Supplementary information Table S1. Oligonucleotides used Primer Name Sequence 5’ to 3’* pf AIM1 CACCTCTCAGTGATAAAGGAT pr AIM1 TGCACCACTCAGTCTTTCA pfAIM1 SNP CACCTCTCAGTGATAAAGGATAAGTT G4AIM1 CGGGGGGGATGGGGGGTGGTAGGG BSpf AIM1 all AAAGTTATTTGAAAGTTAATGTTATGG BSpr AIM1 all AAAAGTAACTAATAACAACCAACATCT BSpf2 AIM1 CG ATAAAGGATAGGTTTTTAGGTCG pfBLCAP TTGCAGGATGAGACAGGCAG prBLCAP TCAGCCTATCACCCCAGACA pfBLCAP SNP TTGCAGGATGAGACAGGCAGAACC G4BLCAP GGGGAGGTGGGGGGACGTGGGGGTGAGGGG BSpf BLCAP all TTGTAGGATGAGATAGGTAGAGT BSpr BLCAP all ATACTTCCTTTCCAAACCATTA BSpf2 BLCAP CG TTGTAGGATGAGATAGGTAGAGTCG pfBLCAP (B) CAACGTGTCTCTGGGGCATA Experimental use Template Mixing Template Mixing and Sequencing Primer Mutagenesis CD Spectroscopy Bisulfite PCR amplification Bisulfite PCR amplification Bisulfite methylation specific PCR amplification Template Mixing Template Mixing and Sequencing Primer Mutagenesis CD Spectroscopy Bisulfite PCR amplification Bisulfite PCR amplification Bisulfite methylation specific PCR amplification Template Mixing pr BLCAP (B) TCGGGGAGCAGGTTTGCTGT Template Mixing and Sequencing pfBLCAP (B) SNP CAACGTGTCTCTGGGGCATATAAAGGA Primer Mutagenesis G4BLCAPB GGGGGGTGGGGGCGGTGGGGGGGGG CD Spectroscopy BSpf BLCAP (B) GGGTATATAGAGGAAGTTAGAGGTTAT Bisulfite PCR amplification all CCATTTACTAGATATCTATTTTGAAAT Bisulfite PCR amplification BSpr BLCAP (B) GTATATAGAGGAAGTTAGAGGTTATCG Bisulfite methylation specific all PCR amplification BSpf2 BLCAP (B) CG Template Mixing pfDNMT1 GGCAGAAGTCCTTCCTTCCC prDNMT1 AGCCTCATTCCCATCAAGTAGC pfDNMT1 SNP** GGCAGAAGTCCTTCCTTCCCAAAT G4DNMT1 CGGGGGCTGGGGGCTGAGGGCCGGTTGGG BSpfDNMT1all GTAGGTGTTTGAGATTTATGTT BSprDNMT1all AACATTTCTATCACTCAAATATTA BSpf2DNMT1CG TATTTGGATAGTGGGGTCG pfDNMT1 (B) ACAGTGGGTCGTTTCTTCCC Template Mixing prDNMT1 (B) TTCAGTAAGGGATGGCTGGC Template Mixing and Sequencing pfDNMT1 (B) SNP ACAGTGGGTCGTTTCTTCCCTATGTCT Primer Mutagenesis G4DNMT1B GGGCCCTGGGGCTGGGGCGGG CD Spectroscopy Template Mixing and Sequencing Primer Mutagenesis CD Spectroscopy Bisulfite PCR amplification Bisulfite PCR amplification Bisulfite methylation specific PCR amplification BSpfDNMT1 (B) all TGATAATATTTGTGAGGGGTTTT Bisulfite PCR amplification BSprDNMT1 (B) all CTATACCATTAAACCCTACCTTCA Bisulfite PCR amplification BSpf2DNMT1 (B) TGATAATATTTGTGAGGGGTTTTCG Bisulfite methylation specific CG PCR amplification pfGRB10 GTTTGGGAAACTGCCTGCAG prGRB10 GCAACAGATGAGAACAGTGG pfGRB10 SNP GTTTGGGAAACTGCCTGCAGAAAG G4GRB10 GGGTGGGGGAGGGCTGGG BSpf GRB10all TAGTTTATATGTTTATTTGTAGATTTAG BSpr GRB10all ATCAACTTTAAACATTACAAATATAC BSpf2 GRB10CG TAGTTTATATGTTTATTTGTAGATTTAGCG pfKCNQ1 CCTGGCTTCGGTCCCCTGGA prKCNQ1 GCAGTGCCCAGCACAGGGAG pfKCNQ1 SNP CCTGGCTTCGGTCCCCTGGACTGG G4KCNQ1 CGGGGACTGGGGCTGGGGCTGGGG BSpf KCNQ1all TGTTTTTGGTGTAGGTGG BSpr KCNQ1all CCTAAACACCCACAAACCT BSpf2 KCNQ1CG TTTTTGGTGTAGGTGGCG pfPLAGL1 AGAGCAAACTCGGCAGGCGG Template Mixing Template Mixing and Sequencing Primer Mutagenesis CD Spectroscopy Bisulfite PCR amplification Bisulfite PCR amplification Bisulfite methylation specific PCR amplification Template Mixing Template Mixing and Sequencing Primer Mutagenesis CD Spectroscopy Bisulfite PCR amplification Bisulfite PCR amplification Bisulfite methylation specific PCR amplification Template Mixing prPLAGL1 AGAGCAAACTCGGCAGGCGG Template Mixing and Sequencing pfPLAGL1 SNP AGAGCAAACTCGGCAGGCGGATTA Primer Mutagenesis G4PLAGL1 GGGGTTGGGGGAAAGGGGTTTGGG CD Spectroscopy PLAGL1Fa CCATAAGAGACGAAAGTGCAAACA PCR amplification genomic DNA PLAGL1Ra CGAGGAGGGTGTGCCTTTG PCR amplification genomic DNA G4PLAGL1a GGGGCTGCCTGGGTTGCGGGTGACGATCTGCGGGG CD Spectroscopy of genomic G4a G4PLAGL1b CGGGTCCGGGCTCCGCGGGGCCGGGTGCGGG CD Spectroscopy of genomic G4b BSpf PLAGL1all ATAGATTATGATATTTAGTAGAGTAAACT Bisulfite PCR amplification BSpr PLAGL1all CAAATACCCCTCACCATCCT Bisulfite PCR amplification BSpf2 PLAGL1 ATAGATTATGATATTTAGTAGAGTAAACTCG Bisulfite methylation specific PCR amplification *Bold nucleotides indicate guanines predicted by QGRS Mapper to contribute towards G4 formation. **Underlined nucleotides denote the position of the artificial SNP introduced by primer mutagenesis Figure S1. DNA sequences of PCR amplicons used in template mixing experiments. Horizontal black arrows represent the forward and reverse primers used for amplification. The longer forward arrow represents the primer used during primer mutagenesis. The single nucleotide above the vertical black arrows represents the nucleotide substituted during primer mutagenesis. Underlined bases represent CpG dinucleotides which can be potentially methylated using M. SssI. Bold bases represent the G4 forming motifs. Black box indicates the recognition sequence for HpaII/MspI , used for assessing successful methylation. 23 Figure S2. Example of primer combinations used for primer mutagenesis and amplification. The pfAIM1 SNP primer (purple) was used to generate a synthetic template containing an “A” allele (yellow) at the 23rd nt in place of a “G”. The alternative template was generated using pfAIM1 primer (green), and consisted of the wild-type “G” containing sequence. Reamplification during the subsequent mixing experiments was performed using the pfAIM1 primer, and a common reverse primer (Supplementary Table 1.). Genotyping of products was performed by Sanger sequencing with the reverse primer. Figure S3. Genomic DNA sequences of PLAGL1 used to demonstrate ADO in genomic DNA Horizontal black arrows represent the forward and reverse primers used for amplification. Bold bases represent the G4 forming motifs. A B Figure S4. CD spectra of PLAGL1 G4 from genomic DNA at 20oC and 95oC. (A) G4PLAGL1a (B) G4PLAGL1b. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. Solid lines represent CD spectra in the presence of 10 mM Tris-HCl 50 mM KCl and 1.5 mM MgCl2, and the dashed lines represent CD spectra in 10 mM Tris-HCl and 1.5 mM MgCl2. DNA sequences of G4PLAGL1a and G4PLAGL1b are shown in Supplementary Figure 2 and Supplementary Table 1. 12 10 8 6 4 2 0 -2 -4 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -6 Figure S5. CD spectra of AIM1 G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 12 10 8 6 4 2 0 -2 -4 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -6 Figure S6. CD spectra of BLCAP G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 12 10 8 6 4 2 0 -2 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -4 Figure S7. CD spectra of BLCAP (B) G4 at 20oC and 95oC Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 8 6 4 2 0 -2 -4 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -6 Figure S8. CD spectra of DNMT1 G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 10 8 6 4 2 0 -2 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -4 Figure S9. CD spectra of DNMT1 (B) G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 12 10 8 6 4 2 0 -2 -4 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -6 Figure S10. CD spectra of GRB10 G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 7 6 5 4 3 2 1 0 -1 -2 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -3 Figure S11. CD spectra of KCNQ1 G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis. 10 8 6 4 2 0 -2 -4 320 315 310 305 300 295 290 285 280 275 270 265 260 255 250 245 240 235 230 225 220 215 210 205 200 -6 Figure S12. CD spectra of PLAGL1 G4 at 20oC and 95oC. Spectral profiles obtained at 20oC (grey lines) and 95oC (black lines), in PCR buffer. Samples analysed in 10 mM Tris-HCl, 50 mM KCl and 1.5 mM MgCl2 are represented by solid lines and samples analysed in 10 mM Tris-HCl and 1.5 mM MgCl2 are represented by dashed lines. Molar ellipticity (x105 deg.cm2.dmol-1) is on the vertical axis and wavelength (nm) is on the horizontal axis.
© Copyright 2026 Paperzz