4246-4254
Nucleic Acids Research, 1995, Vol. 23, No. 21
© 1995 Oxford University Press
Only one of four possible secondary structures of the
central conserved region of potato spindle tuber
viroid is a substrate for processing in a potato
nuclear extract
Tilman Baumstark and Detlev Riesner*
Institut fur Physikalische Biologie, Heinrich-Heine-Universitat Dusseldorf, Universitatsstrasse 1, 40225 Dusseldorf,
Germany
Received September 6, 1995; Revised and Accepted September 19, 1995
ABSTRACT
The influence of RNA secondary structure on the
substrate activity of a longer-than-unit length transcript for processing to circular vlroids was studied in
a nuclear extract from potato suspension cells. The
nuclear extract was prepared according to a modified
procedure for a plant transcription extract. The transcript of the potato spindle tuber viroid (PSTVd)
consists of a monomeric molecule with 17 additional
nucleotides, thus doubling most of the central conserved region of vlroids of the PSTVd-class. The
transcript can assume four different secondary structures, which either co-exist as conformers in solution
or can be kept as metastable structures after different
treatments by temperature and/or ionic strength. The
structures were analysed by thermodynamic calculations and temperature-gradient gel electrophoresis
and were confirmed by oligonucleotide mapping. Only
the so-called extended middle structure was processed to exact viroid circles. In this structure the
5-and 3-ends are branching out from the rod-like
viroid structure at the loop starting with nucleotide 87.
The other structures were processed only if they could
be rearranged into the active structure.
INTRODUCTION
Viroids are plant pathogens distinguished from viruses by the
absence of a protein coat and by their small size. They are circular,
single-stranded RNA molecules consisting of a few hundred
nucleotides, ranging from 240 to 600 nucleotides. There is no
evidence for any viroid-encoded translation product. Thus viroid
replication and pathogenesis entirely depend on the host enzyme
systems (reviewed in refs 1—4). Current models of viroid
replication assume different types of rolling circle mechanisms
(5,6). As the final step the oligomeric (+) strand RNA has to be
cleaved to unit-length molecules, which are then ligated to the
mature viroid circles. For this cleavage-ligation reaction different
viroid species use different mechanisms: Two special viroids,
* To whom correspondence should be addressed
ASBVd and PLMVd, contain the hammerhead-ribozyme sequences (7) and self-cleave in vitro (8,9). For all other viroids
self-cleavage or self-ligation could not be found in spite of
repeated attempts (e.g. 10). Although the majority of viroids does
not contain a self-cleaving structural element, one has to expect
particular structural features that are responsible for specific
interactions with host enzymes. The structure and structural
transitions of viroids and in particular of PSTVd, which is the
viroid of interest in this study, have been described in detail
(reviewed in refs 11-14). During thermal denaturation, viroids
undergo a highly co-operative main transition, in which all base
pairs of the native structure are disrupted and well defined
segments form stable hairpins. Several reports indicated that the
region containing one of these hairpins, called HP 1(15), may be
involved in the processing of oligomeric (+) strand intermediates
to mature circles. HP I is formed in a region central of the native
viroid structure, that shows a strong sequence homology within
a large group of viroids, which is therefore called the PSTVd
class; the segment of homology was designated Central Conserved Region (CCR), upper CCR (UCCR) in the upper part of
the native structure and lower CCR (LCCR) in the lower part. A
long series of infectivity studies using RNA transcripts of
different cloned viroids revealed that longer-than-unit length
transcripts are infectious, which start and end with the UCCR
(16-20). Especially short repeats of 8-11 nt of the UCCR resulted
in highly infectious RNA (21). From these findings it was
concluded, that the processing of viroids proceeds within this
region with the UCCR folding into a highly base paired, G:C rich
and extremely stable secondary structure (17,22-24). In other
studies it was demonstrated that certain viroid RNAs may also be
processed, yet with lower efficiency, at alternative sites located
outside the CCR (20,25,26). Furthermore naturally occuring
linear viroid molecules as well as certain in vitro transcripts of
exact monomeric length with varying 5'- or 3'-phosphates are
infectious (27-29), which is probably due to the fact that these
molecules are ligated to circles by RNA ligases present in the
plant (30,31) without any prior cleavage step.
In order to investigate the mechanism of processing within the
UCCR, we previously used purified RNase Tl from Aspergillus
oryzxie, an enzyme that catalyses the complete cleavage-ligation
Nucleic Acids Research, 1995, Vol. 23, No. 21 4247
reaction of longer-than-unit length RNA transcripts to mature
viroid circles in vitro as found by Tsagris and co-workers
(26,32,33). Biophysical, biochemical and infectivity studies in
this system demonstrated that the substrate RNA transcript could
assume different conformations and that only an extended,
rod-like conformation, where the duplications at the 5'- and
3'-end are branching out in the middle of the CCR were accurately
processed and ligated to circular molecules (34).
In the work presented here our first aim was to advance from
the heterologous non-host system of RNase Tl to the homologous
host plant enzymes in a cell-free system. A nuclear extract from
non-infected potato suspension cells was adapted from a protocol
developed for in vitro transcription of plant promotors (35). The
viroid RNA transcript used in this study was shorter than that
applied previously to facilitate the biophysical interpretation but
still sufficiently long that it was cleaved at both ends by the
nuclear extract's enzymes and then ligated to correct viroid
circles. As our second aim we elucidated the different structures
adopted by this RNA and their interconversions using a new
combination of temperature-gradient gel electrophoresis (TGGE)
and oligonucleotide mapping. Finally we analysed the activity of
the different structures as substrate for processing in the nuclear
extract and found that only one of four possible structures was the
active substrate.
MATERIALS AND METHODS
Buffers
For nuclear extract preparation the buffer OSB (20 mM
HEPES-KOH, pH 7.9, 10 mM Mg-acetate, 50 mM K-acetate, 5
mM EDTA, 12 mM 6-mercaptoethanol, 25% glycerol), for
TGGE TBE-buffer (1 x TBE = 89 mM Tris, 89 mM boris acid,
2 mM EDTA), for renaturation of RNA in high ionic strength
buffer 500/4/1/0.1 (500 mM NaCl, 4 M urea, 1 mM K-cacodylate,
0.1 mM EDTA, pH 7.9) or in low ionic strength TE (10 mM
Tris-HCl, pH 8.0, 1 mM EDTA), respectively, were used.
Synthesis and properties of the viroid-specific RNA
transcript TB110
For the cloning of a longer-than-unit length PSTVd transcription
vector, the plasmid pRH701 carrying a T7 (<&10) promotor (36)
directly upstream of a StuUEcoRl excisable cassette (24) was
used. A synthetic 16 bp oligonucleotide DNA linker, corresponding to PSTVd sequence 81-96 (numbering is given according to
ref. 11) with a four-nucleotide EcoRl 3'-overhang and an internal
Bam\\\ site was cloned into the StuVEcoRl cleaved vector to yield
plasmid pTBlO. Insertion of a BamHl monomeric cDNA of
PSTVd, strain KF 440-2 (37), in (+) orientation into the unique
BamH\ site of pTBlO within the PSTVd-specific linker resulted
in plasmid pTB 110. Linearization of pTB 110 with £coRI and in
vitro transcription with T7 RNA polymerase yields RNA
molecules of 381 nt length, consisting of a 5' vector-derived pppG
followed by a 376 nt PSTVd-specific sequence starting with G80
and ending with G96 in (+) orientation and the vector-derived
nucleotides AAUU at the 3'-end (cf. Fig. 3).
DNA and RNA oligonudeotides
For RT-PCR following DNA primers were used: TB1, complementary to PSTVd sequence 171-147, (5TTTCGGCGGGAAT-
TACTCCTGTCGG3'); TB2, sequence of PSTVd 20-42,
(5'CCTGTGGTTCACACCTGACCTCC3'); RNA oligonucleotides 3'-oligo (5'GGUUCCGGGGAAACCUGGAGCGUCCU3')
and 5'-oligo (5'GUUUCCCCGGGGAAACCUGGAGCC3')
were synthesized as in vitro transcripts from DNA oligonucleotide templates with upstream located T7 promotor as published
(38). The internal oligo complementary to PSTVd 303-284
(5'GAGAAAAAGCGGUUCUCGGG3'), was synthesized on a
nucleic acid synthesizer (model 381 A, Applied Biosystems)
using 2'-O-Fpmp-RNA-CE-Phosphoramidites (MWG Biotech).
Apart from the primers used for RT-PCR, oligonudeotides were
gel-purified before use.
Enzymes and enzymatic reactions
Restriction enzymes and T4 Polynucleotidekinase for the 5'-labeling of synthetic oligonudeotides with [y-32P] ATP were used
according to the manufacturer (Boehringer Mannheim, Germany) and standard protocols (39). T7 RNA Polymerase was
purified and used for in vitro synthesis of transcripts according to
the literature (40,41); transcripts were labeled internally by
addition of [a-32P]UTP to the transcription mixture. For RT-PCR
of circular products from the processing reaction, the RNA was
eluted from a highresolutiondenaturing gel as described by Krupp
(42) and ethanol-precipitated. The RNA was re-dissolved in 30
\x\ of 100 mM NaCl, 50 mM Tris-HCl, pH 8.3, 1 mM EDTA,
annealed with 50 pmol of primer TB1 by heating to 80-90°C for
10 min and then cooled to room temperature slowly over 2-3 h.
After ethanol precipitation pellets were dissolved in 20 fxl first
strand buffer (BRL) containing additionally 10 mM DTT, 0.5 mM
dNTP and 200 U of reverse transcriptase (Superscript II, BRL)
and incubated at 48 °C for 1 h; the reaction was stopped by raising
the temperature to 90°C for 10 min and transferring the sample
to ice. For PCR amplification, the RT-mix was adjusted to 20 mM
Tris-HCl, pH 9.0, 50 mM KC1, 1.5 mM MgCl2, 0.1% Triton
X-100, 1 |xM each of primer TB 1 and TB2, 200 |iM dNTP and
2.5 U Taq DNA polymerase (Promega) in a final volume of 100
Hi. After 3 min denaturation at 94°C, 30 cycles (94,60, 72°C for
60 s each) of amplification were carried out with a final 10 min
elongation step at 72°C. PCR products were purified and desalted
with disposable spin columns (QIAquick spin, Qiagen) and eluted
in 100 (il TE buffer. Sequencing of both strands was performed
with 3-5 \i\ of PCR products (30 ng, 0.3 pmol), 40 pmol primer
TB1 or TB2, respectively, appropriate [a-32P]-desoxytriphosphates and Sequenase 2.0 (USB) as published (43).
Calculation of secondary structures
The calculation of RNA secondary structures and structural
transitions was carried out on a DECstation 3800 (Digital
Equipment) using the algorithm LinAII published previously
(44). AG° values are obtained for 1 M ionic strength and 1 M of
each RNA species. RT-PCR primers were chosen according to
calculations using a program developed recently (45).
Temperature-gradient gel electrophoresis
Temperature-gradient gel electrophoresis (46,47) was carried out
on a commercially available instrument (Qiagen TGGE System,
Qiagen, Hilden, Germany). Gels contained 5% (w/v) polyacrylamide, 0.17% (w/v) bisacrylamide, 0.1% (v/v) TEMED, 0.2 x
TBE and 0.04% ammonium peroxodisulphate for starting the
4248 Nucleic Acids Research, 1995, Vol. 23, No. 21
polymerisation. The RNA sample was applied to the broad
sample slot (130 x 4 mm), while small slots ( 5 x 4 mm) at both
sides were used for appropriate marker RNA. Upon applying 500
V and a uniform temperature of 15°C for 10 min the RNA
migrates into the gel matrix for a few mm. Electrophoresis is
paused 10-15 min for the equilibration of the 20-60°C gradient
and continued for 1.5 h at 500 V. Gels were stained with silver
(48) and/or exposed to X-ray film (Kodak Xomat AR). Tm values
of PSTVd structural transitions observed in TGGE (0.2 x TBE)
are 33°C lower than in the calculations (I M ionic strength) and
18°C lower than those in structure probing experiments
(500/4/1/0.1 buffer) (23,34).
5 mM DTT, 8 mM MgC^ and between 4 x 104 and 2 x 105 c.p.m.
32
P-labeled viroid RNA transcripts. The reaction was stopped by
addition of 150 ul stopmix (27 mM EDTA, 0.5% SDS) and
extraction with phenol, phenol-chloroform and chloroform. The
processing products were finally precipitated with ethanol and
dissolved in formamide-urea loading solution for analysis on
denaturing gels (39 cm long, 0.4 mm strong) containing 5%
polyacrylamide, 0.17% bisacrylamide, 0.1 % TEMED, 8 M urea,
0.4 x TBE and 0.04% ammonium peroxodisulphate for starting
the polymerisation. After power-controlled electrophoresis in 0.4
x TBE at 55-6O°C measured at the outside of the glassplates, gels
were exposed to X-ray film (Fuji New-RX; Kodak Xomat AR).
Preparation of nuclei and nuclear extracts
RESULTS
The protocol is based on the procedure published by Roberts and
Okita (35). Solanum tuberosum dihaploid stock HH258 (49)
suspension cultures (50) were grown at 24°C in 200 ml medium
and harvested 4 days post subculture into fresh medium by draining
and washing with 150 ml of plasmolysation buffer PB (0.4 M
mannitol, 50 mM K+citrate, adjusted to pH 5.8 with citric acid)
(51). Forty gram cells (fresh weight) were plasmolysed for 1 h at
24°C in 200 ml PB, then drained again. Cells were converted to
protoplasts in 150 ml of PB containing 1% (w/v) cellulase
Onozuka R10 (Serva) and 0.1% (w/v) pectolyase Y23 (Seishin
Pharmaceuticals) within 1.5-2 h at 29°C. Protoplasts were
collected by centrifugation for 5 min at 210 g and washed three
times with 50 ml PB. After thefinalcentrifugation protoplasts were
suspended in 50 ml ice cold lysis buffer L l ? (20 mM MES-KOH,
pH 5.8,20 mM K-acetate, 15% Ficoll 400,0.15 mM spermine, 0.5
mM spermidine, 10 mM P-mercaptoethanol, 0.5 mM PMSF, 0.6
(iM leupeptin, 0.15 (xM pepstatin) and mechanically disrupted on
ice by 3-5 strokes in a glass homogenizer with a pestil S. The
homogenate was filtered through 140 |im and 40 urn steel sieves
and the filtrate was divided into 2 x (22-24 ml) sample. Each was
layered onto a two-step gradient consisting of 10 ml cushion buffer
E [87.6% (v/v) percoll, 0.62 x L (L = L1* minus Ficoll)] overlaid
with 25 ml lysis buffer L 18 (= L15, but with 18% instead of 15%
Ficoll 400), all ice cold. After centrifugation for 1 h at 4°C and
4000 g, nuclei floating at the interphase between E and L 18 were
carefully collected with a turned-around 10 ml glass pipette and
pooled on ice. An amount of 1.5 vol of buffer L was added, gently
mixed and the mixture centrifuged for 20 min at 4°C and 1400 g.
The pelleted nuclei were suspended carefully in 2 ml of nuclear
resuspension buffer NRB (1 x L containing additionally 50% (v/v)
glycerol and 0.12% (v/v) N? 40). The nuclei, typically 1-3 x 108,
were quick-frozen in liquid nitrogen and could be stored at -70°C
for up to 1 year. For preparation of nuclear extracts the protocol of
Roberts and Okita (35) was modified only in respect to the two
centrifugation steps, which were performed for 1 h at 154 000 g,
4°C, in a SW-40 rotor (step 1) and for 30 min at 83 000 g, 4°C,
in a SW-28 rotor (step 2). From > 108 nuclei 20-23 aliquots of 55 uJ
each could be obtained as a nuclear extract with a protein
concentration of typically 3-A mg/ml, keeping its processing
activity at -70 °C for 6-8 months.
The longer-than-unit length transcript TB110 is correctly
processed to PSTVd cirdes in a nudear extract from
potato suspension cells
Processing reaction
Standard processing reactions of RNA substrates were performed
in a 50 (il vol at 30°C for varying times (cf. figure legends). They
contained 10 (il of nuclear extract, thawed on ice and, in addition
to the buffer components (OSB) therein, 50 mM HEPES, pH 7.9,
A nuclear extract from healthy potato cells for viroid processing
had been published before (52). We used this extract for our initial
experiments. The RNA substrates were the dimeric (+)-strand
PSTVd transcripts RH717 and RH719 starting at position 282 or
147, respectively (24,53), and the new transcript TB110 described in Materials and Methods with its 17 nt duplication from
position 80 to 96 (cf. Fig. 3). Despite the fact that these substrates
were infectious when inoculated to plants, none of them in
different conformations was processed by this extract; not even
specific cleavage activity was detectable.
A modified preparation procedure was established based on an
in vitro transcription extract published earlier (35). It differs from
that of Tsagris and colleagues (52) in four points we consider
important: (i) nuclei are prepared in highly viscous media and in
the absence of detergents like NP40 until final storage; (ii) nuclei
are disrupted osmotically instead of mechanically and at a higher
ionic strength; (iii) the nuclear matrix is removed by enforced
centrifugation and soluble proteins are precipitated by ammonium
sulphate; (iv) the extract was not cleared by a final centrifugation
step after dialysis or before performing a processing reaction.
The new nuclear extract was active in viroid processing, as
shown in Figure 1. With increasing incubation time the 381 nt
transcript TB110 is cleaved first to form linear molecules L| —4—8
nt shorter (left panel, lanes 2,3). Subsequently, the intensity of L|
decreases, while a second RNA species L2 of about PSTVd unit
length accumulates, which seems to be rather resistant to nuclease
attack (lanes 3,4). Long exposure of the gel (right panel) shows that
two circular products appear after 10 min incubation (lane 2),
which can be identified by their drastic retardation under
denaturing gel conditions. The faster migrating circle accumulated
to much higher amounts as compared to the slower species (lanes
2-4). In other experiments it was found co-migrating with natural
cPSTVd (not shown) and was designated C359. RT-PCR amplification and sequencing revealed that it is the wildtype circular viroid
without insertions or deletions (data not shown). The larger circles
Ca are the product of an aberrant processing reaction. They were
found similarly already in the processing reaction by RNase TI but
are of no further interest here. Other monomeric constructs with
different duplications and dimeric constructs with the same
duplication as TBU0 were processed to circles of the correct
length, but our further studies concentrated completely on
transcript TB110; also the RNA transcript Ha 106 used in the earlier
work, was processed to correct circles (data not shown).
Nucleic Acids Research, 1995. Vol. 23, No. 21 4249
M
M 12 3 4 5 6 7
2 3 4
slot-
M 1 2 3 4 5 6 7 C^ZZ
Figure 1. Processing of transcripl TB110 with ihe nuclear extract. The products
of the processing reaction were analysed on a 5% PAA denaturing gel after 24 h
exposure to show the linear products (left panel; Fuji film New-RX) and 7 day
exposure to show the circular products (right panel; KodakfilmXomat AR with
intensifying screen). 2.8 x I0 4 c.p.m. labeled transcript TBIIO pretrcated
according to procedure I in Table I were incubated with the nuclear extract for
10 min (lanes 2), 45 min (lanes 3) or 90 min (lanes 4). The control in lanes 1
consisted of a mock processing rrux with buffer OSB instead of nuclear extract,
which was not incubated but stopped immediately and then treated identically
to the other samples. Lanes M contain labeled Hind restriction fragments of
pBR 322 as size markers (1631, 517, 506/501, 396, 344 and 298 nt). The
fullength transcript TB 110 (FL), the linear processing intermediates (L|, LT)
and the correct (C359) and aberrant (CJ circular products, respectively, are
indicated by arrows.
The enzymatic activities involved in the processing reaction were
characterised to some extent by their dependence upon Mg 2 + and
RNase inhibitors (Fig. 2). Compared to the standard processing
reaction mix containing 10 mM Mg 2+ , where circular and linear
products accumulate (lanes 2), a nuclear extract reaction mix with
10 mM EDTA added is inactive in yielding specific circular or linear
processing products (lanes 3). Instead, a high unspecific degradation
of the substrate RNA into oligonucleotides is observed, apparently
by Mg2+-independent nucleases in the extract Addition of 200 U of
placental RNase inhibitor (RNasinR, Promega), which is known to
inhibit the activity of RNase A, B and C, does not change this result
Neither the processing activity in the presence of Mg 2 + nor the
nucleases active in the absence of Mg 2 + are inhibited (lanes 4,5). hi
the presence of 20 mM ribonucleotide-vanadylate-complex both
unspecific degradation and specific cleavage-ligation are efficiently
inhibited independent of Mg 2 + (lanes 6, 7); the RNA pattern is
identical to that of the control (lane 1).
Transcript TB110 can assume four different structures
The optimal and suboptimal secondary structures of transcript
TBI10 as calculated with the program LinAll were obtained
Figure 2. Influence of magnesium-ions and of RNase inhibitors on the
processing reaction. Gel analysis after short exposure for 2 h Oeft panel) and
long exposure for 2 day (right panel) with size markers in lanes M and controls
in lanes 1 was identical to that of Figure 1. The processing reaction of 4 x 105
c.p.m. transcript pretreated identically to the experiment in Figure 1 was
performed for 60 min under the following conditions: No inhibitor (lanes 2 and
3); in the presence of 4000 U/ml placental RNase inhibitor RNasin (lanes 4 and
5); in the presence of 20 mMribonucleotide-vanadylate-complex(lanes 6 and
7). The reaction mix contained 10 mM Mg 2+ (lanes 2,4 and 6) or 10 mM EDTA
(lanes 3, 5 and 7). Designation of fullength substrate, linear intermediates and
circular products are identical to Figure 1.
similar to those discussed in our earlier study with RNase T1 (34).
Figure 3 depicts the transcript in four principally different
structures and one variation. Only the central segments with the
characteristic differences are depicted, because the left (nt 317-43)
and right (nt 126-235) termini are in all cases in the rod-like
structure as known from native PSTVd (cf. ref. 11; also shown as
insertions in Fig. 4B and C). The 'tri-helical' structure (TriH)
contains only two of the three stable helices which were possible
in the longer transcript of our former study. With a AG° value for
structure formation of-421.8 kJ/mol, the structure TriH is less
favourable than the extended middle structure ExM (AG°=
-434.5 kJ/mol) but more favourable than the extended left
structure ExL (AG°= ^14.4 kJ/mol). The conformation ExM is
predicted to be most favourable. It contains basepairs in addition
to the unit length rod-like structure by forming a bifurcating helix
involving the 5'- and 3'-terminal sequences. The duplicated
sequence is single stranded at the 3'-end in the structure ExL. An
extended right conformation ExR (AG° = -399.3 kJ/mol) with
single-stranded 5'-sequence is less favourable in the transcript
TB 110. It may be stabilised, however, in a complex with the RNA
5'-oligonucleotide as depicted in Figure 3. Similarly, an increased
stability can be achieved for ExL in a complex with the RNA
3'-oligonucleotide. The oligonucleotides are not perfectly com-
4250 Nucleic Acids Research, 1995, Vol. 23, No. 21
UVAA
gCUAOOOACUlX
-jii
fit-"
1MH
«
J
«
»niuce iul «Mcc | .
A«A
^c^uuucc-
ExL
I
A***°****A
A 0 ,- '
«aA
IoA**c
A*«
A*A
'
-•ACAA*
AOAAoacao cucaa
MCUUCA*
UCC cca«a
CIMSA&C« (Mac
AAAM-
. juiuic " *
2
|uuuliuc»citli»»ccV. UOBAAOUC
«»« oogcc
*ACAA
"
c
Aa *
A
oicuuooc
COM
IW<«<
B
•OUUCA« *uce CCM
/
cucW
r
I
«*CUUCA«
Quoj ui
UCAU C
I
m
AA
wui>ccccaaoaA*A*AAccuoQAQcc
ccu
euaa**c« u**c *****
a**
u
Figure 3. Sequence and secondary structures of transcript TB 110. The central
section (in blue) of the 381 nt RNA transcript TB 110 is shown in five different
structures for 40°C. The duplicated sequence between nucleotides 80 and 96
(dark red) is part of the Central Conserved Region (CCR) given in pink and red.
Numbering is used according to ref. 11; terminal parts of the molecule that are
identical to circular PSTVd (see alsoref.11) are represented by black lines left
and right. The tri-helical structure (TriH) is designated according to earlier
studies on a longer transcript (34) although it contains only two of the three
stable helices. The extended left (ExL), extended middle (ExM) and extended
right structure (ExR) are named according to the position of the segments
branching out from the native rod-like secondary structure. In ExL the segment
complementary to the internal oligonucleotide (see text) is boxed. The structure
ExR is stable only as a hybrid with the 5'-oligonucleoo'de (ExR5'0'"*0); the
structure ExL3 "'•B0 represents a hybrid of ExL with the 3'-oligonucleotide.
Vector-derived nucleotides at the 5'- and 3'-end as well as sequences of the 5'and 3'-oligonucleon'de arc given in black. Dashed lines represent phosphodiester bonds for graphical reasons.
plementary to TB 110, but simulate structural elements present in
a larger oligomeric intermediate (14).
The structure prediction was confirmed by TGGE. Figure 4A
presents the analysis of the structures formed by the transcript
TB110 after slow renaturation. The assignment of the transition
curves to the structures could be carried out as described (34), since
the curves in Figure 4 are qualitatively similar to those determined
for the longer transcript in the earlier study. It should be noted that
the first transition of ExL is not completely reversible, so that two
curves are visible at low temperature which coincide after the first
transition. The bimolecular complexes are not shown in Figure 3,
because they are of no further interest in this work. In agreement
with its low thermodynamic probability ExR is missing. The band
intensities reflect fairly well the calculated statistical weights as
obtained from the corresponding AG° values.
The correlation of bands in TGGE with structures obtained from
calculation was confirmed further by probing the individual
secondary structures with selective oligonucleotides. The 3'-oligonucleotide, designed complementary to the 3'-end of the transcript
TB110 (cf. Fig. 3) could be bound to TB110 over a broad
temperature range (30-70°C) in high ionic strength. Analysis by
TGGE (Fig. 4B) yields the same first and second transition as
known for ExL. Since the oligonucleotide was labeled with 32P, it
could be selectively detected. The autoradiograph in the lower
panel shows that the oligonucleotide was bound to the transcript over
the whole temperature range of the conformational transitions up to
the temperature of its own dissociation at 55 °C. The autoradiographic curve proves the attribution of the transition curve to the
structure ExL. The shift of the first transition to a slightly increased
temperature in comparison to the uncomplexed structure ExL (cf.
Fig. 4A) will be discussed below.
Structure probing with the 32P-labeled RNA 5'-oligonucleotide
preferentially complementary to the 5'-end of TB110 (cf. Fig. 3)
resulted in a different behaviour. Only after annealing at temperatures above 60°C in high ionic strength a single labeled transition
curve was detected in TGGE (Fig. 4C) that displays the reversible
one-step transition characteristic for an extended right structure as
identified previously (34). This result had to be expected, since the
5'-end of the transcript is not accessible to the complementary
5'-oligonucleotide as long as it is base paired intramolecularly in
the stable structures ExL and ExM. However, above the denaturation temperatures of these structures (i.e. ~56°C in the ionic
strength used for oligonucleotide annealing) the 5'-end of TB 110
can form a stable complex with the 5'-oligonucleotide and the rest
of the transcript assumes the ExR conformation at lower temperatures. Thus, the 5'-oligonucleotide functions as a tool to efficiently
shift the structure of the transcript TB110 from a distribution of
ExL and ExM into the single structure ExR not detectable
otherwise.
In a third application of this structure probing approach with
oligonucleotides we elucidated the nature of the first transition of
ExL (cf. Fig. 4A and B). Since this transition does not contribute
significantly to a UV absorbtion change in an optical melting
curve, a small change in base pairing was expected. As only ExL
exhibited this transition at low temperature and a region within
the left half of the rod-like structure known to be of significantly
lower thermodynamic stability, the so-called premelting loop 2
(PM 2 in Fig. 3) is located closest to the opening between left and
right half in the ExL structure, we focused on thisregion.An RNA
oligonucleotide was designed complementary to the lower strand
of the two helices which close the left part of the rod-like structure
ExL (cf. internal oligo in ExL of Fig. 3). Binding of this
oligonucleotide displaces the upper strand from the 3'-end right
into the PM loop region and abolished the first transition of ExL
in a TGGE experiment (data not shown). This result demonstrates
that indeed this small segment in the structure of ExL is
Nucleic Acids Research, 1995, Vol. 23, No. 21 4251
B
20°C
Figure 4. TGGE analysis of structures formed by transcript TB110. Co-existing structures of TB110 are analysed in (A); (B) and (C) represent analysis of selected
structures ExL and ExR, respectively, by ohgonucleotide mapping. (A) structures TriH, ExL, ExM (as in Fig. 3) and bimolecular complexes BiCom (see text) are visible
as distinct bands. For attribution of the bands to the structures sec text. The slower band at high temperatures arises from the structures that are already strongly retarded
during the first 10 min of electrophoresis, that is under native conditions prior to the establishment of the temperature gradienL As markers a HPLC fraction of natural
PSTVd isolate (P) containing 7S RNA (7S) was applied at both sides of the main sample; at high temperature PSTVd is separated in circular (C) and linear (L)
molecules. 500 ng transcript TB 110 was denatured and slowly renatured over night in TE buffer, TGGE was performed and the gel stained with silver as described
in Materials and Methods. In (B) and (C) the upper panels show all structures present in silver-stained gels analogous to A, the lower panels are expositions of the
respective gel on Kodak Xomat AR X-ray film with intensifying screen (B: 5 days; C: 19 days). (B) The structure ExL 3oll 8 0 was established, when labeled
3'-oligonucleotide (9 x 10* c.p.m.) was annealed to 500 ng transcript TB 110 in 200 ul of 500/4/1/O.I buffer at 40°C and subsequently dialysed against 0.2 x TBE.
A schematic representation of the structure ExL 3 ' 01 '^ (cf. also Fig. 3) is mounted in the lower panel with the labeled 3'-oligonucleotide in thickened lines. (Q The
structure ExR 5o)i s° was established, when labeled 5'-oligonucleotide (3.3 x 105 c.p.m.) was annealed to 500 ng TB110 at 60°C in 200 ul of 500/4/1/0.1 buffer and
dialysed against 0.2 x TBE. Representation of the structure ExR5'01'*0 (cf. also Fig. 3) as in (B). In the experiments of (B) and ( Q the same markers as in (A) were
used but not depicted.
responsible for thefirsttransition in accordance with the very low
effect in UV absorption. The slight increase in the Tm value of the
first transition observed upon binding of the 3'-oligonucleotide to
the 3'-end of the transcript can be explained with a destabilising
effect of the uncomplexed 3'-end on the neighboring helices. This
may be caused by the formation of small stem-loop structures
involving the 3'-end and the upper strand of the two helices. The
second band visible only in the first transition is probably due to
a slightly different mode of oligonucleotide binding arising from
impurities of shorter oligonucleotides.
TVanscript TB110 can be folded into single structures
With TGGE as a diagnostic tool, protocols were developed to
establish single structures by employing different pre-incubation
steps, that is incubations before the consecutive processing assay
(cf. below). These treatments are based on the kinetic and
thermodynamic features of the different structures and their
transitions; they are summarised in Table 1. In all cases only the
transition curve characteristic for that specific structure was
observed in TGGE. The physical background for the formation
of defined structures by the treatments described in Table 1 shall
be briefly outlined: (i) as expected and obvious from experiments,
formation of bimolecular complexes is efficiently suppressed by
low salt and snap-cooling of low concentrated RNA. This is
clearly caused by the slow second-order kinetics combined with
the requirement of counter ions for double strand formation; (ii)
low ionic strength favours formation of extended over bulky,
bifurcated structures as represented by the tri-helical conformation.
However, the structure ExM, which appears more bulky than ExL
(cf. Fig. 3), is kinetically favoured over ExL under low salt
conditions (treatment 0. while it rearranges into ExL under high
ionic strength and moderate temperatures (treatment Ha). At
present both effects cannot be interpreted quantitatively, because
the kinetic intermediates during formation of ExM and the
thermodynamic parameters for bifurcations as present in ExM are
not well known; (iii) the two helices formed by the 3'- and 5'-ends
in the structure TriH (cf. Fig. 3) are the most stable structural
elements at elevated temperatures, that is 60°C under high salt
conditions (cf. treatment III). Upon fast decrease of the temperature
a refolding into the equilibrium structure ExL is kinetically
inhibited, whereas upon slow renaturation a partial equilibration
into three structures, that is TriH, ExL and bimolecular complexes,
occurs (not shown); (iv) in the presence of the oligonucleotides at
elevated temperature and high salt (treatment IIb,c) doublestranded segments are formed forcing the rest of the transcript at
lower temperatures into the structures possible under these
circumstances, that is ExR with 5'-oligo and ExL with 3'-oligo,
respectively.
Activity of single structures for correct processing
The five structures shown in Figure 3 were formed by the
preincubation scheme of Table 1 and incubated in a time course
with the nuclear extract. The analysis of the processing products
on denaturing gels is shown in Figure 5. Clearly the structure
ExM is the substrate structure most active in the processing
reaction and yields predominantly correct circular molecules
C359 (Fig. 5, upper panels lanes 2-4 and 22-24). The only other
structure active in formation of circles is the conformation ExL
4252 Nucleic Acids Research, 1995, Vol. 23, No. 21
M
»lot-|
1 2 3 4 5 6 7 8 M
j-
m
9 10 11 12 13 14 IS 16 17 18 19 20 21 22 23 24 M
|E
• -
fc-
•
-^•-xlot
two species were transformed into circles; the same is true for the
linear intermediates Li and L2 from ExM and ExL (not shown).
This proves that the linear products from ExR5 oU8° are indeed
potentially active intermediates, but before further processing to
circles could occur the bound oligonucleotide had to be removed
by the gel elution procedure. Thus, the structure ExR might be
active in processing, yet it is not stable in this RNA construct
without the 5'-oligonucleotide. Table 2 summerises the activities of
all substrate structures concerning formation of linear intermediates and circular products in the nuclear extract. The dependence
of processing activity upon the correct RNA structure was as
critical with dimeric transcripts as with the monomeric TB110,
although the dimeric structures were not analysed in such detail.
517-
Table 1. Pre-incubation procedures for the formation of single RNA
structures
FL-*
M 1 2 3 4 5 6 7
517-
M
*
•
-517
FL
L
-
Lj
2
298-
Treatment
9 10 11 12 13 14 15 1617 1819 20 21 22 23 24 M
Ih.if:
-
-
Low salt soap
1. RNA concentration <20 ng/nl in TE
2. 10min/90°C
3. Transferto EtOH/ice (-15°C) subsequently
keep below 4°C
Resulting structure
ExM
-2SS
High salt slow
1. Low salt snap (1-3) as above
2. Adjust to 500/4/1/0.1
Figure S. Substrate activity for processing of transcript TB110 in the different
structures. The structures shown in Figure 3 were preformed from labeled
transcript TB 110 according to the procedures in Table 1 and the RNA (1-1.5
x 105 c.p.m.) was subjected to a standard processing reaction for 10 min (lanes
2, 6, 10, 14, 18 and 22), 30 min (lanes 3, 7, 11, 15, 19 and 23), 60 min (lanes
4 and 8) or 90 min (lanes 12, 16, 20 and 24). In the case of ExL 3oli 8° and
ExR 5oll «° unlabeled oligonucleotides were used for annealing in a 70- to
90-fold molar excess over TB 110. Slopes labeled 't' in the figure head indicate
qualitatively the time course of incubation. Unprocessed controls were either
added to a mock reaction mix as described in the legend to Figure 1 (lanes l and
5) or an aliquot was taken before adding the processing extract (lanes 9, 13, 17
and 21). The analysis was carried out on 5% PAA denaturing gels and exposed
in an autoradiography (Fuji New RX) for 27 h (lower left panel) or 10 h (lower
right panel) and afterwards for 3 days (upper left panel) or 7 days (upper right
panel) (Kodak Xomat AR with intensifying screen). The first predominant
cleavage product of TriH (lane 6, lower left panel) is denoted by an open arrow.
Size markers in lanes M and designation of substrate RNA and products as in
Figure 1.
(lanes 18-20), which in contrast to ExM gives rise to mainly
aberrant larger circular molecules C a and only minor amounts of
C359. All other structures tested (lanes 6-16; see also Table 2) do
not yield detectable amounts of circular products. The formation of
linear processing intermediates as visible on short exposures of the
same gels (Fig. 5, lower panels) is more differentiated. As with the
formation of circles, also the linear intermediates L\ and L2 are
most efficiently produced from the ExM substrate, but also from
ExL. However, quite different linear RNA molecules were
obtained from the structure TriH, which was not processed further
into circles, but is cleaved into fragments smaller than 280 bases
with a first specific cleavage (lane 6, open arrow) and consecutive
unspecific degradation (lanes 7,8). In contrast to ExL3'°H°t where
basically no cleavage products can be detected (lanes 10-12),
ExR 5ob 8° notably yields three different linear intermediates
around the size of monomeric length (lanes 14—16). Purified from
the gel and reincubated with the nuclear extract, the larger sized
3a. 45 min/40°C
3b. 45 min/60°C including 3'-oligo
3c. 45 min/63°C including 5'-ohgo
4. Slowly cool to room temperature overnight
5. Dialyse against TE at 4°C subsequently keep
below 4°C
ExL
ExL3'oll«°
ExR5'oli8°
High salt fast
1. Low salt snap (1-3) as above
2. Adjust to 500/4/1/0.1
3. 3min/60°C
4. Transfer to 4°C on air, 20 min
5. Dialyse against TE at 4°C subsequently keep
below 4°C
TriH
The steps 1-3 of low salt snap exclude bimolecular complexes; keeping below
4°C maintains metastable structures. For abbreviations see Figure 3.
DISCUSSION
The homologous nuclear extract is a model system for
in vivo processing of PSTVd
The nuclear extract from the host plant potato resembles much
closer conditions for viroid processing in vivo than the purified,
non-host RNase T1, which had to be used in our earlier study (34).
The processing extract established here on the basis of a
transcription extract (35) contains enzymatic activities responsible for viroid processing that are different from those in a potato
nuclear extract published before (52). While Tsagris and colleagues (52) reported viroid processing activity even in 40 mM
EDTA, the extract used in this work was inactive in the presence
of 10 mM EDTA and only unspecific degradation was observed
under this condition (cf. Fig. 2). Upon incubation with our nuclear
extract the monomeric transcript TB110 as well as other
monomeric and dimeric constructs yielded the correct circular
Nucleic Acids Research, 1995, Vol. 23, No. 21 4253
products. Especially important to us was the fact that the
transcript Ha 106, which is infectious in vivo, but is processed to
non-infectious circular molecules of 358 nt by RNase Tl (32), is
processed to mature circles of 359 nt length by our extract. These
findings emphasise that the activity of our extract is not restricted
to a particular transcript like TB 110.
Table 2. Activity of substrate RNA structures for processing in the nuclear
extract
Substrate structure
Linear intermediates
TriH
-
Circular products
Correct
Aberrant
-
-
ExM
+
++
+
ExL
+
+/-
+
Exi/ohgo
_
_
E x R 5'oligo
+
_(+)
The amount of linear and circular processing products was evaluated qualitatively from a number of independent experiments (e.g. Fig. 5). ++, +, predominantly detectable, +/-, detectable in minor amounts; -, not detectable; - (+),
detectable only upon re-incubation with the nuclear extract (see text).
Advantages of structure determination by TGGE and
oligonucleotide mapping
In addition to the well established methods for RNA structure
analysis like structural calculations, UV melting curves and
TGGE, we applied a procedure of structure probing with RNA
oligonucleotides. In this method, used before under different
conditions (e.g. 54—58), we designed short labeled RNA probes
complementary to segments which are single stranded or only
weakly base paired in one structure, but stably base paired in
others. Comparison of the transition curves from TGGE with and
without the label is highly instructive under several aspects, (i) If
transition curves are found, which are identical or very similar
after silver staining and after autoradiography (minor changes
might be due to the increased molecular size after oligonucleotide
binding), the oligonucleotide is a purely diagnostic tool and the
transition curve is attributed unambiguously to the structure with
the corresponding segment being single-stranded. For example,
the 3'-end of the transcript in ExL conformation (cf. Fig. 4B) is
already accessible to oligonucleotide binding at moderate temperatures; (ii) The oligonucleotide may also shift the distribution
of several structures. The structure ExR could be stabilised in this
way after breaking base pairs of more stable structures (ExL and
ExM) at high temperature and its transition curve could be
recorded in TGGE; (iii) The oligonucleotide may even label
intermediates during thermal denaturation. A clear example was
the annealing of the internal oligonucleotide to the transcript in
structure ExL at temperatures above the first transition thereby
preventing this transition in the next round of thermal denaturation
as monitored by TGGE.
Although chemical or enzymatic structure probing has been
applied successfully in many examples of RNA structure analysis
(for review see ref. 59), it could not be applied in this work for
several reasons. Modification of nucleotides involved in a
structural equilibrium may shift the equilibrium in an unpredictable manner (A. Schroder and D. Riesner, unpublished). Further-
more, the single-stranded state of the 3'-end, which is indicative
for the presence of structure ExL, could not be tested, since the
modifications are mapped most commonly by primer extension
analysis and this cannot be done at the ultimate 3'-end. A
particular difficulty of PSTVd structure analysis is caused by the
fact that the same nucleotides are either single-stranded or base
paired in quite different conformations.
The method of oligonucleotide labeling was not only helpful to
determine the structures perse, but also to identify the processing
activities of the different structures. As will be discussed below,
a particular structure might be the active substrate for processing
as such or might be in an equilibrium with the active structure.
These cases can be distinguished if one structure can be locked in
its state by oligonucleotide binding.
Only structure ExM is active in correct processing
The transcript TB110 was tested for processing activity in five
different structures counting ExL and ExL 3ol| 8° as different
structures (cf. Table 2). The structure ExM is most active in the
processing assay although it is thermodynamically not the most
favourable structure. We suggest that it bears particular structural
features, which are essential for protein recognition in the
processing reaction and are probably a consequence of the
bifurcation. The motif(s) for specific recognition, however, cannot
be described in full detail as long as the exact cleavage sites have
not been determined Also ExL is processed to circular PSTVd
though with lower yield, but it is blocked completely by the
3'-oligonucleotide in the structure ExL3 ol'£°. The larger amounts
of aberrant circles produced from the ExL substrate together with
the lack of any, even partially cleaved linear intermediates with
ExL3ol|8° argues strongly that the specific viroid processing
activity of ExL is actually derived from its potential rearrangement
into another conformation, supposedly ExM. This rearrangement
is blocked by the 3'-oligonucleotide locking the ExL conformation. ExR could be established in solution only as a complex with
the 5'-oligonucleotide; it was then substrate to cleavages, but was
blocked from final processing to mature circles, unless the
5'-oligonucleotide was removed. Finally, the structure TriH was
predominantly degraded without any indication of circle production. It should be mentioned that the tri-helical structure was
favoured in earlier studies (17,22-24) as a candidate for
processing activity because of its remarkable thermodynamic
stability and its obvious ability to arrange oligomeric PSTVd
sequences into monomeric units. However, the high structural
stability of the tri-helical element and in consequence its inability
to be transformed into other comformations has now to be
regarded the reason for its inactivity in the processing reaction, in
the nuclear extract as well as with RNase Tl.
Another secondary structural element discussed in the literature
(15,19) has to be considered in this context. The 5'-end of TB 110
contains almost the complete UCCR with its inverted repeats and
might form the small stem-loop called hairpin I. A structure
containing HPI would bear the characteristics of the ExR type, but
the corresponding AG° value of-390.7 kJ/mol at 40°C is another
8.6 kJ/mol less favourable than the value for ExR without
oligonucleotide (-399.3 kJ/mol). Since even ExR could not be
found experimentally without stabilising it with the 5'-oligonucleotide, it is not surprising that we have no evidence for HPI
under any conditions tested. Thus, a potential processing activity
of HPI could only be considered, if exceptional structural features
4254 Nucleic Acids Research, 1995, Vol. 23, No. 21
of HPI or particular interactions with proteins would revise the
thermodynamic predictions. In this context it is noteworthy that
a transcript with an even shorter duplication of the UCCR can
definitely not form HPI, but was found to be infectious (21).
Outlook
For the presentation of a detailed molecular model of the
mechanism of viroid processing in vivo the knowledge of the
cleavage and ligation sites is clearly indispensable. We are fully
aware of the necessity to obtain this information from the 3'- and
5'-ends of the linear processing intermediates accumulating during
the processing reaction. However, as we realised the importance of
RNA secondary structure for correct processing, we decided to
concentrate first on the determination of the structures involved
and the evaluation of their processing activity; we will now turn to
the determination of the cleavage sites. Preliminary results
revealed that the cleavage and ligation sites differ from those in the
RNase Tl processing system.
ACKNOWLEDGEMENTS
We thank Drs P. Klaff, A. Sattler, G. Steger and M. Schmitz for
stimulating discussions and critically reading the manuscript and
Mrs H. Gruber for help in preparing the manuscript. The work
was supported by grants from the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie.
REFERENCES
1 Riesner, D. and Gross, HJ. (1985) Annu. Rev. Biochem., 54, 531-564.
2 Diener, T.O. (1987) The Viroids. Plenum Publishing Corporation, New
York.
3 Semancik, J.S. (1987) Viroids and Viroid-like Pathogens. CRC Press, Boca
Raton, FL.
4 Symons, R.H. (1990) Sem. Virology, 1, 75-81.
5 Branch, A. and Robertson H.D. (1984) Science, 223, 450-455.
6 Sanger, H.L. (1987) In Diener, T.O. (ed.) The Viroids. Plenum Publishing
Corporation, New York. pp. 117-166.
7 Forster, A.C. and Symons, R.H. (1987) Cell, 49, 211-220.
8 Hutchins CJ., Rathjen, P.D., Forster, A.C. and Symons, R.H. (1986)
Nucleic Acids Res., 14, 3627-3640.
9 Hernandez, C. and Flores, R. (1992) Proc. Natl. Acad. Sci. USA, 89,
3711-3715.
10 Tsagris, M , Tabler, M. and Sanger, H.L. (1987) Virology, 157, 227-231.
11 Gross, HJ., Domdey, H., Lossow, Ch., Jank, P., Raba, M., Alberty, H. and
Sanger, H.L. (1978) Nature, 273, 203-208.
12 Riesner, D. (1987) In T.O. Diener (ed.), The viroids. Plenum Press, New
York, pp. 63-98.
13 Riesner, D. and Steger, G. (1990) In Saenger, W. (ed.), Landolt-Bdmstein,
New Series, VII Biophysics, \bL I Nucleic Acids, Springer Verlag, Berlin,
pp. 194-243.
14 Riesner, D. (1990) Sent Virology, 1, 83-99.
15 Henco, K., Sanger, H.L. and Riesner, D. (1979) Nucleic Acids Res., 6,
3041-3059.
16 Tabler, M. and Sanger, H.L. (1984) EMBO J., 3, 3055-3062.
17 Hashimoto, J. and Machida, Y. (1985) J. Gen. Appl. Microbioi, 31,
551-561.
18 Meshi, R., Ishikawa, M., Watanabe. Y, Yamaya, J., Okada, Y, Sano, T. and
Shikata, E (1985) Mol. Gen. Genet., 200, 199-206.
19 Visvader, J.E., Forster, A.C. and Symons, R.H. (1985) Nucleic Acids Res.,
13,5843-5856.
20 Rakowski, A.G. and Symons, R.H. (1994) Virology, 203, 228-335.
21 Candresse, T., Diener, T.O. and Owens, R.A. (1990) virology, 175,
232-237.
22 Diener, T.O. (1986) Proc. Natl. Acad. Sci. USA, 83, 58-62.
23 Steger, G., Tabler, M., Briiggemann, W., Colpan, M., Klotz, G., Sanger
H.L. and Riesner, D. (1986) Nucleic Acids Res., 14, 9613-9630.
24 Hecker, R., Wang, Z., Steger, G. and Riesner, D. (1988) Gene, 72, 59-74.
25 Hammond, R., Diener, T.O. and Owens, R.A. (1989) Vlrologv, 170,
486-495.
26 Tabler, M. and Tsagris, M. (1990) In Fraser, R.S.S. (ed.), Recognition and
Response in Plant-Virus Interactions. NATO ASI Series, Vol. H41,
Springer-Verlag, Berlin, pp. 185-205.
27 Hashimoto, J., Suzuki, K. and Uchida, T, (1985) J. Gen. Virol., 66,
1545-1551.
28 Palukaitis, P. and Zaitlin, M. (1987) Virology, 157, 199-210.
29 Rigden, J.E. and Rezaian, M A (1992) Virology, 186, 201-206.
30 Konarska, M., Filipowicz, W., Domdey, H. and Gross, HJ. (1981) Nature,
293,112-116.
31 Kikuchi, Y, Tyc, K., Filipowicz, W., Sanger, H.L. and Gross, HJ. (1982)
Nucleic Acids Res., 10, 7521-7529.
32 Tsagris, M., Tabler, M. and Sanger, H.L. (1991) Nucleic Acids Res., 19,
1605-1612.
33 Tabler, M., Tzortzakaki, S. and Tsagris, M. (1992) Virology, 190, 746-753.
34 Steger, G., Baumstark, T., Morchen, M., Tabler, M., Tsagris, M. and
Sanger, H.L. and Riesner, D. (1992) J. Mol. Biol., 227, 719-737.
35 Roberts, M.W. and Okita,T.W. (1991) Plant Mol. Biol., 16, 771-786.
36 Dunn, JJ. and Studier, F.W. (1983) J. Mol. Biol., 166, 477-535.
37 Schnolzer, M., Haas, B., Ramm, K , Hofmann, H. and Sanger, H.L. (1985)
EMBOJ., 4, 2181-2190.
38 Milligan, J.F., Groebe, D.R., Witherell, G.W. and Uhlenbeck, O.C. (1987)
Nucleic Acids Res., 15, 8783-8798.
39 Sambrook, J., Fritsch, E.F. and Maniatis, R. (1989) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor University Press, Cold Spring
Harbor, NY.
40 Davanloo, P., Rosenberg, A.H., Dunn, JJ. and Studier, F.W. (1984) Proc.
Natl. Acad. Sci USA, 81, 2035-2039.
41 Melton, D.A., Kneg, PA., Rebagliati, M.R., ManiaUs, T, Zinn, K. and
Green, M.R. (1984) Nucleic Acids Res., 12, 7035-7056.
42 Krupp, G. (1988) Gene, 72, 75-89.
43 Petersen, I., Ohgaki, H., Ludeke, B. and Kleihues, P. (1994) Anal.
Biochem., 218, 478-479.
44 Schrrutz, M. and Steger, G. (1992) CAB1OS, 8, 389-399.
45 Steger, G. (1994) Nucleic Acids. Res., 22, 2760-2768.
46 Rosenbaum, V. and Riesner, D. (1987) Biophys. Chem., 26, 235-246.
47 Riesner, D., Henco, K. and Steger, G. (1991) In A. Chrambach, MJ. Dunn
and B J. Radola (eds). Advances in Electrophores'is Vol. 4. VCH
Verlagsgesellschaft, Weinheim, pp. 169-250.
48 Schumacher, J., Meyer, N., Riesner, D. and Weidemann, H.L. (1986) J.
Phytopathology, 115, 332-343.
49 Behnke, M. (1975) Z PflanzenzBcht, 75, 262-265.
50 Mtlhlbach, H.-P. and Sanger, H.L. (1981) Biosci. Rep., 1, 79-87.
51 Faustmann, O., Kern, R^ Sanger, H.L. and MUhlbach, H.-P. (1986) Virus
Res., 4, 213-227.
52 Tsagris, M., Tabler, M., MUhlbach, H.-P. and Sanger, H.L. (1987) EMBO
J., 6,2173-2183.
53 Hecker, R. (1989) Dissertation, Heinrich-Heine-Universitat Dilsseldorf.
54 Uhlenbeck, O.C, Bailer, J., Doty, P., (1970) Nature, 225, 508-512.
55 Weller, J.W., Hill, W.E (1992) Biochemistry, 31, 2748-2757.
56 LeCuyer, K. and Crothers, D.M. (1994) Proc. Natl. Acad. Sci. USA, 91,
3373-3377.
57 Zarrinkar, P.P. and Williamson. JR. (1994) Science, 265, 918-924.
58 Pinard, R^ Payant, C. and Brakier-Gingras, L. (1995) Biochemistry, 34,
9611-9616.
59 Ehresmann, C, Baudin, F., Mougel, M., Romby, P., Ebel. J.-P. and
Ehresmann B. (1987) Nucleic Acids Res., 22, 9109.