The Plant Cell, Vol. 24: 3009–3025, July 2012, www.plantcell.org ã 2012 American Society of Plant Biologists. All rights reserved.
The CRYPTOCHROME1-Dependent Response to Excess
Light Is Mediated through the Transcriptional Activators ZINC
FINGER PROTEIN EXPRESSED IN INFLORESCENCE
MERISTEM LIKE1 and ZML2 in Arabidopsis
C W
Jehad Shaikhali,a Juan de Dios Barajas-Lopéz,a Krisztina Ötvös,a,b Dmitry Kremnev,a Ana Sánchez Garcia,a
Vaibhav Srivastava,c Gunnar Wingsle,c Laszlo Bako,a and Åsa Stranda,1
a Umeå
Plant Science Centre, Department of Plant Physiology, Umeå University, S-901 87 Umea, Sweden
of Plant Biology, Biological Research Center, Hungarian Academy of Sciences, H-6726 Szeged, Hungary
c Umeå Plant Science Centre, Department of Forest Genetics and Plant Physiology, Swedish University of Agricultural Sciences,
S-901 87 Umea, Sweden
b Institute
Exposure of plants to light intensities that exceed the electron utilization capacity of the chloroplast has a dramatic impact
on nuclear gene expression. The photoreceptor Cryptochrome 1 (cry1) is essential to the induction of genes encoding
photoprotective components in Arabidopsis thaliana. Bioinformatic analysis of the cry1 regulon revealed the putative ciselement CryR1 (GnTCKAG), and here we demonstrate an interaction between CryR1 and the zinc finger GATA-type
transcription factors ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM LIKE1 (ZML1) and ZML2. The
ZML proteins specifically bind to the CryR1 cis-element as demonstrated in vitro and in vivo, and TCTAG was shown to
constitute the core sequence required for ZML2 binding. In addition, ZML2 activated transcription of the yellow fluorescent
protein reporter gene driven by the CryR1 cis-element in Arabidopsis leaf protoplasts. T-DNA insertion lines for ZML2 and its
homolog ZML1 demonstrated misregulation of several cry1-dependent genes in response to excess light. Furthermore, the
zml1 and zml2 T-DNA insertion lines displayed a high irradiance-sensitive phenotype with significant photoinactivation of
photosystem II (PSII), indicated by reduced maximum quantum efficiency of PSII, and severe photobleaching. Thus, we
identified the ZML2 and ZML1 GATA transcription factors as two essential components of the cry1-mediated photoprotective
response.
INTRODUCTION
Plants can detect almost all facets of light, including direction,
intensity, duration, and wavelength using three major classes of
photoreceptors: the red/far-red light absorbing phytochromes,
the blue/UV-A light absorbing cryptochromes and phototropins,
and the UV-B sensing UV-B receptors. These photoreceptors
perceive light signals and initiate intracellular signaling pathways
and large-scale reorganization of the transcriptional program to
modulate plant growth and development (Chen et al., 2004).
Arabidopsis thaliana cryptochromes cry1 and cry2 are well
characterized and regulate several aspects of growth and development (Li and Yang, 2007). The more divergent member
of the family, cry3, is localized to the organelles and was reported to be involved in single-stranded DNA repair (Kleine et al.,
2003; Pokorny et al., 2008). Cry2 undergoes degradation following light activation via ubiquitylation and targeting to the
1 Address
correspondence to [email protected].
The author responsible for distribution of materials integral to the findings
presented in this article in accordance with the policy described in the
Instructions for Authors (www.plantcell.org) is: Åsa Strand (asa.strand@
plantphys.umu.se).
C
Some figures in this article are displayed in color online but in black and
white in the print edition.
W
Online version contains Web-only data.
www.plantcell.org/cgi/doi/10.1105/tpc.112.100099
proteasome (Lin et al., 1998; Yu et al., 2007), whereas cry1 is
stable in bright light (Ahmad and Cashmore, 1993). Thus, cry1 is
responsible for seedling deetiolation in high fluence rates of blue
light, and cry2 mediates flowering time and deetiolation in response to lower fluence rates (Ahmad and Cashmore, 1993; Lin
et al., 1998). It has also been demonstrated that cry1 plays
a critical role in the photoprotective response to excess light
(Kleine et al., 2007). Cry1 is present in the nucleus, and although
having considerable effects on transcriptional activity, cry1 is
not known to bind DNA (Cashmore et al., 1999; Lin and Shalitin,
2003). Some of the cry1 action on the transcription level has
been attributed to its interaction with CONSTITUTIVE PHOTOMORPHOGENIC1 (COP1). The cry1-COP1 interaction is light
dependent and suppresses the activity of COP/DEETIOLATED
proteins, thereby allowing light-activated transcription (Wang
et al., 2001; Yang et al., 2001). Cry1 has also been shown to be
present in the cytosol (Yang et al., 2000). It has been suggested
that cry1 may be involved in both nuclear and cytosolic events,
and it is possible that there are separate functions for nuclear
and cytoplasmic cry1 (Wu and Spalding, 2007).
Genetic screens have revealed several regulators in the
cryptochrome-mediated light signaling pathway; a blue light–
specific Ser/Thr protein phosphatase (PP7) has been isolated
(Møller et al., 2003), and SHORT UNDER BLUE1 is a cytoplasmic calcium binding protein with a major function in cryptochrome
signaling but that also modulates phyA-mediated signaling (Guo
3010
The Plant Cell
et al., 2001). Cry1 inhibits COP1-mediated degradation of a
MYB transcription factor, BIT1, to activate blue light–dependent
gene expression (Duek and Fankhauser, 2003; Hong et al.,
2008). Furthermore, HFR1, a basic helix-loop-helix protein
identified as a component in the far-red signaling has been
demonstrated to be crucial for regulating global gene expression
in response to cry1-mediated early blue light response (Duek
and Fankhauser, 2003). In addition, HYPERSENSITIVE TO RED
AND BLUE1, SHORT HYPOCOTYL UNDER BLUE1, and OBF
BINDING PROTEIN3 have been shown to act both in red and
blue signaling pathways (Kang et al., 2005; Ward et al., 2005;
Kang and Ni, 2006). Photoexcited cry2 was found to interact
with CRYPTOCHROME-INTERACTING BASIC-HELIX-LOOPHELIX1 to regulate transcription and initiation of flowering (Liu
et al., 2008). In addition, cry1 has been shown to interact directly
with ZTL/LKP1/ADO1 in yeast two-hybrid assays and in vitro
pull-down tests (Kiyosue and Wada, 2000; Somers et al., 2000;
Jarillo et al., 2001). ZTL/LKP1/ADO1 is a protein that was originally identified in a study of the circadian clock in Arabidopsis,
and ZTL/LKP1/ADO1 plays an important role in regulating the
circadian clock and photoperiodic flowering in Arabidopsis
(Somers et al., 2000). Thus, cryptochromes are involved in numerous aspects of plant growth and development.
Cry1 has also been assigned a role in plant stress responses,
and analysis of the high irradiance response of the photoreceptor mutants phyA, phyB, cry1, and cry2 revealed a function
of cry1 in mediating plant responses to high irradiances (Kleine
et al., 2007). In Arabidopsis, cry1 regulates a large number of
genes in response to excess light, and as a consequence of the
misregulation of these genes the cry1 mutant displayed a high
irradiance-sensitive phenotype with significant photoinactivation
of photosystem II (PSII) (Kleine et al., 2007). Thus, in addition to
a role in photomorphogenesis, cry1 is essential to the induction
of photoprotective mechanisms against high light stress (Kleine
et al., 2007; Li et al., 2009). Numerous array experiments have
shown that exposure to excess light results in dramatic changes
in gene expression in plants (Kimura et al., 2001; Rossel et al.,
2002; Richly et al., 2003; Kleine et al., 2007). A significant
number of these excess light–regulated genes depend on the
action of cry1 for correct regulation and 26 of those genes were
also LONG HYPOCOTYL5 (HY5) dependent (Kleine et al., 2007).
The cry1-dependent genes encode components of the protective
mechanisms against light stress, such as several enzymes in the
phenylpropanoid pathway, EARLY LIGHT INDUCED PROTEIN1
(ELIP1) and ELIP2, GPX7 that encodes a putative glutathione
peroxidase, the glutathione S-transferase ERD9, and a MYB
family transcription factor (At5g49330). Bioinformatics studies
performed on the HY5-independent cry1 regulon revealed that
two previously undescribed cis-elements, CryR1 (GnTCkAG)
and CryR2 (ACATAwCT), were enriched in the list of cry1dependent genes responding to excess light (Kleine et al.,
2007). CryR1 was significantly enriched in the promoters of
genes induced by excess light in the wild type, suggesting
interaction with an activator of gene expression (Kleine et al.,
2007).
Although cry1 plays an essential role in mediating plant
responses to high irradiances, HY5 is the only transcription
factor responding to cry1 that has been identified to play a role
under these conditions (Kleine et al., 2007). Thus, to discover
nuclear components involved in the cry1-mediated signaling
pathway in response to excess light, we used a biochemical
approach and identified interaction between the GATA-type
transcription factor ZINC FINGER PROTEIN EXPRESSED IN
INFLORESCENCE MERISTEM LIKE2 (ZML2; also known as
TIFY2a) (Vanholme et al., 2007) and the CryR1 cis-element. We
confirmed binding and specificity of ZML2 and its homolog
ZML1 (TIFY2b) to the CryR1 cis-element in vitro and in vivo. We
also demonstrate a function of ZML2 as a trans-activation factor. T-DNA insertion lines for ZML2 and ZML1 demonstrated
an excess light-sensitive phenotype, increased accumulation of
reactive oxygen species (ROS), and misregulation of several
cry1-dependent genes in response to excess light. Thus, we
identified two key regulators, ZML2 and ZML1, of gene expression in the cry1-dependent response to excess light.
RESULTS
Identification of a Transcription Factor Binding to the
Putative CryR1 cis-Element
To test whether a nuclear protein(s) recognizes the putative
CryR1 cis-element, oligonucleotides corresponding to the CryR1
element (GAAAAAGTTCTAGAATTTTTT) were used in electrophoretic mobility shift assays (EMSAs). Nuclear protein extracts
for EMSA were prepared from wild-type plants grown under
control conditions. When nuclear protein extracts were incubated with biotin-labeled CryR1 oligonucleotides, a DNAprotein complex with slower mobility in EMSA was observed
(see Supplemental Figure 1 online).
To identify the transcription factor(s) responding to the cry1mediated signal and interacting with the putative cis-element
CryR1, we used a biochemical approach where a DNA fragment
containing the cis-element of interest was tagged with biotin and
linked to microbeads via interaction with streptavidin (Figure 1)
(Gabrielsen et al., 1989; Rey et al., 2003). The 218-bp DNA
promoter fragment containing the CryR1 putative cis-element
was amplified from the R2R3 transcription factor (At5g49330)
(Figure 2) representing one of the genes responding to excess
light in a cry1-dependent manner. MatInspector analysis for ciselements within the 218-bp CryR1-containing promoter fragment revealed the presence of DOF, MADS box, GT-box, GAGA,
L1-box, W-box, heat shock, homeobox, and AS1/AS2 elements
(http://www.genomatix.de).
Nuclear proteins were prepared from wild-type plants exposed to control conditions and to excess light. The two different sample types of nuclear proteins were incubated together
with the DNA fragment containing the CryR1 cis-elements, and
the proteins binding to the DNA fragment were isolated and
identified using mass spectrometry. Using this approach, we
identified an interaction between ZML2 (At1g51600) and the
CryR1 element (Table 1). ZML2 was identified in both the control
sample and the sample exposed to excess light (Table 1). The
ZML2 protein belongs to the GATA-type zinc finger family, and
ZIM was originally identified in Arabidopsis due to its pronounced expression in flowers and flower buds (Nishii et al.,
ZML1/2, Key Components of the Photoprotective Response
Figure 1. Schematic Outline of the Method for Affinity Trapping of DNA
Binding Proteins.
PCR amplification of a promoter region of interest where primer1 was
modified with biotin. The biotinylated PCR product was immobilized on
streptavidin-coated magnetic beads. Nuclear proteins from Arabidopsis
were incubated with the DNA fragment linked to the beads to allow interaction between the protein(s) and the DNA. To eliminate binding
of nonspecific proteins, several washing steps were performed. DNA
binding proteins were eluted from the complex using high salt buffer.
3011
(Figure 2C). Furthermore, we demonstrated that ZML2 binds
specifically to the CryR1 cis-element using a 21-bp DNA fragment containing the CryR1 element (Figure 2D). To determine
the core sequence that is essential for ZML2 binding of the
CryR1 cis-element, mutations were introduced into this element
(Figure 2A) and in vitro binding to ZML2 was tested by EMSA.
Changing the sequence of the CryR1 cis-element from
GTTCTAG to TGGTGGT (M1) abolished DNA binding of the
ZML2 protein to the CryR1 target completely. Similarly to M1,
M3 in which TCT of the CryR1 element were mutated to GTG
and M4 in which the nucleotides AGA were mutated to GTG
resulted in loss of DNA binding (Figure 2E). By contrast, mutation of AGT to GTG (M2) did not abolish ZML2 binding (Figure
2E). Taken together, these results indicate that the CryR1 ciselement is the target motif for the ZML2 transcription factor and
that the core sequence required for binding is TCTAG. Our
results also validate the method used to trap DNA binding
proteins. This biochemical approach was previously proven
successful in bacterial and yeast systems (Gabrielsen et al.,
1989; Rey et al., 2003), and our results demonstrate that it is
possible to successfully apply this technique also on the more
complex plant material.
Arabidopsis plants overexpressing ZIM (ZIM-ox) were shown
to upregulate a significant number of genes compared with the
wild type when grown under control conditions (Shikata et al.,
2004). We analyzed 500 bp from the ATG site of the promoters
of these genes and found that the CryR1 cis-element was
overrepresented in the promoters of the genes upregulated in
the ZIM-ox plants (see Supplemental Table 1 online). In 92%
of the promoters, the CryR1 cis-element showed 71 to 100%
identity to GTTCTAG, which is the sequence of the CryR1
cis-element in the promoter of R2R3, and the CryR1 ciselement occurred at least twice in 62% of the promoters (see
Supplemental Table 1 online). This suggests that ZIM and ZMLs
recognize and bind to the same cis-element.
Subcellular Localization of ZML2
2000). There are two ZIM homologs, ZML1 and ZML2, and these
three proteins form a separate group when compared with the
other typical GATA-type proteins (Teakle et al., 2002). The zinc
finger domains of ZIM, ZML1, and ZML2 have 20 residues between the two Cys pairs (C-X2-C-X20-C-X2-C), while those of the
other Arabidopsis GATA factors all have 18 residues (Shikata
et al., 2004).
EMSAs Confirmed Binding of ZML2 to the CryR1
cis-Element
EMSA was performed to confirm the interaction between the
isolated protein and the DNA fragment used as bait in the biochemical approach. Full-length cDNA of ZML2 was expressed
as a His-tagged protein in Escherichia coli, and the ability of the
fusion protein to bind specific DNA fragments was examined
(Figure 2A). Binding was not detected in the presence of control
lysate from E. coli bacterial cells transformed with an empty
expression vector, pET100D (Figure 2B). The ZML2 protein was
demonstrated by EMSA to bind to the 218-bp DNA fragment
containing the CryR1 cis-element used in the biochemical assay
ZML2 was isolated as a nuclear protein binding to the CryR1
element, and it contains a basic residue-rich region indicating
a putative NLS. The subcellular localization of ZML2 protein was
investigated in transiently transfected protoplasts from Arabidopsis using confocal laser scanning microscopy. The ZML2:
CFP (for cyan fluorescent protein) fusion protein was transfected
into the protoplasts either separately or with the nuclearlocalized bZIP transcription factor, ABI5 (Lopez-Molina et al.,
2003; Shaikhali et al., 2008). Detection of ZML2:CFP and ABI5:
YFP (for yellow fluorescent protein) fusion proteins demonstrated that both proteins were distributed exclusively to the
nucleus (Figure 3). The fluorescence distribution of ZML2:CFP in
the nucleus was consistent with expected nuclear localization of
this protein and confirms that ZML2 is localized to the nucleus.
Chromatin Immunoprecipitation Analysis Reveals in Vivo
Binding of ZML2 to the CryR1 Element
To investigate if ZML2 is also able to bind the CryR1 element in
vivo, chromatin immunoprecipitation (ChIP) assays were performed
3012
The Plant Cell
Figure 2. Characterization of DNA Binding of Recombinant ZML2 Protein.
(A) Nucleotide sequence of the 218-bp fragment containing the CryR1 cis-element from the promoter of R2R3 family transcription factor and the upper
strand sequence of the synthetic double-stranded oligonucleotide containing CryR1 cis-element or its mutagenized variants used as probes.
(B) EMSA of lysate from E. coli transformed with pET100D empty expression vector and the 218-bp CryR1 fragment.
(C) to (E) EMSA of recombinant ZML2 protein with 218-bp CryR1 fragment (C), CryR1 cis-element (D), and its mutagenized variants (E). Positions of
free DNA probes and DNA-protein complexes are indicated by arrows.
using Arabidopsis protoplasts (Lee et al., 2007). The fusion protein
HA-ZML2 was expressed in Arabidopsis protoplasts under dark
and light conditions (Figure 4A). Interestingly, the level of ZML2
was much higher in light compared with the dark-grown samples.
For ChIP analysis, Arabidopsis protoplasts were transfected with
HA-ZML2 fusion protein or a mock control and incubated in light
for 16 to 24 h. At the end of the incubation time, chromatin
complexes were cross-linked with formaldehyde and the chromatin was fragmented by sonication and incubated with anti-HA
monoclonal antibody. The immunoprecipitated complexes were
captured with protein G-coated magnetic beads. PCR analysis
performed on the DNA eluted from the beads revealed that R2R3
promoter fragments containing CryR1 element, F2 and F5, were
enriched in the ChIP samples prepared with the anti-HA compared with the mock control (Figure 4B). By contrast, no PCR
product was amplified using primers designed for the lateral rootspecific promoter (At2g42430), indicating that these sequences were
absent from the immunoprecipitated chromatin (Figure 4B). Taken
Table 1. ZML2 Was Identified to Interact with the CryR1 cis-Element
cis-Element
Protein
Samples in Which Peptide Was Identified
Peptide
CryR1 (GTTCTAG)
At1g51600
ZML2 transcription factor
Control light
Exposure to excess light
YTVRKEVALR*
Complete Mascot score result and ion spectra for the ZML2 identification in control sample are available in Supplemental Figure 9 online. The asterisk
indicates that the same peptide was also identified in samples exposed to excess light.
ZML1/2, Key Components of the Photoprotective Response
3013
effector plasmid carried the ZML2 cDNA driven by cauliflower
mosaic virus (CaMV) 35S promoter, and in the reporter plasmid,
the YFP gene was linked to the 218-bp fragment of the R2R3
promoter containing CryR1 (Figure 4C). An empty effector
plasmid was used as a negative control. A vector containing the
CaMV35S:CFP was cotransfected in each experiment as a control for transfection efficiency (Figure 4C). The ZML2 protein
transactivated expression of the YFP reporter gene in Arabidopsis
protoplasts. The YFP expression was eightfold higher compared
with the empty vector control (Figure 4D). Thus, the putative
CryR1 cis-element identified using bioinformatics (Kleine et al.,
2007) was demonstrated to be biologically active. Furthermore,
ZML2 functions as a transcriptional activator in the cry1-mediated
response to excess light, which is in agreement with the bioinformatic analysis that demonstrated that CryR1 was significantly enriched in the promoters of genes induced by excess
light in a cry1-dependent manner.
The zml Mutants Showed Impaired Regulation of Genes in
the cry1 Regulon
Figure 3. Subcellular Localization of ZML2 Fusion Protein in Arabidopsis
Protoplasts.
Confocal laser scanning microscope images of ZML2-CFP and ABI5YFP coexpressed transiently in Arabidopsis protoplasts. Transmitted
light image (A), chlorophyll fluorescence image (B), ZML2-CFP image
(C), ABI5-YFP image (D), and merged image of (A) to (D) in (E). CFP
signal is shown in blue, YFP signal is shown in yellow, and the chloroplast (chlorophyll) autofluorescence is shown in red. Bars = 10 mm.
together, the ChIP assay indicates that ZML2 specifically binds the
R2R3 promoter in vivo and most likely to the CryR1 cis-element.
Transactivation Assays Demonstrated That ZML2 Activates
Gene Expression via the CryR1 cis-Element
We demonstrated that ZML2 interacts with the CryR1 element in
vitro and in vivo by EMSA and ChIP, respectively. CryR1 was
significantly enriched in the promoters of genes induced by
excess light in the wild type, suggesting interaction with an
activator of gene expression (Kleine et al., 2007). To determine
whether the ZML2 protein could transactivate transcription, we
performed a transactivation assay using protoplasts prepared
from Arabidopsis leaves. The protoplasts were cotransfected
with an effector plasmid and a reporter plasmid (Figure 4C). The
To demonstrate whether the identified interaction between ZML2
and the CryR1 cis-element was biologically significant, we obtained T-DNA insertion lines for ZML2; zml2-1 and zml2-2, and
ZML1; zml1 and ZIM; zim. The presence of the T-DNA insertions
was confirmed by PCR (see Supplemental Figure 2 online). RNA
was isolated from homozygous plants, and quantitative RT-PCR
analysis confirmed the absence of ZML2, ZML1, and ZIM transcripts in the T-DNA insertion lines (see Supplemental Figure 2
online). Under normal growth conditions, no obvious phenotype
could be observed in the zml2, zml1, and zim mutants. The expression of ZML1 and ZIM in the zml2 mutant and vice versa was
not altered compared with the wild type or the cry1 mutant (see
Supplemental Figure 3 online). Furthermore, no significant change
in expression of the ZML1/2 or ZIM could be detected following
exposure to excess light in the wild type or in the mutant lines (see
Supplemental Figure 3 online).
Expression of four marker genes in the cry1-dependent regulon containing the CryR1 cis-element in their promoters and
two marker genes in the cry1-independent regulon (Kleine et al.,
2007) was investigated in the zml2, zml1, and zim mutants and
compared with the wild type and the cry1 mutant (Figure 5).
Under normal growth conditions, the expression of the cry1dependent genes ELIP2, GPX7, and ERD9 was not significantly
altered in any of the mutants compared with the wild type (see
Supplemental Figure 4 online). Expression of a gene encoding
a MYB family transcription factor, MYB7, was significantly repressed in the zim mutant but demonstrated wild-type levels
in the other mutants when grown at control conditions (see
Supplemental Figure 4 online).
When exposed to excess white light (1000 µmol m22 s21) for
3 h, the expression of ELIP2 was induced 15-fold compared with
control conditions in the wild type and the zim mutant. The cry1,
zml2, and zml1 mutants demonstrated significantly impaired induction of ELIP2 expression in response to excess light (Figure
5A). Expression of GPX7 and ERD9 was induced severalfold in
response to excess light in the wild type and the zim mutant,
whereas the zml2 and zml1 mutant lines demonstrated strongly
3014
The Plant Cell
Figure 4. Binding of ZML2 to CryR1 in Vivo.
(A) Transient expression of HA-ZML2 fusion protein in protoplasts from Arabidopsis cell culture under light (lane 2) and dark (lane 3) conditions. MWT,
molecular weight.
(B) ChIP assay using Arabidopsis protoplasts expressing HA-ZML2 fusion protein was performed with anti-HA antibody. The positions of the CryR1
elements identified in the R2R3 promoter and the fragments analyzed by PCR are represented in the scheme. Genomic DNA obtained from ChIP was
analyzed by PCR. Immunoprecipitation with IgG antibody was used as a control. Primers for F2 and F5 of the R2R3 promoter and primers for lateral
root-specific promoter (At2g42430) were used for PCR amplification. Input, total input chromatin DNA; HA, DNA precipitated using HA antibody; IgG,
DNA precipitated using IgG antibody.
(C) Schematic diagram of the effector and reporter constructs used in the transactivation assay. The effector plasmid carried the ZML2 cDNA driven by
CaMV 35S promoter. NosT represents the polyadenylation site of nopaline synthetase gene. In the reporter plasmid, the YFP gene was linked to the
218-bp CryR1 fragment and a 35S minimal TATA promoter. As a negative control, an empty effector plasmid was used, and as a control for transfection
efficiency, CaMV35S:CFP was cotransfected in each experiment.
(D) CryR1 reporter construct was transfected into protoplasts from Arabidopsis leaves with ZML2 effector construct or 35S empty control vector. To
normalize the transfection efficiency, 35S:CFP:NosT was cotransfected in each experiment. Bars represent means of three independent experiments
(6SD) with five protoplasts in each experiment. The asterisk indicates significant difference according to the Student’s t test (P < 0.05).
attenuated induction of GPX7 and ERD9 similar to the cry1 mutant
(Figures 5B and 5C). Expression of MYB7 was induced fivefold in
the wild type in response to excess light (Figure 5D), whereas all of
the mutants demonstrated inability to induce expression of MYB7
in response to excess light (Figure 5D). Expression of the cry1independent genes encoding ribulose bisphosphate carboxylase
small chain (RBCS) and the light-harvesting protein (LHCB2.4) in
response to excess light revealed similar expression patterns in
the wild type and the cry1, zml2, zml1, and zim mutants (Figures 5E
and 5F). Under control conditions, the expression of RBCS and
LHCB2.4 was not significantly altered in any of the mutants
compared with the wild type (see Supplemental Figure 4 online).
The misregulation of cry1-dependent marker genes in both the
zml2 and zml1 mutants suggests that the ZML1 and ZML2 transcription factors act in concert and are significant components of
the cry1-mediated response to excess light.
The zml Mutants Displayed Impaired Response to
Excess Light
Several ROS, such as hydrogen peroxide (H2O2), singlet oxygen,
superoxide, and hydroxyl radicals, are generated in chloroplasts
ZML1/2, Key Components of the Photoprotective Response
3015
Figure 5. Expression of Genes in the cry1 Regulon in the cry1, zml2-1, zml2-2, zml1, and zim Mutant Lines after Exposure to High Light.
Wild-type and the different mutant seedlings were grown for 10 d in continuous white light (100 mmol quanta m22 s21) at 23°C and shifted to excess
light (3 h 1000 mmol quanta m22 s21). Expression of genes from the cry1-dependent regulon ELIP2 (At4g14690) (A), GPX7 (At4g31870) (B), ERD9
(At1g10370) (C), and MYB7 (At1g56650) (D) as well as the cry1-independent regulon RBCS (At1g67090) (E) and LHCB2.4 (At3g27690) (F) were
analyzed using real-time PCR. The expression following exposure to high light was related to the control of each genotype. The results were normalized
to the expression level of At4g36800 encoding a ubiquitin-protein ligase-like protein. The mean (6SD) of at least three biological replicates is shown. WT,
the wild type.
under exposure to excess light (Asada, 2006). Superoxide is
often the first reduced form of oxygen to be generated in plant
tissues leading to the subsequent formation of H2O2 and hydroxyl radical. We examined the distribution of superoxide with
nitro blue tetrazolium (NBT) staining in 2-week-old Arabidopsis
plants of the wild type, cry1, zml2-1, zml2-2, zml1, and zim
mutants exposed for 24 h to excess light (1000 µmol m22 s21). A
clear NBT staining was observed following exposure to excess
light, but no difference in superoxide accumulation and NBT
staining could be detected between the wild type and the different mutants (see Supplemental Figure 5 online). In addition,
we determined H2O2 accumulation in 2-week-old Arabidopsis
plants of the wild type, cry1, zml2-1, zml2-2, zml1, and zim
mutants following 24 h exposure to excess light (1000 µmol m22
s21). When exposed to excess light, a two- to threefold increase
in H2O2 content was observed in the wild type and the zim
mutant (Figure 6A). The cry1, zml2, and zml1 mutants accumulated
significantly more H2O2 compared with the wild type following
exposure to excess light (Figure 6A).
In the wild type, anthocyanin accumulation increased sixfold
after 48 h exposure to 1000 µmol m22 s21 excess light (Figure
6B). In the cry1 mutant, the anthocyanin accumulation was
less compared with the wild type (Figure 6B) (Kleine et al.,
2007). Reduced anthocyanin levels in cry1-deficient Arabidopsis
seedlings have been shown in continuous blue light (Ahmad
et al., 1995; Lin et al., 1996) and in continuous white light (Neff
and Chory, 1998). In contrast with the cry1 mutant, the zml
mutants accumulated wild-type levels of anthocyanins in response to excess light (Figure 6B). The anthocyanin accumulation pattern in response to excess light in mature plants (see
Supplemental Figure 6 online) was similar to that observed in
seedlings (Figure 6B). The cry1-mediated accumulation of anthocyanin was shown to be mediated via HY5 (Kleine et al.,
2007) and is independent of ZML1 and ZML2. The CryR1
3016
The Plant Cell
demonstrated a significant increased sensitivity to excess light,
measured as lower Fv/Fm compared with the wild type and the
zim mutant (Table 2). Exposure to excess light for 48 h resulted
in lower chlorophyll content in wild-type and zim seedlings
(Figure 6C). However, the chlorophyll content was significantly
lower in cry1, zml1, and zml2 mutants compared with the wild
type (Figure 6C). Furthermore, 10-d-old seedlings of the cry1,
zml2, and zml1 mutants demonstrated severe photobleaching
following exposure to excess light (Figure 7). A similar effect was
observed with mature plants (see Supplemental Figure 6 online).
Thus, the high light–sensitive phenotype in the zml mutants
demonstrated by the drop in Fv/Fm, the enhanced photobleaching, and the higher accumulation of ROS coincides with
the misregulation of GPX7 and ERD9, encoding components
involved in the photoprotective response (Kleine et al., 2007). In
summary, these results support the conclusion that the ZML
transcription factors are significant components of the cry1mediated photoprotective response.
ZML2 and ZML1 Physically Interact in Vivo in the Yeast
Two-Hybrid System and in a Coimmunoprecipitation Assay
Figure 6. Physiological Characterization of zml2, zml1, and zim T-DNA
Insertion Lines in Response to Excess Light.
(A) H2O2 accumulation in control and 24 h high light–exposed 2-weekold seedlings of the wild type, cry1, zml2-1, zml2-2, zml1, and zim mutants. The mean (6SD) of three biological replicates is shown. FW, fresh
weight.
(B) Relative anthocyanin content in control and 48 h high light–exposed
10-d-old seedlings of the wild type, cry1, zml2-1, zml2-2, zml1, and zim
mutants. The mean (6SD) of three biological replicates is shown.
(C) Chlorophyll content relative to the control of 48 h high light–exposed
10-d-old seedlings of the wild type, cry1, zml2-1, zml2-2, zml1, and zim
mutants. The mean (6SD) of three biological replicates is shown. Significant differences compared with the wild type were assessed according to Student’s t test: *P < 0.05, **P < 0.01, and ***P < 0.001. Gray
bars and black bars represent control and high light samples, respectively. WT, the wild type.
element was identified in the HY5-independent regulon of the
cry1-regulated genes.
Exposure to excess light resulted in photoinactivation of PSII
as demonstrated by a drop in maximum quantum efficiency of
PSII (Fv/Fm) from 0.836 to 0.639 after 12 h in the wild type (Table
2). The cry1 mutant was almost twice as sensitive to excess
light exposure as the wild type, shown by a drop in Fv/Fm from
0.837 to 0.374 (Table 2). The zml2 and zml1 mutant lines also
The misregulation of cry1-dependent genes in both the zml2 and
zml1 mutants suggests that there is no redundancy and that
ZML1 and ZML2 act in concert in the cry1-mediated response to
excess light. To determine if there is a direct physical interaction
between ZML2 and ZML1, a yeast two-hybrid assay was performed. A fusion protein of the GAL4 DNA binding domain and
ZML2 (ZML2 bait) activated the transcription of the HIS3 reporter gene in the presence of GAL4 activation domain and
ZML1 (ZML1-prey) (Figure 8A) but not with GAL4 activation
domain only (empty prey) (Figure 8A), suggesting a direct
protein–protein interaction between ZML2 and ZML1 in yeast
cells. ZML1 not only heterodimerizes with ZML2 but also homodimerizes with itself when ZML1 bait was cotransformed with
ZML1 prey (Figure 8A) but not with an empty prey. The HIS3
reporter gene activation assay was performed in the presence of
7.5 mM 3-aminotriazole (3-AT), a competitive inhibitor of the
HIS3 gene. To confirm the observed interactions further, the
interaction was also monitored through LacZ reporter activation,
and strong activation was observed for the combinations ZML2
bait and ZML1 prey, and ZML1 bait and ZML1 prey (Figure 8B).
Whereas it was clear that ZML2 interacted with ZML1, the
C-terminal domain of CRY1 (CRY1-CT) was unable to interact
with ZML2 or ZML1 (Figures 8A and 8B). Thus, no direct
physical interaction between ZML1/2 and the C terminus of
CRY1 could be detected in yeast. We also confirmed the
interaction between ZML1 and ZML2 using an in vivo coimmunoprecipitation (Co-IP) assay. HA-ZML2, cMYC-ZML1, and
cMYC-CRY1 fusion proteins were expressed in Arabidopsis
protoplasts, and Co-IP was performed using anti-cMYC monoclonal antibody bound to protein G–coated magnetic beads. Input
and Co-IP fractions were detected by immunoblot analysis with
anti-cMYC and horseradish peroxidase (HRP)–conjugated antiHA monoclonal antibodies, respectively (Figure 8C). From the in
vivo Co-IP, it is clear that ZML1 and ZML2 can form heterodimers
but that no direct interaction can be detected between ZML2
and CRY1 (Figure 8C).
ZML1/2, Key Components of the Photoprotective Response
3017
Table 2. Maximum Quantum Efficiency of PSII (Fv/Fm)
Genotype
Control Fv/Fm
Wild type
cry1
zml2-1
zml2-2
zml1
zim
0.836
0.837
0.835
0.821
0.836
0.837
6
6
6
6
6
6
12-h High-Light Fv/Fm
0.002
0.005
0.003
0.002
0.004
0.001
0.693
0.374
0.569
0.556
0.397
0.657
6
6
6
6
6
6
0.083
0.065*
0.025*
0.033*
0.109*
0.027
Fv/Fm was estimated before and after exposure to 12 h of white light at 1000 mmol of photons m22 s21 in 5-week-old plants of the wild type and cry1,
zml2-1, zml2-2, zml1, and zim mutants. Measurements were made in humidified air. Each point is the mean 6 SD of nine leaves from at least three
individual plants after 30 min of dark acclimation. The Fv/Fm was significantly different from the wild type in the cry1, zml2, and zml1 mutants following
high light exposure (asterisk) according to the Student’s t test (P < 0.05).
The strong similarity between the DNA binding domains of
ZML2 and ZML1 suggests that both proteins could recognize
and interact with the CryR1 binding site. To confirm this hypothesis, DNA binding was tested by EMSA (Figure 8D). Similarly to recombinant ZML2 (Figure 8D), recombinant ZML1
protein was able to bind the CryR1 element (Figure 8D). It is not
surprising that the position of the protein-DNA complexes was
the same since the size of ZML2 and ZML1 recombinant proteins is almost the same (;37 kD); therefore, the size of the
protein-DNA complexes formed should be similar for both proteins. To confirm the formation of a heterodimer complex in
vitro, ZML2 and ZML1 recombinant proteins were incubated
together at room temperature prior to the binding reaction
containing the CryR1 DNA probe. A shifted band was detected
at the same position as that for the DNA-protein complexes
formed with the single proteins ZML2 and ZML1, respectively.
However, the intensity of the shifted band was significantly reduced, suggesting formation of second protein-DNA complex of
high molecular weight that was unable to enter the native PAGE
due to size restrictions (Figure 8D, lane 4). Thus, formation of
a ZML2/ZML1 heterodimer complex is most likely occurring in
vitro and the heterodimer also binds to the CryR1 element.
Analysis of Double and Triple Mutants
To test the interaction between cry1 and ZML1/2 genetically,
double and triple mutants were generated for the different
genotypes. Expression of two marker genes, ELIP2 and GPX7,
in the cry1-dependent regulon was investigated in the zml2-2
zml1, cry1 zml1, and cry1 zml2-2 double mutants and cry1 zml1
zml2-2 triple mutant and compared with the wild type and the
single mutants (Figure 9). The ELIP2 and GPX7 expression following exposure to excess light was similar in the zml2-2 zml1
double mutant compared with the respective zml2-2 and zml1
single mutants (Figure 9). Thus, no enhanced suppression of
expression could be found in the double mutant compared with
the single mutants, supporting the suggestion that ZML1 and
ZML2 are genetically linked and act in concert in the cry1mediated response to excess light. In addition, expression of
ELIP2 and GPX7 following exposure to excess light in the cry1
zml1 and cry1 zml2-2 double mutants and the cry1 zml1 zml2-2
triple mutant was similar to the expression observed in the cry1
single mutant (Figure 9). Thus, no significant enhanced suppression of expression could be found in the double and triple
mutants compared with the cry1 single mutants, demonstrating
that ZML1/2 and cry1 are components in the same signaling
pathway. Furthermore, it is clear that induction of ELIP2 and
GPX7 expression in response to excess light is controlled by the
cry1-ZML1/2 pathway.
DISCUSSION
The CryR1 cis-element was identified through bioinformatic
analysis and was suggested to be a putative cis-element involved in the cry1-dependent response to excess light (Kleine
et al., 2007). We identified an interaction between the CryR1 ciselement and the GATA-type zinc finger protein, ZML2 (Table 1),
using a biochemical approach previously proven successful in
bacterial and yeast systems (Gabrielsen et al., 1989; Rey et al.,
2003). ZML2 was demonstrated to be localized exclusively to
the nucleus (Figure 3) and to act as a transcriptional activator of
the YFP reporter gene driven by the CryR1 cis-element in Arabidopsis leaf protoplasts (Figure 4). Thus, the putative cis-element
CryR1 was demonstrated to be biologically active, and an interplay between cry1, the CryR1 binding transcription factor
ZML2, and its homolog ZML1 is essential for the induction of
genes encoding photoprotective components in response to excess light in Arabidopsis.
ZIM, ZML2, and ZML1 belong to a group of atypical plantspecific GATA factors. The plant GATA zinc finger type transcription factors have been divided into subfamilies I, II, III, and
IV, where group III is also known as the atypical GATA zinc finger
type (Shikata et al., 2004; Manfield et al., 2007). The GATA
factors were first identified as proteins that interacted with GATA
motif (WGATAR) in vertebrates (Martin et al., 1989). In fungi, the
GATA (GATAAGG) motif has been identified as the binding site
for AREA (Kudla et al., 1990), and the sequence motif ATGATAAGG was found to be present in the promoter of many LHC
and RBCS genes from different plant species (Dean et al., 1985;
Grob and Stüber, 1987). In vitro binding studies with GATA1,
GATA2, GATA3, and GATA4 from subfamily I, which represents
the majority the plant GATA factors, demonstrated specificity of
these proteins for the GATA motif (Teakle et al., 2002; Jeong and
Shih, 2003). However, to the best of our knowledge, no previous
report is available on the binding site of the atypical GATA
transcription factors. Here, we demonstrated that ZML1 and
ZML2 specifically bind to the CryR1 cis-element in vitro (Figures
3018
The Plant Cell
Figure 7. The zml2, zml1, and zim T-DNA Insertion Lines Exposed to
Excess Light.
Ten-day-old seedlings of the wild type, cry1 mutant, and the zml2-1,
zml2-2, zml1, and zim T-DNA insertion lines following 24 h (A) and 48 h
(B) exposure to high light (HL; 1000 mmol quanta m22 s21). The severe
photobleached phenotype observed in the zml2-1, zml2-2, and zml1 was
reproduced in a second independent experiment. WT, the wild type.
2 and 8). In addition, the bases TCTAG of the CryR1 cis-element
were demonstrated to be the core sequence required for ZML2
binding (Figure 2E). In a ChIP assay, we demonstrated that
ZML2 pulled down two fragments from the R2R3 promoter both
containing the CryR1 element (Figure 4B). Furthermore, using
transient expression in Arabidopsis leaf protoplasts, we demonstrated that ZML2 transactivated the R2R3 promoter
fragment containing CryR1 cis-element (Figure 4D). Thus, in
agreement with the indications from the bioinformatic analysis
where the CryR1 cis-element was enriched in the promoters of
genes induced by excess light in the wild type, we could demonstrate that the ZML2 protein acts as transcriptional activator.
An acidic region in the N terminus of the ZIM protein has been
demonstrated to play a role as a transcriptional activation domain in transactivation experiments using cultured tobacco
(Nicotiana tabacum) Bright Yellow-2 cells (Shikata et al., 2003).
The entire amino terminal region (76 amino acids) of ZML2
shares 44% similarity with ZIM. Although the sequence itself is
not highly conserved, the ZML2 amino terminal region is rich in
acidic amino acids, suggesting a similar role for this region. ZIM
was overexpressed using the CaMV 35S promoter in Arabidopsis, and the ZIM-ox plants demonstrated elongated hypocotyls and petioles and an upward positioning of the leaves
(Shikata et al., 2004). The phenotype was observed under all
wavelengths of light and in the presence of inhibitors of brassinosteroid and gibberellin biosynthesis (Shikata et al., 2004). A
significant number of genes were shown to be upregulated in
the ZIM-ox plants, and in 92% of the promoters of those genes,
one or two CryR1 cis-elements were found either in exact copies
as it occurs in the promoter of R2R3 or in slight variants (see
Supplemental Table 1 online). This suggests that ZIM, ZML2,
and ZML1 recognize and bind to the same cis-element. In
addition to the GATA domain, the ZIM and ZML proteins are
characterized by a 36–amino acid domain containing the conserved ZIM/TIFY motif (TIFF/YXG) (Vanholme et al., 2007). The
ZIM/TIFY domain has been found in other plant proteins, and the
corresponding genes have been grouped into the plant-specific
TIFY family with 18 members in Arabidopsis. According to a suggested nomenclature, the ZIM, ZML2, and ZML1 were named
TIFY1, TIFY2a, and TIFY2b, respectively (Vanholme et al., 2007).
The TIFY family is very diverse, and ZIM/TIFY1, ZML2/TIFY2a,
and ZML1/TIFY2b are the only proteins with a GATA zinc finger
(Vanholme et al., 2007). The TIFY domain has been demonstrated to be involved in protein–protein interactions (Chung and
Howe, 2009).
ZML1 and ZML2 are involved in the cry1-dependent induction
of ELIP2, GPX7, ERD9, and MYB7 expression in response to
excess light, and induction of these genes was significantly
impaired in the zml2 and zml1 single and zml2-2 zml1 double
mutants (Figures 5 and 9). Analysis of the cry1 zml1 and cry1
zml2-2 double mutants and the cry1 zml1 zml2-2 triple mutant
confirmed that cry1 and ZML1/2 are components in the same
signaling pathway since no enhanced suppression of ELIP2 and
GPX7 expression could be found in the double and triple mutants compared with the cry1 single mutant (Figure 9). Similarly
to the cry1 mutant, the zml mutants displayed a clear excess
light–sensitive phenotype as demonstrated by the drop in Fv/Fm,
the enhanced photobleaching, reduced chlorophyll content, and
higher accumulation of ROS compared with the wild type (Table
2, Figures 6 and 7; see Supplemental Figure 6 online). The
excess light–sensitive phenotype of the cry1, zml2, and zml1
mutants could possibly be explained by the misregulation of
the stress-related genes encoding the chloroplastic glutathione
peroxidase7 (GPX7) and the glutathione S-transferases (ERD9)
in the mutants. Glutathione peroxidases have been shown to
function as both ROS transducers and scavengers, and glutathione S-transferases have been shown to respond to various
stresses such as high light, cold, and drought (Wagner et al.,
2002; Seki et al., 2003; Goulas et al., 2006; Miao et al., 2006).
A gpx7 T-DNA insertion mutant demonstrated similar phenotype
to the cry1 and zml mutants with compromised photooxidative
stress tolerance and higher H2O2 levels in the leaves following
exposure to excess light, demonstrating an important role for
GPX7 during photoprotection (Chang et al., 2009). In contrast
with cry1, the zml2 and zml1 lines accumulated anthocyanin
following exposure to excess light (Figure 6). It was demonstrated
ZML1/2, Key Components of the Photoprotective Response
3019
Figure 8. Heterodimerization of ZML2 and ZML1.
(A) and (B) The C-terminal domain of CRY1 protein does not interact with ZML2 and ZML1 proteins (3 and 6), whereas ZML2 and ZML1 homo- and
heterodimerize in the yeast two-hybrid system as indicated by the activation of HIS3 reporter gene (A) and by the LacZ activation (B). Growth due to the
activation of HIS3 reporter gene was examined in the presence of 3-AT. NMY51 yeast strain was cotransformed with ZML2 bait and empty prey vector
(negative control) (1), ZML2 bait and ZML1 prey (2), ZML2 bait and CRY1-CT prey (3), ZML1 bait and empty prey vector (negative control) (4), ZML1 bait
and ZML1 prey (5), ZML1 bait and CRY1-CT prey (6), and p53 bait and Large T prey (positive control) (7).
(C) Interaction was observed between ZML2 and ZML1, but not ZML2 and CRY1, using an in vivo Co-IP assay. HA-ZML2, cMYC-ZML1, and cMYCCRY1 fusion proteins were expressed in Arabidopsis protoplasts, and Co-IP was performed using anti-cMYC monoclonal antibody bound to protein G–
coated magnetic beads. Input and Co-IP fractions were detected by immunoblot analysis with anti-cMYC and HRP-conjugated anti-HA monoclonal
antibodies, respectively. The arrows indicate the position of the respective fusion proteins.
(D) EMSA testing DNA binding activity of ZML1 and heterodimerization with ZML2. Signals were detected using a chemiluminescent nucleic acid
detection module. Lane 1, free DNA probe; lane 2, ZML2 protein incubated with DNA probe; lane 3, ZML1 protein incubated with DNA probe; lane 4,
ZML2 and ZML1 proteins with DNA probe. The migration positions of the free DNA probe (bottom band) and the DNA-protein complexes (top band) are
marked by arrows.
[See online article for color version of this figure.]
that the induction of the genes encoding components of the
phenylpropanoid pathway in response to excess light is a cry1HY5–mediated response (Kleine et al., 2007). The CryR1 binding
factor ZML2 and its homolog, ZML1, represent components
of the HY5-independent cry1-mediated response. Thus, no effect on the anthocyanin accumulation was expected in the zml
mutants.
No functional redundancy was observed between ZML2 and
ZML1. ELIP2 and GPX7 expression following exposure to
excess light was similar in the zml2-2 zml1 double mutant
compared with the respective single mutants, supporting the
suggestion that ZML1 and ZML2 act in concert and that they
bind the CryR1 element as a heterodimer in vivo. We demonstrated that ZML1 and ZML2 homo- and heterodimerize in yeast
(Figures 8A and 8B) (Chung and Howe, 2009) and that ZML1 and
ZML2 interact in Arabidopsis protoplasts (Figure 8C). Similarly to
recombinant ZML2, recombinant ZML1 protein was also able to
bind the CryR1 element (Figure 8D). When ZML2 and ZML1
recombinant proteins were incubated together, the intensity of
the shifted band was significantly reduced, suggesting formation of second protein-DNA complex of high molecular weight
that was unable to enter the native PAGE due to size restrictions, and formation of a ZML2/ZML1 heterodimer complex
is most likely occurring in vitro (Figure 8). By analyzing deletion
3020
The Plant Cell
Figure 9. Double and Triple Mutant Analysis in Response to Excess
Light.
Wild-type (WT) and the different mutant seedlings were grown for 10 d in
continuous white light (100 mmol quanta m22 s21) at 23°C and shifted to
excess light (3 h 1000 mmol quanta m22 s21). Expression of genes from
the cry1-dependent regulon GPX7 (A) and ELIP2 (B) was analyzed using
real-time PCR. The expression following exposure to high light was related to the control of each genotype. The results were normalized to the
expression level of At4g36800 encoding a ubiquitin-protein ligase-like
protein. The mean (6SD) of nine biological replicates is shown.
constructs of the JASMONATE ZIM-domain (JAZ) proteins in the
TIFY family, it was demonstrated that the conserved TIFY domain mediates homo- and heteromeric interactions between
several JAZ proteins in Arabidopsis, and it was suggested that
combinatorial interactions between various JAZ proteins play
a role in generating diverse jasmonate signal outputs (Chung
and Howe, 2009). Thus, it is possible that the ZML1 and ZML2
interact via the TIFY domain. However, unlike the other GATA
proteins or proteins in the TIFY family in Arabidopsis, ZML2 and
ZML1 also contain a CCT domain (Shikata et al., 2004). The CCT
domain is present in the flowering time protein CONSTANS (CO;
Robson et al., 2001; Suárez-López et al., 2001), CO-like protein
(Griffiths et al., 2003), and in TIMING OF CAB EXPRESSION1
(Strayer et al., 2000). CCT was first identified in CO, and it
was suggested to mediate protein–protein interactions (Robson
et al., 2001). This was supported by the observation that the
CCT domain of CO interacted with the Arabidopsis transcription
factor ABI3 in yeast cells (Kurup et al., 2000). Thus, it is also
possible that ZML2 interacts with ZML1 through the CCT
domain.
No direct interaction between the C terminus of CRY1 and
ZML1 or ZML2 could be detected in yeast (Figures 8A and 8B) or
between the full-length CRY1 and ZML2 in Arabidopsis protoplasts (Figure 8C). Our results suggest that cry1 and ZML1/2 are
genetically linked and that cry1 action, via some unknown
component, stimulates the formation and/or activation of the
ZML heterodimer required for full expression of genes encoding
photoprotective components (Figure 10). It is also possible that
cry1 action modifies the ZML1/2 protein levels or phosphorylation status. Expression of the genes containing the CryR1 ciselement in their promoters was not impaired in zml mutant lines
or in cry1 under control conditions (see Supplemental Figure 4
online), suggesting that cry1 activates the ZML1/2 complex only
in response to excess light to stimulate induction of genes encoding photoprotective components (Figure 10). Furthermore,
the hypocotyl growth response to blue light was not affected in
seedlings of the zml2 and zml1 mutants (see Supplemental
Figure 7 online), suggesting that normal blue light response is
not mediated via the ZMLs. The ZIM, ZML1, and ZML2 proteins
homo- and heterodimerize in all possible combinations (Chung
and Howe, 2009), and it is possible that different combinations
of the GATA transcription factors are triggered by different cues
and regulate specific gene sets. It is also possible that heterodimers could be formed with other members of the TIFY family,
such as the PEAPOD1 (PPD1) and PPD2. Similarly to ZIM, PPD1
and PPD2 have been shown to regulate leaf size and shape in
Arabidopsis (Shikata et al., 2004; White, 2006). Further experiments will determine the exact interplay between the TIFY proteins and their role in gene regulation. However, it is clear that
the TIFY protein ZML2 and its homolog, ZML1, are essential
components of the cry1-mediated response to excess light.
Figure 10. Working Model for the cry1-Mediated HL Response.
In response to excess light, cry1 activates the ZML complex via some
unknown component, possibly by facilitating heterodimerization between
ZML1 and ZML2. The ZML complex binds to the CryR1 cis-element,
and expression of genes encoding photoprotective components is
induced.
ZML1/2, Key Components of the Photoprotective Response
METHODS
Plant Material and Growth Conditions
Seeds of Arabidopsis thaliana Columbia-0 wild type, cry1-304 (Ahmad
and Cashmore, 1993), zml2-1 (GK448C11), zml2-2 (GK833C07), zml1
(SALK_069271), and zim (SALK_144513) were used. The T-DNA insertion
lines obtained from the European Arabidopsis Stock Center were grown
on soil at 23°C (16 h light 100 mmol quanta m22 s21) and 18°C (8 h dark) at
60% relative humidity. For aseptic growth, seeds were sterilized for
15 min with 75% (v/v) ethanol, 0.01% Triton X-100, washed three times
with 95% ethanol, and plated on 0.27% phytoagar plates containing 13
Murashige and Skoog salt mixture including vitamins (Duchefa) and 2%
Suc. The plates were maintained in darkness at 4°C for 2 d for stratification and then placed for 10 d in continuous light (100 mmol quanta m22
s21). For high light treatment, either 10-d-old seedlings or 4-week-old
plants were subjected to 3 h 1000 mmol quanta m22 s21 (metal halide
HQI-T 400-W day light bulbs; Orsam).
Nuclear Protein Extraction
Control and 3 h high light–treated leaves of 4-week-old Arabidopsis
plants were used for nuclear protein extractions using the CelLytic PNPlant nuclei isolation/extraction kit (Sigma-Aldrich) according to the
manufacturer’s instructions. The plant tissue was ground in liquid nitrogen, homogenized in nuclei extraction buffer, and filtered through
nylon net, and the pellets were collected by centrifugation. For cell
membrane lysis, Triton X-100 was added to 0.3% final concentration.
Nuclear proteins were extracted from crude nuclei in protein extraction
buffer.
DNA-Affinity Trapping of DNA Binding Proteins
DNA promoter fragments of the R2R3 transcription factor (At5g49330)
containing CryR1 was used to isolate proteins binding to the cis-elements
in these promoter fragments. The promoter region was 21060 to 21278
of R2R3. Biotinylated DNA promoter fragments were generated by PCR
using the following primers: CryR1-F, biotin-59-CTTCTTTAACTCGTTAAATC-39; CryR1-R, 59-TTTATGGTCCAGAGACCAGT-39. Biotinylated
DNA promoter fragment was immobilized on Dynabeads M-280 streptavidin (Invitrogen) according to the manufacturer’s instructions in which
2 mg beads were immobilized using 23 binding buffer (10 mM Tris HCl,
pH 7.5, 1 mM EDTA, and 2 M NaCl). Protein binding to the DNA was
performed as described by Gabrielsen et al. (1989) with some modifications. Incubation (15 min) at 25°C was performed after the beads were
resuspended in protein binding buffer (20 mM Tris HCl, pH 8.0, 1 mM
EDTA, 10% glycerol, 100 mM NaCl, 0.05% Triton X-100, and 1 mM DTT)
and mixed with Arabidopsis nuclear protein extracts. The Dynabeads
were washed three times with protein binding buffer before proteins were
eluted in elution buffer (20 mM Tris HCl, pH 8.0, 1 mM EDTA, 10%
glycerol, 1 M NaCl, 0.05% Triton X-100, and 1 mM DTT).
Protein Digestion, Mass Spectrometry, and Data Analysis
Total proteins in solution were incubated at 95°C for 15 min in presence of
0.1 M NH4HCO3 and 10 mM DTT, cooled to room temperature, mixed with
8 M urea, and incubated for 1 h. Subsequently, alkylation reaction was
done at 37°C for 30 min in dark after adding 55 mM iodoacetamide. Urea
concentration was reduced to 0.8 M by diluting with 0.1 M NH4HCO3.
Trypsin was added at 1:50 enzyme-to-substrate ratio, and digestion was
performed overnight at 37°C. The resulting peptides were lyophilized,
resuspended in 1% trifluoroacetic acid, and desalted using a Poros 50
reverse-phase R2 microcolumn (PerSeptive Biosystems) as described by
Yanamandra et al. (2009).
3021
The desalted tryptic peptides were separated by reversed-phase
ultraperformance liquid chromatography using a nanoACQUITY UPLC
system (Waters) prior to mass spectrometry analysis. Each sample
(peptides) was concentrated on a C18 trap column (Symmetry 180 µm 3
20 mm 5 µm; Waters) and washed with 5% acetonitrile and 0.1% formic
acid at 15 µL/min for 1 min. The samples were eluted from the trap column
and separated on a C18 analytical column (75 µm 3 100 mm 1.7 µm;
Waters) at 350 nL/min using 0.1% formic acid as solvent A and 0.1%
formic acid in acetonitrile as solvent B, in a gradient. The following
gradients were used: linear from 0 to 40% B in 25 min, linear from 40 to
80% B in 1 min, isocratic at 80% B in 1 min, linear from 80 to 5% B in
1 min, and isocratic at 5% B for 7 min. The eluting peptides were sprayed
into the mass spectrometer (Q-Tof Ultima; Waters) with the capillary
voltage set to 2.6 kV and cone voltage to 40 V. The instrument was
operated in data-dependent mode as described (Srivastava et al., 2009)
without any further changes.
ProteinLynx Global Server software (V2.2.5) was used to convert raw
data to peak lists for database searching. Proteins were identified by
a local version of Mascot search program (V2.1.04; Matrix Science
Limited) using Arabidopsis protein database from The Arabidopsis Information Resource (version 9.0; July 19, 2009; 33,410 sequences). The
following settings were used for the database search: trypsin-specific
digestion with two missed cleavage allowed, carbamidomethylated Cys
set as fixed modification, oxidized Met in variable mode, peptide tolerance
of 80 ppm, and fragment tolerance of 0.1 D. Peptides with Mascot ion
scores exceeding the threshold for statistical significance of P < 0.05 were
selected and processed manually to validate their significance (see
Supplemental Figure 9 online).
Expression and Purification of Recombinant Proteins
The full-length open reading frame of ZML2 and ZML1 were PCR
amplified using the primers ZML2-F1 (59-CACCATGGATGACCTACATGGAA-39), ZML2-R (59-TCACTGTGAGTTGCTTATGTCATT-39), ZML1-F
(59-CACCATGGATGATCTTCATGG-39), and ZML1-R (59-TCACTGTGTGTTGCTAA-39) (see Supplemental Table 2 online). The ZML2 and ZML1
PCR products were cloned into the pET100D TOPO vector according to
the manufacturer’s instructions (Invitrogen). After 5 h induction with 1 mM
isopropylthio-b-galactoside, Escherichia coli (BL21)–expressed proteins
were affinity purified on Ni2+-NTA agarose resin (Qiagen).
EMSAs
To generate a 218-bp CryR1-containing fragment, the promoter region
21060 to 21278 of R2R3 factor gene family was used for PCR amplification using the primers (cryR1-F: 59-CTTCTTTAACTCGTTAAATC-39;
cryR1-R: 59-TTTATGGTCCAGAGACCAGT-39). To generate G-box cis-element, CryR1 cis-element, and its mutant variants, forward primers cryR1cisF (59-TCAACTGACACGTGGCATAAC-39), cryR1cis-F (59-GAAAAAAGTTCTAGAATTTTTT-39), cryR1-M1-F (59-GAAAAGTGGTGGTAATTTTTT-39),
cryR1-M2-F (59-GAAAAGTGTCTAGAATTTTTT-39), cryR1-M3-F (59-GAAAAAGTGTGAGAATTTTTT-39), and cryR1-M4-F (59-GAAAAAGTTCTGTGATTTTTT-39) were annealed with their complementary oligonucleotides
at room temperature after they were incubated at 70°C for 5 min.
DNA probes were labeled using the AlkPhos direct labeling and detection
system (Amersham) according to the supplier’s instructions with some
modifications. Reaction buffer (10 mL) was added to 10 mL DNA (ng/mL
diluted DNA) after the DNA was cooled on ice for 5 min, 2 mL labeling
reagent was added to the reaction followed by the addition of 10 mL of
cross-linker, and the reactions were incubated for 30 min at 37°C. DNA–
protein interactions were performed in 25-mL reactions that contained
2.5 mL 103 binding buffer (100 mM Tris HCl, 250 mM KCl, and 10 mM
DTT), 1 mg poly dI.dC (Sigma-Aldrich), 2.5% glycerol, 0.05% Triton X-100,
5 mM MgCl2, 10 mM EDTA, 20 ng DNA, and 2.5 mg protein and were
3022
The Plant Cell
then incubated at room temperature for 30 min. The reactions were run on
6% native PAGE in 0.53 Tris-borate-EDTA at 100 V. Gels were transferred
to a positively charged nylon membrane (Amersham) using a wet transfer
cell (Bio-Rad), and the DNA was cross-linked to the membrane using a UV
linker (Spectroline). Membranes were blocked for 1 h at room temperature
in blocking buffer containing 2% blocking reagent (AlkPhos direct labeling
and detection system; Amersham) and 1% milk powder in 13 TBS.
Membranes were washed four times for 7 min before the DNA was detected with CDPstar (AlkPhos direct labeling and detection system).
Biotin Labeling and Detection
PCR products and double-stranded oligonucleotides were labeled at their
39 end with biotin-14-dCTP using biotin-labeling kit (Pierce) according
to the supplier’s instructions. Biotin detection was performed using the
Chemiluminescent Nucleic Acid Detection Module (Pierce) according to
the supplier’s instructions.
Subcellular Localization and Transactivation Assay
To study the subcellular localization of ZML2 protein, full-length coding
sequence, lacking the stop codon, of ZML2 was fused upstream of CFP in
the 35S:CFP vector to produce the fluorescence fusion ZML2:CFP.
ZML2:CFP and ABI5:YFP (Shaikhali et al., 2008) were transfected and
coexpressed transiently in protoplasts isolated from Arabidopsis leaves
(see Supplemental Table 2 online). After 16 to 24 h incubation of the
transfected cells, fluorescence was visualized using a SP2 confocal laser
scanning system equipped with an inverted microscope (Leica) and 363
water immersion objective (numerical aperture of 0.75). Representative
images were taken at 433 and 514 nm for the specific emission of CFP and
YFP, respectively. In transactivation assays, effector plasmids used were
constructed using full-length cDNAs of ZML2 that were cloned into NcoI
and EcoRI sites of 35S:CFP-NosT (Seidel et al., 2005), replacing the CFP
gene, and the construct was designated 35S:ZML2 (see Supplemental
Table 2 online). The empty vector control was constructed after 35S:CFPNosT vector was digested with NcoI-EcoRI and religated. To construct
reporter plasmids, the 35S promoter of 35S:YFP-NosT (Seidel et al., 2005)
was replaced with 35S minimal TATA promoter in BamHI-NcoI sites, and
then the 218-bp cryR1-containing fragments were cloned into the HindIII
site upstream of the 35S minimal TATA promoter. Isolation and transfection
of Arabidopsis mesophyll protoplasts was performed as described (Seidel
et al., 2004). CFP and YFP fluorescence was quantified using ImageJ (http://
rsbweb.nih.gov/ij/). Ten different regions displaying fluorescence signal
were selected for quantification, and YFP brightness was normalized to CFP
signal. 35S-CFP-NosT was transfected in all experiments to serve as an
internal control to normalize the transfection efficiency.
ChIP Assays
For ChIP assays, protoplasts were prepared as described above, and
ChIP assays were performed as described by Lee et al. (2007). Protoplasts were transfected with 5 mg of ZML2 cDNA fused to HA tag (HAZML2) construct or with water and incubated for 16 to 24 h at room
temperature. The expression of HA-ZML2 fusion protein was assessed by
immunoblots using protoplast protein extracts. Protoplasts were fixed
with formaldehyde, and chromatin was isolated and sheared by sonication to obtain fragments of sizes between 100 and 1500 bp. Anti-HA
monoclonal antibody bound to protein G–coated magnetic beads (Dynabeads Protein G Immunoprecipitation kit; Invitrogen) were used to
immunoprecipitate the genomic DNA fragments. Semiquantitative PCR
was performed with immunoprecipitated genomic DNA using primer pairs
corresponding to fragments of R2R3 promoter (F2 and F5). Primers
specific for lateral root promoter (At2g42430) were used to amplify
a negative control.
Genotyping of T-DNA Insertion Lines
Two mutant alleles of zml2 (GabiKat line 448C11 and GabiKat line
833C07), one mutant allele of zml1 (Salk_069271), and one mutant allele
of zim (Salk_144513) were obtained from the European Arabidopsis Stock
Center. Individual plants were screened for T-DNA insertion by PCR using
gene-specific primers and primers anchored in the T-DNA borders.
Homozygous plants were identified by the absence of the PCR products
obtained from gene-specific primers, which compose the T-DNA insertion
site (see Supplemental Figure 8 online). Gene-specific primers used
for genotyping were GK448C11-F (59-GTGGTAGTGAACAACAAGGAGATC-39) and GK448C11-R (59-AGTATGTCAGGAACTCGCAGT-39) for
zml2-1 (448C11), GK833C07-F (59-ACATGAGCATGGAACCTATACG-39)
and GK833C07-R (59-CTACAGAACCTGAGGCGATTCA-39) for zml2-2
(833C07), salk069271-F (59-CCTCGTATCATGTGAAGAATGG-39) and
salk069271-R (59-CATGTTCACAACCATTTGACG-39) for zml1 (069271),
and salk144513-F (59-CAGGCTCTTTTTGTGTTCCTG-39) and salk144513R (59-CCGATGGCTCGAATTACTTC-39) for zim (144513). Primers for the
T-DNA left borders were o8409 (59-ATATTGACCATCATACTCATTGC-39)
for the Gabi T-DNA and LBa1 (59-TGGTTCACGTAGTGGGCCATCG-39) for
the Salk T-DNA.
RNA Isolation, cDNA Synthesis, and Real-Time PCR
A plant RNA mini kit (EZNA) was used for total RNA isolation according to
the manufacturer’s instructions. One microgram of total RNA was used for
cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad) according
to the manufacturer’s instructions. The primers (see Supplemental Table 2
online) used for real-time PCR analysis were designed to flank intron sites
to detect amplification of genomic DNA. Real-time PCR was performed in
20-mL reactions containing 2 mL cDNA (1:10 dilution) using iQSYBER
Green Supermix (Bio-Rad). Two-step thermal cycling protocol consisted
of an initial step at 95°C for 3 min followed by 40 cycles of 10 s at 95°C and
30 s at 60°C before performing a melt curve 60°C to 95°C was performed
using the CFX96 Real-Time system (C1000 Thermal Cycler; Bio-Rad). All
reactions were performed in triplicate, and the relative transcript abundance of each tested gene was normalized to the expression level of
ubiquitin (At4g36800). The data were analyzed using LinRegPCR software
(Pfaffl, 2001; Kindgren et al., 2012).
Maximal PSII Quantum Yield
In vivo chlorophyll a fluorescence of single leaves was measured using the
Dual-PAM-100 measuring system (Walz) in ambient air at room temperature. Plants were dark adapted for 30 min, and minimum fluorescence
(F0) excited by weak measuring light at open PSII centers was measured
(settings: measuring light, 10). Then, saturating pulses (0.6 s) of white light
(3000 mmol photons m22 s21) were used to determine the maximum
fluorescence (Fm) at closed PSII centers, and the ratio maximum quantum
yield of PSII (Fv/Fm = (Fm 2 F0)/Fm) was calculated.
Chlorophyll and Anthocyanin Measurements
The chlorophyll and anthocyanin measurements were performed as
described (Porra et al., 1989; Neff and Chory, 1998). Ten-day-old
seedlings or 5-week-old plants were harvested, weighed, and ground in
liquid nitrogen to fine powder. For the chlorophyll measurements, total
chlorophyll was extracted in 80% acetone and calculated according to
Porra et al. (1989). For the anthocyanin measurement, the pigments were
extracted in 1% HCl in methanol. Water was added and the chlorophyll
was extracted with an equal volume of chloroform. The anthocyanin
quantity was determined by spectrophotometric measurement of the
aqueous phase at A530 to A657 and normalized to the total fresh weight
used in each sample.
ZML1/2, Key Components of the Photoprotective Response
H2O2 Measurement
Two-week-old plants were used to measure H2O2 in control and high light
treatment. Leaf powder (50 to 200 mg) was homogenized in 1 mL of 0.2 M
HClO4, incubated on ice for 5 min, and then centrifuged at 10,000g for
10 min at 4°C. The acidic supernatant was neutralized to pH 7.0 to 8.0 with
0.2 M NH4OH, pH 9.5, and briefly centrifuged at 3000g for 2 min to
sediment the insoluble material. Quantification of H2O2 in the extracts was
performed using the Amplex Red Hydrogen Peroxide-Peroxidase Assay kit
(Molecular Probes) according to the manufacturer’s instructions. Fluorescence was measured with a plate reader (Spectra Max Gemini; Molecular
Devices) using excitation at 530 nm and fluorescence detection at 590 nm.
The concentration of H2O2 was calculated using a standard curve.
ROS (Superoxide) Staining
Two-week-old plants were exposed to high light for 12 h. For superoxide
staining, the plants were incubated for 1.5 h in 0.1% NBT at room
temperature before they were destained in ethanol.
Yeast Two-Hybrid System
The yeast two-hybrid was performed with the DUALhybrid system
(Biotech) according to the manufacturer’s instructions. Full-length coding
sequence of ZML2 and ZML1 genes was cloned into pLexA-N vector
to generate fusion proteins with LexA DNA binding domain (bait) (see
Supplemental Table 2 online). ZML1 full-length coding sequence and
CRY1 C-terminal domain coding sequence (CRY1-CT) were cloned into
pGAD-HA vector to generate fusions of the prey protein with the GAL4
activation domain. NMY51 yeast strain was cotransformed with bait and
prey vectors and the transformants were selected on selective media SDTrp-Leu-HIS and containing 7.5 mM 3-AT. b-Galactosidase overlay assay
to detect LacZ activation was performed with an overlay buffer containing
0.5 M potassium phosphate, pH 7.0, 6% dimethylformamide, 0.1% SDS,
50 mL/100 mL b-mercaptoethanol, 5 mg/mL low melting agarose, and
0.05% X-Gal (Fermentas).
Co-IP
3023
At4g14690; GPX7, At4g31870; ERD9, At1g10370; MYB7, At1g56650;
RBCS, At1g67090; and LHCB2.4, At3g27690.
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure 1. Interaction of Synthetic Double-Stranded
Oligonucleotide Containing CryR1 cis-Element with Nuclear Protein
Extracts.
Supplemental Figure 2. Genotyping zml2, zml1, and zim T-DNA
Insertion Lines.
Supplemental Figure 3. Expression Analysis of ZML2, ZML1, and ZIM
in Response to HL and in the Different Genotypes.
Supplemental Figure 4. Real-Time Analysis of cry1-Dependent and
-Independent Genes in the cry1, zml2-1, zml2-2, zml1, and zim Mutant
Lines under Control Conditions.
Supplemental Figure 5. Superoxide Accumulation of zml2, zml1, and
zim T-DNA Insertion Lines in Response to Excess Light.
Supplemental Figure 6. The zml2, zml1, and zim T-DNA Insertion
Lines Exposed to Excess Light.
Supplemental Figure 7. Hypocotyl Growth Response to Blue Light.
Supplemental Figure 8. Genotyping of zml2, zml1, and cry1 Double
and Triple Mutants.
Supplemental Figure 9. Mascot Score Result and Ion Spectra for the
ZML2 Identification.
Supplemental Table 1. Occurrence of the CryR1 cis-Element in 500
bp of the Promoters of Genes Induced in ZIM-ox Plants.
Supplemental Table 2. Primers Used in Real-Time PCR Analysis and
for Generation of Constructs.
ACKNOWLEDGMENTS
To generate expression constructs for Co-IP assays, full-length coding
sequence of ZML2 was cloned into BamHI-EcoRI sites in pRT104_3HA
vector, and the construct was designated HA-ZML2 (see Supplemental
Table 2 online). To generate MYC-ZML1 and MYC-CRY1 constructs, fulllength coding sequences of ZML1 and CRY1 were cloned into EcoRI-KpnI
and SmaI-EcoRI sites in pRT104_3MYC vector, respectively. Proteins
from protoplasts transformed with expression constructs were extracted
in 300 mL immunoprecipitation buffer (25 mM Tris- HCl, pH 7.8, 75 mM
NaCl, 10 mM MgCl2, 2 mM DTT, 5 mM EGTA, 0.2% Triton X-100, 10%
glycerol, and 0.2 mM PMSF) for 40 min at 4°C. Protein extracts were
incubated with 5 µg of anti-cMYC monoclonal antibody (Bio-Site) bound
to protein G–coated magnetic beads (Dynabeads Protein G Immunoprecipitation kit; Invitrogen) for 1 h at 4°C. Subsequent washing steps
were performed according to kit recommendations (Invitrogen), and target
antigen was eluted with SDS-PAGE sample loading buffer. To detect the
fusion proteins tagged with cMYC, immunoblots were detected with anticMYC chicken IgY fraction (Invitrogen) and rabbit HRP-anti-chicken IgY
(H+L) (Invitrogen), respectively. HA-tagged proteins were detected with
anti-HA peroxidase (Roche).
We thank Thorsten Seidel for providing the YFP and CFP vectors. This
work was supported by grants from the Swedish Research Foundation,
Vetenskapsrådet, and the FFL2 grant from the Foundation for Strategic
Research (Å.S.). Å.S. is a Royal Swedish Academy of Sciences Research
Fellow supported by a grant from the Knut and Alice Wallenberg
Foundation.
Accession Numbers
REFERENCES
Sequence data from this article can be found in the Arabidopsis Genome
Initiative or GenBank/EMBL databases under the following accession
numbers: ZML2, At1g51600; ZML1, At3g21175; ZIM, At4g24470; ELIP2,
Ahmad, M., and Cashmore, A.R. (1993). HY4 gene of A. thaliana
encodes a protein with characteristics of a blue-light photoreceptor.
Nature 366: 162–166.
AUTHOR CONTRIBUTIONS
Å.S. and J.S. designed the research. J.S., J.B.-L., K.Ö., D.K., A.S.G.,
V.S., and Å.S. performed the experiments and analyzed data. G.W., K.Ö.,
and L.B. contributed new analytic and experimental tools and analyzed
data. All authors contributed to writing the article.
Received May 1, 2012; revised June 5, 2012; accepted June 19, 2012;
published July 10, 2012.
3024
The Plant Cell
Asada, K. (2006). Production and scavenging of reactive oxygen
species in chloroplasts and their functions. Plant Physiol. 141:
391–396.
Cashmore, A.R., Jarillo, J.A., Wu, Y.J., and Liu, D. (1999). Cryptochromes: Blue light receptors for plants and animals. Science 284:
760–765.
Chang, C.C., Slesak, I., Jordá, L., Sotnikov, A., Melzer, M.,
Miszalski, Z., Mullineaux, P.M., Parker, J.E., Karpinska, B., and
Karpinski, S. (2009). Arabidopsis chloroplastic glutathione peroxidases play a role in cross talk between photooxidative stress and
immune responses. Plant Physiol. 150: 670–683.
Chen, M., Chory, J., and Fankhauser, C. (2004). Light signal transduction in higher plants. Annu. Rev. Genet. 38: 87–117.
Chung, H.S., and Howe, G.A. (2009). A critical role for the TIFY motif
in repression of jasmonate signaling by a stabilized splice variant of
the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis. Plant
Cell 21: 131–145.
Dean, C., Elzen, P.V., Tamaki, S., Dunsmuir, P., and Bedbrook, J.
(1985). Differential expression of the eight genes of the petunia ribulose bisphosphate carboxylase small subunit multi-gene family.
EMBO J. 4: 3055–3061.
Duek, P.D., and Fankhauser, C. (2003). HFR1, a putative bHLH
transcription factor, mediates both phytochrome A and cryptochrome signalling. Plant J. 34: 827–836.
Gabrielsen, O.S., Hornes, E., Korsnes, L., Ruet, A., and Oyen, T.B.
(1989). Magnetic DNA affinity purification of yeast transcription
factor tau—A new purification principle for the ultrarapid isolation of
near homogeneous factor. Nucleic Acids Res. 17: 6253–6267.
Goulas, E., Schubert, M., Kieselbach, T., Kleczkowski, L.A.,
Gardeström, P., Schröder, W.P., and Hurry, V. (2006). The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show
differential sensitivity to short- and long-term exposure to low
temperature. Plant J. 47: 720–734.
Griffiths, S., Dunford, R.P., Coupland, G., and Laurie, D.A. (2003).
The evolution of CONSTANS-like gene families in barley, rice, and
Arabidopsis. Plant Physiol. 131: 1855–1867.
Grob, U., and Stüber, K. (1987). Discrimination of phytochrome dependent light inducible from non-light inducible plant genes. Prediction of a common light-responsive element (LRE) in phytochrome
dependent light inducible plant genes. Nucleic Acids Res. 15:
9957–9973.
Guo, H., Mockler, T., Duong, H., and Lin, C. (2001). SUB1, an Arabidopsis Ca2+-binding protein involved in cryptochrome and phytochrome coaction. Science 291: 487–490.
Hong, S.H., Kim, H.J., Ryu, J.S., Choi, H., Jeong, S., Shin, J., Choi,
G., and Nam, H.G. (2008). CRY1 inhibits COP1-mediated degradation of BIT1, a MYB transcription factor, to activate blue lightdependent gene expression in Arabidopsis. Plant J. 55: 361–371.
Jarillo, J.A., Capel, J., Tang, R.H., Yang, H.Q., Alonso, J.M., Ecker, J.R.,
and Cashmore, A.R. (2001). An Arabidopsis circadian clock component
interacts with both CRY1 and phyB. Nature 410: 487–490.
Jeong, M.J., and Shih, M.C. (2003). Interaction of a GATA factor with
cis-acting elements involved in light regulation of nuclear genes
encoding chloroplast glyceraldehyde-3-phosphate dehydrogenase
in Arabidopsis. Biochem. Biophys. Res. Commun. 300: 555–562.
Erratum. Biochem. Biophys. Res. Commun. 333: 1385.
Kang, X., Chong, J., and Ni, M. (2005). HYPERSENSITIVE TO RED
AND BLUE 1, a ZZ-type zinc finger protein, regulates phytochrome
B-mediated red and cryptochrome-mediated blue light responses.
Plant Cell 17: 822–835.
Kang, X., and Ni, M. (2006). Arabidopsis SHORT HYPOCOTYL UNDER BLUE1 contains SPX and EXS domains and acts in cryptochrome signaling. Plant Cell 18: 921–934.
Kimura, M., Yoshizumi, T., Manabe, K., Yamamoto, Y.Y., and
Matsui, M. (2001). Arabidopsis transcriptional regulation by light
stress via hydrogen peroxide-dependent and -independent pathways. Genes Cells 6: 607–617.
Kindgren, P., Kremnev, D., Blanco, N.E., de Dios Barajas López, J.,
Fernández, A.P., Tellgren-Roth, C., Small, I., and Strand, A.
(2012). The plastid redox insensitive 2 mutant of Arabidopsis is
impaired in PEP activity and high light-dependent plastid redox
signalling to the nucleus. Plant J. 70: 279–291.
Kiyosue, T., and Wada, M. (2000). LKP1 (LOV kelch protein 1): A
factor involved in the regulation of flowering time in arabidopsis.
Plant J. 23: 807–815.
Kleine, T., Kindgren, P., Benedict, C., Hendrickson, L., and Strand,
A. (2007). Genome-wide gene expression analysis reveals a critical
role for CRYPTOCHROME1 in the response of Arabidopsis to high
irradiance. Plant Physiol. 144: 1391–1406.
Kleine, T., Lockhart, P., and Batschauer, A. (2003). An Arabidopsis
protein closely related to Synechocystis cryptochrome is targeted
to organelles. Plant J. 35: 93–103.
Kudla, B., Caddick, M.X., Langdon, T., Martinez-Rossi, N.M.,
Bennett, C.F., Sibley, S., Davies, R.W., and Arst, H.N. Jr. (1990).
The regulatory gene areA mediating nitrogen metabolite repression
in Aspergillus nidulans. Mutations affecting specificity of gene activation alter a loop residue of a putative zinc finger. EMBO J. 9:
1355–1364.
Kurup, S., Jones, H.D., and Holdsworth, M.J. (2000). Interactions of
the developmental regulator ABI3 with proteins identified from developing Arabidopsis seeds. Plant J. 21: 143–155.
Lee, J.H., Yoo, S.J., Park, S.H., Hwang, I., Lee, J.S., and Ahn, J.H.
(2007). Role of SVP in the control of flowering time by ambient
temperature in Arabidopsis. Genes Dev. 21: 397–402.
Li, Q.H., and Yang, H.Q. (2007). Cryptochrome signaling in plants.
Photochem. Photobiol. 83: 94–101.
Li, Z., Wakao, S., Fischer, B.B., and Niyogi, K.K. (2009). Sensing and
responding to excess light. Annu. Rev. Plant Biol. 60: 239–260.
Lin, C., and Shalitin, D. (2003). Cryptochrome structure and signal
transduction. Annu. Rev. Plant Biol. 54: 469–496.
Lin, C., Yang, H., Guo, H., Mockler, T., Chen, J., and Cashmore,
A.R. (1998). Enhancement of blue-light sensitivity of Arabidopsis
seedlings by a blue light receptor cryptochrome 2. Proc. Natl. Acad.
Sci. USA 95: 2686–2690.
Liu, H., Yu, X., Li, K., Klejnot, J., Yang, H., Lisiero, D., and Lin, C.
(2008). Photoexcited CRY2 interacts with CIB1 to regulate transcription and floral initiation in Arabidopsis. Science 322:
1535–1539.
Lopez-Molina, L., Mongrand, S., Kinoshita, N., and Chua, N.H.
(2003). AFP is a novel negative regulator of ABA signaling that
promotes ABI5 protein degradation. Genes Dev. 17: 410–418.
Manfield, I.W., Devlin, P.F., Jen, C.H., Westhead, D.R., and
Gilmartin, P.M. (2007). Conservation, convergence, and divergence
of light-responsive, circadian-regulated, and tissue-specific expression patterns during evolution of the Arabidopsis GATA gene
family. Plant Physiol. 143: 941–958.
Miao, Y., Lv, D., Wang, P., Wang, X.C., Chen, J., Miao, C., and
Song, C.P. (2006). An Arabidopsis glutathione peroxidase functions
as both a redox transducer and a scavenger in abscisic acid and
drought stress responses. Plant Cell 18: 2749–2766.
Møller, S.G., Kim, Y.S., Kunkel, T., and Chua, N.H. (2003). PP7 is
a positive regulator of blue light signaling in Arabidopsis. Plant Cell
15: 1111–1119.
Neff, M.M., and Chory, J. (1998). Genetic interactions between
phytochrome A, phytochrome B, and cryptochrome 1 during Arabidopsis development. Plant Physiol. 118: 27–35.
ZML1/2, Key Components of the Photoprotective Response
Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29: e45.
Pokorny, R., Klar, T., Hennecke, U., Carell, T., Batschauer, A., and
Essen, L.O. (2008). Recognition and repair of UV lesions in loop
structures of duplex DNA by DASH-type cryptochrome. Proc. Natl.
Acad. Sci. USA 105: 21023–21027.
Porra, R.J., Thompson, W.A., and Kriedemann, P.E. (1989). Determination of accurate extinction coefficients and simultaneous
equations for assaying chlorophyll a and b extracted with four different solvents: Verification of the concentration of chlorophyll
standards by atomic absorption spectroscopy. Biochim. Biophys.
Acta 975: 384–394.
Rey, D.A., Pühler, A., and Kalinowski, J. (2003). The putative transcriptional repressor McbR, member of the TetR-family, is involved
in the regulation of the metabolic network directing the synthesis of
sulfur containing amino acids in Corynebacterium glutamicum. J.
Biotechnol. 103: 51–65.
Richly, E., Dietzmann, A., Biehl, A., Kurth, J., Laloi, C., Apel, K.,
Salamini, F., and Leister, D. (2003). Covariations in the nuclear
chloroplast transcriptome reveal a regulatory master-switch. EMBO
Rep. 4: 491–498.
Robson, F., Costa, M.M., Hepworth, S.R., Vizir, I., Piñeiro, M.,
Reeves, P.H., Putterill, J., and Coupland, G. (2001). Functional
importance of conserved domains in the flowering-time gene CONSTANS demonstrated by analysis of mutant alleles and transgenic plants.
Plant J. 28: 619–631.
Rossel, J.B., Wilson, I.W., and Pogson, B.J. (2002). Global changes
in gene expression in response to high light in Arabidopsis. Plant
Physiol. 130: 1109–1120.
Seidel, T., Golldack, D., and Dietz, K.J. (2005). Mapping of C-termini
of V-ATPase subunits by in vivo-FRET measurements. FEBS Lett.
579: 4374–4382.
Seidel, T., Kluge, C., Hanitzsch, M., Ross, J., Sauer, M., Dietz, K.J.,
and Golldack, D. (2004). Colocalization and FRET-analysis of
subunits c and a of the vacuolar H+-ATPase in living plant cells. J.
Biotechnol. 112: 165–175.
Seki, M., Kamei, A., Yamaguchi-Shinozaki, K., and Shinozaki, K.
(2003). Molecular responses to drought, salinity and frost: Common
and different paths for plant protection. Curr. Opin. Biotechnol. 14:
194–199.
Shaikhali, J., Heiber, I., Seidel, T., Ströher, E., Hiltscher, H.,
Birkmann, S., Dietz, K.J., and Baier, M. (2008). The redoxsensitive transcription factor Rap2.4a controls nuclear expression
of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes. BMC Plant Biol. 8: 48.
Shikata, M., Matsuda, Y., Ando, K., Nishii, A., Takemura, M.,
Yokota, A., and Kohchi, T. (2004). Characterization of Arabidopsis
ZIM, a member of a novel plant-specific GATA factor gene family. J.
Exp. Bot. 55: 631–639.
Shikata, M., Takemura, M., Yokota, A., and Kohchi, T. (2003).
Arabidopsis ZIM, a plant-specific GATA factor, can function as
3025
a transcriptional activator. Biosci. Biotechnol. Biochem. 67:
2495–2497.
Somers, D.E., Schultz, T.F., Milnamow, M., and Kay, S.A. (2000).
ZEITLUPE encodes a novel clock-associated PAS protein from
Arabidopsis. Cell 101: 319–329.
Srivastava, V., Srivastava, M.K., Chibani, K., Nilsson, R., Rouhier,
N., Melzer, M., and Wingsle, G. (2009). Alternative splicing studies
of the reactive oxygen species gene network in Populus reveal
two isoforms of high-isoelectric-point superoxide dismutase. Plant
Physiol. 149: 1848–1859.
Strayer, C., Oyama, T., Schultz, T.F., Raman, R., Somers, D.E.,
Más, P., Panda, S., Kreps, J.A., and Kay, S.A. (2000). Cloning of
the Arabidopsis clock gene TOC1, an autoregulatory response
regulator homolog. Science 289: 768–771.
Suárez-López, P., Wheatley, K., Robson, F., Onouchi, H., Valverde,
F., and Coupland, G. (2001). CONSTANS mediates between the
circadian clock and the control of flowering in Arabidopsis. Nature
410: 1116–1120.
Teakle, G.R., Manfield, I.W., Graham, J.F., and Gilmartin, P.M.
(2002). Arabidopsis thaliana GATA factors: Organisation, expression
and DNA-binding characteristics. Plant Mol. Biol. 50: 43–57.
Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T., and
Gheysen, G. (2007). The tify family previously known as ZIM. Trends
Plant Sci. 12: 239–244.
Wagner, U., Edwards, R., Dixon, D.P., and Mauch, F. (2002).
Probing the diversity of the Arabidopsis glutathione S-transferase
gene family. Plant Mol. Biol. 49: 515–532.
Wang, H., Ma, L.G., Li, J.M., Zhao, H.Y., and Deng, X.W. (2001).
Direct interaction of Arabidopsis cryptochromes with COP1 in light
control development. Science 294: 154–158.
Ward, J.M., Cufr, C.A., Denzel, M.A., and Neff, M.M. (2005). The Dof
transcription factor OBP3 modulates phytochrome and cryptochrome signaling in Arabidopsis. Plant Cell 17: 475–485.
White, D.W. (2006). PEAPOD regulates lamina size and curvature in
Arabidopsis. Proc. Natl. Acad. Sci. USA 103: 13238–13243.
Wu, G., and Spalding, E.P. (2007). Separate functions for nuclear and
cytoplasmic cryptochrome 1 during photomorphogenesis of Arabidopsis seedlings. Proc. Natl. Acad. Sci. USA 104: 18813–18818.
Yanamandra, K. et al. (2009). Amyloid formation by the proinflammatory S100A8/A9 proteins in the ageing prostate. PLoS ONE
4: e5562.
Yang, H.Q., Tang, R.H., and Cashmore, A.R. (2001). The signaling
mechanism of Arabidopsis CRY1 involves direct interaction with
COP1. Plant Cell 13: 2573–2587.
Yang, H.Q., Wu, Y.J., Tang, R.H., Liu, D., Liu, Y., and Cashmore,
A.R. (2000). The C termini of Arabidopsis cryptochromes mediate
a constitutive light response. Cell 103: 815–827.
Yu, X., Klejnot, J., Zhao, X., Shalitin, D., Maymon, M., Yang, H.,
Lee, J., Liu, X., Lopez, J., and Lin, C. (2007). Arabidopsis cryptochrome 2 completes its posttranslational life cycle in the nucleus.
Plant Cell 19: 3146–3156.
The CRYPTOCHROME1-Dependent Response to Excess Light Is Mediated through the
Transcriptional Activators ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE
MERISTEM LIKE1 and ZML2 in Arabidopsis
Jehad Shaikhali, Juan de Dios Barajas-Lopéz, Krisztina Ötvös, Dmitry Kremnev, Ana Sánchez Garcia,
Vaibhav Srivastava, Gunnar Wingsle, Laszlo Bako and Åsa Strand
Plant Cell 2012;24;3009-3025; originally published online July 10, 2012;
DOI 10.1105/tpc.112.100099
This information is current as of July 31, 2017
Supplemental Data
/content/suppl/2012/07/03/tpc.112.100099.DC1.html
References
This article cites 64 articles, 28 of which can be accessed free at:
/content/24/7/3009.full.html#ref-list-1
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY