Gene Therapy and Molecular Biology Vol: 17, page 82
Gene Ther Mol Biol Vol 17, 82-99, 2015
Suppression of chicken prolactin transcription and
translation in hen anterior pituicytes by RNA
interference and its effect on associated hormones
Research Article
I. J. Reddy1*, Ashish Mishra1 and Sukanta Mondal1
1
Animal Physiology Division, National Institute of Animal Nutrition and Physiology, Bangalore, India
*Correspondence: Animal Physiology Division, National Institute of Animal Nutrition and Physiology,
Hosur Road, Adugodi, Bangalore- 560 030. India, Tel: +91 80 25711304, Fax: +91 80 25711320, Email:
[email protected]
Keywords: chPRL siRNA-anterior pituicytes- GH, FSHβ, ERα mRNA, E2β - hen
Received: 1 September 2015; Revised: 9 September 2015
Accepted: 9 October 2015; electronically published: 13 October 2015
Summary
Prolactin (PRL) is a peptide hormone synthesized and secreted by lactotroph cells in anterior
pituitary of the hen. In aves, hyper secretion of PRL causes ovarian regression, ovarian
dysfunction and broodiness. In addition, pituitary estrogens (E2β) play synergetic effects on
both replication and synthesis of PRL in pituitary lactotrophs leading to hyperprolactinemia. The
aim of this study was in vitro suppression of chPRL transcription and translation in hen anterior
pituicytes by small-interfering RNA (siRNA) targeting chPRL and assessing its effects on the
mRNA levels of PRL, prolactin receptor (PRLR), follicle stimulating hormone (FSHβ), growth
hormone (GH) estrogen receptor (ERα), pituitary content of estrogen (E2β) and PRL
concentration in primary cultures of anterior pituitary cells obtained from broody hens. Three
chPRL- siRNA’s were chemically synthesized based on turkey and chicken PRL mRNA and
conducted suppression of PRL in primary cultured anterior pituicytes of hen. After 24 hours of
chPRL-siRNA transfection the amount of chPRL, GH, PRLR, FSHβ, ERα, expression levels
were analyzed by polymerase chain reaction (PCR). Protein content of PRL and GH in the
control and siRNA transfected culture media were analysed by western blot method. Pituitary
content of PRL and E2β was estimated in the cultured medium by radioimmuno assay (RIA).To
investigate the effective concentration of siRNA 50nM and 60nM of PRL siRNA was
introduced into primary cultured anterior pituitary cells. PRL mRNA expression was reduced
to 58% at 50nM and 65% at 60nM compared with the control. Protein content of PRL was
clearly suppressed in transfected cells. Conversely, the protein content of GH did not
significantly different between control and treated cells. PRL concentration in the cultured
82
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
medium of siRNA treated cells was significantly (P<0.05) lower than controls, whereas the
pituitary E2β levels were not significantly different between the control and treated cells.
Treatment of cultured cells with varying doses of E2β significantly increased the mRNA levels
of PRL, GH, and ERα, protein content of PRL, GH and PRL concentration in the control group.
However, mRNA levels of PRLR, FSHβ, and pituitary content of E2β levels were not significantly
(P>0.05) increased with E2β treatment of control and siRNA transfected cells. Results suggest
that, chPRL-siRNA designed in this study suppresses PRL gene expression specifically and that
the level of PRLR, GH, FSHβ, ERα expression and estradiol were not associated with PRL in
anterior pituitary. Our data support that chPRL- siRNA serves as a potential therapeutic tool
to control hyperprolactinemia in vertebrates.
I. Introduction
Gonadotrophic and gonadal hormones are
required for ovulation, egg formation and egg
lay in hen. Blocking of these hormones lead to
disruption of the ovulatory cycle in chicken and
turkeys (Zadworny and Etches 1987).Thus
hyperprolactinemia
is
an
endocrine
derangement resulting from over-production of
PRL by anterior pituitary leading to affect the
HPG axis, broodiness, cessation of egg lay and
reproductive disorders in domestic hen
(Zadworny and Etches 1987; Sharp et al, 1996;
Bédécarrats et al, 1999) and other native breeds
of fowl. Classical drugs blocking excess
pituitary PRL production are not efficient in
these conditions, which has encouraged the
search for alternative ways of inhibiting the
undesirable actions of PRL in hen and other
species (Vincent Goffin et al, 2007; Lu J et al,
2005).The alteration of specific PRL gene can
provide an ideal method to study the causes and
potential therapeutics of hyperprolactinemia
and broodiness affecting the egg laying chicken
(Nicoll et al, 1986) and this may provide an
appealing alternative to the conventional
methods of PRL suppression by active or
passive immunization against PRL in hen
(Sharp et al, 1996). After the invention of
RNAi, it is possible to suppress RPL
transcription and translation n hen anterior
Anterior pituitary gland consists of several
cell types essential for many physiological
processes such as homeostasis, development,
metabolism,
growth
and
reproduction
(Ronchetti et al, 2013). Almost 50% of the gland
is constituted by lactotrophs, which secrete PRL
together with gonadotrophs (Ronchetti et al,
2013). The pituitary prolactin (PRL) also
familiar as versatalin is a peptide hormone that
is primarily synthesized in the anterior pituitary
gland and is known to be involved in numerous
biological actions in vertebrates (Bole-Feysot
et al, 1998).In avian species, the primary
functions of PRL are the onset and maintenance
of incubation behaviour (broodiness) in
galliformes and production of crop-sac milk in
pigeons (Bédécarrats et al, 1999). However,
excess of PRL secretion leads to various
disorders of reproductive functions in
mammals. Hyper secretion of PRL alters the
hypothalamic- pituitary-gonadal (HPG) axis as
PRL tends to decrease the secretion of
gonadotrophic releasing hormone (GnRH) from
the hypothalamus and in turn suppresses the
secretion of follicle stimulating hormone (FSH)
and luteinizing hormone (LH) from the anterior
pituitary, estradiol-17β (E2β) and progesterone
(P4) from gonads in hen (Sharp et al, 1996;
Bédécarrats et al, 1999; Reddy et al, 2002).
83
Gene Therapy and Molecular Biology Vol: 17, Page 84
pituitaries during prenatal period inorder to
maintain normal levels of PRL in post natal
period (Hiyama et al, 2008). It is known that
RNA interference (RNAi) is a sequence specific
gene silencing process triggered by double
stranded RNA, which is highly conserved
among different species (Caplen et al, 2001).
There is a great promise in the use of RNAi in
domestic hen to control PRL secretion to
improve our understanding of biology of
broodiness / hyperprolactinemia in domestic
hen. However, in order to enable the adoption of
new applications in vertebrates, the methods of
gene manipulation as well as the technologies to
be used to suppress target gene require further
refinements to improve efficiency, precision
and simplicity. Knockdown of PRL may alter
the synthesis and release of other gonadotrophic
and gonadal hormones because PRL and GH are
structurally and biologically related members of
a multigene family and are thought to have
originated from a single ancestral gene by a
duplication event (Zadworny and Etches 1987;
Bole- Feysot et al, 1998; Simmons et al, 1990).
PRL cells and GH producing cells originate
from the same progenitor cells which express
the transcription factors that play an important
role in the differentiation of PRL and GH cells
(Simmons et al, 1990).It is known that PRL
secretion is thought to be controlled by various
factors from the hypothalamus, peripheral
hormones and growth factors (epidermal
growth factor; EGF, IGF1). It is unquestionable
that vasoactive intestinal peptide (VIP) and E2β
(Schwardz 2000; Denef 2003; Ronchetti et al,
2013; Tamiki et al, 2009) stimulates the PRL
release from anterior pituitary cells. PRL acts
an endocrine, autocrine, and paracrine (Oomizu
et al, 1998) way through the PRL receptor and
to some extent by cytokine receptors (BoleFeysot et al, 1998) in terms of growth and PRL
gene expression. It was reported that growth of
pituitary lactotrophs are sensitive to estrogens
with small pool of estradiol 17 β receptor (ERα)
than the PRL response suggesting that E2β is
another key regulator of PRL synthesis and
replication (Chun et al, 1998) through a
mechanism involving increased transcription of
the PRL gene in pituitary lactotrophs (Maurer
1982). E2β increases the sensitivity of PRL
cells to GnRH stimulation (Weber et al, 1997),
inhibits PRL proteolysis in the hypothalamoneurohypophyseal system and stimulates FSHβ
(Copeland et al, 1984) secretion in
vertebrates.Hence the purpose of the present
study was to investigate the effects of small
interfering RNA against chPRL (chPRLsiRNA) on PRL, PRLR, GH, FSHβ, ERα,
pituitary content of PRL,E2β and protein
content of PRL, GH, in in vitro cultured hen
anterior pituitary cells primed with varying
doses of E2β. In order to attenuate the PRL in
in vivo it is necessary to demonstrate the effects
of low levels of PRL on various endocrine
factors in in vitro conditions. However, stable
and chronic suppression of PRL gene
expression in vivo is required using a siRNA
expression vector. This may serve as the most
promising strategy to develop more potent and
specific
therapeutics
with
improved
characteristics (fewer side effects) against
hyperprolactinemia in vertebrates.
84
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
carry out the experiment. Cells (1.5×105 per 1ml)
were seeded to a 12 well poly-L-lysine coated
plates containing a mixture of 50 nM of siRNA,
Lipofectamine 2000 (Invitrogen) and Opti-MEM
(Invitrogen).Similarly cells (1.5×105 per 1ml) were
seeded to another 12 well poly-L-lysine coated
plates containing a mixture of 60 nM of siRNA,
Lipofectamine 2000 (Invitrogen) and Opti-MEM
(Invitrogen). Cells were incubated without
antibiotics for 24 h at 370C in humidified 95% air5% CO2, after which the culture medium was
replaced with DMEM/F12 Ham containing 10%
chicken serum and 1% ITS. Four hours later E2β
(sigma) (0.1µM, 0.5 µM and 10 µM) was added
individually and after 6h incubation, total RNA was
extracted from the cultured cells. The first strand
cDNA was synthesized from 300ng of total RNA
with the use of random primer. The culture medium
for each experimental group was collected for
measurement of the E2 β and PRL concentration by
radioimmunoassay.
II. Materials and Methods
II.A. Cell culture
Chicken heads from broody hens were
collected (n=60) from local abattoir immediately
after slaughter and transported to the laboratory in
ice. Anterior pituitary glands were isolated from
hen and processed for primary cell culture. Cells
were isolated and cultured as per the method
described by Hiyama et al. 2008. Cells were diced
in PBS and centrifuged at 1500RPM for 5 minutes
and washed in PBS 4 times. Cell pellet was
resuspended and cultured in Dulbecco Modified
Eagle Medium (DMEM).Cells were incubated
without antibiotics for 18 h at 370C in humidified
95% air-5% CO2, after which the culture medium
was replaced every 24 hours with DMEM/F12
Ham containing 1% ITS. After reaching the
confluence, cells were treated with trypsin/EDTA
for 1 min at 370C and then cultured in poly Llysine coated well plates. First passage cells were
used for RNAi experiments.
II.C. RNA Extraction and PCR
II.B. Designing of siRNA and
transfection of siRNA into anterior
pituitary cells
Total RNA from cultured cells was extracted
using Trizol reagent, as per the manufacturer’s
protocol. The recovered RNA was dissolved in
diethyl pyrocarbonate-treated water to a final
concentration of 1 ug/ul. Integrity of the RNA was
electrophoretically verified in 1.2% formaldehyde
agarose gels stained with ethidium bromide.
Three synthetic siRNAs (siRNA1, siRNA2
and siRNA3; Table 1) targeting the chicken PRL
mRNA (AB011434) were designed based on
turkey and chicken PRL mRNA using the siRNA
Target Finder software. SiRNA’s were obtained
from Ambion (Life Technologies Inc.) and BLAST
search (www.ncbi.nlm.nih.gov/ BLAST) was
carried out to confirm the specificity of sequences.
Testing of siRNA (Life Technologies Inc.) was
carried by utilizing siPort NeoFX transfection
agent as per the manufacturer’s procedure. Three
siRNA’s were individually tested in poly –L-lysine
coated plates containing a mixture of siRNA and
anterior pituitary cells and the same is repeated six
times. ChPRL mRNA levels were assessed by
qRTPCR after 24 hours of incubation. In the
controls, cells were incubated with the siPort
NeoFX without siRNA to monitor cell death and
cytotoxicity. However, the concentration of siRNA
transfection mixture was adjusted accordingly to
II.D.Reverse Transcription and RealTime PCR
The first strand cDNA was synthesized from
300 ng of total RNA with the use of random primer.
5 µg of total RNA was heat-denatured and reverse
transcribed by incubation at 50oC for 50 min using
superscript III-reverse transcriptase, RNase OUT,
DTT, MgCl2, dNTP mixture and oligo (dT) primer
in a final volume of 20 µl of 1X RT buffer.
Subsequently the reaction was terminated by
heating at 850C for 5 min and cooling on ice. After
reverse transcription, the mRNA levels of PRL,
PRLR and GH, FSHβ, and ERα receptor were
estimated by qRTPCR.
85
Gene Therapy and Molecular Biology Vol: 17, Page 86
Table 1. Locations and sequences of three different siRNAs on chicken PRL mRNA
Gene
siRNA
PRL- I
(458-477)
siRNA
PRL –II
(606-624)
siRNAPRL- III
(679-698)
Sequence(5’-3’)
Length
M.Wt
Molar
21
Percent
G/C
29%
Sense:
CGAAGGCUGUAGAGAUUGAtt
Antisense:
UCAAUCUCUACAGCCUUCCag
6900
220600
21
48%
6500
197200
Sense:
CCAGACUCUUUGCUUUUUAtt
21
29%
6600
196400
Antisense:
UAAAAAGCAAAGAGUCUGGag
21
38%
6800
228300
Sense:
GUUUUGAAGUGCCGCCUAA tt
Antisense: :
UUAGGCGGCACUUCAAAAC tt
21
29%
6700
204100
21
43%
6700
203400
antibody for GH). The blot was then incubated with
1:5000 diluted alkaline phosphatase labeled antirabbitIgG antibody. The chemiluminescence signal
was analyzed with an autoradiography film after
treatment of the membrane with Renaissance
reagent (NEN Life Science Products, PerkinElmer,
Boston, MA). The intensity of the signal was
quantified by the densitometry of autoradiograms
using Alpha Imager.
Primer sets were designed based on the cDNA
sequence of the chPRL, chPRLR, chGH, chFSHβ
and ERα using the online primer design procedure
(Gene bank Accession Numbers; Table 2). Realtime PCR was performed to study PRL, PRLR,
GH, FSHβ and ERα gene expressions relative to β–
actin. Each cDNA sample was analysed in
duplicate using Light Cycler (Step One Plus, ABI,
USA). For the real-time PCR reaction, Fast Sybr
Master Mix was used (ABI, USA). To confirm a
constant housekeeping gene expression level,
amplification of β-actin was performed using same
protocol as stated above.
II.E. Protein content of PRL and GH by
western blotting
Effects of chPRL-siRNA on the protein
content of PRL and GH were assessed with and
without the addition of E2β. Total protein was
extracted from cultured cells. To detect protein
content of PRL and GH in the control and siRNA
transfected group, samples (5ug per sample) were
subjected to 12% SDS gel and electrotransferred
onto nitrocellulose membranes. After blocking, the
blot was incubated overnight with 1:1000 diluted
rabbit anti-recombinant chPRL (chGH polyclonal
86
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
Table 2. Gene accession numbers and product lengths of different hormones.
Hormone
Accession
number
Forward and reverse primers
Product
length
chProlactin
AB011434.1
F:5’ GGCATTTTACCTCCTGGCCT 3’
R:5’ ACGAAGTAGTTGCCTCCAGC 3’
392
chProlactin
receptor
AY237377.1
F: 5’ CAAGCAACCATGGAAACGCA 3’
R:5’ CCACCCCCTCTTCCTACAGA 3’
759
chGrowth
hormone
AY461843.1
F:5’ CAACATGTGGGCTTGTGTGG 3’
R:5’ CGTTGGCAAACAGGTTGGAG 3’
Estradiol
receptor α
NM 205183.2
chFollicle
stimulating
hormone β
AB077362.1
211
F:5’ GCCTGGCAGGATTTCACTCT 3’
R:5’ AGCTTCCCTCATCCCAAAGC 3’
155
F:5’ GCTGCGGTGACCATCCTGAA 3’
R:5’ AGGATGGCCCCAGTCCTCTC 3’
114
II.F. Estimation of E2β and PRL by
Radioimmuno Assay (RIA)
variation for PRL were 7.01 and 8.90%,
respectively, and the sensitivity of the method was 5
ng/ml per tube. The antiserum had a specificity of
100% for chicken PRL and less than 1% for chicken
growth hormone. Highly purified chicken PRL one
ampoule, approximately 100 μg was provided and
stored in 20 –30 μg of aliquots.
The culture medium for each experimental
group was collected for measurement of the E2 β
and PRL concentration by RIA. Estradio-17β in
cultured media was estimated utilizing the RIA kits
obtained from M/s. Immunotech, France. All
samples from the same experiment were assayed
simultaneously in control and treated samples with
and without addition of E2β. All samples from each
experiment were assayed in duplicate within a
single assay. Concentration of estradio-17β in the
cultured media was estimated using Graph Pad
Prism (RIA Smart software, Packard Cobra).
Chicken PRL anti serum, chicken PRL iodination
grade and pure chicken PRL hormone were obtained
from NIADDK, USA. PRL levels in culture media
were estimated by radioimmuno assay using highly
specific antiserum to chicken PRL (Kaprowski and
Tucker 1971). Intra and inter assay coefficient of
87
Gene Therapy and Molecular Biology Vol: 17, Page 88
suppressing chPRL mRNA expression and
hence we used 60nM of siRNA in the present
experiment to study its effects on various
parameters. Twenty four hours after the
introduction of siRNA into anterior pituitary
cells, chPRL mRNA expression was reduced to
58% at 50nM (Figure 1) and 65% at 60nM
(Figure 2). Furthermore, the effects of siRNA
on PRL mRNA suppression were directly
proportional to the dose. Twenty four hours
after the introduction of siRNAs into pituitary
cells, chPRL mRNA levels were significantly
(P<0.01) supressed by all 3 siRNAs on an
average by 62% as compared to the control
group (non- transfected cells).We could not
significantly distinguish siRNA 1 from
siRNA2 and siRNA3 and vice versa in their
efficacy to suppress the chPRL transcript
(Figure 1 & 2). However, 3 siRNAs produced
diverse silencing effects on chPRL mRNA.
siRNA1 supressed PRL mRNA more
efficiently than other 2 siRNA’s and hence
siRNA 1 is used in this experiment. The
expression level of β-actin mRNA was similar
in all the groups.
II.G. Growth of anterior pituitary cells
in control and siRNA transfected cells by
methyl thiazolyl tetrazolium (MTT) assay
The effect of siRNA-chPRL on cell
proliferation was measured by MTT colorimetric
assay in control and siRNA transfected group.
The day before transfection, anterior pituitary cells
were seeded at a density of 1.5×105 cells/well into
12 well poly-L-lysine coated plates. Experiments
were designed as control (cells were incubated with
the siPort NeoFX without siRNA) and treated
group (chPRL- siRNA). After transfection, cells
cells were incubated at 37℃, 5%CO2 incubator for
24 h. MTT (5 g/L) was added to the wells (10
ml/well) at the end of experimental period. After 4
h incubation at 37℃, the medium was removed
from the wells and dimethylsulfoxide (DMSO) was
added to each well (150 ml/well). The plates were
vibrated at room temperature for 5 min.
Absorbance of each well at 570 nm was read with
a plate reader.
II.I. Statistical analysis
Each experiment was replicated six times. The
data were expressed as means ± SEM. The
statistical significance of difference was analyzed
by ANOVA using Graph Pad PRISM; Graph Pad
Software, Inc., San Diego, CA.USA. P < 0.05 was
considered statistically significant.
III. Results
III.A.
Effect
of
suppressive
concentration of chPRL-sRNA on PRL
mRNA expression
Three chemically synthesised chPRLsiRNA’s at two different concentrations
(50nM & 60nM) were tested to suppress
chPRL mRNA in primary cultured anterior
pituitary cells of domestic chicken. chPRL
mRNA expression was significantly (P<0.01)
suppressed by 50nM of chPRL-siRNA after
twenty four hours of introduction, however,
60nM of siRNA was more effective in
88
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
siRNA transfected cells with higher doses of
E2β (at 10 µM) stimulated PRL mRNA
Expression non-significantly (P>0.05). E2β
treatment of cultured cells significantly
increased the mRNA levels of chPRL in the
control group (Figure 5) than the treated
(siRNA transfected) group. However, mRNA
levels of GH ERα chPRLR, FSHβ were not
significantly different between control and
treated group (Figure 5).
III.B. Expression of chPRLR, chGH,
FSHβ, and ERα gene expression in anterior
pituitary cells transfected with siRNAchPRL
chPRLR, chGH, FSHβ, and E2α receptor
gene expressions between siRNA transfected
and non-siRNA transfected cells were
investigated. After 24h of introduction of
chPRL-siRNA into anterior pituitary cells, the
mRNA levels of chPRLR, chGH, FSHβ, and
ERα were not significantly (P>0.05) different
between the two groups. However, chPRL
mRNA was significantly supressed in chPRLsiRNA transfected cells (Figure 3). The
expression level of β-actin mRNA was similar
in all the groups (Figure 3).
III.C. Effects of addition of varying
doses of E2β on chPRL expression in control
and siRNA transfected cells
E2β treatment of cultured cells
significantly (P <0.01) increased the PRL
mRNA expression in control group in a dose
dependent manner (Figure 4). On the other
hand, E2β treatment of siRNA transfected cells
did not increase the PRL mRNA expression at
0.1µM and 0.5 µM, whereas treatment of
89
Gene Therapy and Molecular Biology Vol: 17, Page 90
109.91±0.06 to 101.82±0.13 ng/ml in siRNA
transfected group. PRL concentration was
significantly (P<0.01) decreased in chPRL –
siRNA transfected cells than the nontransfected cells (Figure 6). No significant
(P>0.05) difference in E2β concentration was
observed between siRNA transfected and nontransfected cells (Figure 7).
III.D. Estimation of chPRL and E2β
concentration in culture medium by RIA
chPRL and E2β concentration were
estimated in the cultured medium of control
and siRNA transfected cells by RIA. chPRL
concentration fluctuated between 364.18±0.11
to 371.37±0.13 ng/ml in non- transfected
group (control) as against
90
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
of PRL and siRNA can exhibit a suppressive
effect on the level of PRL under E2β
stimulated condition (Figure 8). However,
chPRL siRNA showed no effect on protein
level of GH. E2β stimulation enhanced protein
content of GH in control and treated groups
(Figure 9).
III.E.Effects of chPRL-siRNA on
protein content of PRL
Results suggest that protein level of PRL
was suppressed in chPRL-siRNA transfected
cells compared to control group. Results
indicate that reduction of PRL mRNA level by
siRNA leads to the decrease of the protein level
Control
+E2 β
chPRL siRNA+E2β
- E2 β
+E2 β
- E2 β
chPRL
β Actin
PRL/B-actin
0.3
0.2
0.1
0.0
siRNA treated
Control
Figure 8. Effect of introduction of chPRL siRNA on the protein expression of PRL in chicken anterior pituitary
cells. E2β (0.5 µM) stimulated PRL protein in the culture medium of control group. Protein expression of PRL is
suppressed in chPRL siRNA transfected cells. Protein expression of PRL is significantly lower in chPRL siRNA
treated group with and without E2β stimulation. Differences in protein bands for PRL abundance between control
and siRNA transfected samples were assessed by densitometric analysis. The intensity (mean± SEM) of the PRL
bands was compared to the intensity of corresponding β-actin bands. Intensities of western blot electrophoresis
bands was analyzed by using Graph Pad Prism 5 to calculate the relative variation of the protein expression.
Differences between control and treated cells are significant (P<0.01).
91
Gene Therapy and Molecular Biology Vol: 17, Page 92
Control
+E2 β
chPRL siRNA+E2β
- E2 β
+E2 β
- E2β
GH
β Actin
GH/B-actin
0.6
0.4
0.2
0.0
Control
siRNA treated
Figure 9. Effect of introduction of chPRL-siRNA on the protein expression of GH in chicken anterior pituitary
cells. Treatment of control and siRNA transfected cells with E2β (0.5 µM) stimulated GH protein in the culture
medium. Protein expression of GH is not altered by chPRL siRNA. Differences in protein bands for GH abundance
between control and siRNA transfected samples were assessed by densitometric analysis. The intensity (mean±
SEM) of the GH bands was compared to the intensity of corresponding β-actin bands. Intensities of western blot
electrophoresis bands was analyzed by using Graph Pad Prism 5 to calculate the relative variation of the protein
expression. Differences between control and treated cells are non-significant (P>0.05).
92
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
effects on other pituitary hormones related to
hyperprolactinemia in hen anterior pituitary
cells. The present study demonstrated that
introduction of siRNA against PRL mRNA
into anterior pituitary cells strongly supresses
the expression of PRL mRNA and reduces the
production of PRL. In this study, we selected
three sequences for chPRL-siRNA using a
siRNA design program and conducted
suppression of PRL mRNA in primary
cultured anterior pituitary cells of domestic
chicken. Treatments with all three siRNAs
produced significant suppression of PRL
mRNA expression (Clevenger 2003; Reddy
et al, 2014). In regard to inhibition of target
gene expression through introduction of
siRNA, the inhibitory effect on the expression
of a target gene with RNAi is known to differ
according to the sequence of the introduced
siRNA (Clevenger 2003). One sequence may
inhibit chPRL mRNA expression more
efficiently than other sequences (Kobayashi
shui-ichi et al, 2007). In this study, the lowest
PRL mRNA level was observed in the
siRNA-1 treated cells and hence siRNA-1
was used in the following experiments
(Figure 1& 2). We used two different
concentrations of siRNA 1 and studied its
suppressive effects on PRL mRNA
expression in anterior pituitary cells. Twenty
four hours after the introduction of siRNA
into anterior pituitary cells chPRL mRNA
expression was reduced to 58% at 50nM
and 65% at 60nM, suggesting that the
suppressive effect of siRNA may be
influenced by the siRNA concentration
introduced into the target cells (Kobayashi
sui-ichi et al, 2007). The effective siRNA
concentration (50nM) in the present study
was quite similar to the previous reports
(Reddy et al, 2014).
III.F. Growth of anterio pituitary cells
in control and siRNA transfected cells
Growth of in vitro cultured anterior
pituitary cells in control and chPRL-siRNA
treated groups were observed after 24 hours
of transfection. The effect of chPRL-siRNA
on cell growth was estimated by MTT assay.
Prior transfection, anterior pituitary cells were
seeded at a density of 1.5×105 cells per well
into 12 well plates in both control and treated
group. After transfection, growth of cultured
cells was significantly (P<0.05) lower in the
siRNA treated group (1.0 x105cells per ml) as
compared to control group (2.0 x 105cells per
ml). After MTT assay the viability of the cells
in the control group was almost 100% as
compared to 60% in siRNA treated group. In
the controls, cells were incubated with the
siPort NeoFX without siRNA to monitor cell
death. (Figure 10 & 11). SiPort NeoFX
without siRNA did not show any adverse
effects on cell growth.
V. Discussion
The crucial challenge for achieving
efficient RNAi in vivo is its delivery to the
desired organ and into the target cells to
ensure specificity and adequate dose and
duration as well as its effect on other
biologically
and
structurally
related
hormones/growth factors. To achieve this it
is important to conduct a comprehensive
analysis of its relationship with other
biomolecules, hormones or cofactors because
recent studies have shown that several
hormones may act to alter the transcription of
the PRL gene. As a first step to studying the
latter, we conducted knockdown of PRL gene
expression in hen anterior pituitary cells in
vitro by RNAi. Therefore, the primary goal
of this study was to determine the feasibility
of using RNAi to modify PRL gene
expression in anterior pituitary cells and its
93
Gene Therapy and Molecular Biology Vol: 17, Page 94
However, siRNA at 60nM resulted in a more
powerful reduction of chPRL mRNA
expression; hence we used 60nM of siRNA1
concentration in this study. Our results support
the general notion that, in the gene silencing
experiments, it is necessary to select effective
sequence and concentration of siRNA to
suppress the target gene in target cells
(Kobayashi shu-ichi et al, 2007). One of the
novel
targets
in
broodiness
and
hyperprolactinemia therapies is to obtain a
selective down regulation of those genes
overexpressed in anterior pituitary tissues and
PRL is certainly one of them. We assume that
the above data have laid a foundation for
further investigations to follow to control the
PRL induced broodiness in domestic hen.
In this study, chPRL siRNA affected cell
growth in siRNA transfected cells compared
to control cells. It is known that hyper
secretion of chPRL from the anterior pituitary
induces abnormal proliferation of PRL
secretary cells by autocrine /paracrine way. In
addition there is increasing evidence that PRL
acts as a growth-promoter (Yu Cheng et al,
2000) that accesses most cell types as a
pituitary hormone or a locally secreted factor
and activates a mitogen signaling pathway
with a concurrent gain in differentiation of
pituitary cells (Das and Vonderhaar 1997).
The secreted PRL show synergistic effect on
lactotrophs to release PRL that participates
in the hyper secretion of PRL from anterior
pituitary cells and present evidence that the
non-transfected cells are associated with
significantly (P<0.01) higher concentration of
PRL than the siRNA transfected cells (Figure
6).Thus, results of this study, support the
above findings that, down regulation of chPRL
expression resulting from introduction of
siRNA affected the growth of pituitary cells in
siRNA transfected cells compared to non-
transfected cells (Figure 10 & 11) in the
current cell culture conditions.
To demonstrate the effects of low level of
PRL on other pituitary hormones, we
conducted knockdown of PRL gene
expression in chicken anterior pituitary cells in
in vitro by RNA interference and assessed its
effects on GH, FSHβ, chPRLR ERα and E2β
after siRNA transfection by quantitative real
time PCR. Introduction of PRL siRNA into
cultured anterior pituitary cells significantly
(P<0.01) reduced the PRL mRNA expression.
On the other hand, GH, FSHβ, ERα receptor,
PRL receptor mRNA expressions and E2β
concentration in the cultured medium (Figure
7) were not affected 24 hour after introduction
of chPRL siRNA into cells, suggesting that the
suppressive effect of siRNA is specific to PRL
mRNA and PRL levels produced by anterior
pituitary cells in the culture medium. The
results suggests that, down regulation of
chPRL mRNA induced no effects either on
GH, FSHβ, chPRLR, ERα or on E2β, (Mei Pan
et al, 2007). Generally, PRL receptor interacts
with the PRL molecule as a receptor contains
an extracellular region that binds PRL, a
transmembrane region and a cytoplasmic
region. When PRL binds to the receptor, it
leads to dimerize with another PRL receptor
which activates the Janus kinase 2 (Jak2) a
tyrosine kinase that triggers the JAK- signal
transducer and activator of transcription
(STAT) pathway. Further stimulation of PRL
receptor also leads in the stimulation of
mitogen-activated protein kinases and Src
kinase (Yu Cheng et al, 2000).So, when
expression of PRL is down regulated, binding
sites of PRLR is minimized, the Jak2/STAT
pathway is blocked, which led to the inhibition
of PRL expression (Harris et al, 2004;
Clevenger and Kline 2001).
94
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
Control
siRNA transfected cells
Figure 10. Growth of chicken anterior pituitary cells in control and chPRL- siRNAtransfected cells (magnification;
100X).
E2β treated anterior pituitary
cells without chPRL siRNA
siRNA transfected pituitary cells with E2β
Figure 11. Growth of chicken anterior pituitary cells with E2β and chPRL- siRNAtransfected cells.
95
Gene Therapy and Molecular Biology Vol: 17, Page 96
The results suggest that, E2 β significantly (P
<0.01) increased the PRL secretion in nontransfected cells in a dose dependent manner.
On the other hand, E2β treatment of siRNA
transfected cells did not increase the PRL
levels at 0.1µM and 0.5
µM. However higher doses of E2β (nM)
stimulated PRL secretion non-significantly
(P>0.05). This may suggest that higher doses
of E2β or a different treatment protocol may
be required to suppress the expression of PRL
secretion in siRNA transfected cells in in vitro
conditions. However, it was suggested that
estrogen regulates PRL gene expression
within the anterior pituitary gland (Lieberman
et al, 1981; Maurer 1982; Shull and Gorski
1984; Shull; Gorski 1989) by binding to its
nuclear receptor and subsequently conferring
DNA binding and transcriptional activation of
the gene (Waterman et al, 1988). The
transcription of the PRL gene results in
increased synthesis of PRL and the increased
PRL secretion may be a reflection of newly
synthesized hormone from the estrogenstimulated pituitary cells as observed in the
non-transfected cells (Figure 4). Furthermore,
E2β-induced PRL release and gene expression
are modulated by the intracellular signaling
pathways activated by estrogen that result in
stimulation of PRL transcription and release,
through cAMP, Ca2+, IP3, phosphorylation in
response to E2β and other second messengers.
The reasons for the lack of responsiveness of
PRL to E2β treatment in chPRL-siRNA
transfected cells are uncertain. It may be
associated with the above-mentioned or other
mediation factors on the E2β-ERα-PRLPRLR pathway under the current cell culture
conditions.
Therefore, down regulation of PRL blocked
the signal transduction pathways triggered by
PRL- PRLR complex, which subsequently
influenced either degradation of PRL mRNA
sequences (Sushelas Chaidarun et al, 1998)
or knockdown of PRL in pituitary cells and the
promoter of target gene (Clevenger
2003).This is further supported by observing
the normal levels GH, FSHβ, chPRLR ERα
andE2β in both siRNA transfected and nontransfected pituitary cells (Figure 3).
Therefore, the experiments not only once
again validated the expression of GH, FSHβ,
chPRLR, ERα andE2β in siRNA transfected
cells failed to enhance or inhibit GH, FSHβ,
chPRLR ERα (Figure3) and E2β (Figure 7),
but also explained the reason why transfected
cells were unable to alter the GH, FSHβ,
chPRLR ERα andE2β after siRNA
transfection (Figure 3). This suggests that, the
suppressive effect of siRNA may be specific
to PRL transcripts and the levels of GH,
FSHβ, PRLR, ERα and E2β may be
independent of PRL mRNA level (Ronchetti
et al, 2013; Mei Pan et al, 2007). Further, our
results support the predominant role that
RNAi is assuming in the field of gene
silencing owing to its specificity. We believe
that the above data have laid a foundation for
further therapeutic investigations to follow for
controlling the secretion of PRL from PRL
secretary cells of anterior pituitary gland in
broody hen by RNAi. Recent studies have
shown that several hormones may act to alter
the transcription of the PRL gene. Estradiol is
an important physiological regulator of PRL
production by the pituitary (Maurer 1982). To
further examine possible E2β effects on PRL
mRNA expression and PRL secretion we
investigated E2β effects in primary cultured
anterior pituitary cells in both the siRNA
transfected and non- transfected cells by
treating the cells with different doses of E2β.
96
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
E2β stimulated condition (Maurer and Gorski
1977). On the other hand, an increase of PRL
level was observed by adding E2β within
control samples. The reason for this could be
that, protein content of PRL was consistent
with the level of PRL mRNA and suppression
of PRL affected the protein levels of PRL.
Protein content of GH was not significantly
different between treated and non-treated cells
(Figure9) suggesting that, suppressive effect
of chPRL-siRNA may be specific to protein
levels of PRL and protein level of GH may
be independent of PRL.
In summary, chPRL- siRNA reduces the
chPRL gene expression, PRL concentration
and growth of pituitary cells with specificity
without affecting other associated hormones
and this may provide the basis for a better
understanding of the role of PRL in avian
physiology and behavior. An understanding of
the mechanisms and or studying its regulation
and action at the physiological and the
molecular level in galliforms which control
broodiness/hyperprolactinemia may provide
the basis for the development of new
therapeutic methods for the prevention and/or
for selection against this economically
important trait.
Another reason for lack of responsiveness of
PRL to E2β treatment in the siRNA
transfected cells may be due to changes in the
synthesis or degradation of PRL transcription
by effective chPRL siRNA in the transfected
cells (Maurer 1982; Greene 1986). It is known
that, ER-α is a nuclear receptor that is
activated by the E2β (Walter et al, 1985).
Estrogen treatment of chPRL- siRNA
transfected cells stimulated ERα nonsignificantly (P>0.05) than the nontransfected cells. Recent studies have shown
that, estrogen requires PRL which can
stimulate the expression of ER-α (Frasor and
Gibori 2003).These results are consistent with
those of previous studies that reported that
ER-α expression appears to be dependent on
the PRL biosynthesis (Frasor and Gibori
2003) and therefore, low PRL in the siRNA
transfected cells non-significantly (P>0.05)
affected the ER-α expression in transfected
cells in response to E2β treatment. The results
reported here demonstrate that E2β stimulates
both synthesis and secretion of PRL from
individual lactotrophs and also that the ability
of E2β to influence synthesis and its ability to
influence PRL secretion are interdependent
(Frasor and Gibori 2003).
To investigate whether the reduction of
PRL mRNA reflects PRL protein expression
or activity, we measured the protein levels of
PRL and PRL concentration produced by the
siRNA transfected and non- transfected cells
in the culture medium. The protein content of
PRL and PRL concentration was significantly
low (P<0 .01) in siRNA transfected cells than
the control. These results may suggest that the
reduction of PRL mRNA level by siRNA
leads to the decrease of the protein level of
PRL, and siRNA can exhibit a suppressive
effect on the level of PRL (Figure8.) under
Acknowledgements
The authors are thankful to Director,
NIANP, Bangalore, for providing necessary
facilities to carry out the work. We are
thankful to Dr. A.F. Parlow, Director,
NIADDK, California (USA), providing the
chicken prolactin hormone and antisera for the
above study.
97
Gene Therapy and Molecular Biology Vol: 17, Page 98
Greene GL, Gilna P, Waterfield M, Baker A, Hort Y,
Shine J(1986). Sequence and expression of
human estrogen receptor complementary DNA.
Science, 231 (4742): 1150–1154.
Harris J, Prudence MS, Samantba RO, Christopher JO.
(2004).Prolactin and the prolactin receptor: new
targets of an old hormone. Annals and
Medicine, 36:414-25.
Hiyama Gen, Kanasaku N, Reddy IJ, Scotonical S,
Guemene
D,
Zadworney
D
(2008).
Knockdown of PRL gene expression in the
anterior
pituitary
gland
during
late
embryogenesis in turkey. 9th International
Society for Avian Endocrinology, July 10-15,
Leuven, Belgium.
Kaprowski JA, Tucker HA (1971). Radio
immunoassay of prolactin. J of Dairy Sci,
54:1675–1680.
Kobayashi Shu-ichi, Miki Sakatani, Shuji Kobayashi,
Kyoshi
Okuda, Masshi Takahashi,
(2007).Gene silencing of cyclooxygenase2mRNA by RNA interference in bovine
cumulus granulosa cells. J of Reprod and
Develop, 6(53):1305-1311.
Lieberman ME, Maurer RA, Claude P, Wiklund J,
Wertz N, Gorski J (1981).Regulation of
pituitary growth and prolactin expression by
estrogen. Advances in
Experimental
Medicine and Biology, 138:151-163.
Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb
J, Peck D, Sweet-Cordero A et al (2005).
MicroRNA expression profiles classify human
cancers. Nature, 435: 834-838.
Maurer RA, Gorski J (1977). Effects of estradiol-173
and pimozide on prolactin synthesis in male
and female rats. Endocrinol, 101: 76-84.
Maurer RA (1982). Estrodiol regulates the
transcription of the prolactin gene. J of Biolo
Chem, 257:2133-2136.
Mei Pan, Qinjun Wei, Fang Cao, Yajie Lu, Yibao Zhu,
Yongqian Shu, Xin Cao (2007).Inhibition of
cell proliferation by siRNA targeting hPRLR in
breast cancer MCF-7 cell line. J. of Nanjing
Medical University, 21(6):372-376
Nicoll CS, Mayer GL, Russell SM (1986). Structural
features of prolactins and growth hormones that
can be related to their biological properties.
Endocrine Reviews, 7:169–203.
Oomizu S, Takeuchi S, Takahashi S (1998).
Stimulatory effect of insulin-like growth factor
I on proliferation of mouse pituitary cells in
serum-free culture. J. of Endocrinology,
157:53–62.
References
Bedecarrats GY,Guemene D, Morvan C, Kuhnlein U,
Zadworny D (1999). Quantification of prolactin
messenger ribonucleic acid, pituitary content
and plasma levels of prolactin and detection of
immunoreactive isoforms of prolactin in
pituitaries from turkey embryos during
ontogeny. Biol Reprod, 61:757-763.
Bole-Feysot CV, Goffin M, Edery N. Binart Kelly PA
(1998). Prolactin (PRL) and its receptor:
Actions, signal transduction pathways and
phenotypes observed in PRL receptor knockout
mice. Endocrine Reviews, 19:225–268.
Caplen NJ, Parrish S, Imani, F, Fire A, Morgan RA
(2001). Specific inhibition of gene expression
by small double-stranded RNAs in invertebrate
and vertebrate systems. Proceedings of
National Academy of Sciences, U.S.A.,
98:9742–9747.
Cheng Y, Zhizhin I, Perlman RL and Mangoura D
(2000). Prolactin-induced cell proliferation in
PC12 cells depends on JNK but not ERK
activation. J Biol Chem, 275(30):23326-32.
ChunTY,
Gregg
D,
Sarkar
DK.,
Gorski
J(1998).Differential regulation by estrogens of
growth and prolactin synthesis in pituitary cells
suggests that only a small pool of estrogen
receptors is required for growth. Proceedings of
National Academy of Sciences, U.S.A.,
3, 95(5),2325-30.
Clevenger CV (2003). Role of prolactin /prolactin
receptor signalling in human breast cancer.
Breast Disease, 18:75-86.
Clevenger CV, Kline JB (2001). Prolactin receptor
signal transduction. Lupus, 706-18.
Clevenger CV, Kline JB (2001). Prolactin receptor
signal transduction. Lupus, 706-18.
Copeland KC, Johnson DM, Kuehl TJ, Castracane VD
(1984). Estrogen stimulates growth hormone
and somatomedin-C in castrate and intact
female baboons. J of Clinic Endocrinol and
Metab, 58:(4):698-703.
Das R and Vonderhaar BK (1997). Prolactin as a
mitogen in mammary cells.Journal of
Mammary Gland Biology and Neoplasia,
2(1):29-39.
Denef C (2003). Paracrine control of lactotrope
proliferation and differentiation. Trends in
Endocrinol and Metabolism, 14:188–195.
Frasor J, Gibori G (2003). Prolactin regulation of
estrogen receptor expression. Trends in
Endocrinology and Metabolism, 14 (3):11823.
98
Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen
Reddy IJ, David CG, Sarma PV, Khub Singh (2002).
Possible role of PRL on laying performance and
steroid hormones in domestic hen (Gallus
domesticus). Gen. Comp. Endocrinol, 1:249255.
Reddy IJ, Ashish Mishra, Mondal S (2014).Effects of
chicken prolactin siRNA on pituitary insulin like
growth factor-1 and prolactin receptor in in vitro
cultured hen anterior pituicytes. Gene Ther and
Mol Biol, 16:237-250.
Ronchetti SA, Miler EA, Duvilanski BH, Cabilla, JP
(2013). Cadmium Mimics Estrogen-Driven Cell
Proliferation and Prolactin Secretion from
Anterior Pituitary Cells. PLoS ONE 8(11),
e81101. (doi:10.1371/journal.pone.0081101).
Schwardz J (2000). Intracellular communication in the
anterior pituitary. Endocrine Reviews, 21
488–513.
Sharp PJ (1996).Immunization of poultry against
broodiness. Proceedings of worlds Poultry
Congress, 2-5 September 1996, New Delhi,
India. Volume II. PP.1-5.
Shull JD, Gorski J (1989).Estrogen regulation of
prolactin transcription in vivo: paradoxical
effect of 17beta estradiol dose. Endocrinol,
124:279-285.
Shull JD, Gorski (1984).Estrogen stimulates prolactin
gene transcription by a mechanism independent
of pituitary protein synthesis. Endocrinol,
114:1550-1557.
Simmons DM, Voss JW, Ingraham HA, Holloway JM,
Broide RS, Rosenfeld MG, Swanson LW
(1990). Pituitary cell phenotypes involve cellspecific Pit-1 mRNA translation and synergistic
interactions with other classes of transcription
factors. Genes and Develop 4:695–711.
Sushela.SChaidarun, Brooke Swearingen, Joseph
Alexander (1998). Differential Expression of
Estrogen Receptor-b (ERb) in Human Pituitary
Tumors: Functional Interactions with ERα and a
Tumor-Specific Splice Variant. J of Clinic
Endocrinol and Metab, 83:3308–3315,
Tamiki Hikake, Shinji Hayashi, Taisen Iguchi, Tomomi
Sato. (2009). The role of IGF1 on the
differentiation of prolactin secreting cells in the
mouse anterior pituitary. J. of Endocrinol,
203:231–240
99