Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/226053724
Chlorophyllasynthesisbyananimalusing
transferredalgalnucleargenes.Symbiosis
ArticleinSymbiosis·December2010
ImpactFactor:1.44·DOI:10.1007/s13199-009-0044-8
CITATIONS
READS
26
167
3authors,including:
NicholasECurtis
JulieSchwartz
AveMariaUniversity
11PUBLICATIONS215CITATIONS
24PUBLICATIONS369CITATIONS
SEEPROFILE
SEEPROFILE
Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,
lettingyouaccessandreadthemimmediately.
Availablefrom:NicholasECurtis
Retrievedon:24May2016
SYMBIOSIS (2009) 49, 121–131
DOI 10.1007/s13199-009-0044-8
©Springer Science+Business Media B.V. 2009
ISSN 0334-5114
Chlorophyll a synthesis by an animal using transferred algal nuclear
genes
Sidney K. Pierce*, Nicholas E. Curtis, and Julie A. Schwartz
Department of Integrative Biology, SCA 110, University of South Florida, 4202 E. Fowler Ave., Tampa, FL 33620, USA,
Email. [email protected]
(Received September 22, 2009; Accepted October 13, 2009)
Abstract
Chlorophyll synthesis is an ongoing requirement for photosynthesis and a ubiquitous, diagnostic characteristic of plants and
algae amongst eukaryotes. However, we have discovered that chlorophyll a (Chla) is synthesized in the symbiotic
chloroplasts of the sea slug, Elysia chlorotica, for at least 6 months after the slugs have been deprived of the algal source of
the plastids, Vaucheria litorea. In addition, using transcriptome analysis and PCR with genomic DNA, we found 4
expressed genes for nuclear-encoded enzymes of the Chla synthesis pathway that have been horizontally transferred from
the alga to the genomic DNA of the sea slug. These findings demonstrate the first discovery of Chla production in an
animal using transferred nuclear genes from its algal food.
Keywords:
Horizontal gene transfer, chlorophyll synthesis, chloroplast symbiosis, kleptoplasty, Elysia chlorotica,
Vaucheria litorea
1. Introduction
In plants and algae, the chlorophyll a (Chla) synthesis
pathway, starting with 5-aminolevulinic acid (ALA), is
contained within the chloroplast, and regulated by intricate
interactions among the production of plastid- and nuclearencoded, cytoplasmically-processed enzymes used in the
reactions of the synthesis, the presence or absence of light,
as well as cofactor and substrate level kinetics. While
chlorophyll synthesis does not occur in animals, the
synthesis of the identical porphyrin moieties of chlorophyll
and cytochrome/hemoglobin proceeds from ALA to the
level of protoporphyrin IX along an identical synthesis
pathway in both plants and animals, albeit in different
intracellular compartments using enzymes of identical
name, but distinctive sequence. At that point, the pathway
directions diverge to either the chlorophylls or
cytochrome/hemoglobin (see the review by Tanaka and
Tanaka, 2007). Thus, while the porphyrin synthesis
enzymes in the initial portion of the pathway to Chla are
present in the mitochondria or cytoplasm of animal cells, a
plant/algae-specific set of several, nuclear-encoded
enzymes is required to complete the synthesis inside the
*The author to whom correspondence should be sent.
chloroplast. In spite of this plant/animal dichotomy, we
have discovered the long term ability to synthesize Chla in
an animal.
A few years ago, we reported the first discovery of the
transfer of functional, nuclear genes between multicellular
species (Pierce et al., 2007). The sacoglossan sea slug,
Elysia chlorotica, eats the chromophytic alga, Vaucheria
litorea. Certain cells that line the slug’s digestive
diverticula are able to phagocytize undigested chloroplasts
which are maintained intracellularly, and continue to be
photosynthetically active for as long as the 10–11 month
life cycle of the slug (West et al., 1984). Although there is
no evidence of chloroplast division in the slug cytoplasm,
synthesis of several chloroplast proteins occurs during the
endosymbiotic association, including proteins that are
encoded by algal nuclear genes (Pierce et al., 1996; Hanten
and Pierce, 2001). Our original discovery found expressed
genes for three of the algal light-harvesting complex
proteins, LHCV-1, LHCV-2 and FCP, in genomic DNA of
the slug (Pierce et al., 2007). In addition, we located the
same genes in the genomic DNA of unhatched veliger
larvae, which lack symbiotic chloroplasts and do not feed
on V. litorea, confirming that the transferred algal genes
were vertically transmitted in the slugs. Transferred gene
sequences were also present in slug cDNA, indicating their
transcription (Pierce et al., 2007).
122
S.K. PIERCE ET AL.
Furthermore, transfer of another algal nuclear gene
between these species has recently been confirmed by
others (Rumpho et al., 2008). All of the above results were
produced using PCR-based experiments which were greatly
impeded by the lack of slug and alga reference sequences in
the public databases for both primer design and product
identification, as well as low sequence conservation of
many of the genes of interest and contamination from the
copious amounts of mucus produced by the highly
mucogenic slugs.
In order to facilitate the hunt for additional transferred
genes, we have recently turned our efforts to the production
and analysis of a transcriptome [expressed sequence tags
(EST)] library database from V. litorea (Schwartz et al.,
submitted). Since EST’s are RNA-based, they are only a
representation of the genes being expressed at the moment
the RNA is extracted. However, they provide the exact
coding sequence of genes of interest, which greatly
facilitates not only identification, but also primer design
and comparison with sequences in the slug. Using EST
analysis, subsequently confirmed by PCR, we have already
located several additional transferred genes in the slug
genomic DNA (lhcv-3, lhcv-4, prk) (Schwartz et al.,
submitted), as well as four genes in the Chla synthesis
pathway.
2. Materials and Methods
Animals
Specimens of Elysia chlorotica were collected in a salt
marsh on Martha’s Vineyard, MA. They were shipped to
Tampa, FL where they were kept in aquaria, without access
to algae, containing sterilized, aerated, artificial sea water
(Instant Ocean, 1,000 mosm/kg H2O) at 10oC under a 14/10
hr light/dark cycle using fluorescent tubes (cool white).
The slugs were starved for at least 2 months before use in
the experiments.
on the sides of the aquarium. When found, they were gently
removed and placed immediately into small culture dishes
containing sterile artificial sea water containing rifampicin,
where the embryos were maintained until they had
developed into veliger larvae (West et al., 1984), but had
not hatched. At the point DNA was extracted (see below),
the veliger larvae, which do not contain symbiotic plastids,
had not fed and were still inside their egg capsules.
Genomic DNA purification
Genomic DNA was purified from pre-hatched
E. chlorotica veliger larvae and V. litorea using the
Nucleon® genomic DNA extraction kit, PhytoPure® (Tepnel
Life Sciences, Manchester, UK) following manufacturer’s
instructions.
RNA isolation and mRNA purification
E. chlorotica: Total RNA was isolated from >2 month
starved slugs as follows. Slugs were homogenized in
Trizol® Reagent (Invitrogen, Carlsbad, CA) and the
homogenate was centrifuged at 12,000 × g at 4oC to pellet
cellular debris. The supernatant was extracted with 1:6 (v/v)
chloroform and centrifuged at 12,000 × g at 4o C. RNA was
precipitated from the aqueous phase by adding 1:4 (v/v)
isopropanol followed by 1:4 (v/v) 0.8M Na citrate/1.2 M
NaCl solution and spun at 12,000 × g at 4oC. The RNA
pellet was washed twice with 75% ethanol, air dried,
resuspended in diethylpyrocarbonate (DEPC)-treated water
and quantified spectrophotometrically (260 nm). mRNA
was purified from total RNA using the Dynabeads® Oligo
(dt)25 mRNA Purification Kit (Invitrogen) following
manufacturer’s instructions and quantified spectrophotometrically (260 nm).
V. litorea: Total RNA was isolated from the alga using
the Nucleon® genomic DNA extraction kit, PhytoPure®
following the manufacturer’s instructions, taking advantage
of the co-purification of RNA in that methodology. mRNA
was purified as described above.
Algae
cDNA preparation
The Vaucheria litorea used in the experiments came
from a culture maintained in modified f/2 medium as
described previously (Pierce et al., 1996). The original
inoculum for this culture came from the same salt marsh
that provided the slugs. At the time of the experiments the
slugs and algae had not been in contact with each other for
months and had undergone several biweekly changes of
sterile media.
Veliger larvae
The aquaria containing the adult slugs were monitored
daily for egg masses. Generally, the masses were deposited
E. chlorotica and V. litorea 1st and 2nd strand cDNAs
were synthesized from purified mRNA using the Mint
cDNA Synthesis Kit (Evrogen, Moscow, Russia) according
to manufacturer’s instructions.
PCR and sequencing
Specific primers (Eurofins MWG/Operon, Huntsville,
AL) were designed from our EST sequences. Touchdown
PCR reactions were done using 100 ng of genomic DNA or
cDNA, 12.5 pmol of each primer, 0.25 mM dNTP mix (ID
Labs, London, Ontario, Canada) and 1.25 units of
CHLOROPHYLL SYNTHESIS BY AN ANIMAL
IDProof™ DNA polymerase (ID Labs). Initial denaturation
was done at 95oC for 2 min, followed by 20 cycles of
denaturing at 95oC (30 s) and annealing (30 s) where the
annealing temperature was reduced 1oC every other cycle,
then a 72oC extension period. This was followed by an
additional 20 cycles of denaturing at 95oC for 30 s, then 30
s at the lowest annealing temperature obtained in the
touchdown and 72oC extension. Generally, the annealing
temperatures started 5oC below the melting temperature of
the primers. PCR products were separated on 1% agarose
gels containing 0.2 µg/ml ethidium bromide and visualized
by UV illumination. DNA bands were excised from agarose
gels, purified using the QIAquick® Gel Extraction Kit
(Qiagen, Valencia, CA) and cloned using the TOPO® TA
Cloning® Kit (Invitrogen) following manufacturer’s
instructions. Clones were PCR amplified using M13
forward and reverse primers, purified and sequenced
(Eurofins MWG/Operon) in forward and reverse directions.
Sequences were analyzed using the tblastx algorithm
searching the GenBank nr database and then aligned using
the ClustalW2 sequence alignment program. Identified gene
sequences used in this paper were uploaded to GenBank
and the acquisition numbers are indicated below.
A critical concern in these experiments is to be sure that
algal DNA is not somehow contaminating the slug extracts.
Therefore, we always perform several controls in our
experiments. All the PCR reagents were tested in the
absence of template with negative results. Furthermore, we
tested the extracted slug DNA for the presence of nonchloroplast targeted, V. litorea nuclear genes, either internal
transcribed spacer region (ITS) (see Pierce et al., 2007) or
spermidine synthase (SPDS), which was chosen from the
V. litorea EST sequence data. Primers for both these genes
always produced products with both V. litorea DNA and
cDNA extracts using our PCR protocols, but NEVER with
slug genomic DNA, cDNA or larval DNA. By now, we
have performed our procedures on dozens of extracts from
several batches of slugs at several times of year, in different
lab rooms, in different buildings. In addition to these lab
hygiene controls, the starved slugs had stopped producing
digestive wastes for weeks before use in the experiments, so
gut contents were not included in the experiments. Lastly,
as mentioned above, the veliger larvae had not hatched
from the egg masses, so they had not fed, do not have
symbiotic chloroplasts and have never touched sea water.
Chlorophyll a production
At the end of a 8 hr dark period, slugs or algal filaments
were exposed to 15 µCi or 7.5 µCi (respectively) 14C-ALA
(14C-4, 55 µCi/mmol, American Radiolabeled Chemical, St.
Louis, MO) in their respective media for 2 hr in the dark in
a constant temperature (25oC) agitator. At the end of the
two hours, the slugs or filaments were placed under intense
illumination (2–75 watt Halogen flood lamps) for 18 hrs,
123
still in the 14C-ALA containing media as above. Following
the incubation, the slugs or filaments were removed from
their media, washed in medium without isotope and Chla
was extracted immediately. To test the effect of light on
Chla synthesis, the experiment was done the same way
except that the 18 hr incubation under lights was replaced
with 18 hrs in the dark.
Chlorophyll a extraction
Chla was extracted by homogenizing the slugs and algal
filaments in cold, HPLC grade acetone (Pinckney et al.,
1996). Samples were kept cold and exposure to light
minimized throughout the extraction procedure. Samples
were kept at -20oC in the dark until chromatography.
Chlorophyll a purification and scintillation counting
In order to determine the amount of 14C incorporation
into Chla during the incubation period, Chla was purified
using HPLC and radioactivity determined. Chromatography (System Gold, Beckman Coulter, Fullerton, CA)
was done using two C18 columns (Microsorb 100-3, 100 ×
4.6 mm, 3 mm, Varian, Lakeforest, CA and Vydac 201TP,
150 × 4.6 mm, 5 mm, Vydac, Hespira, CA) connected in
series using a mobile phase starting with 80% MeOH: 20%
NH4CH3COOH (0.5 M, pH 7.2) changing to 80%
MeOH/20% acetone, according to the protocol described
elsewhere (Pinckney et al., 1998). The second column was
heated to 40oC. NH4CH3COOH was added to the samples
as an ion pair and injections were kept to 50 µl in order to
not overload the analytical-sized columns. All chemicals
were HPLC grade. Detection was done at 438 nm. This
protocol is designed to separate not only a wide array of
photopigments, but also several Chla precursors and
derivatives (Pinckney et al., 1998). The eluant was directed
to a fraction collector set to collect at various intervals
following the sample injection. In order to obtain a
sufficient amount of material, several chromatographic runs
of each extract were necessary. The corresponding fractions
from each run were pooled, dried under a stream of N2, the
residue dissolved in acetone, added to scintillation cocktail
(Scintisafe 30%, Fisher Scientific, Fair Lawn, NJ) and the
radioactivity determined with a scintillation counter
(LS6000IC, Beckman Coulter, Fullerton, CA). Chla causes
a large quenching effect (Nayar et al., 2003), so counting
efficiency was determined by spiking samples with a
known amount of cpm and correcting the results to dpm
using the measured counting efficiency for each sample.
Confirmation of radioactivity in Chla
As well as TLC, we used the well-documented
(Llewellyn et al., 1990; Nayar et al., 2003) acid conversion
of radiolabelled Chla to phaeophytin followed by HPLC
124
S.K. PIERCE ET AL.
separation and fraction collecting to demonstrate the
molecular location of 14C. In separate experiments, slugs or
algal filaments were labeled with 14C-ALA as described
above. After the incubation period, Chla was extracted from
the slugs or algae, the extract run in 50 µl aliquots through
the HPLC protocol already described and the Chla peaks
collected from the eluant and pooled, all as described
above. Although the amount of Chla and the associated
radioactivity in the extracts were reasonably robust, our
analytical HPLC with its analytical-sized columns and 50
µl sample loop required the collection of several dozen
Chla peaks. The pooled peaks were dried under nitrogen
and dissolved in a small amount of acetone. HCl (3.6 M)
was added and incubated for 5 min at room temperature,
which removes the Mg2+ from Chla, thereby converting it to
phaeophytin (Llewellyn et al., 1990; Nayar et al., 2003).
The acid was then neutralized with 3.6 M NH4OH, the
sample was spiked with non-radioactive Chla and
rechromatographed on the HPLC. As before, several dozen
50 µl injections were done, the eluant in the region of the
chromatogram where the Chla spike and the phaeophytin
peak eluted were collected, pooled and the radioactivity in
the pooled peaks determined by scintillation counting,
corrected for background, quench and converted to dpm.
3. Results
The genes in the Chla synthesis pathway of V. litorea,
which we have identified in slug cDNA, and/or pre-hatched
veliger larva genomic DNA (see Table 3, for example), are
uroD (uroporphyrinogen decarboxylase), ChlD (ChlD
subunit of magnesium chelatase), ChlH (ChlH subunit of
magnesium chelatase) and ChlG (chlorophyll synthase)
(Tables 1–4). UroD is a porphyrin synthesis enzyme
common to both plants and animals, catalyzing the same
reaction, albeit with different sequences and different
reaction sites (chloroplast vs. cytoplasm, respectively)
(Reith, 1995; Obornik and Green, 2005; Tanaka and
Tanaka, 2007; Eberhard et al., 2008). We have found an
uroD sequence in slug cDNA that matches a consensus
uroD sequence in the V. litorea EST almost exactly (9
bases different in a 1026 base transcript) (Table 1). The
other 3 enzymes (Chl-D, -H and -G) are in the unique
pathway that leads to Chla synthesis from protoporphyrin
IX, including the terminal reaction catalyzed by chlorophyll
synthase. The sequences of these 3 genes in the slug cDNA
match the sequence from the alga almost exactly (Tables
2–4).
Together, the expression of the genes for the Chla
synthesis enzymes in the slug DNA, as well as the manymonths long unabated photosynthesis by the endosymbiotic
chloroplasts, a process that requires regular Chla synthesis
in plants, suggest that Chla synthesis is occurring in the
slug cell. We tested this possibility by incubating slugs
under lights in sea water containing 14C-labeled ALA and
comparing the pattern of radiolabel distribution to that of
similarly treated V. litorea filaments, using HPLC and
fraction collection. In the algal filaments, 14C co-migrated
with several peaks on the HPLC chromatogram, some
colored and some not, including Chla (Fig. 1).
Qualitatively, the chromatogram and distribution of
radioactivity in the V. litorea extracts is very typical of
those from measurements of Chla synthesis in organisms as
phylogenetically diverse as phytoplankton (Riper et al.,
1979) and barley (Wamsley and Adamson, 1994), for but
two examples of many. Although we were unable to load
comparable amounts of 14C-ALA into the slugs,
undoubtedly due to external mucus, the HPLC chromatogram and distribution of radioactivity in the corresponding
fractions collected from the slug extracts were very similar
to the results from the alga (Fig. 2). Due to the several
hours-long incubation period in 14C-ALA, radioactivity
appears in a variety of peaks along the chromatogram, some
of which are probably Chla precursors and Chla derivatives
(Pinckney et al., 1996) as well as a robust number of counts
in the Chla peak fraction. The almost complete lack of
radioactivity in the Chla peak when the experiment was
done in the dark (Fig. 3), the conversion of both the Chla
peak and its radioactivity to phaeophytin following acid
treatment of the HPLC purified Chla (Fig. 4) and the comigration of radioactivity with the Chla band following thin
layer chromatography (TLC) of the HPLC fraction (data not
shown) all confirm that the radiolabel was a component of
Chla rather than a co-elutant. We did not have authentic
standard compounds to attempt to identify the other
radioactive peaks on the chromatogram, but as with the
alga, the elution times of some, compared with other studies
(see above), suggests that they might be Chla precursors
and derivatives, as well as chlorophyll c.
4. Discussion
Altogether, the results clearly demonstrate that
E. chlorotica expresses several V. litorea nuclear genes that
code for enzymes in the Chla synthesis pathway. In
addition, Chla synthesis occurs in the slug cells and
continues for months after the animal has been separated
from its food alga. This not only expands on our earlier
discovery of horizontally transferred genes between
multicellular species (Pierce et al., 2007) but also is the first
demonstration of the transfer of an entire biosynthetic
pathway between eukaryotic species. We did not yet find
genes for all the Chla synthesis pathway enzymes in our
ongoing analysis of the 4 million bases in the V. litorea
transcriptome library. Indeed, there is some possibility that
those genes may not be in the transcriptome or may not
have been transferred to E. chlorotica, indicating that
continued long-term Chla synthesis in the slug results
CHLOROPHYLL SYNTHESIS BY AN ANIMAL
125
Table 1. Comparison of consensus nucleotide sequences of uroD (uroporphyrinogen decarboxylase) located in the transcriptome data and
cDNA of V. litorea (GU068606) with that found by PCR in E. chlorotica cDNA (GU068607). The two sequences are extremely similar in
composition over the 1026 bases differing by 9 bases (bold). The slug sequences come from at least 3 separate mRNA extractions done on
at least 3 different groups of slugs at different times of the year.
V. litorea cDNA
E. chlorotica cDNA
AAAGATCCATTGTTGTTAAGGGCAGCAAGAGGAGAGGCTGTGGAAAGGGTTCCTGTTTGG
AAAGATCCATTGTTGTTAAGGGCAGCAAGAGGAGAGGCTGTGGAAAGGGTTCCTGTTTGG ....
V. litorea cDNA
E. chlorotica cDNA
ATGATGAGACAGGCAGGCAGACACATGCAAGAATACAGAGACCTTGTCAAAAAGTACCCC
ATGATGAGACAGGCAGGCAGACACATGCAAGAATACAGAGACCTC ATCAAAAAGTACCCC .... 120
V. litorea cDNA
E. chlorotica cDNA
ACATTCAGAGAGAGATCGGAGATCCACGAAGTGTCCACTGAAATTTCACTTCAGCCTTAC
ACATTCAGAGAGAGATCGGAGATCCACGAAGTGTCCACTGAAATTTCACTTCAGCCTTAC .... 180
V. litorea cDNA
E. chlorotica cDNA
AGGCGATATGGAACCGATGGAGTGATCTTATTTTCTGATATTCTGACTCCACTGCCTGGA
AGGCGATACGGAACCGATGGAGTGATCTTATTTTCTGATATTCTGACTCCACTGCCTGGA .... 240
V. litorea cDNA
E. chlorotica cDNA
ATGGGTGTCGATTTCAAAATTGAAGAGAAAACCGGGCCCAAATTGGTCCCAATGAGAACA
ATGGGTGTCGATTTCAAAATTGAAGAGAAAACCGGGCCCAAATTGGTCCCAATGAGAACG .... 300
V. litorea cDNA
E. chlorotica cDNA
TGGGAAAGTGTCAATGCAATGCACACAATTGATTCTGAAAAGGCATGTCCTTTTGTGGGG
TGGGAAAGTGTCAATGCAATGCACACAATTGATTCTGAAAAGGCATGTCCTTTTGTGGGG .... 360
V. litorea cDNA
E. chlorotica cDNA
CAAACTCTGAGAGATTTGAAAAAAGAGGTCGGATCAAATGCAACAGTCCTGGGTTTTGTG
CAAACTCTGAGAGATTTGAAAAAAGAGGTCGGATCAAATGCAACAGTCCTGGGTTTTGTG .... 420
V. litorea cDNA
E. chlorotica cDNA
GGATGTCCGTACACACTTGCCACTTACATGGTTGAAGGAGGTTCAAGCAGAGAATATTTG
GGATGTCCGTACACACTTGCCACTTACATGGTCGAAGGAGGTTCAAGCAGAGAATATTTG .... 480
V. litorea cDNA
E. chlorotica cDNA
GAAATTAAAAAGATGATGTTCACTGAGCCTGAGTTGTTGCATGCCATGCTGGCCAAAATT
GAAATTAAAAAGATGATGTTCACTGAGCCTGAGTTGTTGCATGCCATGCTGGCCAAAATT .... 540
V. litorea cDNA
E. chlorotica cDNA
GCTGATTCAATAGGGGATTATGGGATTTATCAAATCGAAAGTGGTGCACAGGTGATTCAA
GCTGATTCAATAGGGGATTATGGGATTTATCAAATCGAAAGTGGTGCACAGGTGATTCAA .... 600
V. litorea cDNA
E. chlorotica cDNA
GTCTTTGACTCTTGGGCAGGCCATCTCTCCCCCAAAGACTATGATGTTTTTGCGGCACCT
GTCTTTGACTCTTGGGCAGGCCATCTTTCCCCCAAAGACTATGATGTTTTTGCAGCACCT .... 660
V. litorea cDNA
E. chlorotica cDNA
TACCAAAAGAAGGTTATCCAAAAAATCAAATCTTCTCATCCTGAAGTCCCCATCATCATT
TACCAAAAGAAGGTTATCCAAAAAATCAAATCTTCTCATCCTGAAGTCCCCATCATCATT .... 720
V. litorea cDNA
E. chlorotica cDNA
TACATAAACAAGAGTGGTGCACTTTTGGAAAGGATGAGTCAAAGTGGGGCAGATATCATC
TACATAAACAAGAGTGGTGCACTTTTGGAAAGGATGAGTCAAAGTGGGGCAGATATCATC .... 780
V. litorea cDNA
E. chlorotica cDNA
AGCTTGGATTGGACAGTGACGATTGAAGAGGCTAGGAAAAGAATCGGCAACGATATTGGC
AGCTTGGATTGGACAGTGACGATTGAAGAGGCTAGGAAAAGAATA GGCAACGATATTGGC .... 840
V. litorea cDNA
E. chlorotica cDNA
ATCCAGGGTAACCTTGATCCAGCCGCCTTGTTTGCACCAAATGAAGTTATCAAGGAAAGG
ATCCAGGGTAACCTTGATCCAGCT GCCTTGTTTGCACCAAATGAAGTTATCAAGGAAAGG .... 900
V. litorea cDNA
E. chlorotica cDNA
ACTGAAGAAATTTTGAGGGCATGCGGAGGGAGAAACCATGTCATGAATTTGGGCCATGGA
ACTGAAGAAATTTTGAGGGCATGCGGAGGGAGAAACCATGTCATGAATTTGGGCCATGGA .... 960
V. litorea cDNA
E. chlorotica cDNA
ATCGAAGCGACGACTTCAGAAGAAAAGGCTGAATTTTTCATCAATACCGTAAAAAACTTC
ATCGAAGCGACGACTTCAGAAGAAAAGGCTGAATTTTTCATCAATACCGTAAAAAACTTC .... 1020
V. litorea cDNA
E. chlorotica cDNA
AGGTTC
AGGTTC
60
........................................................ 1026
from some sort of long-term storage of massive amounts of
enzyme in the symbiotic chloroplast. However, the
presence and expression of Chl-D and –H in the slug, genes
for the subunits of the initial enzyme in the Chla specific
pathway, as well as the terminal enzyme, Chl-G, indicate a
good possibility that the genes for the intermediate steps
have been transferred as well.
126
S.K. PIERCE ET AL.
Table 2. Comparison of consensus sequences of Mg2+ chelatase subunit D (ChlD) located by PCR in V. litorea (GU068608) and
E. chlorotica (GU068609) cDNAs using primer sequences based on the V. litorea transcriptome data. These gene fragments match exactly
over the 975 bases. The E. chlorotica data come from 3 separate mRNA extractions done on at least 3 different groups of slugs at different
times of the year.
V. litorea cDNA
E. chlorotica cDNA
AAAGAAATGAGCCTGAGCCGGAAAATCAGCCCGAAGATGACGAAGCCCCATCTGTACCCC
AAAGAAATGAGCCTGAGCCGGAAAATCAGCCCGAAGATGACGAAGCCCCATCTGTACCCC ....
V. litorea cDNA
E. chlorotica cDNA
AAGAATTCATGTTTGGCATCGATTCAACGGTCATCGACCCTGAACTGTTGGATTTCGGAC
AAGAATTCATGTTTGGCATCGATTCAACGGTCATCGACCCTGAACTGTTGGATTTCGGAC .... 120
V. litorea cDNA
E. chlorotica cDNA
GGAAGAACAATGCCGGCAGGTCTGGGAAGAGGGGAATGATCTTTAACATGGAAAGAGGGC
GGAAGAACAATGCCGGCAGGTCTGGGAAGAGGGGAATGATCTTTAACATGGAAAGAGGGC .... 180
V. litorea cDNA
E. chlorotica cDNA
GGAAGAACAATGCCGGCAGGTCTGGGAAGAGGGGAATGATCTTTAACATGGAAAGAGGGC
GATATATCAAGCCGATGCTTCCGAAAGGAAAAAAAGGGAAATTGGCGTTGGATGCGACGC .... 240
V. litorea cDNA
E. chlorotica cDNA
TGAGATCAGCGGCGCCGTATCAATTGTCGAGAAGATCGCGCGCTCTCTCAAAGAACGACG
TGAGATCAGCGGCGCCGTATCAATTGTCGAGAAGATCGCGCGCTCTCTCAAAGAACGACG .... 300
V. litorea cDNA
E. chlorotica cDNA
GGAATCCGACCAAAAGAACAGTCTTTGTCGAAAAGTCTGATCTGAGGGTCAAAAAGCTCG
GGAATCCGACCAAAAGAACAGTCTTTGTCGAAAAGTCTGATCTGAGGGTCAAAAAGCTCG .... 360
V. litorea cDNA
E. chlorotica cDNA
CGCGGAAAGCCGGCTCACTTATCATTTTCTGCGTTGACGCGAGCGGGAGCATGGCGCTGA
CGCGGAAAGCCGGCTCACTTATCATTTTCTGCGTTGACGCGAGCGGGAGCATGGCGCTGA .... 420
V. litorea cDNA
E. chlorotica cDNA
ACCGAATGAACGCCGCGAAAGGCGCAGCAATGTCATTGCTGGGCGAAGCCTACAAAAGCA
ACCGAATGAACGCCGCGAAAGGCGCAGCAATGTCATTGCTGGGCGAAGCCTACAAAAGCA .... 480
V. litorea cDNA
E. chlorotica cDNA
GGGACAAAGTGTGCCTCATACCTTTCCAGGGGGAAAGGGCTGAAGTCCTCCTCCCACCTT
GGGACAAAGTGTGCCTCATACCTTTCCAGGGGGAAAGGGCTGAAGTCCTCCTCCCACCTT .... 540
V. litorea cDNA
E. chlorotica cDNA
CAAGTTCAATAGCAATGGCAAAAAGCCGTTTGGAGACGATGCCGTGTGGAGGTGGGTCAC
CAAGTTCAATAGCAATGGCAAAAAGCCGTTTGGAGACGATGCCGTGTGGAGGTGGGTCAC .... 600
V. litorea cDNA
E. chlorotica cDNA
CGCTCGCTCATGCAATCAACGTCGCTGTACGGACAGGGATTAACGCCATCAAATCACAGG
CGCTCGCTCATGCAATCAACGTCGCTGTACGGACAGGGATTAACGCCATCAAATCACAGG .... 660
V. litorea cDNA
E. chlorotica cDNA
ACGTGGGAAAAGTGGTGATTGTGATGGTAAGCGATGGTCGAGCGAATGTGCCCCTCGCGG
ACGTGGGAAAAGTGGTGATTGTGATGGTAAGCGATGGTCGAGCGAATGTGCCCCTCGCGG .... 720
V. litorea cDNA
E. chlorotica cDNA
TCAGTAACGGCACGCAGCTCCCTGAAGATGAGAAGATGTCCAGGGAGGAGTTGAAGGAGG
TCAGTAACGGCACGCAGCTCCCTGAAGATGAGAAGATGTCCAGGGAGGAGTTGAAGGAGG .... 780
V. litorea cDNA
E. chlorotica cDNA
AGGTGTTGAACACTGCGAAGGCGCTGAGGGAGTTGCCGGCCTTTAGCTTGGTGGTGTTGG
AGGTGTTGAACACTGCGAAGGCGCTGAGGGAGTTGCCGGCCTTTAGCTTGGTGGTGTTGG .... 840
V. litorea cDNA
E. chlorotica cDNA
ACACTGAGAATAAGTTCGTGAGCACTGGCATGGCGAAGGAGTTGGCTGCAGCGGCTGGTG
ACACTGAGAATAAGTTCGTGAGCACTGGCATGGCGAAGGAGTTGGCTGCAGCGGCTGGTG .... 900
V. litorea cDNA
E. chlorotica cDNA
GGAGATATCATTATATTCCAAAAGCAACGGATCAAGCGATGGCGAAGGTGGCCAGCGAAG
GGAGATATCATTATATTCCAAAAGCAACGGATCAAGCGATGGCGAAGGTGGCCAGCGAAG .... 960
V. litorea cDNA
E. chlorotica cDNA
CAATTTCAAGCATCA
CAATTTCAAGCATCA ................................................. 975
Each generation of E. chlorotica must take up
chloroplasts from the algal food. However, once ensconced
into the digestive cells, the symbiotic plastids encounter an
array of algal genes transmitted from the parent slugs,
which are sufficient to keep photosynthesis operating.
During the life cycle, the slugs will feed and take up chloro-
60
plasts as long as V. litorea is available. However, under
field or lab starvation conditions, photosynthesis continues
for months at a level sufficient to sustain slug reproduction
without the input of fresh plastids. The remarkable
longevity of the chloroplast symbiosis in E. chlorotica
suggests that many more algal genes have been transferred
CHLOROPHYLL SYNTHESIS BY AN ANIMAL
127
Table 3. Comparison of consensus sequences of ChlH (ChlH subunit of magnesium chelatase) in cDNA (GU068610) and genomic DNA
(GU068611) from V. litorea and also cDNA from E. chlorotica adults (GU068612) and genomic DNA from pre-hatched E. chlorotica
veliger larvae (GU068613). The sequences differ in 1 nucleotide between algae and slug (bold). The sequence data were the same among
at least 3 different DNA or mRNA extractions from at least 3 different groups of organisms at different times of the year.
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
AGGCTTTGTATGCCAGAACCAAACTCTTGAACCCGAAGTTCTACGAGGGGATGTTGAACA
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
GTGGGTACGAGGGCACAAGGGAGATCACCAAAAGGCTGAGAAATACCATGGGATGGTCTG
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
CCACTGCAGGGGAGGTGGACAACTTTATCTACGAAGATGCGAACGATGTTTTCATCAAAG
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
ATGAAGCCATGAGGGAGAGACTGCTCAATACCAATCCGAACGCCTTCCGCGACATGATCA
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
CCACTTTTCTGGAGGCCAATGGAAGGGGCTACTGGGACACCTCGGATGATAATATAGAAC
V.
V.
E.
E.
litorea cDNA
litorea genomic DNA
chlorotica cDNA
chlorotica larval genomic DNA
TGTTGCAGGATCTGTACCAAGAGGTGGAAGATAAAATCGAGGGAGTTTGAGGAAAAT
AGGCTTTGTATGCCAGAACCAAACTCTTGAACCCGAAGTTCTACGAGGGGATGTTGAACA
AGGCTTTGTATGCCAGAACCAAACTCTTGAACCCGAAGTTCTACGAGGGGATGTTGAACA
AGGCTTTGTATGCCAGAACCAAACTCTTGAACCCGAAGTTCTACGAGGGGATGTTGAACA ....
60
GTGGGTACGAGGGCACAAGGGAGATCACCAAAAGGCTGAGAAATACCATGGGATGGTCTG
GTGGGTACGAGGGCACAAGGGAGATCACCAAAAGGCTGAGAAATACCATGGGATGGTCTG
GTGGGTACGAGGGCACAAGGGAGATCACCAAAAGGCTGAGAAATACCATGGGATGGTCTG .... 120
CCACTGCAGGGGAGGTGGACAACTTTATCTACGAAGATGCGAACGATGTTTTCATCAAAG
CCACTGCAGGGGAGGTGGACAACTTTATCTACGAAGATGCGAACGATGTGTTCATCAAAG
CCACTGCAGGGGAGGTGGACAACTTTATCTACGAAGATGCGAACGATGTGTTCATCAAAG .... 180
ATGAAGCCATGAGGGAGAGACTGCTCAATACCAATCCGAACGCCTTCCGCGACATGATCA
ATGAAGCCATGAGGGAGAGACTGCTCAATACCAATCCGAACGCCTTCCGCGACATGATCA
ATGAAGCCATGAGGGAGAGACTGCTCAATACCAATCCGAACGCCTTCCGCGACATGATCA .... 240
CCACTTTTCTGGAGGCCAATGGAAGGGGCTACTGGGACACCTCGGATGATAATATAGAAC
CCACTTTTCTGGAGGCCAATGGAAGGGGCTACTGGGACACCTCGGATGATAATATAGAAC
CCACTTTTCTGGAGGCCAATGGAAGGGGCTACTGGGACACCTCGGATGATAATATAGAAC .... 300
TGTTGCAGGATCTGTACCAAGAGGTGGAAGATAAAATCGAGGGAGTTTGAGGAAAAT
TGTTGCAGGATCTGTACCAAGAGGTGGAAGATAAAATCGAGGGAGTTTGAGGAAAAT
TGTTGCAGGATCTGTACCAAGAGGTGGAAGATAAAATCGAGGGAGTTTGAGGAAAAT ......
than we have uncovered so far-perhaps even pieces of, or
even entire, algal chromosomes are involved. Nevertheless,
these results clearly show that the successful transfer of
functional nuclear genes between multicellular species not
only can occur, but also can involve many genes which are
expressed producing alien proteins that reach cellular
targets and are capable of function.
These results seem important at several levels. First, the
phenomenon of chloroplast symbiosis has been of interest
for almost half a century. Although many species of elysiid
sea slugs are capable of intracellular sequestration of
chloroplasts, some protists do it as well (Gast et al., 2007;
Johnson et al., 2007). The division of the symbiotic
chloroplasts has not been seen so far in any kleptoplastic
species, including E. chlorotica. Also, while E. chlorotica
may hold the longevity record for plastid maintenance, the
symbiotic organelles in other species persist from but a few
days [for example, Elysiella pusilla (Evertson et al., 2007)]
to several months [E. clarki (Pierce et al., 2006)] and
involve a variety of algal taxa, often, unlike E. chlorotica,
with more than one species of alga per species of sea slug
(Curtis et al., 2006). While the mechanism of sequestration
357
is likely similar amongst the slug species (but see below),
the differences in chloroplast source and longevity suggest
that the transferred gene array is different between slug
species. This specificity of transferred gene arrays within
sea slug species suggests, in turn, that gene movements
have occurred many times across species and in different
amounts. Second, on a broader scale, our results here and
previously (Pierce et al, 2007) clearly show that completely
unrelated organisms can transfer genes between them,
integrate the transfers into the host genome and, not only
express the genes, but also successfully use the gene
products. Thus, at least some multicellular species do not
have to wait for a mutation to occur for an evolutionary
change to take place. Much as in prokaryotes and protists,
mechanism(s) for a successful swap of DNA between even
distantly related species is both present and active in
metazoans.
Clearly, genome sequencing is necessary to determine
the entire scope of algal genes in the genome of
E. chlorotica. In addition to the pathway we have found, to
work efficiently, the chlorophyll biosynthesis requires
retrograde signaling by the chloroplasts to help regulate
128
S.K. PIERCE ET AL.
Table 4. Comparison of consensus sequences of the chlorophyll synthase gene (ChlG), the terminal enzyme in the Chla synthesis pathway,
in cDNA from V. litorea (GU068614) and E. chlorotica (GU068615). The sequences match 100% over the 800 base run. As with the
preceding figures, these fragments were produced by PCR using primer sequences made from the V. litorea transcriptome data. The
E. chlorotica data come from 3 separate mRNA extractions done on at least 3 different groups of slugs at different times of the year.
V. litorea cDNA
E. chlorotica cDNA
TCACACCTGGAATCCATTCGCAGGGCCAGATGCAGTTGATTTACAAGATGCTGGGATTGA
TCACACCTGGAATCCATTCGCAGGGCCAGATGCAGTTGATTTACAAGATGCTGGGATTGA ....
V. litorea cDNA
E. chlorotica cDNA
CTTGGCCAAAGCTCTGACTTGTATGATATTGGCTGGGCCCTTTCTAACTGGCTTTACCCA
CTTGGCCAAAGCTCTGACTTGTATGATATTGGCTGGGCCCTTTCTAACTGGCTTTACCCA .... 120
V. litorea cDNA
E. chlorotica cDNA
AACCATCAACGATTGGTATGACCGAGATATTGATGCGATCAATGAGCCATATCGACCCAT
AACCATCAACGATTGGTATGACCGAGATATTGATGCGATCAATGAGCCATATCGACCCAT .... 180
V. litorea cDNA
E. chlorotica cDNA
TCCTTCTGGAGCTATTTCTGAGGGTCAAGTGAAAGCGCAAATTGCCTTTCTTCTAGTTGG
TCCTTCTGGAGCTATTTCTGAGGGTCAAGTGAAAGCGCAAATTGCCTTTCTTCTAGTTGG .... 240
V. litorea cDNA
E. chlorotica cDNA
TGGATTGGCTTTGTCGTATGGTTTGGATCTATGGGCAGGGCACCAAATGCCCACTGTTTT
TGGATTGGCTTTGTCGTATGGTTTGGATCTATGGGCAGGGCACCAAATGCCCACTGTTTT .... 300
V. litorea cDNA
E. chlorotica cDNA
TTTGTTGTCATTGTTTGGGACTTTCATTTCATACATATACTCAGCCCCGCCACTGAAATT
TTTGTTGTCATTGTTTGGGACTTTCATTTCATACATATACTCAGCCCCGCCACTGAAATT .... 360
V. litorea cDNA
E. chlorotica cDNA
GAAACAGAATGGCTGGGCAGGTAATTTTGCCTTGGGCTCAAGCTACATTAGCTTGCCGTG
GAAACAGAATGGCTGGGCAGGTAATTTTGCCTTGGGCTCAAGCTACATTAGCTTGCCGTG .... 420
V. litorea cDNA
E. chlorotica cDNA
GTGGTGTGGTCAGGCTATGTTTGGTGAGCTCAACTTGCAAGTTGTGGTCCTAACTTTGCT
GTGGTGTGGTCAGGCTATGTTTGGTGAGCTCAACTTGCAAGTTGTGGTCCTAACTTTGCT .... 480
V. litorea cDNA
E. chlorotica cDNA
GTATTCTTGGGCAGGCCTTGGAATTGCAATAGTAAATGACTTCAAATCAGTTGAGGGGGA
GTATTCTTGGGCAGGCCTTGGAATTGCAATAGTAAATGACTTCAAATCAGTTGAGGGGGA .... 540
V. litorea cDNA
E. chlorotica cDNA
TAGAGCCATGGGTTTACAGTCTCTTCCTGTGGCTTTTGGTATAGAAAAAGCCAAGTGGAT
TAGAGCCATGGGTTTACAGTCTCTTCCTGTGGCTTTTGGTATAGAAAAAGCCAAGTGGAT .... 600
V. litorea cDNA
E. chlorotica cDNA
ATGTGTGAGTAGCATTGACATTACTCAATTGGGCATAGCCGCATGGCTATATTATATTGG
ATGTGTGAGTAGCATTGACATTACTCAATTGGGCATAGCCGCATGGCTATATTATATTGG .... 660
V. litorea cDNA
E. chlorotica cDNA
AGAGCCTACCTATGCATTCGTTTTATTGGGCCTCATTCTTCCTCAGATATATGCACAATT
AGAGCCTACCTATGCATTCGTTTTATTGGGCCTCATTCTTCCTCAGATATATGCACAATT .... 720
V. litorea cDNA
E. chlorotica cDNA
TAAGTATTTTTTGCCGGATCCAGTTGAGAATGATGTCAAATACCAAGGATTTGCTCAGCC
TAAGTATTTTTTGCCGGATCCAGTTGAGAATGATGTCAAATACCAAGGATTTGCTCAGCC .... 780
V. litorea cDNA
E. chlorotica cDNA
ATTTCTTGTATTTGGGATTT
ATTTCTTGTATTTGGGATTT
nuclear gene expression (Green et al., 2000). It is not yet
clear how refined this control system is in the symbiotic
plastids in the E. chlorotica digestive cells, but algal
nuclear genes that code for the proteins that signal between
the chloroplast and nucleus as well as proteins involved in
targeting and trafficking are obvious candidates. This
especially long-lived chloroplast symbiosis in E. chlorotica
presents a unique opportunity to study the evolution of
intracellular organelles as it is occurring.
Finally, from both theoretical and applied perspectives
understanding the gene transfer mechanism may be of
considerable significance. The uptake of the chloroplasts
has only been examined in a few instances. However, the
ancient literature makes clear that digestion in herbivorous
........................................
60
800
gastropods is largely accomplished using intracellular
vacuoles (Owen, 1966). During ingestion, food material is
mechanically broken down into small pieces or sucked up,
in the case of the sacoglossan. It then passes into the
digestive tubules where the epithelial cells phagocytize the
pieces into lysosomal vacuoles where digestion proceeds.
The chloroplasts are engulfed from the lumen of the tubules
by either the same phagocytic mechanism, or an analogous
process, according to the few studies that have examined it
(McLean, 1976; Mondy and Pierce, 2003). Although some
other reports have incorrectly stated that the symbiotic
chloroplasts are naked in the cytoplasm of the digestive
tubule cell (Graves et al., 1979; Rumpho et al., 2001)
they are actually surrounded by a tightly applied animal
CHLOROPHYLL SYNTHESIS BY AN ANIMAL
Figure 1. Typical HPLC chromatogram of Chla extracted from
V. litorea (upper chart) and separated according to the protocol
described in the methods section. The Chla peak is labeled such at
approximately 43.5 min. The lower chart represents the
radioactivity (14C) in fractions collected from the HPLC column
eluant also as described in the methods. The large peak in
radioactivity at approximately 43.5 min coelutes exactly with the
Chla peak in the upper chart. Although we did not identify them,
the smaller radioactive peaks just preceding the Chla location are
most likely intermediates in the Chla synthesis pathway (see
Pinckney et al., 1996). The large peak of radioactivity starting at
about 4 min, which was not detected on the HPLC chromatogram,
is right at the column void volume.
membrane (Mondy and Pierce, 2003; Curtis et al., 2006).
Instead of being digested, the plastids reside inside the
vacuole for the duration of their association. There is some
possibility that the algal genes, especially if they are
transferred in the form of chromosomes or pieces of
chromosomes, enter the host cell by a similar process.
Alternatively, circumstantial evidence indicates that
endogenous retroviruses could be the transfer agent, at least
in E. chlorotica (Pierce et al., 1999; Mondy and Pierce,
2003) although the increasing number of transferred genes
being found in this species may make viral transfer a less
attractive hypothesis.
129
Figure. 2. Typical HPLC chromatogram (upper chart) of Chla
extracted from E. chlorotica and separated by the same protocol
that produced the V. litorea results in Fig. 1. The peak at
approximately 43.5 min corresponds to the elution time of both
standard Chla (Sigma Chemicals) as well as the Chla peak in the
V. litorea chromatogram. The lower chart represents the (14C)
radioactivity profile in fractions of eluant collected during the
HPLC run. The large peak of radioactivity at approximately 43.5
min corresponds exactly with the elution of the Chla peak. The
large peak starting at about 4 min into the run is right at the
column void volume. The identities of the other radioactive peaks
are unknown. Those just preceding and following Chla are likely
Chla precursors and degradation products (Llewellyn et al., 1990;
Pinckney et al., 1996; Nayar et al., 2003). The broad peak from
13–15 min is in the region where chlorophyll c and fucoxanthin
elute in this HPLC protocol (Llewellyn et al., 1990).
Acknowledgements
We gratefully acknowledge the generous financial
support of a private donor, who wishes to remain
anonymous. The work reported here could not have been
done without that donor’s help.
130
S.K. PIERCE ET AL.
Figure 3. Typical HPLC chromatogram of Chla and associated
radioactivity following incubation of slugs with 14C ALA in the
dark and extraction as described in the methods. As in the other
figures, Chla is the peak at 45 min labeled “chlorophyll a”. The
histogram inset displays the small amount of radioactivity that was
incorporated in Chla by slugs and algal filaments during an 18 hr
incubation in the dark, indicating that almost no Chla synthesis
occurs in either the algal filaments or the symbiotic chloroplasts
without the presence of light (compare to Figs. 1 and 2).
Figure 4. Typical chromatogram showing the results of conversion
of radioactive chlorophyll purified from E. chlorotica to phaeophytin by acid treatment as described in the methods. Initially,
radioactive Chla was collected as usual from the HPLC. Neither
peak nor radioactivity was recovered in the region where
phaeophytin elutes (55.8 min). The collected Chla was acid treated
as described, the extract was spiked with non-radioactive Chla to
mark its elution point (arrow) and rechromatographed. As shown
here, a new radioactive peak (inset) has appeared which co-elutes
with phaeophytin (Llewellyn et al., 1990) (arrow) and is well
separated from the Chla spike.
REFERENCES
Curtis, N.E., Massey, S.E., and Pierce, S.K. 2006. The symbiotic
chloroplasts in the sacoglossan Elysia clarki are from several
algal species. Journal of Invertebrate Biology 125: 336–345.
Eberhard, S., Finazzi, G., and Wollman, F.-A. 2008. The
dynamics of photosynthesis. Annual Review of Genetics 42:
463–515.
Evertsen, J., Burghardt, I., Johnsen, G., and Wagele, H. 2007.
Retention of functional chloroplasts in some sacoglossan from
the Indo-Pacific and Mediterranean. Marine Biology 151: 2159–
2166.
Gast, R.J., Moran, D.M., Dennett, M.R., and Caron, D.A. 2007.
Kleptoplasty in an Antarctic dinoflagellate: caught in
evolutionary transition? Environmental Microbiology 9: 39–45.
Graves, D.A., Gibson, M.A., and Bleakney, J.S. 1979. The
digestive diverticula of Alderia modesta and Elysia chlorotica
(Opisthobranchia : Sacoglossa). Veliger 21: 415–422.
Green, B.J., Li, W.-Y., Manhart, J.R., Fox, T.C., Summer, E.J.,
Kennedy, R.A., Pierce, S.K., and Rumpho, M.E. 2000. Molluscalgal chloroplast endosymbiosis, photosynthesis, thylakoid
protein maintenance, and chloroplast gene expression continue
for many months in the absence of the algal nucleus. Plant
Physiology 124: 331–342.
Hanten, J.J. and Pierce, S.K. 2001. Synthesis of several lightharvesting complex I polypeptides is blocked by cycloheximide
in symbiotic chloroplasts in the sea slug, Elysia chlorotica
(Gould): A case for horizontal gene transfer between alga and
animal? Biological Bulletin 201: 33–44.
Johnson, M.D., Oldach, D., Delwiche, C.F., and Stoecker, D.K.
2007. Retention of transcriptionally active cryptophyte nuclei by
the ciliate Myrionecta rubra. Nature 445: 426–428.
Llewellyn, C.A, Mantoura, R.F.C., and Brereton, R.G. 1990.
Products of chlorophyll photodegradation -1 Detection and
separation. Photochemistry and Photobiology 52: 1037–1041.
McLean, N. 1976. Phagocytosis of chloroplasts in Placida
dendritica (Gastropoda: Sacoglossa). Journal of Experimental
Zoology 197: 321–330.
Mondy, W.L. and Pierce, S.K. 2003. Apoptotic-like morphology
is associated with the annual synchronized death of a population
of kleptoplastic sea slugs (Elysia chlorotica). Journal of
Invertebrate Biology 122: 126–137.
Nayar, S., Goh, B.P.L., and Chou, L.M. 2003. Interference of
chlorophyll a in liquid scintillation counting of phytoplankton
productivity samples by the 14C technique. Estuarine and
Coastal Shelf Science 56: 957–960.
Obornik, M. and Green, B.R. 2005. Mosaic origin of the heme
biosynthesis pathway in photosynthetic eukaryotes. Molecular
Biology and Evolution 22: 2343–2353.
Owen, G. 1966. Digestion. In: Physiology of Mollusca II. Wilbur,
K.M. and Yonge, C.M., eds. Academic Press, NY, pp. 53–96.
Pierce, S.K., Biron, R.W., and Rumpho, M.E. 1996.
Endosymbiotic chloroplasts in molluscan cells contain proteins
synthesized after plastid capture. Journal of Experimental
Biology 199: 2323–2330.
Pierce, S.K., Curtis, N.E., Hanten, J.J., Boerner, S.L., and
Schwartz, J.A. 2007. Transfer, integration and expression of
functional nuclear genes between multicellular species.
Symbiosis 43: 57–64.
Pierce, S.K., Curtis, N.E., Massey, S.E., Bass, A.L., Karl, S.A.,
and Finney, C. 2006. A morphological and molecular
comparison between Elysia crispata and a new species of
kleptoplastic
sacoglossan
sea
slug
(Gastropoda:
Opisthobranchia) from the Florida Keys USA. Molluscan
Research 26: 23–38.
Pierce, S.K., Maugel, T.K., Rumpho, M.E., Hanten, J.J., and
Mondy, W.L. 1999. Annual viral expression in a sea slug
population: Life cycle control and symbiotic chloroplast
maintenance. Biological Bulletin 197: 1–6.
CHLOROPHYLL SYNTHESIS BY AN ANIMAL
Pinckney, J.L., Millie, D.F., Howe, K.E., Paerl, H.W., and Hurley,
J.P. 1996. Flow scintillation counting of 14C-labeled microalgal
photosynthetic pigments. Journal of Plankton Research 18:
1867–1880.
Pinckney, J.L., Paerl, H.W., Harrington, M.B., and Howe, K.E.
1998. Annual cycles of phytoplankton community-structure and
bloom dynamics in the Neuse River Estuary, North Carolina.
Marine Biology 131: 371–381.
Reith, M. 1995. Molecular biology of rhodophyte and
chromophyte plastids. Annual Review of Plant Physiology and
Molecular Biology 46: 549–575.
Riper, D.M., Owens, T.G., and Falkowski, P.G. 1979. Chlorophyll
turnover in Skeletonema costatum, a marine plankton diatom.
Plant Physiology 64: 49–54.
Rumpho, M.E., Summer, E.J., Green, B.J., Fox, T.C., and
Manhart, J.R. 2001. Mollusc/algal chloroplast symbiosis: How
can isolated chloroplasts continue to function for months in the
cytosol of a sea slug in the absence of an algal nucleus?
Zoology 104: 303–312.
131
Rumpho, M.E., Worful, J.M., Lee, J., Kannan, K., Tyler, M.S.,
Bhattacharya, D., Moustafa, A., and Manhart, J.R. 2008.
Horizontal gene transfer of the algal nuclear gene psbO to the
photosynthetic sea slug Elysia chlorotica. Proceedings of the
National Academy of Science, USA 105: 17867–17871.
Schwartz, J.A., Curtis, N.E., and Pierce, S.K. Transcriptome
analysis reveals several horizontally transferred algal nuclear
genes in the genome of the sea slug Elysia chlorotica. Journal of
Molecular Evolution (submitted).
Tanaka, R. and Tanaka, A. 2007. Tetrapyrrole biosynthesis in
higher plants. Annual Review of Plant Biology 58: 321–346.
Wamsley, J. and Adamson, H. 1994. Chlorophyll turnover in
etiolated greening barley transferred to darkness: Isotopic (1-14C
glutamic acid) evidence of dark chlorophyll synthesis in the
absence of chlorophyll accumulation. Physiologia Plantarum
93: 435–444.
West, H.H., Harrigan, J., and Pierce, S.K. 1984. Hybridization of
two populations of a marine opisthobranch with different
developmental patterns. Veliger 26: 199–206.