Fuscheria terricola
Monodinium sp.
Monodinium sp.
Pelagodileptus trachelioides
Spathidium cf. fraterculum
Trachelophyllum sp.
Bromeliophrya sp. MD2012
Cinetochilum margaritaceum
Dexiotricha sp.
Dexiotricha tranquilla
Epistylis sp.
Glaucomides sp. 2
Glaucomides sp. 1
Lambornella sp. 1
Lambornella sp. 2
Ophryoglena sp.1
Ophryoglena sp.2
Paramecium tetraurelia
Pseudocohnilembus sp.
Telotrochidium sp.
Tetrahymenid ciliate
Urocentrum turbo
Vorticella convallaria
Vorticella convallaria
Vorticella sp.
Tokophrya infusionum
Coleps hirtus cf. viridis
Gastrostyla sp.
Gonostomum sp.
Orthoamphisiella stramenicola
Oxytricha c.f
Oxytricha ottowi
Oxytricha ottowi
Oxytricha sp.
Sterkiella cf. caviola
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Colpodea
Heterotrichea
Heterotrichea
Heterotrichea
Heterotrichea
Litostomatea
Litostomatea
Litostomatea
Litostomatea
Litostomatea
Litostomatea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Oligohymenophorea
Phyllopharyngea
Prostomatea
Spirotrichea
Spirotrichea
Spirotrichea
Spirotrichea
Spirotrichea
Spirotrichea
Spirotrichea
Spirotrichea
WF
WF
WF
WF
WF
WF
WF
WF
WF
WF
WF
BS
BS
BS
WF
WF
BS
BS
WF
BS
WF
BS
WF
BS
WF
WF
WF
WF
WF
BS
BS
KL
WF
WF
WF
BS
WF
BS
WF
WF
BS
WF
WF
WF
WF
WF
WF
WF
WF
GenBank Accession no.
KF287645
KF287659
KF287658
KF287653
KF287655
KF287646
KF287654
KF287660
KF287647
KF287644
KF287656
KF287649
KF287648
KF287651
KF287650
KF287657
KF287652
For details, see Materials and methods section. All taxa produced PCR bands of the expected size. Sixteen randomly chosen PCR products were chosen for sequencing, all of which resulted in the correct D1-D2-sequence. Accession nos are provided in the last column. BS,
Bettina Sonntag, University of Innsbruck; KL, Stoeck lab, University of Kaiserslautern; WF, Wilhelm Foissner, University of Salzburg
72 °C for 1 min, followed by a final extension at 72 °C
for 10 min. PCR product was purified with the MiniElute
Kit (Qiagen) and cloned into a vector using the TA-Cloning
Kit (Invitrogen, Carlsbad, CA). To check for any intrapolymorphisms, seventeen randomly chosen samples
(Table 1) of the resulting PCR products were purified
© 2013 John Wiley & Sons Ltd
D1-D2 REGION AS CILIATE BARCODE
with the MiniElute Kit (Qiagen), cloned into a vector
using the TA-Cloning Kit (Invitrogen, Carlsbad, CA) and
sequenced using vector primers with the Big Dye terminator chemistry (Applied Biosystems, Foster City, CA)
on an ABI 3730 automated sequencer.
Testing the barcoding gap in Paramecium
Strain selection. To test the ability of the D1-D2 region to
resolve conspecific and congeneric sequence divergence,
63 Paramecium strains were sampled from 24 mating species (Table 2). These strains are in the permanent culture
collection of the Polish Academy of Sciences, Institute of
Systematics and Evolution of Animals; they are available
from the authors upon request. Cells were grown at
room temperature in Volvic water, amended with a
wheat grain and Klebsiella minuta as a food source.
To use a protocol applicable to environmental
samples without prior cultivation, a single-cell PCR was
conducted for D1-D2 PCR amplification. An individual
cell was picked from a culture, then washed in sterile
Volvic water. The cell, in a volume of 5 lL of sterile
washing water, was then transferred into a PCR tube
containing the reaction mixture as described previously.
PCR protocol, purification of PCR products, cloning and
sequencing followed the protocol as described earlier.
We note that cloning is not an essential step in this protocol. Alternatively, PCR products from single cells can be
successfully sequenced directly when using the PCRprimers as sequencing primers. However, to allow for
long-term material storage (plasmids with inserts) in our
laboratory, we preferred the cloning step. All obtained
sequences went through rigorous standard quality
assessments, PHRED and PHRAP analysis using the
program CODONCODE ALIGNER v. 1.2.4 (CodonCode
Corporation, Dedham, MA). GenBank Accession nos are
provided in Table 2.
Sequence analyses. Pairwise genetic distances of the
resulting Paramecium sequences were calculated with
PairAlign as implemented in JAguc (Nebel et al. 2011).
Pairwise distances were written in a triangular distance
matrix and used to calculate intra- (conspecific) and
interspecific (congeneric) variation in the D1-D2 fragment in the strains used in this study. For the neighbourjoining (NJ) analyses, the D1-D2 LSU-rDNA sequences
of the Paramecium strains (Table 2) were aligned in SEAVIEW v. 4 (Gouy et al. 2010) using Muscle (Edgar 2004).
The alignment was manually refined in MacClade
(Maddison & Maddison 1992) and start- and endtrimmed to the same position in all sequences. The final
alignment included 799 positions and is available from
the authors upon request. An NJ tree was constructed
under the K2P evolutionary model as recommended by
© 2013 John Wiley & Sons Ltd
461
Table 2 Paramecium (sibling) species, strains, and origins used
in this study.
Species
P. primaurelia
P. biaurelia
P. triaurelia
P. tetraurelia
P. pentaurelia
P. sexaurelia
Origin of strains and
[strain number]
Sevilla, Andalusia, Spain
[3/1]
Valmanara, Italy [4/1]
Near Rejkjavik, Iceland [5/
1]
Piekary near Krak
ow,
Poland [6/1]
Nałez cz
ow (Lublin region),
Poland [7/1]
Hanoi, Vietnam [17/1]
Onoda, Japan [18/1]
Tasmania Island, Australia
[2/2]
Yamaguchi, Japan [3/2]
Marlishausen, Germany
[6/2]
Velke Heraltice, Czech
Republic [7/2]
Krak
ow, Poland [13/2]
_
Zywiec
Beskids, Poland
[14/2]
Astrahan Nature Reserve,
Russia [16/2]
San Rafael, Spain [3/3]
Krak
ow-Opatkowice,
Poland [6/3]
Natural Reserve Complex
Volga-Ahtuba, Russia [9/
3]
Sydney, Australia [1/4]
Botanical Garden,
Melbourne, Australia [2/
4]
Tabgha, Israel [6/4]
Paris, France [8/4]
Skalnate Pleso, Tatras,
Slovakia [9/4]
Botanical Garden, Krak
ow,
Poland [10/4]
Pennsylvania (87), USA
[1/5]
Vaciamadrid, Rivas, Spain
[2/5]
Valmarana, Italy [3/5]
Balaton Lake, Hungary [4/
5]
Astrahan Nature Reserve
(AZ6-24), Russia [6/5]
Altai Foreland, Russia [7/
5]
Puerto Rico (159), Spain
[1/6]
GenBank
Accession
no.
KF287661
KF287662
KF287663
KF287664
KF287665
KF287666
KF287667
KF287668
KF28769
KF287670
KF287671
KF287672
KF287673
KF287674
KF287675
KF287676
KF287677
KF287678
KF287679
KF287680
KF287681
KF287682
KF287683
KF287684
KF287685
KF287686
KF287687
KF287688
KF287689
KF287690
KF287691
462 T . S T O E C K , E . P R Z Y B O S a n d M . D U N T H O R N
Table 2 (Continued)
Species
P. septaurelia
P. octaurelia
P. novaurelia
P. decaurelia
P. undecaurelia
P. dodecaurelia
P. tredecaurelia
P. quadecaurelia
P. sonneborni
P. bursaria
P. calkinsi
P. caudatum
P. jenningsi
P. multimicronucleatum
P. nephridiatum
P. polycarium
P. putrinum
P. woodruffi
Origin of strains and
[strain number]
Phuket Island, Thailand
[2/6]
Yamaguchi, Japan [3/6]
Joannina, Greece [5/6]
Seville, Spain [6/6]
Stuttgart, Germany [8/6]
Astrahan Nature Reserve,
Russia [9/6]
Natural Reserve VolgaAhtuba (AZ6-23), Russia
[2/7]
Florida (138), USA [1/8]
Ein Effek, Israel [2/8]
Lafiloliere (534), France
[1/9]
Florida (223), USA
[1/10]
Texas, (219), USA [2/11]
Elba Island, Italy [4/12]
Jordan’s Park, Krak
ow,
Poland [7/12]
Paris (209), France [1/13]
Cuernavaca (321), Mexico
[2/13]
Kyryat Motzkin, Israel [3/
13]
Namibia Vindhoek, Africa
[2/14]
Texas, USA, ATCC
30995
Syngen 3, Bejing, China
[1/3(b)]
Syngen 4, Oklahoma,
Ardmoore, USA [1/4(b)]
Syngen 5, St.Petersburg,
Russia [1/5(b)]
Vladivostok, Maritime
Territory, Russia
[2/cal]
Titicaca, Peru [4/c]
Bangalore, India [2/j]
Okinawa, Japan [3/j]
Rome, Italy [1/m]
Cheboksary, Russia
[2/m]
Baton Rouge, Louisiana,
USA [4/m]
Pisa, Italy [P.n.]
Khabarovsk, Russia [P.p.]
Khanka Lake, Russia
[P.put.]
Slavyanka, Maritime
Territory, Russia [P.w.]
GenBank
Accession
no.
KF287692
KF287693
KF287694
KF287695
KF287696
KF287697
KF287698
KF287699
KF287700
KF287701
KF287702
KF287703
KF287704
KF287705
KF287706
KF287707
KF287708
KF287709
KF287710
KF287711
KF287712
KF287713
KF287714
KF287715
KF287716
KF287717
KF287718
KF287719
KF287720
KF287721
KF287722
KF287723
CBOL (http://barcoding.si.edu/pdf/dwg_data_standardsfinal.pdf).
Results and discussion
To demonstrate that the D1-D2 region of the LSU-rDNA
locus is an appropriate barcode for ciliates, we will walk
through the main criteria for a successful DNA-barcoding as specified by CBOL (http://barcoding.si.edu/pdf/
dwg_data_standards-final.pdf).
Ease of DNA extraction and sequencing of D1-D2
Ciliates range in their size between c. 10 lm (some scuticociliates) up to c. 4 mm (some Spirostomum species)
(Lynn 2008). They are characterized by ‘germline’
micronuclei and ‘somatic’ macronuclei, the latter of
which possesses tens to thousands of copies (Jahn &
Klobutcher 2002; Gong et al. 2013). Such high genome
copy numbers in ciliates make DNA extractions
un-needed as they are ideally suited for single-cell PCR’s
(Lynn & Pinheiro 2009) (see Fig. S1, Supporting information). Specific genes, including potential barcoding
genes, are accordingly highly replicated in the macronuclei of ciliates and provide sufficient template for PCR
amplification. This is specifically helpful when it comes
to ciliates that are difficult to culture or directly isolated
from an environmental sample for species identification.
This ease of single-cell PCR amplification in ciliates
has been taken advantage of in a number of studies (e.g.
Gong et al. 2013). Yet, we note that without doubt, single-cell PCR’s are easier to perform on larger ciliate cells,
and genes from very small species may be more difficult
to amplify in single-cell reactions. As a solution to this
problem, we suggest whole-genome amplification
(WGA), which performs well with minute DNA concentrations prior to targeted PCR. The length of suggested
barcode here is about 840 bp. This corresponds approximately to the length of the COI gene fragment length
used as potential barcodes in ciliates (Gentekaki & Lynn
2009) and is about 190 bp more than the COI region used
for vertebrate and insect barcoding (Hebert et al. 2004;
Wiemers & Fiedler 2007). Such a fragment length is still
possible to sequence with one single Sanger read, a strategy that complies with the recommended CBOL protocol
for sequence analyses (http://www.barcodeoflife.org/
content/about/what-dna- barcoding). In case of direct
sequencing of PCR products without prior plasmid
cloning, such a read length may be critical. Therefore, we
recommend cloning of PCR products for this specific
DNA-barcoding protocol. In case of direct PCR-product
sequencing, it would be beneficial to assess whether a
shorter fragment of the D1-D2 region, sequenced from
the 5′ or 3′ end would suffice for species discrimination.
© 2013 John Wiley & Sons Ltd
D1-D2 REGION AS CILIATE BARCODE
Primer and gene universality of D1-D2
Nuclear protein-coding genes emerged as too conserved
for intraspecific analyses in ciliates (Gentekaki & Lynn
2009). They are also subject to extensive paralogy and
rapid rates of evolution (Israel et al. 2002; Katz et al.
2004; Aury et al. 2006; Dunthorn & Katz 2008). While
mitochondrial genes, especially COI, have been shown to
be effective as a barcode, this region can hardly be amplified in the large and ecologically important clade Spirotrichea (Str€
uder-Kypke & Lynn 2010). Another problem
with COI is that many ciliates are found in anoxic habitats (Stoeck et al. 2007; Lynn 2008; Orsi et al. 2012), and
thus lack functional mitochondria and the full set of
mitochondrial genes, such as COI. While it may be a
good genetic marker to identify populations, species and
cryptic species in some ciliates, COI is not an effective
barcode for all ciliates because mitochondria are missing
is many ecologically important taxa (Lynn 2008). Given
CBOL’s criteria for DNA barcodes, COI will have to be
rejected as a general ciliate barcode marker.
The D1-D2 region of the LSU-rDNA, on the other
hand, is found in all ciliates, and thus is potentially a better general ciliate barcode. Here, for in silico analyses of
primer specificities, we have retrieved sequences from
only 65 different species from the GenBank database
(Table S1, Supporting information). Of these, 43 species
included the original D1-forward region and 34 species
included the region of the D2-reverse primer (Sonnenberg et al. 2007). Alignments showed a coverage of 35%
for the original D1-forward primer and of 18% for the
original D2 reverse primer. However, degenerating the
original D1-forward primer at two positions to 5′-AGCGGAGGARAAGAAAHTA-3′ results in a 96% coverage
for the forward primer. Only the two species Entodinium
sp. (Accession no.: Z49857.1) and Epidinium sp.
(Z49914.1) remain with one mismatch to the degenerate
forward primer. Both species are trichostomatide ciliates
belonging to the Litostomatea. Similarly, degeneration of
the reverse primer at one position to 5′- ACGADCGA
TTTGCACGTCAG-3′ increases the target coverage of
this primer to 85%. The five sequences that still show
mismatches to the degenerate primer are from Apodiophrys ovalis (JF694045.1), Epiphyllum shenzhenense (JF975392.
1), Loxophyllum jini (JF975393.1), Phialina salinarum
(JF975395.1), and Loxophyllum sp. (JF975388.1). The latter
four species are all haptorid ciliates belonging to the
class Litostomatea, while A. ovalis is a Spirotrichea.
We also found in laboratory experiments that the primer pairs were able to produce PCR products of the
expected size from all 49 test strains using the original
D1-D2 primers. Of these, all seventeen PCR products
randomly chosen for sequencing were identified as the
correct D1-D2 regions (Table 1). Thus, we were able to
© 2013 John Wiley & Sons Ltd
463
recover the D1-D2 region of LSU-rDNA from nine of
twelve classes of Ciliophora (Cariacotrichea, Armophorea, and Karyorelictea excluded) in silico and in laboratory experiments, indicating good primer universality
within the ciliates.
Presence of a barcode gap in D1-D2
Ideally for a barcode, there should be a ‘barcode gap’,
for which genetic variation within a biological species
is lower than divergence among biological and cryptic
species (Hebert et al. 2003a). For the identification of
species in birds, Hebert et al. (2004) proposed that
within genera (congeneric) sequence divergences
should be one order of magnitude greater than within
species (conspecific) sequence divergence. Typically, in
a variety of animal phyla, the intraspecific COI divergence is less than 2%, while the average interspecific
COI sequence divergence is commonly more than 8%
(Hebert et al. 2003b).
For ciliates, a barcode gap for the D1-D2 region of
LSU-rDNA was demonstrated for tintinnid ciliates (Santoferrara et al. 2013). Here, we show that this gap also
occurs in closely related, and oftentimes cryptic, Paramecium species. The average conspecific D1-D2 variation is
0.18%, whereas congeneric sequence divergence averages 4.83%. In detail, 96.2% of the conspecific pairwise
sequence comparisons (n conspecific pairwise sequence
comparisons = 105) have a sequence divergence in the
D1-D2 region <0.6% (Fig. 1). Only four pairwise
sequence comparisons show a divergence that is >0.5%.
One pair of Paramecium bursaria (syngen three from
China and syngen five from Russia) exhibits 3.8%
sequence divergence in the D1-D2 region. A recent study
demonstrated that P. bursaria seems to be a species complex consisting of different species (Greczek-Stachura
et al. 2012). However, unlike the recognized species of
the P. aurelia complex, the P. bursaria complex is only
recognized and officially described as one species. We
therefore consider the different syngens of the P. bursaria
complex as one species, even though the D1-D2 fragment
of the LSU-rDNA confirms that P. bursaria is a cryptic
species complex. Three pairwise sequence comparisons
within P. multimicronucleatum show a D1-D2 sequence
divergence >0.6% (Fig. 1). Therefore, it is reasonable to
assume that also P. multimicronucelatum is a species
complex rather than one defined species. This is also
evidenced by COI and ITS gene analyses, in which
P. multimicronucleatum strains show high intraspecific
variations (Barth et al. 2006). Our data provide further
support that concerted efforts of ciliate taxonomists
should be to officially erect species complex status for
P. bursaria and P. multimicronucleatum and define individual species according to the Code of the International
464 T . S T O E C K , E . P R Z Y B O S a n d M . D U N T H O R N
100
90
Conspecific
Congeneric
% Specimen pairs
80
70
60
50
40
30
20
10
0
Fig. 1 D1-D2 LSU rDNA sequence divergence (%) between conspecific and congeneric pairs of Paramecium sequences (see
Table 1). The average conspecific D1-D2
variation is 0.18%, whereas congeneric
sequence divergence averages 4.83%. The
vast majority (n = 1561) of all congeneric
sequence pairs diverge for >1% in their
D1-D2 LSU region. While most (93.3%)
conspecific sequence pairs diverge not
more than 0.5%. Defining a barcode gap
at 0.6% sequence divergence in the D1-D2
region, c. 3.5% of all data have the potential of false assignments. The total number
of congeneric sequence divergence comparisons runs to 1845 and for conspecific
comparisons this number is 105.
Category (% sequence divergence)
Commission of Zoological Nomenclature (http://iczn.
org), as carried out for P. aurelia species.
In case of tintinnid ciliates, which are morphologically
identified by a lorica, not present in other ciliates, Santoferrara et al. (2013) used 1% sequence divergence (pairwise p-distance) in the D1-D2 region of the LSU-rDNA to
discriminate the maximum number of species. At this
cut-off, only 14% of all species could be falsely assigned.
We here identify a D1-D2 sequence divergence of <0.6%
as an ideal threshold to discriminate Paramecium species.
Using this definition, only 3.8% of all conspecific
sequence comparisons have the potential of false assignments. Likewise, in the congeneric D1-D2 sequence
analyses, 3.9% of all pairwise comparisons (n
total = 1845) show a divergence of <0.6% and could be
falsely assigned. Even though the vast majority of all congeneric sequence pairs (n congeneric Paramecium
sequence comparisons in this analysis = 1561) diverge
for >1% in their D1-D2 LSU-rDNA region, the risk of
false assignments would increase from 3.9% to 15% for
pairwise congeneric sequence comparisons when using a
sequence divergence cut-off of 1%.
The risk of falsely positive or negative assignment is
low compared with other cases without a true barcoding
gap. Just to name a few examples, in Lepidoptera of the
genus Agrodiaetus, overlaps in the range of intra- and
interspecific COI sequence divergence is 18% (Wiemers
& Fiedler 2007). In an analysis of more than 400 Diptera
species, the success rate of species identification using
COI was even lower than 70% (Meier et al. 2006), and
COI barcoding in marine gastropods show a 16% chance
of false assignments (Meyer & Paulay 2005). Also, Cnidaria show a much higher risk of false assignments (Hebert
et al. 2003b) and several orders of insects show substantial overlap in conspecific and congeneric COI sequence
divergence resulting in 45% false assignments (Cognato
2006). Hardly, any such comparative data are available
for protists. An exception are diatoms, that are subject
of relatively intense barcoding efforts (Moniz &
Kaczmarska 2009, 2010; Hamsher et al. 2011; Zimmermann et al. 2011; Saunders & McDevit 2012). Several
different barcode markers tested in distinct genera of diatoms show a much higher risk of false assignments due
to a larger overlap between conspecific and congeneric
sequence divergences (Moniz & Kaczmarska 2009). More
promising in diatoms seems the V4 region of the SSUrDNA, which identified almost all of the 123 limnetic
diatom species analysed by Zimmermann et al. (2011).
In cases where a barcoding gap does not exist, evolutionary models are suggested as alternative strategies for
species diagnosis (Austerlitz et al. 2009; Lou & Golding
2010). The phylogenetic analyses conducted with the Paramecium sequences confirm the suitability of the D1-D2
region as barcode marker for Paramecium (Fig. 2). With
one exception (Paramecium octaurelia), this evolutionary
model reliably resolves cryptic species and morphospecies. Using these molecular data, 61 species were inferred
to be monophyletic. The error rate of 3.1% is thus in the
same order of magnitude as for genetic distances. By
contrast, in a corresponding tree profile approach, which
relies on taxon sampling and the monophyly of species
rather than a barcoding gap, at least 16% of Agrodiaetus
specimens were misidentified (Wiemers & Fiedler 2007).
Our results for Paramecium and the D1-D2 region of LSUrDNA corroborate with the requirements of CBOL for
the performance of a genetic barcode marker.
Voucher depositions
One major advantage of ciliates compared with other
microbial eukaryotes is their relative ease of enrichment,
isolation and cultivation, although some species most
© 2013 John Wiley & Sons Ltd
D1-D2 REGION AS CILIATE BARCODE
465
Fig. 2 Neighbour-joining Kimura 2-parameter evolutionary model tree of the Paramecium sequences obtained and analysed in this
study. In cases with more than one sequence per species, the concept of a monophyletic species as prerequisite for barcoding is met.
One exception is the two strains of Paramecium octaurelia, which do not fall into other monophyletic clades, but which do not branch
together in monophyly. For details on tree construction, see Materials and methods section.
likely remain recalcitrant to the laboratory. Diagnostic
microscopy slides can thus be prepared from barcoded
and identified cultures for type species deposition, using
standard silver staining procedures (e.g., Foissner 1991).
Another advantage of ciliates is their relatively large cell
size, which makes them comparably easy to spot in environmental samples. This is helpful for ciliates that escape
cultivation efforts.
DNA barcoding of individual ciliates, though, results
in destroyed cells. Diagnostic images are therefore
suggested as being acceptable as depository material
(Pawlowski et al. 2012). To achieve this aim, we take
advantage of a method of Auinger et al. (2008), which
combines Lugol’s iodine staining of whole samples or
individual cells, followed by microscopy analyses and
imaging with subsequent single-cell PCR of the imaged
cell (Fig. S1, Supporting information). This way, a specific morphotype can be linked to a specific barcoded
genotype. We note that this strategy does not allow
© 2013 John Wiley & Sons Ltd
naming new species, but it is still useful for the identification of known morphotypes and deposited DNA barcodes and also helps to discover novel and undescribed
diversity.
Outlook
The primer set used in this study successfully amplified
the D1-D2 region of the LSU-rDNA from 73 ciliate species (Paramecium strains included) originating from seven
distinct ciliate classes. Also in silico analyses of available
ciliate LSU-rDNA sequences in public databases show
that a substantial proportion of these sequences include
the complementary annealing sites for the D1-D1-primer
pair tested in this study. However, considering the high
diversity of these protists, further primer tests with more
taxa will be necessary and when indicated, the modification of these primers or the design of novel primers
targeting this D1-D2 region. Likewise, further efforts will
466 T . S T O E C K , E . P R Z Y B O S a n d M . D U N T H O R N
be to evaluate whether conspecific and congeneric
distances in the D1-D2 region in other ciliate genera are
in the same order of magnitude as reported here for
Paramecium. Finally, it will be a major task to fill the ciliate D1-D2 barcode database with data. The number of
globally described free-living ciliate species is about 4500
(Foissner 2008) included in c. 1500 genera (Aescht 2001).
Estimates are that the number of free-living ciliate
species may be even as high as 40 000 (Foissner et al.
2008). This sharply contrasts with the number of D1-D2
rDNA sequences of described ciliate species deposited in
public databases (n = 65 in Genbank database on April
30, 2013). Even though this latter task will be a major
basic research endeavour, which requires the contribution of numerous scientists in this field, it will lay the
cornerstone for numerous applications and pave the way
for ciliate species diagnosis in a variety of fields with
high relevance for science, economy and politics.
Acknowledgements
Funding for this study came from the Deutsche Forschungsgemeinschaft (DFG grant STO414/3-1) to T.S. and
(DFG grant DU1319/1-1) to M.D. The authors thank
Tobias Siemensmeyer, Franziska G€
odecke and Isabell
Trautmann for help with labwork. Furthermore, we
express our gratitude to Bettina Sonntag (University of
Innsbruck, Austria) and Wilhelm Foissner (University
of Salzburg, Austria) for the identification and providing
of ciliate species for gene analyses. We also thank Alexey
Potekhin (St. Petersburg State University, Russia) for
strains of Paramecium bursaria, P. calkinsi, P. polycarium,
P. putrinum, and P. woodruffi from Core Facilities Centre
“Culture Collection of Microorganisms” used in the
studies.
References
Adl SM, Simpson AG, Lane CE et al. (2012) Revised classification of the
protists. Journal of Eukaryotic Microbiology, 59, 429–493.
Aescht E (2001) Catalogue of the generic names of ciliates (Protozoa, Ciliophora). Denisia, 1, 1–350.
April J, Mayden RL, Hanner RH, Bernatchez L (2011) Genetic calibration
of species diversity among North America’s freshwater fishes. Proceedings of the National Academy of Science USA, 108, 10602–10607.
Auinger BM, Pfandl K, Boenigk J (2008) Improved methodology for identification of protists and microalgae from plankton samples preserved
in Lugol’s iodine solution: combinig microscropic analysis with singlecell PCR. Applied and Environment Microbiology, 74, 2505–2510.
Aury JM, Jaillon O, Duret L et al. (2006) Global trends of whole-genome
duplications revealed by the ciliate Paramecium tetraurelia. Nature, 444,
171–178.
Austerlitz F, David O, Schaeffer B et al. (2009) DNA barcode analysis: a
comparison of phylogenetic and statistical classification methods.
BMC Bioinformatics, 10, S10.
Azam F, Fenchel T, Field JG et al. (1983) The ecological role of watercolumn microbes in the sea. Marine Ecology Progress Series, 10, 257–263.
Barth D, Krenek S, Fokin SI, Berendonk TU (2006) Intraspecific genetic
variation in Paramecium revealed by cytochrome c oxidase I sequences.
Journal of Eukaryotic Microbiology, 53, 20–25.
Barth D, Tischer K, Berger H, Schlegel M, Berendonk TU (2008) High
mitochondrial haplotype diversity of Coleps sp. (Ciliophora: Prostomatida). Environmental Microbiology, 10, 626–634.
Borisenko AV, Lim BK, Ivanova NV, Hanner RH, Hebert PDN (2008)
DNA barcoding in surveys of small mammal communities: a field
study in Suriname. Molecular Ecology Resources, 8, 471–479.
Burns JM, Janzen DH, Hajibabaei M, Hallwachs W, Hebert PDN (2005)
DNA barcodes and cryptic species of skipper butterflies in the genus
Perichares in Area de Conservacio ́ n Guanacaste, Costa Rica. Proceedings of the National Academy of Science USA, 105, 6350–6355.
Chantangsi C, Lynn DH, Brandl MT et al. (2007) Barcoding ciliates: a
comprehensive study of 75 isolates of the genus Tetrahymena.
International Journal of Systematic and Evolutionary Microbiology, 57,
2412–2425.
Cochrane G, Karsch-Mizrachi I, Nakamura Y, International Nucleotide
Sequence Database Collaboration (2011) The International Nucleotide
Sequence Database Collaboration. Nucleic Acids Research, 39, D15–18.
Cognato AI (2006) Standard percent DNA sequence difference for insects
does not predict species boundaries. Journal of Economic Entomology,
99, 1037–1045.
Corliss JO (2002) Biodiversity and biocomplexity of the protists and an
overview of their significant roles in maintenance of our biosphere.
Acta Protozoologica, 41, 199–219.
Dolan JR, Montagnes DJS, Agatha S, Coats DW, Stoecker DK (2013) The
Biology and Ecology of Tintinnid Ciliates: Models for Marine Plankton. John
Wiley & Sons, Ltd, Chichester.
Dunthorn M, Katz LA (2008) Richness of morphological hypotheses in
ciliate systematics allows for detailed assessment of homology and
comparisons with gene trees. Denisia, 23, 389–394.
Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797.
Epstein S, L
opez-Garcıa P (2008) “Missing” protists: a molecular prospective. Biodiversity and Conservation, 17, 261–276.
Finlay BJ, Fenchel T (1996) Ecology: role of ciliates in the natural environment. In: Ciliates: Cells as Organisms (eds Hausmann K, Bradbury PC),
pp. 417–440. Gustav Fischer, Stuttgart.
Foissner W (1991) Basic light and scanning electron microscopic methods
for taxonomic studies of ciliated protozoa. European Journal of Protistology, 27, 313–330.
Foissner W (2008) Protist diversity and distribution: some basic considerations. Biodiversity and Conservation, 17, 235–242.
Foissner W, Chao A, Katz LA (2008) Diversity and geographic distribution of ciliates (Protista: Ciliophora). Biodiversity and Conservation, 17,
345–363.
Gentekaki E, Lynn DH (2009) High-level genetic diversity but no population structure inferred from nuclear and mitochondrial markers
of the peritrichous ciliate Carchesium polypinum in the Grand River
Bason (North America). Applied and Environment Microbiology, 75,
3187–3195.
Gong J, Dong J, Liu X, Massana R (2013) Extremely high copy numbers
and polymorphisms of the rDNA operon estimated from single cell
analysis of oligotrich and peritrich ciliates. Protist, 164, 369–379.
Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic
tree building. Molecular Biology and Evolution, 27, 221–224.
Greczek-Stachura M, Potekhin A, Przybos E et al. (2012) Identification of
Paramecium bursaria syngens through molecular markers – comparative analysis of three loci in the nuclear and mitochondrial DNA. Protist, 163, 671–685.
Guerra-Garcıa JM, Espinosa F, Garcıa-G
omez JC (2008) Trends in taxonomy today: an overview about the main topics in taxonomy. Zoologica
Baetica, 19, 15–49.
Hamsher SE, Evans KM, Mann DG, Poulickova A, Saunders GW (2011)
Barcoding diatoms: exploring alternatives to COI-5P. Protist, 162,
405–422.
© 2013 John Wiley & Sons Ltd
D1-D2 REGION AS CILIATE BARCODE
Hebert PDN, Gregory TR (2005) The promise of DNA barcoding for
taxonomy. Systematic Biology, 54, 852–859.
Hebert PD, Cywinska A, Ball SL, deWaard JR (2003a) Biological identifications through DNA barcodes. Proceedings of the Royal Society of
London. Series B: Biological Sciences, 270, 313–321.
Hebert PDN, Ratnasingham S, de Waard JR (2003b) Barcoding animal
life: cytochrome c oxidase subunit 1 divergences among closely related
species. Proceedings of the Royal Society of London, Series B: Biological
Sciences, 270, S96–S99.
Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM (2004) Identification
of birds through DNA Barcodes. PLoS Biology, 2, e312.
Israel RL, Kosakovsky Pond SL, Muse SV, Katz LA (2002) Evolution
of duplicated alpha-tubulin genes in ciliates. Evolution, 56, 1110–
1122.
Jahn CL, Klobutcher LA (2002) Genome remodeling in ciliated protozoa.
Annual Reviews in Microbiology, 56, 489–520.
Katz LA, Bornstein JG, Lasek-Nesselquist E, Muse SV (2004) Dramatic
diversity of ciliate histone H4 genes revealed by comparisons of patterns of substitutions and paralog divergences among eukaryotes.
Molecular Biology and Evolution, 21, 555–562.
Kher CP, Doerder FP, Cooper J et al. (2011) Barcoding Tetrahymena: discriminating species and identifying unknowns using the cytochrome c
oxidase subunit 1 (cox-1) barcode. Protist, 162, 2–13.
Koonin EV (2010) The origin and early evolution of eukaryotes in the
light of phylogenomics. Genome Biology, 11, 209.
Kress WJ, Wurdack K, Zimmer EA, Weigt LA, Janzen DH (2005) Use of
DNA barcodes to identify flowering plants. Proceedings of the National
Academy of Science USA, 102, 8369–8374.
Lou M, Golding BG (2010) Assigning sequences to species in the absence
of large interspecific differences. Molecular Phylogenetics and Evolution,
56, 187–194.
Lynn DH (2008) The Ciliated Protozoa: Characterization, Classification, and
Guide to the Literature, 3rd edn. Springer, Dordrecht.
Lynn DH, Pinheiro M (2009) A survey of polymerase chain reaction
(PCR) amplification studies of unicellular protists using single-cell
PCR. Journal of Eukaryotic Microbiology, 56, 406–412.
Lynn DH, Str€
uder-Kypke M (2006) Species of Tetrahymena identical by
small subunut rRNA gene sequences are discriminated by mitochondrial cytochrome c oxidase I gene sequences. Journal of Eukaryotic
Microbiology, 53, 385–387.
Maddison WP, Maddison DR (1992) MacClade: Analysis of Phylogeny and
Character Evolution. Sinauer Associates Inc., Sunderland, MA.
Meier R, Shiyang K, Vaidya G, Ng PKL (2006) DNA barcoding and taxonomy in diptera: a tale of high intraspecific variability and low identification Success. Systematic Biology, 55, 715–728.
Meyer C, Paulay G (2005) DNA barcoding: error rates based on comprehensive sampling. PLoS Biology, 3, e422.
Moniz MBJ, Kaczmarska IA (2009) Barcoding diatoms: is there a good
marker? Molecular Ecology Resources, 9, 65–74.
Moniz MB, Kaczmarska I (2010) Barcoding of diatoms: nuclear encoded
ITS revisited. Protist, 161, 7–34.
Nanney DL (1999) When is a rose?: the kinds of Tetrahymena. In: Species:
New Interdisciplinary Essays (ed. Wilson RA), pp. 93–118. The MIT
Press, Cambridge.
Nanney DL (2004) No trivial pursuit. BioScience, 54, 720–721.
Nebel M, Wild S, Holzhauser M et al. (2011) JAguc - a software package
for environmental diversity estimates. Journal of Bioinformatics and
Computational Biology, 9, 749–773.
Orsi W, Edgcomb V, Faria J et al. (2012) Class Cariacotrichea, a novel ciliate taxon from the anoxic Cariaco Bason, Venezuela. International Journal of Systematic and Evolutionary Microbiology, 62, 1425–1433.
Patterson DJ (1999) The diversity of eukaryotes. The American Naturalist,
154, 96–124.
Pawlowski J, Lecroq B (2010) Short rDNA barcodes for species identification in Foraminifera. Journal of Eukaryotic Microbiology, 57, 197–205.
Pawlowski J, Audic S, Adl S et al. (2012) CBOL Protist Working Group:
barcoding eukaryotic richness beyond the animal, plant, and fungal
kingdoms. PLoS Biology, 10, e1001419.
© 2013 John Wiley & Sons Ltd
467
Przybos E, Barth D, Berendonk TU (2010) Paramecium sexaurelia – intraspecific polymorphism and relationships with other Paramecium aurelia
spp., revealed by cytochrome b sequence data. Folia Biologica (Krakow),
58, 55–60.
Santoferrara L, McManus GB, Alder VA (2013) Utility of genetic markers
and morphology for species discrimination within the order Tintinnida (Ciliophora, Spirotrichea). Protist, 164, 24–36.
Saunders GW, McDevit DC (2012) Methods for DNA barcoding photosynthetic protists emphasizing the macroalgae and diatoms. Methods
in Molecular Biology, 858, 207–222.
Schander C, Willassen E (2005) What can biological barcoding do for
marine biology? Marine Biology Research, 1, 79–83.
Seifert KA, Samson RA, deWaard JR et al. (2007) Prospects for fungus
identification using CO1 DNA barcodes, with Penicillium as a test case.
Proceedings of the National Academy of Science USA, 104, 3901–3906.
Simon EM, Nanney DL, Doerder FP (2008) The “Tetrahymena pyformis”
complex of cryptic species. Biodiversity and Conservation, 17, 365–380.
Simpson AGB, Roger AJ (2004) The real ‘kingdoms’ of eukaryotes.
Current Biology, 14, R693–R696.
Sonneborn TM (1937) Sex, sex inheritance and sex determination in
Paramecium aurelia. Proceedings of the National Academy of Science USA,
23, 378–383.
Sonneborn TM (1957) Breeding systems, reproductive methods, and
species problems in protozoa. In: The Species Problem (ed. Mayr E),
pp. 155–324. American Association for the Advancement of Science,
Washington DC.
Sonnenberg R, Nolte AW, Tautz D (2007) An evaluation of LSU rDNA
D1-D2 sequences for their use in species indentification. Frontiers in
Zoology, 4, 6.
Stoeck T, Bruemmer F, Foissner W (2007) Evidence for local ciliate endemism in an alpine anoxic lake. Microbial Ecology, 54, 478–486.
Str€
uder-Kypke MC, Lynn DH (2010) Comparative analysis of the
mitochondrial cytochrome c oxidase subunit 1 (CO1) gene in ciliates
(Alveolata, Ciliophora) and evaluation of its suitability as a biodiversity marker. Systematics and Biodiversity, 8, 131–148.
Wiemers M, Fiedler K (2007) Does the DNA barcoding gap exist? – a case
study in blue butterflies (Lepidoptera: Lycaenidae). Frontiers in Zoology, 4, 8.
Zimmermann J, Jahn R, Gemeinholzer B (2011) Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new
primers and protocols. Organisms Diversity & Evolution, 11, 173–192.
T.S. conceived and designed the study, E.P. collected,
identified and provided Paramecium strains, M.D. and
T.S. contributed to laboratory work, T.S. analysed data,
T.S. and M.D. wrote manuscript, T.S. and M.D. supervised the work.
Data Accessibility
Sequences were deposited in the GenBank database
under Accession nos KF287645- KF287652 (see Table 1)
and KF287661- KF287723 (see Table 2). Phylogenetic tree
is available from TreeBase under http://purl.org/
phylo/treebase/phylows/study/TB2:S14701.
Supporting Information
Additional Supporting Information may be found in the online
version of this article:
468 T . S T O E C K , E . P R Z Y B O S a n d M . D U N T H O R N
Fig. S1 Flow chart for barcoding ciliates. Single cells are isolated
from environmental samples, enrichments or pure cultures,
stained with 10% LUGOL solution and photographed under the
light microscope. The same individual target cells are destained
in sodium thiosulphate for protocol see (Auinger et al. 2008) and
subjected to PCR with primers targeting the D1-D2 region of
the LSU rDNA. Gene fragments are Sanger-sequenced and
deposited as voucher along with other information (Pawlowski
et al. 2012).
Table S1 Ciliates including the D1-primer region or the D2-primer region or the complete D1-D2 fragment of the LSU rDNA
and accession numbers available in GenBank (April 30, 2013)
and used for in silico primer analysis.
© 2013 John Wiley & Sons Ltd