Chinese Journal of Chemical Engineering, 16(4) 620—625 (2008)
Improve Ethanol Yield Through Minimizing Glycerol Yield in
Ethanol Fermentation of Saccharomyces cerevisiae*
ZHANG Aili (张爱利) and CHEN Xun (陈洵)**
School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072, China
Abstract In ethanol fermentation of Saccharomyces cerevisiae (S. cerevisiae), glycerol is one of the main
by-products. The purpose of this investigation was to increase ethanol yield through minimizing glycerol yield by
using mutants in which FPS1 encoding a channel protein that mediates glycerol export and GPD2 encoding one of
glycerol-3-phosphate dehydrogenase were knocked-out using one-step gene replacement. GLT1 and GLN1 that encode glutamate synthase and glutamine synthetase, respectively, were overexpressed using two-step gene replacement in fps1∆gpd2∆ mutant. The fermentation properties of ZAL69(fps1∆::LEU2 gpd2∆::URA3) and ZAL808
(fps1∆::LEU2 gpd2∆::URA3 PPGK1-GLT1 PPGK1-GLN1) under microaerobic conditions were investigated and compared with those of wild type(DC124). Consumption of glucose, yield of ethanol, yield of glycerol, acetic acid, and
pyruvic acid were monitored. Compared with wild type, the ethanol yield of ZAL69 and ZAL808 were improved
by 13.17% and 6.66 %, respectively, whereas glycerol yield decreased by 37.4 % and 41.7 %. Meanwhile, acetic
acid yield and pyruvic acid yield decreased dramatically compared to wild type. Our results indicate that FPS1 and
GPD2 deletion of S. cerevisiae resulted in reduced glycerol yield and increased ethanol yield, but simultaneous overexpression of GLT1 and GLN1 in fps1∆gpd2∆ mutant did not have a higher ethanol yield than fps1∆gpd2∆ mutant.
Keywords Saccharomyces cerevisiae, ethanol yield, glycerol yield, gene knock-out, gene over-express, FPS1,
GPD2, GLN1, GLT1
1
INTRODUCTION
In ethanol fermentation of Saccharomyces cerevisiae (S. cerevisiae), in addition to biomass and carbon dioxide, a number of byproducts are produced,
such as glycerol and organic acids (e.g., acetic acid
and pyruvic acid, succinic acid). Approximately 5%
carbon source is converted into glycerol in ethanol
fermentation. Eliminating formation of glycerol can
be used to increase ethanol yield of S. cerevisiae
without increasing the overall cost of carbon source.
Fig. 1 presents important pathways of glycerol and
ethanol metabolism in S. cerevisiae.
Glycerol formation has two roles in the fermentation of S. cerevisiae [1]. Under anaerobic fermentations when the respiratory chain is not functioning, net
formation of NADH produced during synthesis of
biomass and organic acids, i.e., acetic acid, and pyruvic acid, must be reoxidized to NAD+ by formation of
glycerol in order to avoid a serious imbalance in the
NAD+/NADH ratio. Synthesis of 1 mol glycerol from
glucose leads to reoxidation of 1 mol NADH. Furthermore, during growth under osmotic stress conditions, glycerol is formed and accumulated inside the
cell where it works as an efficient osmolyte that protects the cell against lysis.
The yield of glycerol is controlled by its biosynthetic pathway as well as by regulated transmembrane
transport systems. Glycerol is produced from the glycolytic intermediate dihydroxyacetone phosphate in
two steps catalyzed by NAD+-dependent glycerol-3phosphate dehydrogenase and glycerol-3-phosphate
phosphatase. Both enzymes are encoded by two similar isogenes, GPD1 plus GPD2 and GPP1 plus GPP2,
respectively. Expression of GPD1 and GPP2 is induced by high osmolarity, whereas that of GPD2 and
GPP1 is stimulated under anaerobic conditions [2-6].
Glycerol-3-phosphate dehydrogenase, and not glycerol phosphatase, is rate-limiting for glycerol production in S. cerevisiae [7].
Ammonium is often used as nitrogen source in
industrial fermentations of S. cerevisiae. Transported
across the membrane into the cytoplasm, ammonium
is assimilated into glutamate by reaction with
α-oxoglutarate. This consists of two coupled reactions,
catalyzed by glutamate synthase (GOGAT) (Reaction
1), encoded by GLT1, and glutamine synthetase (GS)
(Reaction 2), encoded by GLN1. The expression and
regulation of glutamate synthase (GOGAT) have been
reported.
α-oxoglutarate + glutamine + NADH ⎯⎯
→
glutamate + NAD+
glutamate
+ NH +4
(1)
+ ATP ⎯⎯
→ gutamine + ADP + Pi
(2)
α-oxoglutarate
+ NH +4
+ NADH + ATP ⎯⎯
→
(3)
glutamate + NAD+ + ADP + Pi
By over-expressing both GLT1 and GLN1 it should
be possible to convert NADH to NAD+ in the synthesis of glutamate from ammonium and 2-oxoglutarate
resulting in a reduced surplus formation of NADH and,
thus, a lower glycerol production. The genetically
modified strain probably will have an additional requirement for synthesis of ATP because Reaction 2
requires ATP. Presumably the larger drain of ATP will
be compensated by a higher ethanol production [8].
Strategies had been used for construction of
higher ethanol yield strains of S. cerevisiae, for example, deletion of GPD1 and GPD2 which encode
glycerol-3-phosphate dehydrogenase resulting higher
Received 2007-08-13, accepted 2008-03-26.
* Supported by the National High Technology Research and Development Program of China (2002AA647040).
** To whom correspondence should be addressed. E-mail: [email protected]
Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008
621
Figure 1 Important pathways of glycerol and ethanol metabolism in S. cerevisiave
important enzyme: 1—hexokinase (glucokinase); 2—phosphoglucose isomerase; 3—phasphofructokinase; 4—aldolase;
5—triose phosphate isomerase; 6—NAD-dependent glycerol-3-phosphate dehydrogenase; 7—glycerol-3-phosphatase;
8—glycerolaldehyd-3-phosphate dehydrogenase; 9—phosphoglycerate kinase; 10—phosphoglycerate mutase; 11—
enolase; 12—pyruvate kinase; 13—pyruvate decarboxylase; 14—alcohol dehydrogenase; 15—aldehyde dehydrogenase;
16—glycerol kinase; 17—FAD-dependent glycerol-3-phosphate dehydrogenase
ethanol yield [9-11], deletion of FPS1 to increase
ethanol yield [12], and simultaneous overexpression of
GLT1 and GLN1 resulting in higher ethanol yield [8].
But there have been no reports about the applications
of deletion of both FPS1 and GPD2 or simultaneous
overexpression of GLT1 and GLN1 in fps1∆gpd2∆
mutant. Hence, the purpose of this study was to investigate whether deletion of both FPS1 and GPD2 or
simultaneous overexpression of GLT1 and GLN1 in
fps1∆gpd2∆ mutant would result in reduced glycerol
yield and higher ethanol yield.
2
2.1
MATERIALS AND METHODS
Yeast strains and media
The Saccharomyces cerevisiae strains used in this
study were all isogonics to DC124 as described in
Table 1.
The strains of S. cerevisiae cells were routinely
grown in medium containing 2% peptone and 1%
yeast extract supplemented with 2% glucose as carbon
source (YPD). Selective media SC [13] minus leucine
or uracil were used for selection of transformants
containing LEU2 or URA3 selective marker.
2.2
Plasmids and strains constructions
The primers and plasmids used in this study were
described in Table 2 and Table 3, respectively.
2.3
Deletion of GPD2
Primer KGPD2-U containing nucleotides 40 to 1
upstream of the ATG start codon of GPD2 at the 5’
end and 20 nucleotides of the YEplac195 at the 3’ end,
and KGPD2-D containing nucleotides 1363 to 1324 of
the complementary strand downstream of the ATG
start codon of GPD2 at the 5’ end and 20bp nucleotides of the complementary strand of the YEplac195 at
the 3’ end, were used to clone a 1.36kb fragment containing the open reading frame of URA3 by PCR with
the Taq DNA polymerase (TAKARA). The PCR
products were transformed into yeast, and the transformation mixture were incubated on SC minus uracil
plates for 2-3 d. Correct deletion of GPD2 was verified by PCR analysis and the PCR products were digested with EcoR I. For this purpose, primers
CGPD2-U containing restriction enzyme site for Xba I
and BamH I in front of nucleotides 486 to 467
622
Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008
Table 1
Strains used in this study
Strain
Complete genotype
Reference or source
DC124
(isogenic. to SP1)
Matα leu2 ura3 trp1 his3 ade8 can1
M. Wigler
(Cold Spring Harbor, NY, USA)
L-2
Matα leu2 ura3 trp1 his3 ade8 can1 fps1Δ:: LEU2
Zhang et al. [12]
ZAL69
Matα leu2 ura3 trp1 his3 ade8 can1 fps1Δ:: LEU2 gpd2Δ::URA3
this work
ZAL808
Matα leu2 ura3 trp1 his3 ade8 can1 fps1Δ:: LEU2 gpd2Δ::URA3 PPGK1-GLT1 PPGK1-GLN1
this work
Table 2
Primers used in this study
Oligonucleotide
Primer name
KGPD2-U
5’CTCTTTCCCTTTCCTTTTCCTTCGCTCCCCTTCCTTATCAGTAGTCTAGTACTCCTGTG3’
KGPD2-D
5’GCAACAGGAAAGATCAGAGGGGGAGGGGGGGGGAGAGTGTGAAAAGTGCCACCTGACGTC3’
CGPD2-U
5’TCTAGAGGATCCATAGCCATCATGCAAGCGTG3’ (Xba I and BamH I)
CGPD2-D
5’TAGCGCTCTTATCTCAGTGG3’
Glt1-U
5’GGGCCCGTCGACATGCCAGTGTTGAAATCAGA3’ (Sal I)
Glt1-D
5’ GGGCCCCTGCAGTTTTAGTATCGACCATTTCA3’ (Pst I)
Glt1prom.-U
5’GGGCCCGGTACCTTTCTGAGCA CTGTCAGGAG3’ (Kpn I)
Glt1prom.-D
5’GGGCCCGGATCCTGATTTCAACAC TGGCATGC3’ (BamH I)
PGK1 prom.-U
5’GGGCCCGGATCCAGGCATTTGCAAGAATTACTC3’ (BamH I)
PGK1 prom.-D
5’GGGCCCGTCGACTGTTTTATATTTGTTGTAAAAAGTAG3’ (Sal I)
Gln1 P-U
5’GGGCCCGAGCTCGACCCATTTTTCTCAGCGCC3’ (Sac I)
Gln1 P-D
5’GGGCCCAGATCTTCGATGCTTG CTTCAGCCAT3’ (Bgl II)
Gln1-U
5’GGGCCCGTCGACATGGCTGAAGCAAGCATCGA3’ (Sal I)
Gln1-D
5’ GGGCCCCTGCAGATATACAACACAGCG TCGCT3’ (Pst I)
Table 3
Plasmids used in this study
Plasmids name
Description
Reference or source
YEplac195
Ampr,URA3
Gietz et al. [14]
r
YIplac211
Amp ,URA3
Gietz et al. [14]
YIplac211-p-GLN1
Ampr,URA3
this work
YIplac211-p-GLT1
r
Amp ,URA3
this work
upstream of the ATG start codon of GPD2, and
CGPD2-D containing nucleotides 1693 to 1674 of the
complementary strand downstream of the ATG start
codon of GPD2 were used.
2.4
Overexpression of GLT1
Primer Glt1-U, containing restriction enzyme site
for Sal I in front of nucleotides 1 to 20 downstream of
the ATG start codon of GLT1, and Glt1-D containing
restriction enzyme site for Pst I in front of nucleotides
1390 to 1371 of the complementary strand downstream of the start codon of GLT1, were used to clone
parts of the structure gene of GLT1 by PCR with the
Pyrobest DNA polymerase (TARARA). The fragment
was digested with Sal I and Pst I and ligated into the
Sal I and Pst I digestion sites of the plasmid
YIplac211, resulting in the plasmid YIplac211-GLT1
truncation. Primer Glt1prom.-U containing restriction
enzyme site for Kpn I in front of nucleotides 920 to
911 upstream of the ATG start codon of GLT1, and
Glt1prom.-D containing restriction enzyme site for
BamH I in front of nucleotides of the complementary
strand from18bp downstream of the ATG start codon
to 2bp upstream of the ATG start codon of GLT1, were
used to clone parts of the promoter sequence of GLT1
by PCR with the Pyrobest DNA polymerase (TARARA).The fragment was digested with Kpn I and
BamH I , and ligated into the Kpn I and BamH I digestion sites of the plasmid YIplac211-GLT1 truncation, resulting in the plasmid YIplac211-GLT1
truncation-GLT1 promoter. PGK1 prom.-U, containing restriction enzyme site for BamH I in front of nucleotides 721 to 701 upstream of the start codon of
PGK1, and PGK1 prom.-D containing restriction enzyme site for Sal I in front of nucleotides 26 to 1 of
the complementary strand upstream of the start codon
of PGK1, were used to clone parts of the promoter
gene of PGK1 by PCR with the Pyrobest DNA polymerase (TARARA). The fragment was digested with
Sal I and BamH I , and ligated into the Sal I and
BamH I digestion sites of the plasmid YIplac211GLT1 truncation, resulting in the plasmid YIplac211p-GLT1. The plasmid was linearized by digestion with
Bgl II before transformation of yeast to SC minus
uracil medium plates. Correct insertion of the plasmid
into the GLT1 locus on chromosome IV was verified
by PCR. For these purpose primers Glt1 prom.-U and
Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008
Glt1-D were used. Loop-out of the URA3 marker gene
by homologous recombination of the two direct GLT1
promoter sequence was obtained by cultivating the
correct transformations on 5-FOA plates. Correct
loop-out of the URA3 gene was verified by PCR, and
the primers Glt1 prom.-U and Glt1-D were used.
2.5
Overexpression of GLN1
Gln1 P-U containing restriction enzyme site for
Sac I in front of nucleotides 1192 to 1173 upstream of
the ATG start codon of GLN1, and Gln1P-D containing restriction enzyme site for Bgl II in front of nucleotides 20 to 1 of the complementary strand downstream of the ATG start codon of GLN1, were used to
clone parts of the promoter gene of GLN1 by PCR
with the Pyrobest DNA polymerase(TARARA).The
fragment was digested with Sac I and Bgl II , and
ligated into the Sac I and Bgl II digestion sites of the
plasmid YIplac211, resulting in the plasmid
YIplac211-GLN1 promoter. Primer Gln1-U containing
restriction enzyme site for Sal I in front of nucleotides
1 to 20 of downstream of the ATG start codon( +1 bp
to +20 bp)of GLN1, and Gln1-D containing restriction
enzyme site for Pst I in front of nucleotides 1400 to
1381 of the complementary strand downstream of the
ATG start codon of GLN1, were used to clone the
structure gene of GLN1 by PCR with the Pyrobest
DNA polymerase (TARARA).The fragment was digested with Sal I and Pst I , and ligated into the Sal I and
Pst I digestion sites of the plasmid YIplac211-GLN1
promoter, resulting in the plasmid YIplac211-GLN1
ORF-GLN1 promoter. PGK1 prom.-U containing restriction enzyme site for BamH I in front of nucleotides 721 to 701 upstream of the start codon of PGK1,
and PGK1 prom.-D containing restriction enzyme site
for Sal I in front of nucleotides 26 to 1 of the complementary strand upstream of the start codon of
PGK1, were used to clone parts of the promoter gene
of PGK1 by PCR with the Pyrobest DNA polymerase
(TARARA). The fragment was digested with Sal I and
BamH I , and ligated into the Sal I and BamH I digestion sites of the plasmid YIplac211-GLN1 truncation,
resulting in the plasmid YIplac211-p-GLN1. The
plasmid was linearized by digestion with Kpn I before
transformation of yeast to SC minus uracil medium
plates. Correct insertion of the plasmid into the GLN1
locus on chromosome XVI was verified by PCR. For
these purposes primers Gln1 prom.-U and Gln1-D
were used. Loop-out of the URA3 gene by homologous recombination of the two direct GLN1 promoter
sequence was obtained by cultivating the correct
transformations on 5-FOA plates. Correct loop-out of
the URA3 gene was verified by PCR, and the primers
Gln1 prom.-U and Gln1-D were used.
2.6 Growth conditions and experimental procedures
Incubation conditions were standardized at 30°C
－
and 200 r·min 1 orbital shaking. Standard techniques
were applied as described in Ref. [15] for all gene clon-
623
ing experiments. DNA fragments were purified using
DNA recycle kits and PCR products were purified
using phenol deproteinization and ethanol precipitation. Restriction and modification enzymes were used
according to the manufacturers’ instruction. Yeast
transformation was performed by the lithium acetate
method. Escherichia coli Top10’ was used for subcloning. All yeast strains were maintained at 4°C on YPD
plates (containing 2% peptone and 1% yeast extract
supplemented with 2% glucose as carbon source), and
monthly prepared from a glycerol stock kept at －75°C.
2.7
Fermentation conditions
Microanaerobic cultivations were performed at
30°C in the 250 ml unbaffled shake flasks kept at con－
stant stirring speed of 100 r·min 1 with 100 ml medium
(containing 2% peptone and 1% yeast extract supplemented with 6% glucose as carbon source). Initial biomass concentrations were set at OD660nm 1.0 after inoculation. Fermentation experiments were performed in
triplicate and one representative experiment was shown.
2.8
Growth determination
Growth was followed by measuring the absorbance of the cultures at 660 nm in a Bioquest CE2502
spectrophotometer (Progen Scientific Ltd, UK).
2.9 Measurement of glucose, ethanol, glycerol,
acetic acid, and pyruvic acid [16]
The samples (1.5 ml each) were centrifuged for 5
min at 18000 g and the resulting supernatants were
frozen (－20°C) until analysis. The contents of glycerol and glucose in the fermentation broth were determined by HPLC using differential refractive index
detector and Agilent ZORBAX carbohydrate column
(Agilent Technologies Co. Ltd, Beijing, China) eluted
－
by 75% acetonitrile with 1.0 ml·min 1. The content of
acetic acid and ethanol was determined using a gas
chromatograph (Shimadzu GC-2010) with a DB-WAX
capillary column and a FID detector (Flame Ionization
Detector). The temperatures of inlet, oven, and detector were kept at 200°C, 150°C and 200°C, respectively.
The content of pyruvic acid was determined using an
RP18 column (Waters, Milford, USA) eluted with 0.1
－
－
mol·L 1 KH2PO4 (pH 3.0) at a flow rate of 0.6 ml·min 1
at 30°C and a PDA (Photodiode Array) detector.
2.10
Determination of biomass concentration
Samples (50 ml) were centrifuged at 5000 g for
10 min and washed twice with water, and subsequently the pellets were kept at 110°C for 24 h and
weighed after cooling.
3
RESULTS
The fermentation properties of DC124 (wild
624
Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008
type), ZAL69, and ZAL808 were studied under microaerobic condition. As described in Fig. 2, the growth
of ZAL808 is slower than DC124, but the growth of
ZAL69 fast than DC124. According to Table 4, the
biomass concentration of ZAL69 and ZAL808 did not
have great change compared to that of wild type.
ZAL808 decreased 63.4% and 68.8 %, respectively, as
shown in Table 4. Pyruvic acid yield of ZAL69 and
ZAL808 decreased 61.1% and 54% as shown in Table 4. However, glucose consumption profiles of
ZAL69 mutant were similar compared with wild type
during the growth phases according to Fig. 3 (c), but the
glucose consumption profiles of ZAL808 lagged a little.
4
Figure 2 The biomass concentrations of strains DC124 (△),
ZAL69 (□) and ZAL808 (◆) during exponential growth in
the microaerobic conditions
As given in Fig. 3 (a), ethanol yield of ZAL69
and ZAL808 did not shows great changes compared
with DC124 during the first ten hours of the fermentations, but increased sharply during the following hours.
At the end point of the fermentations (24 h), ethanol
yield of ZAL69 and ZAL808 was improved by13.17%
and 6.66%, respectively. As shown in Fig. 3 (b), glycerol yield of ZAL69 and ZAL808 decreased significantly during the fermentations, and at the end point
of the fermentations (24 h), glycerol yield of ZAL69
and ZAL808 decreased by 37.4% and 41.7 % compared with DC124.
Meanwhile, acetic acid yield of ZAL69 and
(a)
DISCUSSION
Investigations on improving ethanol yield by
FPS1 deletion of S. cerevisiae have been reported recently [12]. Other strategies had been used for construction of higher ethanol-producing yield strains of S.
cerevisiae, for example, deletion of GPD1 and GDP2
that encode glycerol-3-phosphate dehydrogenase result in higher ethanol yield [9-11], and simultaneous
over-expression of GLT1 and GLN1 result in higher
ethanol yield [8]. But there have been no reports about
the applications of deletion of both FPS1 and GPD2
or simultaneous overexpression of GLT1 and GLN1 in
fps1∆gpd2∆ mutant. In this study, the effects of deletion of both FPS1 and GPD2 or simultaneous
over-expression of GLT1 and GLN1 in fps1∆gpd2∆
mutant on the fermentation properties were investigated.
The strain ZAL69 and ZAL808, along with wild
type strain DC124, were characterized with respect to
several parameters (Table 4). There was an increase in
－
the maximum specific growth rate from 0.1276 h 1 in
－1
strain DC124 to 0.1342 h in strain ZAL69, but the
－
maximum specific growth rate decreased to 0.1253 h 1
in strain ZAL808 (Fig. 2, Table 4). This result was
further more supported by the fact that the consumption of glucose in ZAL808 lagged a little compared to
DC124 [Fig. 3 (c)]. Similarly, the biomass content in
(b)
(c)
Figure 3 Time course of the measured parameters during microanaerobic conditions of S. cerevisiae DC124 (△), ZAL69
(□), ZAL808 (◆), with 6% glucose as carbon and energy source
Table 4
Comparison of growth and compound yields of DC124, ZAL69 and ZAL808 in batch fermentations
Specific growth
①
－
rate /h 1
Biomass concentra－
tion/g·(100 ml) 1
Glycerol yield
－
/g·(100 ml) 1
Ethanol yield/
－
g·(100 ml) 1
Acetic acid yield
－
/g·(100 ml) 1
Pyruvic acid yield
－
/g·(100 ml) 1
DC124
0.1276
0.66±0.002
0.211±0.01
2.62±0.005
0.093±0.005
1.6287±0.02
ZAL69
0.1342
0.688±0.0021
0.132±0.01
2.965±0.005
0.034±0.005
0.5521±0.02
ZAL808
0.1253
0.68±0.018
0.123±0.01
2.794±0.005
0.029±0.005
0.75±0.02
Note: Standard deviations were calculated for at least three independent fermentations.
① Calculated using measurements of optical density at 660 nm.
Chin. J. Chem. Eng., Vol. 16, No. 4, August 2008
all three strains remained virtually unchanged (Table 4).
Taken together, these results suggest that the cellular
metabolic and biosynthetic pathways of ZAL69 and
ZAL808 did not dramatically change compared to
DC124.
When FPS1 and GPD2 which encode glycerol
export channel protein Fps1p and one of the two
isoenzymes for yeast NAD+-dependent glycerol-3phosphate dehydrogenase Gpd2p of S. cerevisiae, respectively, were knocked-out, and glycerol biosynthesis and export were hampered. Glycerol yield might
be decreased. Glycerol is one of the main by-products
of ethanol fermentations and the decreased glycerol
yield might be useful for increasing ethanol yield. Our
investigations verified this. The ethanol yield and
glycerol yield of ZAL69 increased 9.81% and decreased 37.4%, respectively (Table 4). This suggests
that the substrate that would be used to form glycerol
has been used to produce more ethanol by deletion of
both FPS1 and GDP2. Because the two isoenzymes
for yeast NAD+-dependent glycerol-3-phosphate dehydrogenase Gpd1p and Gpd2p can substitute each
other, in the fps1∆gpd2∆ mutants (ZAL69) Gpd1p is
active, and the cells have the ability to biosynthesis
some glycerol to keep the redox balance and adapt to
the osmotic stress conditions. The increased maximum
specific growth rate of ZAL69 further more supported
this.
The ethanol yield and glycerol yield of ZAL808
increased 6.66% and decreased 41.7%, respectively.
This suggested that simultaneous over-expression of
GLT1 and GLN1 in fps1∆gpd2∆ mutant can increase
ethanol yield compared with wild type. But the ethanol yield of ZAL808 is lower than that of ZAL69. One
possibility might be that the combined effects of deletion of FPS1 and GDP2, and over-expression of
GLN1 and GLT1 of S. cerevisiae to improve ethanol
yield are not useful.
As shown in Table 4, compared with wild type,
acetic acid yield of ZAL69 and ZAL808 decreased
63.4% and 68.8%, respectively, and the pyruvic acid
yield of ZAL69 and ZAL808 decreased 61.1 % and
54%. The decrease of acetic acid and pyruvic acid
yield are the examples of a metabolic regulation by
the cells to minimize the NADH surplus when glycerol synthesis capacity is hampered. According to
metabolic flux analysis of Saccharomyces cerevisiae
[17], when glycerol yield, acetic acid yield, and pyruvic acid yield decreased, the metabolism must shift
towards ethanol. In our research, glycerol yield, acetic
acid yield, and pyruvic acid yield of ZAL69 and
ZAL808 decreased dramatically, whereas ethanol
yield of ZAL69 and ZAL808 increased 9.81% and
3.48%, which verified the metabolic flux analysis of
Nissen et al. [17].
In conclusion, our research demonstrates that
ethanol yield of ZAL69 and ZAL808 increased
13.17% and 6.66%, respectively, whereas the glycerol
yield, acetic acid yield, and pyruvic acid yield of
ZAL69 and ZAL808 decreased dramatically. The
ethanol yield of strain ZAL808 (fps1∆::LEU2
gpd2∆::URA3 PPGK1-GLT1 PPGK1-GLN1) was higher
than that of DC124, but was lower than ZAL69
625
(fps1∆::LEU2 gpd2∆::URA3). In summary, the present
study has demonstrated the proposed concept to increase the ethanol yield by minimizing glycerol yield
under microaerobic conditions through deletion both
FPS1 and GPD2 of S. cerevisiae.
REFERENCES
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
Nevoigt, E., Stahl, U., “Osmoregulation and glycerol metabolism in
the yeast Saccharomyces cerevisiae”, FEMS Microbiol. Rev., 21,
231-241 (1997).
Albertyn, J., Hohmann, S., Thevelein, J.M., Prior, B.A., “GPD1,
which encodes glycerol-3-phosphate dehydrogenase, is essential for
growth under osmotic stress in Saccharomyces cerevisiae, and its
expression is regulated by the high-osmolarity glycerol response
pathway”, Mol. Cell Biol., 6, 4135-4144 (1994).
Ansell, R., Granath, K., Homann, S., Thevelein, J.M., Adler, L.,
“The two isoenzymes for yeast NAD+-dependent glycerol-3-phosphate dehydrogenase encoded by GPD1 and GPD2 have
distinct roles in osmoadaptation and redox regulation ”, EMBO J.,
16, 2179-2187 (1997).
Eriksson, P., Andre, L., Ansell, R., Blomberg, A., Adler, L., “Cloning
and characterization of GPD2, a second gene encoding glycerol-3-phosphate dehydrogenase (NAD+) in Saccharomyces cerevisiae, and its comparison with GPD1 ”, Mol. Microbiol., 1, 95-107
(1995).
Martijn, R., Albertyn, J., Thevelein, J.M., “Different signaling pathways contribute to the control of GPD1 gene expression by osmotic
stress in Saccharomyces cerevisiae”, Microbiol., 145, 715-727 (1999).
Ohmiya, R., Yamada, H., Nakashima, K., Aiba, H., Mizuno, T.,
“Osmoregulation of fission yeast: Cloning of two distinct genes encoding glycerol-3-phosphate dehydrogenase, one of which is responsible for osmotolerance for growth”, Mol. Microbiol., 5,
963-973 (1995).
Remize, F., Barnavon, L., Dequin, S., “Glycerol export and glycerol-3-phosphate dehydrogenase, but not glycerol phosphatase, are
rate limiting for glycerol production in Saccharomyces cerevisiae ”,
Metab. Eng., 3, 301-312 (2001).
Nissen, T.L., Kielland-Brandt, M.C., Nielsen, J., Villadsen, J., “Optimization of ethanol production in Saccharomyces cerevisiae by
metabolic engineering of the ammonium assimilation”, Metab. Eng.,
2, 69-77 (2000).
Bakker, B.M., Overkamp, K.M., van Maris, A.J., Kötter, P., Luttik,
M.A., van Dijken, J.P., Pronk, J.T., “Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae”,
FEMS Microbiol. Rev., 25, 15-37 (2001).
Nissen, T.L., Hamann, C.W., Kielland-Brandt, M.C., Nielsen, J.,
Villadsen, J., “Anaerobic and aerobic batch cultivations of Saccharomyces cerevisiae mutants impaired in glycerol synthesis”,
Yeast, 16, 463-474 (2000).
Valadi, H., Larsson, C., Gustafsson, L., “Improved ethanol production by glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae”, Appl. Microbiol. Biotechnol., 4, 434-439 (1998).
Zhang, A., Kong, Q., Cao, L., Chen, X., “Effect of FPS1 deletion on
the fermentation properties of Saccharomyces cerevisiae”, Lett. Appl.
Microbiol., 44 (2), 212-217 (2007).
Burke, D., Dawson, D., Stearns, T., Methods in Yeast Genetics: A
Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor
Laboratory Press, New York, 174 (2000).
Gietz, R.D., Sugino, A., “New yeast Escherichia coli shuttle vectors
constructed with in vitro mutagenized yeast genes lacking six-base
pair restriction sites”, Gene, 74, 525-534 (1988).
Sambrook, J., Fritsch, E.F., Maniatis, T., Molecular Cloning: A
Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory
Press, New York (1989).
Kong, Q.X., Cao, L.M., Zhang, A.L., Chen, X., “Overexpressing
GLT1 in gpd1Δ mutant to improve the production of ethanol of Saccharomyces cerevisiae”, Appl. Microbiol. Biotechnol., 73,
1382-1386 (2007).
Nissen, T.L., Schulze, U., Nielsen, J., Villandsen, J., “Flux distributions in anaerobic, glucose-limited continuous cultures of Saccharomyces cerevisiae”, Microbiol., 143, 203-218 (1997).