Gene Therapy and Molecular Biology Vol: 17, page 82 Gene Ther Mol Biol Vol 17, 82-99, 2015 Suppression of chicken prolactin transcription and translation in hen anterior pituicytes by RNA interference and its effect on associated hormones Research Article I. J. Reddy1*, Ashish Mishra1 and Sukanta Mondal1 1 Animal Physiology Division, National Institute of Animal Nutrition and Physiology, Bangalore, India *Correspondence: Animal Physiology Division, National Institute of Animal Nutrition and Physiology, Hosur Road, Adugodi, Bangalore- 560 030. India, Tel: +91 80 25711304, Fax: +91 80 25711320, Email: [email protected] Keywords: chPRL siRNA-anterior pituicytes- GH, FSHβ, ERα mRNA, E2β - hen Received: 1 September 2015; Revised: 9 September 2015 Accepted: 9 October 2015; electronically published: 13 October 2015 Summary Prolactin (PRL) is a peptide hormone synthesized and secreted by lactotroph cells in anterior pituitary of the hen. In aves, hyper secretion of PRL causes ovarian regression, ovarian dysfunction and broodiness. In addition, pituitary estrogens (E2β) play synergetic effects on both replication and synthesis of PRL in pituitary lactotrophs leading to hyperprolactinemia. The aim of this study was in vitro suppression of chPRL transcription and translation in hen anterior pituicytes by small-interfering RNA (siRNA) targeting chPRL and assessing its effects on the mRNA levels of PRL, prolactin receptor (PRLR), follicle stimulating hormone (FSHβ), growth hormone (GH) estrogen receptor (ERα), pituitary content of estrogen (E2β) and PRL concentration in primary cultures of anterior pituitary cells obtained from broody hens. Three chPRL- siRNA’s were chemically synthesized based on turkey and chicken PRL mRNA and conducted suppression of PRL in primary cultured anterior pituicytes of hen. After 24 hours of chPRL-siRNA transfection the amount of chPRL, GH, PRLR, FSHβ, ERα, expression levels were analyzed by polymerase chain reaction (PCR). Protein content of PRL and GH in the control and siRNA transfected culture media were analysed by western blot method. Pituitary content of PRL and E2β was estimated in the cultured medium by radioimmuno assay (RIA).To investigate the effective concentration of siRNA 50nM and 60nM of PRL siRNA was introduced into primary cultured anterior pituitary cells. PRL mRNA expression was reduced to 58% at 50nM and 65% at 60nM compared with the control. Protein content of PRL was clearly suppressed in transfected cells. Conversely, the protein content of GH did not significantly different between control and treated cells. PRL concentration in the cultured 82 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen medium of siRNA treated cells was significantly (P<0.05) lower than controls, whereas the pituitary E2β levels were not significantly different between the control and treated cells. Treatment of cultured cells with varying doses of E2β significantly increased the mRNA levels of PRL, GH, and ERα, protein content of PRL, GH and PRL concentration in the control group. However, mRNA levels of PRLR, FSHβ, and pituitary content of E2β levels were not significantly (P>0.05) increased with E2β treatment of control and siRNA transfected cells. Results suggest that, chPRL-siRNA designed in this study suppresses PRL gene expression specifically and that the level of PRLR, GH, FSHβ, ERα expression and estradiol were not associated with PRL in anterior pituitary. Our data support that chPRL- siRNA serves as a potential therapeutic tool to control hyperprolactinemia in vertebrates. I. Introduction Gonadotrophic and gonadal hormones are required for ovulation, egg formation and egg lay in hen. Blocking of these hormones lead to disruption of the ovulatory cycle in chicken and turkeys (Zadworny and Etches 1987).Thus hyperprolactinemia is an endocrine derangement resulting from over-production of PRL by anterior pituitary leading to affect the HPG axis, broodiness, cessation of egg lay and reproductive disorders in domestic hen (Zadworny and Etches 1987; Sharp et al, 1996; Bédécarrats et al, 1999) and other native breeds of fowl. Classical drugs blocking excess pituitary PRL production are not efficient in these conditions, which has encouraged the search for alternative ways of inhibiting the undesirable actions of PRL in hen and other species (Vincent Goffin et al, 2007; Lu J et al, 2005).The alteration of specific PRL gene can provide an ideal method to study the causes and potential therapeutics of hyperprolactinemia and broodiness affecting the egg laying chicken (Nicoll et al, 1986) and this may provide an appealing alternative to the conventional methods of PRL suppression by active or passive immunization against PRL in hen (Sharp et al, 1996). After the invention of RNAi, it is possible to suppress RPL transcription and translation n hen anterior Anterior pituitary gland consists of several cell types essential for many physiological processes such as homeostasis, development, metabolism, growth and reproduction (Ronchetti et al, 2013). Almost 50% of the gland is constituted by lactotrophs, which secrete PRL together with gonadotrophs (Ronchetti et al, 2013). The pituitary prolactin (PRL) also familiar as versatalin is a peptide hormone that is primarily synthesized in the anterior pituitary gland and is known to be involved in numerous biological actions in vertebrates (Bole-Feysot et al, 1998).In avian species, the primary functions of PRL are the onset and maintenance of incubation behaviour (broodiness) in galliformes and production of crop-sac milk in pigeons (Bédécarrats et al, 1999). However, excess of PRL secretion leads to various disorders of reproductive functions in mammals. Hyper secretion of PRL alters the hypothalamic- pituitary-gonadal (HPG) axis as PRL tends to decrease the secretion of gonadotrophic releasing hormone (GnRH) from the hypothalamus and in turn suppresses the secretion of follicle stimulating hormone (FSH) and luteinizing hormone (LH) from the anterior pituitary, estradiol-17β (E2β) and progesterone (P4) from gonads in hen (Sharp et al, 1996; Bédécarrats et al, 1999; Reddy et al, 2002). 83 Gene Therapy and Molecular Biology Vol: 17, Page 84 pituitaries during prenatal period inorder to maintain normal levels of PRL in post natal period (Hiyama et al, 2008). It is known that RNA interference (RNAi) is a sequence specific gene silencing process triggered by double stranded RNA, which is highly conserved among different species (Caplen et al, 2001). There is a great promise in the use of RNAi in domestic hen to control PRL secretion to improve our understanding of biology of broodiness / hyperprolactinemia in domestic hen. However, in order to enable the adoption of new applications in vertebrates, the methods of gene manipulation as well as the technologies to be used to suppress target gene require further refinements to improve efficiency, precision and simplicity. Knockdown of PRL may alter the synthesis and release of other gonadotrophic and gonadal hormones because PRL and GH are structurally and biologically related members of a multigene family and are thought to have originated from a single ancestral gene by a duplication event (Zadworny and Etches 1987; Bole- Feysot et al, 1998; Simmons et al, 1990). PRL cells and GH producing cells originate from the same progenitor cells which express the transcription factors that play an important role in the differentiation of PRL and GH cells (Simmons et al, 1990).It is known that PRL secretion is thought to be controlled by various factors from the hypothalamus, peripheral hormones and growth factors (epidermal growth factor; EGF, IGF1). It is unquestionable that vasoactive intestinal peptide (VIP) and E2β (Schwardz 2000; Denef 2003; Ronchetti et al, 2013; Tamiki et al, 2009) stimulates the PRL release from anterior pituitary cells. PRL acts an endocrine, autocrine, and paracrine (Oomizu et al, 1998) way through the PRL receptor and to some extent by cytokine receptors (BoleFeysot et al, 1998) in terms of growth and PRL gene expression. It was reported that growth of pituitary lactotrophs are sensitive to estrogens with small pool of estradiol 17 β receptor (ERα) than the PRL response suggesting that E2β is another key regulator of PRL synthesis and replication (Chun et al, 1998) through a mechanism involving increased transcription of the PRL gene in pituitary lactotrophs (Maurer 1982). E2β increases the sensitivity of PRL cells to GnRH stimulation (Weber et al, 1997), inhibits PRL proteolysis in the hypothalamoneurohypophyseal system and stimulates FSHβ (Copeland et al, 1984) secretion in vertebrates.Hence the purpose of the present study was to investigate the effects of small interfering RNA against chPRL (chPRLsiRNA) on PRL, PRLR, GH, FSHβ, ERα, pituitary content of PRL,E2β and protein content of PRL, GH, in in vitro cultured hen anterior pituitary cells primed with varying doses of E2β. In order to attenuate the PRL in in vivo it is necessary to demonstrate the effects of low levels of PRL on various endocrine factors in in vitro conditions. However, stable and chronic suppression of PRL gene expression in vivo is required using a siRNA expression vector. This may serve as the most promising strategy to develop more potent and specific therapeutics with improved characteristics (fewer side effects) against hyperprolactinemia in vertebrates. 84 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen carry out the experiment. Cells (1.5×105 per 1ml) were seeded to a 12 well poly-L-lysine coated plates containing a mixture of 50 nM of siRNA, Lipofectamine 2000 (Invitrogen) and Opti-MEM (Invitrogen).Similarly cells (1.5×105 per 1ml) were seeded to another 12 well poly-L-lysine coated plates containing a mixture of 60 nM of siRNA, Lipofectamine 2000 (Invitrogen) and Opti-MEM (Invitrogen). Cells were incubated without antibiotics for 24 h at 370C in humidified 95% air5% CO2, after which the culture medium was replaced with DMEM/F12 Ham containing 10% chicken serum and 1% ITS. Four hours later E2β (sigma) (0.1µM, 0.5 µM and 10 µM) was added individually and after 6h incubation, total RNA was extracted from the cultured cells. The first strand cDNA was synthesized from 300ng of total RNA with the use of random primer. The culture medium for each experimental group was collected for measurement of the E2 β and PRL concentration by radioimmunoassay. II. Materials and Methods II.A. Cell culture Chicken heads from broody hens were collected (n=60) from local abattoir immediately after slaughter and transported to the laboratory in ice. Anterior pituitary glands were isolated from hen and processed for primary cell culture. Cells were isolated and cultured as per the method described by Hiyama et al. 2008. Cells were diced in PBS and centrifuged at 1500RPM for 5 minutes and washed in PBS 4 times. Cell pellet was resuspended and cultured in Dulbecco Modified Eagle Medium (DMEM).Cells were incubated without antibiotics for 18 h at 370C in humidified 95% air-5% CO2, after which the culture medium was replaced every 24 hours with DMEM/F12 Ham containing 1% ITS. After reaching the confluence, cells were treated with trypsin/EDTA for 1 min at 370C and then cultured in poly Llysine coated well plates. First passage cells were used for RNAi experiments. II.C. RNA Extraction and PCR II.B. Designing of siRNA and transfection of siRNA into anterior pituitary cells Total RNA from cultured cells was extracted using Trizol reagent, as per the manufacturer’s protocol. The recovered RNA was dissolved in diethyl pyrocarbonate-treated water to a final concentration of 1 ug/ul. Integrity of the RNA was electrophoretically verified in 1.2% formaldehyde agarose gels stained with ethidium bromide. Three synthetic siRNAs (siRNA1, siRNA2 and siRNA3; Table 1) targeting the chicken PRL mRNA (AB011434) were designed based on turkey and chicken PRL mRNA using the siRNA Target Finder software. SiRNA’s were obtained from Ambion (Life Technologies Inc.) and BLAST search (www.ncbi.nlm.nih.gov/ BLAST) was carried out to confirm the specificity of sequences. Testing of siRNA (Life Technologies Inc.) was carried by utilizing siPort NeoFX transfection agent as per the manufacturer’s procedure. Three siRNA’s were individually tested in poly –L-lysine coated plates containing a mixture of siRNA and anterior pituitary cells and the same is repeated six times. ChPRL mRNA levels were assessed by qRTPCR after 24 hours of incubation. In the controls, cells were incubated with the siPort NeoFX without siRNA to monitor cell death and cytotoxicity. However, the concentration of siRNA transfection mixture was adjusted accordingly to II.D.Reverse Transcription and RealTime PCR The first strand cDNA was synthesized from 300 ng of total RNA with the use of random primer. 5 µg of total RNA was heat-denatured and reverse transcribed by incubation at 50oC for 50 min using superscript III-reverse transcriptase, RNase OUT, DTT, MgCl2, dNTP mixture and oligo (dT) primer in a final volume of 20 µl of 1X RT buffer. Subsequently the reaction was terminated by heating at 850C for 5 min and cooling on ice. After reverse transcription, the mRNA levels of PRL, PRLR and GH, FSHβ, and ERα receptor were estimated by qRTPCR. 85 Gene Therapy and Molecular Biology Vol: 17, Page 86 Table 1. Locations and sequences of three different siRNAs on chicken PRL mRNA Gene siRNA PRL- I (458-477) siRNA PRL –II (606-624) siRNAPRL- III (679-698) Sequence(5’-3’) Length M.Wt Molar 21 Percent G/C 29% Sense: CGAAGGCUGUAGAGAUUGAtt Antisense: UCAAUCUCUACAGCCUUCCag 6900 220600 21 48% 6500 197200 Sense: CCAGACUCUUUGCUUUUUAtt 21 29% 6600 196400 Antisense: UAAAAAGCAAAGAGUCUGGag 21 38% 6800 228300 Sense: GUUUUGAAGUGCCGCCUAA tt Antisense: : UUAGGCGGCACUUCAAAAC tt 21 29% 6700 204100 21 43% 6700 203400 antibody for GH). The blot was then incubated with 1:5000 diluted alkaline phosphatase labeled antirabbitIgG antibody. The chemiluminescence signal was analyzed with an autoradiography film after treatment of the membrane with Renaissance reagent (NEN Life Science Products, PerkinElmer, Boston, MA). The intensity of the signal was quantified by the densitometry of autoradiograms using Alpha Imager. Primer sets were designed based on the cDNA sequence of the chPRL, chPRLR, chGH, chFSHβ and ERα using the online primer design procedure (Gene bank Accession Numbers; Table 2). Realtime PCR was performed to study PRL, PRLR, GH, FSHβ and ERα gene expressions relative to β– actin. Each cDNA sample was analysed in duplicate using Light Cycler (Step One Plus, ABI, USA). For the real-time PCR reaction, Fast Sybr Master Mix was used (ABI, USA). To confirm a constant housekeeping gene expression level, amplification of β-actin was performed using same protocol as stated above. II.E. Protein content of PRL and GH by western blotting Effects of chPRL-siRNA on the protein content of PRL and GH were assessed with and without the addition of E2β. Total protein was extracted from cultured cells. To detect protein content of PRL and GH in the control and siRNA transfected group, samples (5ug per sample) were subjected to 12% SDS gel and electrotransferred onto nitrocellulose membranes. After blocking, the blot was incubated overnight with 1:1000 diluted rabbit anti-recombinant chPRL (chGH polyclonal 86 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen Table 2. Gene accession numbers and product lengths of different hormones. Hormone Accession number Forward and reverse primers Product length chProlactin AB011434.1 F:5’ GGCATTTTACCTCCTGGCCT 3’ R:5’ ACGAAGTAGTTGCCTCCAGC 3’ 392 chProlactin receptor AY237377.1 F: 5’ CAAGCAACCATGGAAACGCA 3’ R:5’ CCACCCCCTCTTCCTACAGA 3’ 759 chGrowth hormone AY461843.1 F:5’ CAACATGTGGGCTTGTGTGG 3’ R:5’ CGTTGGCAAACAGGTTGGAG 3’ Estradiol receptor α NM 205183.2 chFollicle stimulating hormone β AB077362.1 211 F:5’ GCCTGGCAGGATTTCACTCT 3’ R:5’ AGCTTCCCTCATCCCAAAGC 3’ 155 F:5’ GCTGCGGTGACCATCCTGAA 3’ R:5’ AGGATGGCCCCAGTCCTCTC 3’ 114 II.F. Estimation of E2β and PRL by Radioimmuno Assay (RIA) variation for PRL were 7.01 and 8.90%, respectively, and the sensitivity of the method was 5 ng/ml per tube. The antiserum had a specificity of 100% for chicken PRL and less than 1% for chicken growth hormone. Highly purified chicken PRL one ampoule, approximately 100 μg was provided and stored in 20 –30 μg of aliquots. The culture medium for each experimental group was collected for measurement of the E2 β and PRL concentration by RIA. Estradio-17β in cultured media was estimated utilizing the RIA kits obtained from M/s. Immunotech, France. All samples from the same experiment were assayed simultaneously in control and treated samples with and without addition of E2β. All samples from each experiment were assayed in duplicate within a single assay. Concentration of estradio-17β in the cultured media was estimated using Graph Pad Prism (RIA Smart software, Packard Cobra). Chicken PRL anti serum, chicken PRL iodination grade and pure chicken PRL hormone were obtained from NIADDK, USA. PRL levels in culture media were estimated by radioimmuno assay using highly specific antiserum to chicken PRL (Kaprowski and Tucker 1971). Intra and inter assay coefficient of 87 Gene Therapy and Molecular Biology Vol: 17, Page 88 suppressing chPRL mRNA expression and hence we used 60nM of siRNA in the present experiment to study its effects on various parameters. Twenty four hours after the introduction of siRNA into anterior pituitary cells, chPRL mRNA expression was reduced to 58% at 50nM (Figure 1) and 65% at 60nM (Figure 2). Furthermore, the effects of siRNA on PRL mRNA suppression were directly proportional to the dose. Twenty four hours after the introduction of siRNAs into pituitary cells, chPRL mRNA levels were significantly (P<0.01) supressed by all 3 siRNAs on an average by 62% as compared to the control group (non- transfected cells).We could not significantly distinguish siRNA 1 from siRNA2 and siRNA3 and vice versa in their efficacy to suppress the chPRL transcript (Figure 1 & 2). However, 3 siRNAs produced diverse silencing effects on chPRL mRNA. siRNA1 supressed PRL mRNA more efficiently than other 2 siRNA’s and hence siRNA 1 is used in this experiment. The expression level of β-actin mRNA was similar in all the groups. II.G. Growth of anterior pituitary cells in control and siRNA transfected cells by methyl thiazolyl tetrazolium (MTT) assay The effect of siRNA-chPRL on cell proliferation was measured by MTT colorimetric assay in control and siRNA transfected group. The day before transfection, anterior pituitary cells were seeded at a density of 1.5×105 cells/well into 12 well poly-L-lysine coated plates. Experiments were designed as control (cells were incubated with the siPort NeoFX without siRNA) and treated group (chPRL- siRNA). After transfection, cells cells were incubated at 37℃, 5%CO2 incubator for 24 h. MTT (5 g/L) was added to the wells (10 ml/well) at the end of experimental period. After 4 h incubation at 37℃, the medium was removed from the wells and dimethylsulfoxide (DMSO) was added to each well (150 ml/well). The plates were vibrated at room temperature for 5 min. Absorbance of each well at 570 nm was read with a plate reader. II.I. Statistical analysis Each experiment was replicated six times. The data were expressed as means ± SEM. The statistical significance of difference was analyzed by ANOVA using Graph Pad PRISM; Graph Pad Software, Inc., San Diego, CA.USA. P < 0.05 was considered statistically significant. III. Results III.A. Effect of suppressive concentration of chPRL-sRNA on PRL mRNA expression Three chemically synthesised chPRLsiRNA’s at two different concentrations (50nM & 60nM) were tested to suppress chPRL mRNA in primary cultured anterior pituitary cells of domestic chicken. chPRL mRNA expression was significantly (P<0.01) suppressed by 50nM of chPRL-siRNA after twenty four hours of introduction, however, 60nM of siRNA was more effective in 88 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen siRNA transfected cells with higher doses of E2β (at 10 µM) stimulated PRL mRNA Expression non-significantly (P>0.05). E2β treatment of cultured cells significantly increased the mRNA levels of chPRL in the control group (Figure 5) than the treated (siRNA transfected) group. However, mRNA levels of GH ERα chPRLR, FSHβ were not significantly different between control and treated group (Figure 5). III.B. Expression of chPRLR, chGH, FSHβ, and ERα gene expression in anterior pituitary cells transfected with siRNAchPRL chPRLR, chGH, FSHβ, and E2α receptor gene expressions between siRNA transfected and non-siRNA transfected cells were investigated. After 24h of introduction of chPRL-siRNA into anterior pituitary cells, the mRNA levels of chPRLR, chGH, FSHβ, and ERα were not significantly (P>0.05) different between the two groups. However, chPRL mRNA was significantly supressed in chPRLsiRNA transfected cells (Figure 3). The expression level of β-actin mRNA was similar in all the groups (Figure 3). III.C. Effects of addition of varying doses of E2β on chPRL expression in control and siRNA transfected cells E2β treatment of cultured cells significantly (P <0.01) increased the PRL mRNA expression in control group in a dose dependent manner (Figure 4). On the other hand, E2β treatment of siRNA transfected cells did not increase the PRL mRNA expression at 0.1µM and 0.5 µM, whereas treatment of 89 Gene Therapy and Molecular Biology Vol: 17, Page 90 109.91±0.06 to 101.82±0.13 ng/ml in siRNA transfected group. PRL concentration was significantly (P<0.01) decreased in chPRL – siRNA transfected cells than the nontransfected cells (Figure 6). No significant (P>0.05) difference in E2β concentration was observed between siRNA transfected and nontransfected cells (Figure 7). III.D. Estimation of chPRL and E2β concentration in culture medium by RIA chPRL and E2β concentration were estimated in the cultured medium of control and siRNA transfected cells by RIA. chPRL concentration fluctuated between 364.18±0.11 to 371.37±0.13 ng/ml in non- transfected group (control) as against 90 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen of PRL and siRNA can exhibit a suppressive effect on the level of PRL under E2β stimulated condition (Figure 8). However, chPRL siRNA showed no effect on protein level of GH. E2β stimulation enhanced protein content of GH in control and treated groups (Figure 9). III.E.Effects of chPRL-siRNA on protein content of PRL Results suggest that protein level of PRL was suppressed in chPRL-siRNA transfected cells compared to control group. Results indicate that reduction of PRL mRNA level by siRNA leads to the decrease of the protein level Control +E2 β chPRL siRNA+E2β - E2 β +E2 β - E2 β chPRL β Actin PRL/B-actin 0.3 0.2 0.1 0.0 siRNA treated Control Figure 8. Effect of introduction of chPRL siRNA on the protein expression of PRL in chicken anterior pituitary cells. E2β (0.5 µM) stimulated PRL protein in the culture medium of control group. Protein expression of PRL is suppressed in chPRL siRNA transfected cells. Protein expression of PRL is significantly lower in chPRL siRNA treated group with and without E2β stimulation. Differences in protein bands for PRL abundance between control and siRNA transfected samples were assessed by densitometric analysis. The intensity (mean± SEM) of the PRL bands was compared to the intensity of corresponding β-actin bands. Intensities of western blot electrophoresis bands was analyzed by using Graph Pad Prism 5 to calculate the relative variation of the protein expression. Differences between control and treated cells are significant (P<0.01). 91 Gene Therapy and Molecular Biology Vol: 17, Page 92 Control +E2 β chPRL siRNA+E2β - E2 β +E2 β - E2β GH β Actin GH/B-actin 0.6 0.4 0.2 0.0 Control siRNA treated Figure 9. Effect of introduction of chPRL-siRNA on the protein expression of GH in chicken anterior pituitary cells. Treatment of control and siRNA transfected cells with E2β (0.5 µM) stimulated GH protein in the culture medium. Protein expression of GH is not altered by chPRL siRNA. Differences in protein bands for GH abundance between control and siRNA transfected samples were assessed by densitometric analysis. The intensity (mean± SEM) of the GH bands was compared to the intensity of corresponding β-actin bands. Intensities of western blot electrophoresis bands was analyzed by using Graph Pad Prism 5 to calculate the relative variation of the protein expression. Differences between control and treated cells are non-significant (P>0.05). 92 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen effects on other pituitary hormones related to hyperprolactinemia in hen anterior pituitary cells. The present study demonstrated that introduction of siRNA against PRL mRNA into anterior pituitary cells strongly supresses the expression of PRL mRNA and reduces the production of PRL. In this study, we selected three sequences for chPRL-siRNA using a siRNA design program and conducted suppression of PRL mRNA in primary cultured anterior pituitary cells of domestic chicken. Treatments with all three siRNAs produced significant suppression of PRL mRNA expression (Clevenger 2003; Reddy et al, 2014). In regard to inhibition of target gene expression through introduction of siRNA, the inhibitory effect on the expression of a target gene with RNAi is known to differ according to the sequence of the introduced siRNA (Clevenger 2003). One sequence may inhibit chPRL mRNA expression more efficiently than other sequences (Kobayashi shui-ichi et al, 2007). In this study, the lowest PRL mRNA level was observed in the siRNA-1 treated cells and hence siRNA-1 was used in the following experiments (Figure 1& 2). We used two different concentrations of siRNA 1 and studied its suppressive effects on PRL mRNA expression in anterior pituitary cells. Twenty four hours after the introduction of siRNA into anterior pituitary cells chPRL mRNA expression was reduced to 58% at 50nM and 65% at 60nM, suggesting that the suppressive effect of siRNA may be influenced by the siRNA concentration introduced into the target cells (Kobayashi sui-ichi et al, 2007). The effective siRNA concentration (50nM) in the present study was quite similar to the previous reports (Reddy et al, 2014). III.F. Growth of anterio pituitary cells in control and siRNA transfected cells Growth of in vitro cultured anterior pituitary cells in control and chPRL-siRNA treated groups were observed after 24 hours of transfection. The effect of chPRL-siRNA on cell growth was estimated by MTT assay. Prior transfection, anterior pituitary cells were seeded at a density of 1.5×105 cells per well into 12 well plates in both control and treated group. After transfection, growth of cultured cells was significantly (P<0.05) lower in the siRNA treated group (1.0 x105cells per ml) as compared to control group (2.0 x 105cells per ml). After MTT assay the viability of the cells in the control group was almost 100% as compared to 60% in siRNA treated group. In the controls, cells were incubated with the siPort NeoFX without siRNA to monitor cell death. (Figure 10 & 11). SiPort NeoFX without siRNA did not show any adverse effects on cell growth. V. Discussion The crucial challenge for achieving efficient RNAi in vivo is its delivery to the desired organ and into the target cells to ensure specificity and adequate dose and duration as well as its effect on other biologically and structurally related hormones/growth factors. To achieve this it is important to conduct a comprehensive analysis of its relationship with other biomolecules, hormones or cofactors because recent studies have shown that several hormones may act to alter the transcription of the PRL gene. As a first step to studying the latter, we conducted knockdown of PRL gene expression in hen anterior pituitary cells in vitro by RNAi. Therefore, the primary goal of this study was to determine the feasibility of using RNAi to modify PRL gene expression in anterior pituitary cells and its 93 Gene Therapy and Molecular Biology Vol: 17, Page 94 However, siRNA at 60nM resulted in a more powerful reduction of chPRL mRNA expression; hence we used 60nM of siRNA1 concentration in this study. Our results support the general notion that, in the gene silencing experiments, it is necessary to select effective sequence and concentration of siRNA to suppress the target gene in target cells (Kobayashi shu-ichi et al, 2007). One of the novel targets in broodiness and hyperprolactinemia therapies is to obtain a selective down regulation of those genes overexpressed in anterior pituitary tissues and PRL is certainly one of them. We assume that the above data have laid a foundation for further investigations to follow to control the PRL induced broodiness in domestic hen. In this study, chPRL siRNA affected cell growth in siRNA transfected cells compared to control cells. It is known that hyper secretion of chPRL from the anterior pituitary induces abnormal proliferation of PRL secretary cells by autocrine /paracrine way. In addition there is increasing evidence that PRL acts as a growth-promoter (Yu Cheng et al, 2000) that accesses most cell types as a pituitary hormone or a locally secreted factor and activates a mitogen signaling pathway with a concurrent gain in differentiation of pituitary cells (Das and Vonderhaar 1997). The secreted PRL show synergistic effect on lactotrophs to release PRL that participates in the hyper secretion of PRL from anterior pituitary cells and present evidence that the non-transfected cells are associated with significantly (P<0.01) higher concentration of PRL than the siRNA transfected cells (Figure 6).Thus, results of this study, support the above findings that, down regulation of chPRL expression resulting from introduction of siRNA affected the growth of pituitary cells in siRNA transfected cells compared to non- transfected cells (Figure 10 & 11) in the current cell culture conditions. To demonstrate the effects of low level of PRL on other pituitary hormones, we conducted knockdown of PRL gene expression in chicken anterior pituitary cells in in vitro by RNA interference and assessed its effects on GH, FSHβ, chPRLR ERα and E2β after siRNA transfection by quantitative real time PCR. Introduction of PRL siRNA into cultured anterior pituitary cells significantly (P<0.01) reduced the PRL mRNA expression. On the other hand, GH, FSHβ, ERα receptor, PRL receptor mRNA expressions and E2β concentration in the cultured medium (Figure 7) were not affected 24 hour after introduction of chPRL siRNA into cells, suggesting that the suppressive effect of siRNA is specific to PRL mRNA and PRL levels produced by anterior pituitary cells in the culture medium. The results suggests that, down regulation of chPRL mRNA induced no effects either on GH, FSHβ, chPRLR, ERα or on E2β, (Mei Pan et al, 2007). Generally, PRL receptor interacts with the PRL molecule as a receptor contains an extracellular region that binds PRL, a transmembrane region and a cytoplasmic region. When PRL binds to the receptor, it leads to dimerize with another PRL receptor which activates the Janus kinase 2 (Jak2) a tyrosine kinase that triggers the JAK- signal transducer and activator of transcription (STAT) pathway. Further stimulation of PRL receptor also leads in the stimulation of mitogen-activated protein kinases and Src kinase (Yu Cheng et al, 2000).So, when expression of PRL is down regulated, binding sites of PRLR is minimized, the Jak2/STAT pathway is blocked, which led to the inhibition of PRL expression (Harris et al, 2004; Clevenger and Kline 2001). 94 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen Control siRNA transfected cells Figure 10. Growth of chicken anterior pituitary cells in control and chPRL- siRNAtransfected cells (magnification; 100X). E2β treated anterior pituitary cells without chPRL siRNA siRNA transfected pituitary cells with E2β Figure 11. Growth of chicken anterior pituitary cells with E2β and chPRL- siRNAtransfected cells. 95 Gene Therapy and Molecular Biology Vol: 17, Page 96 The results suggest that, E2 β significantly (P <0.01) increased the PRL secretion in nontransfected cells in a dose dependent manner. On the other hand, E2β treatment of siRNA transfected cells did not increase the PRL levels at 0.1µM and 0.5 µM. However higher doses of E2β (nM) stimulated PRL secretion non-significantly (P>0.05). This may suggest that higher doses of E2β or a different treatment protocol may be required to suppress the expression of PRL secretion in siRNA transfected cells in in vitro conditions. However, it was suggested that estrogen regulates PRL gene expression within the anterior pituitary gland (Lieberman et al, 1981; Maurer 1982; Shull and Gorski 1984; Shull; Gorski 1989) by binding to its nuclear receptor and subsequently conferring DNA binding and transcriptional activation of the gene (Waterman et al, 1988). The transcription of the PRL gene results in increased synthesis of PRL and the increased PRL secretion may be a reflection of newly synthesized hormone from the estrogenstimulated pituitary cells as observed in the non-transfected cells (Figure 4). Furthermore, E2β-induced PRL release and gene expression are modulated by the intracellular signaling pathways activated by estrogen that result in stimulation of PRL transcription and release, through cAMP, Ca2+, IP3, phosphorylation in response to E2β and other second messengers. The reasons for the lack of responsiveness of PRL to E2β treatment in chPRL-siRNA transfected cells are uncertain. It may be associated with the above-mentioned or other mediation factors on the E2β-ERα-PRLPRLR pathway under the current cell culture conditions. Therefore, down regulation of PRL blocked the signal transduction pathways triggered by PRL- PRLR complex, which subsequently influenced either degradation of PRL mRNA sequences (Sushelas Chaidarun et al, 1998) or knockdown of PRL in pituitary cells and the promoter of target gene (Clevenger 2003).This is further supported by observing the normal levels GH, FSHβ, chPRLR ERα andE2β in both siRNA transfected and nontransfected pituitary cells (Figure 3). Therefore, the experiments not only once again validated the expression of GH, FSHβ, chPRLR, ERα andE2β in siRNA transfected cells failed to enhance or inhibit GH, FSHβ, chPRLR ERα (Figure3) and E2β (Figure 7), but also explained the reason why transfected cells were unable to alter the GH, FSHβ, chPRLR ERα andE2β after siRNA transfection (Figure 3). This suggests that, the suppressive effect of siRNA may be specific to PRL transcripts and the levels of GH, FSHβ, PRLR, ERα and E2β may be independent of PRL mRNA level (Ronchetti et al, 2013; Mei Pan et al, 2007). Further, our results support the predominant role that RNAi is assuming in the field of gene silencing owing to its specificity. We believe that the above data have laid a foundation for further therapeutic investigations to follow for controlling the secretion of PRL from PRL secretary cells of anterior pituitary gland in broody hen by RNAi. Recent studies have shown that several hormones may act to alter the transcription of the PRL gene. Estradiol is an important physiological regulator of PRL production by the pituitary (Maurer 1982). To further examine possible E2β effects on PRL mRNA expression and PRL secretion we investigated E2β effects in primary cultured anterior pituitary cells in both the siRNA transfected and non- transfected cells by treating the cells with different doses of E2β. 96 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen E2β stimulated condition (Maurer and Gorski 1977). On the other hand, an increase of PRL level was observed by adding E2β within control samples. The reason for this could be that, protein content of PRL was consistent with the level of PRL mRNA and suppression of PRL affected the protein levels of PRL. Protein content of GH was not significantly different between treated and non-treated cells (Figure9) suggesting that, suppressive effect of chPRL-siRNA may be specific to protein levels of PRL and protein level of GH may be independent of PRL. In summary, chPRL- siRNA reduces the chPRL gene expression, PRL concentration and growth of pituitary cells with specificity without affecting other associated hormones and this may provide the basis for a better understanding of the role of PRL in avian physiology and behavior. An understanding of the mechanisms and or studying its regulation and action at the physiological and the molecular level in galliforms which control broodiness/hyperprolactinemia may provide the basis for the development of new therapeutic methods for the prevention and/or for selection against this economically important trait. Another reason for lack of responsiveness of PRL to E2β treatment in the siRNA transfected cells may be due to changes in the synthesis or degradation of PRL transcription by effective chPRL siRNA in the transfected cells (Maurer 1982; Greene 1986). It is known that, ER-α is a nuclear receptor that is activated by the E2β (Walter et al, 1985). Estrogen treatment of chPRL- siRNA transfected cells stimulated ERα nonsignificantly (P>0.05) than the nontransfected cells. Recent studies have shown that, estrogen requires PRL which can stimulate the expression of ER-α (Frasor and Gibori 2003).These results are consistent with those of previous studies that reported that ER-α expression appears to be dependent on the PRL biosynthesis (Frasor and Gibori 2003) and therefore, low PRL in the siRNA transfected cells non-significantly (P>0.05) affected the ER-α expression in transfected cells in response to E2β treatment. The results reported here demonstrate that E2β stimulates both synthesis and secretion of PRL from individual lactotrophs and also that the ability of E2β to influence synthesis and its ability to influence PRL secretion are interdependent (Frasor and Gibori 2003). To investigate whether the reduction of PRL mRNA reflects PRL protein expression or activity, we measured the protein levels of PRL and PRL concentration produced by the siRNA transfected and non- transfected cells in the culture medium. The protein content of PRL and PRL concentration was significantly low (P<0 .01) in siRNA transfected cells than the control. These results may suggest that the reduction of PRL mRNA level by siRNA leads to the decrease of the protein level of PRL, and siRNA can exhibit a suppressive effect on the level of PRL (Figure8.) under Acknowledgements The authors are thankful to Director, NIANP, Bangalore, for providing necessary facilities to carry out the work. We are thankful to Dr. A.F. Parlow, Director, NIADDK, California (USA), providing the chicken prolactin hormone and antisera for the above study. 97 Gene Therapy and Molecular Biology Vol: 17, Page 98 Greene GL, Gilna P, Waterfield M, Baker A, Hort Y, Shine J(1986). Sequence and expression of human estrogen receptor complementary DNA. Science, 231 (4742): 1150–1154. Harris J, Prudence MS, Samantba RO, Christopher JO. (2004).Prolactin and the prolactin receptor: new targets of an old hormone. Annals and Medicine, 36:414-25. Hiyama Gen, Kanasaku N, Reddy IJ, Scotonical S, Guemene D, Zadworney D (2008). Knockdown of PRL gene expression in the anterior pituitary gland during late embryogenesis in turkey. 9th International Society for Avian Endocrinology, July 10-15, Leuven, Belgium. Kaprowski JA, Tucker HA (1971). Radio immunoassay of prolactin. J of Dairy Sci, 54:1675–1680. Kobayashi Shu-ichi, Miki Sakatani, Shuji Kobayashi, Kyoshi Okuda, Masshi Takahashi, (2007).Gene silencing of cyclooxygenase2mRNA by RNA interference in bovine cumulus granulosa cells. J of Reprod and Develop, 6(53):1305-1311. Lieberman ME, Maurer RA, Claude P, Wiklund J, Wertz N, Gorski J (1981).Regulation of pituitary growth and prolactin expression by estrogen. Advances in Experimental Medicine and Biology, 138:151-163. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A et al (2005). MicroRNA expression profiles classify human cancers. Nature, 435: 834-838. Maurer RA, Gorski J (1977). Effects of estradiol-173 and pimozide on prolactin synthesis in male and female rats. Endocrinol, 101: 76-84. Maurer RA (1982). Estrodiol regulates the transcription of the prolactin gene. J of Biolo Chem, 257:2133-2136. Mei Pan, Qinjun Wei, Fang Cao, Yajie Lu, Yibao Zhu, Yongqian Shu, Xin Cao (2007).Inhibition of cell proliferation by siRNA targeting hPRLR in breast cancer MCF-7 cell line. J. of Nanjing Medical University, 21(6):372-376 Nicoll CS, Mayer GL, Russell SM (1986). Structural features of prolactins and growth hormones that can be related to their biological properties. Endocrine Reviews, 7:169–203. Oomizu S, Takeuchi S, Takahashi S (1998). Stimulatory effect of insulin-like growth factor I on proliferation of mouse pituitary cells in serum-free culture. J. of Endocrinology, 157:53–62. References Bedecarrats GY,Guemene D, Morvan C, Kuhnlein U, Zadworny D (1999). Quantification of prolactin messenger ribonucleic acid, pituitary content and plasma levels of prolactin and detection of immunoreactive isoforms of prolactin in pituitaries from turkey embryos during ontogeny. Biol Reprod, 61:757-763. Bole-Feysot CV, Goffin M, Edery N. Binart Kelly PA (1998). Prolactin (PRL) and its receptor: Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews, 19:225–268. Caplen NJ, Parrish S, Imani, F, Fire A, Morgan RA (2001). Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proceedings of National Academy of Sciences, U.S.A., 98:9742–9747. Cheng Y, Zhizhin I, Perlman RL and Mangoura D (2000). Prolactin-induced cell proliferation in PC12 cells depends on JNK but not ERK activation. J Biol Chem, 275(30):23326-32. ChunTY, Gregg D, Sarkar DK., Gorski J(1998).Differential regulation by estrogens of growth and prolactin synthesis in pituitary cells suggests that only a small pool of estrogen receptors is required for growth. Proceedings of National Academy of Sciences, U.S.A., 3, 95(5),2325-30. Clevenger CV (2003). Role of prolactin /prolactin receptor signalling in human breast cancer. Breast Disease, 18:75-86. Clevenger CV, Kline JB (2001). Prolactin receptor signal transduction. Lupus, 706-18. Clevenger CV, Kline JB (2001). Prolactin receptor signal transduction. Lupus, 706-18. Copeland KC, Johnson DM, Kuehl TJ, Castracane VD (1984). Estrogen stimulates growth hormone and somatomedin-C in castrate and intact female baboons. J of Clinic Endocrinol and Metab, 58:(4):698-703. Das R and Vonderhaar BK (1997). Prolactin as a mitogen in mammary cells.Journal of Mammary Gland Biology and Neoplasia, 2(1):29-39. Denef C (2003). Paracrine control of lactotrope proliferation and differentiation. Trends in Endocrinol and Metabolism, 14:188–195. Frasor J, Gibori G (2003). Prolactin regulation of estrogen receptor expression. Trends in Endocrinology and Metabolism, 14 (3):11823. 98 Reddy et al: RNAi-PRL-GH-FSHβ-ERα-hen Reddy IJ, David CG, Sarma PV, Khub Singh (2002). Possible role of PRL on laying performance and steroid hormones in domestic hen (Gallus domesticus). Gen. Comp. Endocrinol, 1:249255. Reddy IJ, Ashish Mishra, Mondal S (2014).Effects of chicken prolactin siRNA on pituitary insulin like growth factor-1 and prolactin receptor in in vitro cultured hen anterior pituicytes. Gene Ther and Mol Biol, 16:237-250. Ronchetti SA, Miler EA, Duvilanski BH, Cabilla, JP (2013). Cadmium Mimics Estrogen-Driven Cell Proliferation and Prolactin Secretion from Anterior Pituitary Cells. PLoS ONE 8(11), e81101. (doi:10.1371/journal.pone.0081101). Schwardz J (2000). Intracellular communication in the anterior pituitary. Endocrine Reviews, 21 488–513. Sharp PJ (1996).Immunization of poultry against broodiness. Proceedings of worlds Poultry Congress, 2-5 September 1996, New Delhi, India. Volume II. PP.1-5. Shull JD, Gorski J (1989).Estrogen regulation of prolactin transcription in vivo: paradoxical effect of 17beta estradiol dose. Endocrinol, 124:279-285. Shull JD, Gorski (1984).Estrogen stimulates prolactin gene transcription by a mechanism independent of pituitary protein synthesis. Endocrinol, 114:1550-1557. Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld MG, Swanson LW (1990). Pituitary cell phenotypes involve cellspecific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes and Develop 4:695–711. Sushela.SChaidarun, Brooke Swearingen, Joseph Alexander (1998). Differential Expression of Estrogen Receptor-b (ERb) in Human Pituitary Tumors: Functional Interactions with ERα and a Tumor-Specific Splice Variant. J of Clinic Endocrinol and Metab, 83:3308–3315, Tamiki Hikake, Shinji Hayashi, Taisen Iguchi, Tomomi Sato. (2009). The role of IGF1 on the differentiation of prolactin secreting cells in the mouse anterior pituitary. J. of Endocrinol, 203:231–240 99
© Copyright 2026 Paperzz