SUPPLEMENTARY INFORMATION
Video1. Time lapse imaging of GFP::ABAP1, showing its subcellular localization in a
cycling BY2 tobacco living cell. The images were obtained using confocal fluorescence
microscopy. GFP::ABAP1 first appeared homogeneously in the nucleus. The video
started when GFP::ABAP1 levels in the nucleus decreased and became enriched in
speckles. GFP::ABAP1 completely disappeared from cells 20 minutes after.
Supplementary Materials and Methods
In silico analyses
The DNA sequences were translated into hypothetical proteins, whose theoretical
characteristics were obtained using several programs in the ExPASy (Expert Protein
Analysis System) server of the Swiss Institute of Bioinformatics (www.expasy.ch/tools/).
Protein sequences were entered into Interpro (protein domain and pattern search
identification) and putative regulatory promoter elements were searched by computer
analysis of the putative promoter region (1000 bp upstream of the transcription initiation)
with the program PLACE (plant cis-acting regulatory domain identification).
Constructs
The full-length coding regions of ABAP1, AtTCP24 and AtORC1a, the amino
terminus of AtORC1a, Armadillo and BTB regions of ABAP1 were amplified by PCR with
the primers
5'-TACAAAAAAGCAGGCTTCACAATGGAGAACCATCCACAAGCGCCA-3'
(ABAP1 5) and 5'-CAAGAAAGCTGGGTTACTTCAAACCGGAATCCTATATG-3'
(ABAP1 3), 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACAATGGAGGTTGACGAAGACATTG-3' (AtTCP24 5´) and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGCTTCCTTTCATCCTCGCC-3' (AtTCP24 3´), 5'-CAAGAAAGCACTGTCGCCTCAGCTCCAAGC-3' (AtORC1a-N 5), 5'-CAAGAAAGCTGGGTTATCCTCATCTCCATCAGC-3' (AtORC1a-N 3), 5'- GGGGACAAGTTTGTACAAAAAAGCTCTCAAAATCGTTAA (ABAP1-N 5) and 3'- GGGGACCACTTTGTACAACTTGATGTGAAAA-
CGGGGTCTGT (ABAP1-N 3), 5'- GGGGACAAGTTTGTACAAAAAAGCCTTGATGTGAAAACGGGGTCTGT (ABAP1-C 5) and 3'- GGGGACCACTTTGTACAACAAGAAAGCTGGGTCACTAGCTTCGACCGGCCG (ABAP1-C 3), 5’- CAAGAAAGCACT
GTCGCCTCAGCTCCAAGC-
3’
(AtORC1a
5’)
and
5’-
CAAGAAAGCTGG
GTCTACATATCGATTCGGGCA- 3’ (AtORC1a 3’).. The amplified fragments were
reamplified
with
the
Gateway
adaptor
primers
5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3'
and
5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3' and cloned into the pDONR201
Gateway vector (Invitrogen). The ABAP1 coding region was transferred (1) to a binary
vector containing the CaMV 35S promoter and the zein terminator sequence with the
selection marker eGFP in plants (35S::ABAP1), (2) to the expression vectors pDEST15
(pDEST15.ABAP1) for GST fusion and pDEST17 (pDEST17.ABAP1) for His fusion.. ,
(3) to the yeast two-hybrid pDESTDBD (DBD.ABAP1) and pDESTAD (AD.ABAP1)
vectors (Invitrogen) with the Gateway Technology (Invitrogen) and to 35S::GFP fusion
vector (pK7WGF2) for ABAP1 subcellular location (GFP::ABAP1). The AtTCP24 and
AtORC1a coding regions were transferred to the expression vectors pDEST15 (pDEST15
AtTCP24 and pDEST15 AtORC1a) for GST fusion and pDEST17 (pDEST17 AtTCP24
and pDEST17 AtORC1a) for His fusion. Vectors of pre-RC genes used in yeast two hybrid
assay are described in Masuda et al. (2004). For ABAP1 promoter isolation, a 1414-bp
genomic fragment containing the putative ABAP1 promoter was amplified from
Arabidopsis
plants
(ecotype
Col-0)
with
the
5'-AAAAAGCAGGCTGGTTTGATCTAAAGT-TTGCGG-3'
5'-AGAAAGCTGGGTTTGCGGATGGTTTGATATCAC-3'.
primers
and
This
fragment
was
reamplified with the Gateway adaptor primers, as described above, cloned into the
pDONR201 vector (Invitrogen), and then transferred to the GUS::GFP- containing binary
vector pKGWFS7(Karimi et al, 2002), generating the plasmid ProABAP1::GUS. Entry
clones of AtTCP3, AtTCP5, AtTCP13 and AtTCP17 were kindly provided by Cropdesign
(Belgium).
The constructs used in the protoplast transient expression experiments, except for
35S::ABAP1, were obtained by LR reaction with the pK7GW43Dnew destination vector,
with the MultiSite Gateway® Technology (Invitrogen), to generate the final constructs
35S::AtORC1a-GST, 35S::AtCDT1b-Flag, 35S::AtCDT1a-Flag, AtTCP24-CBP and
35S::AtORC3-HA. The cDNAs AtORC1a, AtCDT1a, AtCDT1b, AtTCP24 and AtORC3
flanked by attL1 and attL2 were generated by PCR and cloned in pDONR221 Gateway
vector (Invitrogen).
Plant material and transgenic plants production
Arabidopsis thaliana plants were grown on agar plates or soil under long-day
conditions (16 h of light, 8 h of darkness) at 23oC under standard greenhouse conditions.
All analyses in planta (proABAP1::GUS, GFP::ABAP1, ABAP1OE lines and AtTCP24OE)
were performed using the Arabidopsis accession Columbia-0 background, except for
enhancer trap line (ABAP1ET) where the genetic background was Landsberg erecta. These
two Arabidopsis accessions were used as wild-type controls for overexpression and
enhancer trap plants, respectively. At least, 10 transgenic lines were generated and
analyzed for each construct. For Arabidopsis transgenic plants production, Agrobacterium
tumefaciens strain C58C1 harboring the plasmid pMP90 was used to transform the plants
by the floral dip method (Clough and Bent, 1998).
For the subcellular localization of GFP::ABAP1, A. tumefaciens strain LBA4404
was used to transform BY2 tobacco cells (adapted from Shaul et al, 1996) cultivated in MS
medium supplemented with 30 g/L sucrose, 400 mg/L naphtalene acidic acid, 100 mg/L
myo-inositol, and 0.1 mg/L thiamine in the dark under constant agitation at 280C.
GFP::ABAP1 BY2 cells were treated for 16 h with the drugs hydroxyurea (10 mM) ,
aphidicolin (5mg/L), and propyzamide (10 μM), to arrest the cycle in the transition
between G1-to-S, at early S phase and early mitosis, respectively.
For transient expression in Arabidopsis protoplasts, pellets of 5-d-old cultures of the
Arabidopsis cell suspension LMM1 were digested with enzyme solution [1% cellulase
(Serva), 0.2% macerozyme (Yakult), 0.34 M glucose, 0.34 M mannitol in B5 medium, pH
5.5] overnight at room temperature. Protoplasts were washed in B5-0.28S (0.28 M sucrose
in B5 medium, pH 5.5) and counted in a Neubauer chamber. Protoplasts were transformed
by adding 5 µg of each DNA construction, 100 µg of calf thymus DNA and 200 µl of
40% PEG solution (Doelling et al, 1993). Each eppendorf was placed on ice for 30
minutes before incubation at 22 C overnight. PEG solution was diluted three times with
MSMO medium supplemented with 0,5M mannitol and protoplasts were collected by
gentle centrifugation. Protoplasts were ressuspended in MSMO mannitol supplemented.
Molecular and phenotypic analysis of ABAP1OE and ABAP1ET plants
For ABAP1ET genotyping, primers Ds5-4 5’- CCGTACCGACCGTTATCGTA-3’
and ABAP1 3 were used to identify the mutated allele with Ds insertion. The wild type
allele was amplified with ABAP1 5 and ABAP1-N 3 (see constructs). More information
on the Enhancer Trap lines and genotyping can be found at http://genetrap.cshl.org. Flow
cytometric analyses were done according to Boudolf et al. (2004).
For DNA gel blot analysis, the genomic DNA isolated from four lines of
Arabidopsis ABAP1ET leaves was digested using two different pairs of restriction
enzymes (EcoRI + HindIII and SacI + PstI), electrophoresed on a 0.8% agarose gel and
blotted onto Hybond-N Nylon membrane (Amersham Pharmacia Biotech) as described
previously (Jwa et al. 2000). The probe was the 0.6-kb PCR fragment corresponding to
the GUS gene region of the Ds element. Prehybridization and hybridization were carried
out in 5x SSC, 5x Denhardt’s solution, and 0.5% SDS at 60 °C overnight. The
membranes were washed twice in 2x SSC and 1% SDS at room temperature and then in
0.1x SSC and 0.1% SDS at 60 °C for 30 min.
For phenotypic analysis, automated measurements of the rosette area were performed
in CropDesign (Gent, Belgium). For ABAP1OE, ABAP1ET , TCP24OE and wild type plants,
the methodology of kinematics was used to analyze leaf growth, according to De Veylder
et al (2001) and and Fiorani and Beemster (2006). Plants were harvested from day 6 until
day 21 after sowing, cleared overnight in 90% ethanol:10% acetic acid, and subsequently
stored in lactic acid for microscopy. Plants were mounted on a slide and covered. The
leaves primordia were observed under a microscope fitted with differential interference
contrast optics (DMLB; Leica, Wetzlar, Germany). The total (blade) area of leaves 1 and
2 of each seedling was first determined from drawing-tube images with the public
domain image analysis program ImageJ (version 1.30; http://rsb.info.nih.gov/ij/). Cell
density was determined from scanned drawing-tube images of outlines of at least 30 cells
of the abaxial epidermis located at 25% and 75% from the distance between the tip and
the base of the leaf primordium (or blade once the petiole was present), halfway between
the midrib and the leaf margin. The following parameters were determined: total area of
all cells in the drawing, total number of cells, and number of guard cells. From these data,
we calculated the average cell area and estimated the total number of cells per leaf by
dividing the leaf area by the average cell area (averaged between the apical and basal
positions). Finally, average cell division rates for the whole leaf were determined as the
slope of the log2- transformed number of cells per leaf, which was done using five-point
differentiation formulas (Erickson, 1976).
Cell suspension synchronization
Arabidopsis LMM1 cells were reversibly blocked in late G1/early S phase with
aphidicolin according to Nagata et al. (1992) with modifications as follow. A 40 ml aliquot
of cell suspension culture was subcultured into 200 ml fresh MSS, containing 4 µg/ml
aphidicolin (Sigma) and incubated at 23°C, 120 rev/min for 21.5 h. Cells were washed with
2 liters of MSS followed by centrifugation (250 g/1 min) to remove aphidicolin. The cell
pellet was ressuspended in 250 ml MSS and incubated under cultivation conditions.
Samples were collected at 0, 1, 2, 4, 8, 12 and 24 hours after aphidicolin release for
validation procedures, RNA and protein extractions. To determine the metaphase/anaphase
index (M/A index), the proportion of cells with DAPI-stained metaphase and anaphase
nucleus were counted in the same fields.
For flow cytometry of cell suspension cultures, the protocol described by Menges
and Murray (2002) was used, with modifications. To release cell nuclei, the cells were
chopped with a sharp razor blade in 1ml of culture media, followed by digestion with
enzyme solution [1% cellulase (Serva), 0.2% macerozyme (Yakult), 0.34 M glucose, 0.34
M mannitol in B5 medium, pH 5.5] for 2 hours at room temperature. Nuclei were collected
by centrifugation at 1,300x g (3,500rpm) for 5 minutes (40C). Nuclei pellet was incubated
with 1 μg/ml propide iodide to determine the DNA content. The nuclei were analyzed with
the COULTER EPICS XL™ Flow Cytometer and data was analyzed with WinMDI v.2.9
software.
Expression analyses
Total RNA was extracted from the frozen materials according to Logemann et
al.(1987). To eliminate the residual genomic DNA present in the preparation, the RNA
was treated by RNAse-free DNAse I according to the manufacturer’s instructions
(Amersham Biosciences). Total RNA was then quantified with a spectrophotometer and
loaded onto an agarose gel to check its integrity. First strand cDNA was synthesized using
“First Strand
cDNA Synthesis Pharmacia Kit” (Amersham Biosciences) with oligo (dT) primer solution
on 2.5 g RNA template according to the manufacturer’s instructions. Oligonucleotides
used for real-time RT-PCR were designed in gene-specific regions of each gene (ABAP1,
AtTCP24, AtCYCB1;1, AtUBI14, AtPCNA2 and all pre-RC components) with primer
Express 2.0 (Perkin Elmer Applied Biosystems, Foster City, CA) or Primer3 softwares and
are listed below. The cDNA was amplified using SYBR-Green® PCR Master kit (PerkinElmer Applied Biosystem) on the GeneAmp 9600 thermocycler (Perkin-Elmer Applied
Biosystems) under standard conditions. AtUBI14 constitutive gene was used as cDNA
amount control. Data were calculated using the mathematical formula 2[CTubi14-CTgene] and
were further normalized to the level of the controls for expression analyses comparing
overexpressor and enhancer trap with wild type plants.
In situ hybridization was performed essentially as previously described (de Almeida
Engler et al, 2001). Seedlings of Arabidopsis and its close relative radish were hybridized
with 35S-labeled ABAP1 gene-specific antisense and sense RNA probes (as control). Slides
were dipped in photographic emulsion and developed when a hybridization signal was
detected.
GUS activity was detected histochemically with 5-bromo-4-chloro-3-indolyl
β-D-glucoronide in the secondary transformants with minor modifications (Ferreira et al,
1994). The material was cleared with chlorolactophenol (chloral hydrate:phenol:lactic acid,
2:1:1) and analyzed with differential interference contrast (DIC) optics (Axiophot, Zeiss,
Göttingen, Germany) or stereoscope (Zeiss). For the subcellular localization of
GFP::ABAP1, BY2 cells and roots of 6d-old 35S::GFP::ABAP1 Arabidopsis plants were
stained with 2 μg/ml FM 4–64 (Molecular Probes, Eugene, Oregon, United States) and
then washed twice in water. Roots were placed in 100% ethanol for 10 min and DAPI
was added (1 μg/ml) to the samples for 5 minutes prior to observation in Zeiss LSM 410
confocal microscope.
Yeast two-hybrid assay
Yeast strain Y190, with the genotype MATa (gal4, gal80, his3, trp1-901, ade2-101,
ura3-52, leu 2-3-112, URA3::GALlacZ, LYS2::GAL(UAS)-HIS3) was co-transformed
with 5 μg of the constructs by the Polyethylene glycol/LiAc method (Gietz et al, 1992) and
plated on synthetic dropout media without either leucine/tryptophan (-leu/-trp) (to test
transformation efficiency) or leucine, tryptophan, and histidine (-leu/-trp/-his) (low
stringent condition), or leucine, tryptophan, histidine, and adenine (-leu/-trp/-his/-ade) (high
stringent condition), and incubated for 3 days at 30C.
In vitro and in vivo protein interaction assays
ABAP1-GST, AtTPC24-GST, and AtORC1a-GST were produced in cells of E. coli
strain BL21 as described by Chekanova et al (2000), with modification in the lysis buffer
(25 mM Tris, pH 8.0, 1 mM EDTA, 10% glycerol, 50 mM NaCl, 0.1% Triton X-100, 1
mM phenylmethylsulfonyl fluoride (PMSF), 10 mM leupeptin, and 75 mM aprotinin). In
vitro transcription and translation of 35S-methionine (GE-Healthcare) was performed using
the TNT Quick Coupled Transcription/Translation Systems (Promega) according to the
supplier's instructions. GST-pulldown analyses were carried out according to Tarun &
Sachs (1996).
Immunoprecipitation and protein gel blot assays
Immunoprecipitation was carried out using 300 µg of total protein extract. Total
protein of transformed cells were extracted (20 mM sodium phosphate, pH 7.5, 500 mM
NaCl, 0.1% SDS, 1% NP40, 0.5% sodium deoxycholate, and 0.02% sodium azide) and
pre-cleared with 30 µL of 50% (v/v) protein A-Sepharose beads (GE-Healthcare).
Pre-cleared supernatants were diluted 2.5-fold (to a final concentration of 200 mM NaCl)
and incubated with anti-ABAP1 antibody (1:2000; Covance Corp.). Beads were washed
with RIPA buffer (20 mM Tris-Cl, pH 7.4, 5 mM EDTA, 2 mM EGTA, 100 mM NaCl, 2
mM NaF, 0.2% Nonidet P-40, 300 mM PMSF, and 10 µg/mL aprotinin and pepstatin) and
submitted to protein gel blot analysis.
For protein gel blot, proteins were separated by 10% SDS-PAGE and blotted onto
Immobilion-P membranes (Millipore, Bedford, MA). Membranes were blocked (5% milk
powder, 150 mM NaCl, 0.05% Tween 20, 25 mM Tris-Cl, pH 8.0) for 2h at room
temperature and incubated for 1h with antibodies against ABAP1 (1:1000; Covance Corp.),
FLAG (1:1000, Sigma, St.Louis, MO), GST (1:5000; Sigma, St.Louis, MO), CBP (1:2000;
Santa Cruz Biotechnology) or HA (1:2000; Roche) in blocking buffer. Detection was
carried out according to the ECL Western Blotting System according to manufacturer´s
instructions (GE-Healthcare).
Anti-ABAP1 polyclonal antibody was developed against the peptide antigen
GAPIVTQLID (amino acids 28 to 37), by Covance Corp. Anti-ABAP1 specificity was
tested in western blot and immunoprecipitation assays (Supplementary Figure 3A, B).
Electrophoretic mobility shift assay (EMSA)
DNA probes were generated by annealing oligonucleotides spanning the regions of
interest and by filling in the single-strand overhangs with α-32P-dCTP using the Klenow
fragment. Binding reactions were performed using 50 fmol of each oligonucleotide
probe. 50 ng of each recombinant protein, 1x binding buffer (20 mM Hepes-KOH, pH 7.8,
100 mM KCI, 1mM EDTA, 1 mM DTT, 0.05% BSA, and 10% glycerol) and 20 ng of
salmon sperm DNA per ml of reaction solution as a non-specific DNA competitor. The
mixtures were incubated for 30 min at room temperature and loaded on native 5%
polyacrylamide (acrylamide-bisacrylamide, 29:l [w/w]) gels. For electrophoretic mobility
shift assays (EMSAs) with specific antibodies, anti-IgG fractions were added to
preincubated (1-5 min) reaction mixtures, and the mixtures were incubated for another 30
min at room temperature. Electrophoresis was conducted at 4 V/cm for 40 min with 0.5 X
TBE (45 mM Tris-borate and 0.5 mM EDTA, pH 8.2) buffer at room temperature. Gels
were dried and autoradiographed using intensifying screens.
Chromatin Immunoprecipitation and PCR amplification
The young rosette leaves were collected at room temperature and immediately
crosslinked by treating approximately 1/3 of the 50ml falcon tube filled with the rosette
leaves with 37ml of 1% formaldehyde for 15 min under 20-25 psi of vacuum. After
addition of 2M glycine (100 mM final concentration) followed by a 5 min incubation to
stop the crosslinking, the plant material was washed three times with water. The fixed
leaf tissue was then frozen in liquid nitrogen and stored at -80°C. Chromatin isolation and
immunoprecipitation with an antibody against ABAP1 were done according to Gendrel et
al. (2005) with minor modifications (an extra 5 min wash was added at each washing
step).
ABAP1-immunoprecipitated DNA, as well as the input DNA and mockimmunoprecipitated DNA were used in PCR amplification using primers specific to
promoter and coding regions of AtCDT1a and AtCDT1b. 2 µl of ten-fold dilution of
immunoprecipitated DNA (25-fold in the case of input DNA) were used as template in a
20µl PCR reaction for a total of 30 cycles of amplification with the primer annealing
temperature set at 59oC. Following PCR amplification 7µl of the PCR reaction was
separated on 2% metaphor agarose gels and visualized under UV light using ethidium
bromide staining.
Protein chromatin-binding assay
Wild type, ABAP1OE and ABAP1ET plants were collected at 6 days after sowing
and submitted to lyses in liquid nitrogen. Plant cells lysates and chromatin fractionation
were performed as described by Mendez and Stillman (2000), with minor adaptations.
Briefly, lysate cells were ressuspended in 1ml of A buffer (10mM Hepes pH7.9, 10mM
KCl, 1.5mM MgCl2, 0.34M Sucrose and 10% Glycerol plus plant proteases inhibitors
cocktail - Sigma), and incubated for 5 min on ice. Nuclei were collected by centrifugation
at 1,300 x g for 5 minutes followed by another centrifugation (20,000 x g for 15 minutes).
Nuclei pellet was washed in 0.5mL Buffer A, centrifuged at 1,300 x g for 5 minutes,
ressuspended in Buffer B (3mM EDTA,0.2mM EGTA, plant proteases inhibitors
cocktail) and incubated on ice for 30 minutes prior to centrifugation at 1700xg for 5
minutes. Supernatant (S2) was collected; and pellet (P2) was ressuspended in buffer B
(same volume as S2). Equal volumes of 2× Laemmli’s buffer (4% SDS, 10% 2mercaptoethanol, 0.004% bromophenol blue, 0.125 M Tris HCl and 20% glycerol, pH
6,8) were added to each fraction and resolved in SDS PAGE.
Primers
Semiquantitative real time PCR Primers
Primer
Sequence
ABAP1 forward
5'-TCAGCCTTAAGAAGAGCTTGCA-3'
ABAP1 reverse
5'-ACCATAATTGAGAGCTGAGCTTAGTG-3'
AtTCP24 forward
5'-CTCCACCTCTTGACCACCAT-3'
AtTCP24 reverse
5'- TTGGCGAGAGATGAAAGGA-3
AtCYCB1;1 forward
5'-CGAAGAAGCTGAAGAACCAA-3'
AtCYCB1;1 reverse
5'-ATGCAGTGTTTGGGAATGAA-3'
AtUBI14 forward
5'-TCACTGGAAAGACCATTACTCTTGAA-3'
AtUBI14 reverse
5'-AGCTGTTTTCCAGCGAAGATG-3'
AtPCNA2 forward
5´-TCCTTCCTCAATGATTTCTGG-3´
AtPCNA2 reverse
5´-GCCTGTGTGTGACGATGAAT-3´;
Primers for pre-RC members were described elsewhere (Masuda et al. 2004).
Electrophoretic Mobility Shift Assay (EMSA)
Primer
Sequence
AtCDT1a pro WT
5'-CGTGGCAAATATGGGCCCACAGCTATAGAT-3'
AtCDT1a pro mut
5'-CGTGGCAAATATAAGCCCACAGCTATAGAT-3'
AtCDT1b pro WT
5'-AGCAATTCATAATGGGCCTAATTAATGGGC-3'
AtCDT1b pro mut
5'-AGCAATTCATAATAAGCCTAATTAATGGGC-3'
TCP consensus probe WT
5'-GCTGTTGGGCCGAATGTTTGTTTGGCCCAATTT-3'
TCP consensus probe mut
5'-GCTGTTAAGCCGAATGTTTGTTTGGCCCAATTT-3'
Chromatin Immunoprecipitation assay PCRs
Primer
Sequence
Localization
AtCDT1a F.a
5’-CGTTTTAACCCCAGTCTTCTGTG-3’
-488 to -465 bp
AtCDT1a R.a
5’-GCCCATATTTGCCACGTCAC-3’
-151 to -131 bp
AtCDT1b F.b
5’-AAGCAGCATAAACATTGCACGA-3’
-353 to -331 bp
AtCDT1b R.b
5’-CGTATACCTCCCGCGCCTAT-3’
- 164 to -144 bp
AtCDT1a F.c
5’-CCGATGCAATTGTAGTTGAGGA-3’
+631 to +653 bp
AtCDT1a R.c
5’-TTCGGAATTTCGTCCTGCAT-3’
+828 to +848 bp
Supplementary References
Boudolf V, Vlieghe K, Beemster GTS, Magyar Z, Acosta JAT, Maes S, Van Der
Schueren E, Inzé D, De Veylder L (2004) The plant-specific Cyclin-Dependent
Kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of
mitotically dividing and endoreduplicating cells in Arabidopsis. Plant Cell 16:
2683–92
Chekanova JA, Shaw RJ, Wills MA, Belostotsky DA (2000) Poly(A) tail-dependent
exonuclease AtRrp41p from Arabidopsis thaliana rescues 5.8 S rRNA processing
and mRNA decay defects of the yeast ski6 mutant and is found in an
exosome-sized complex in plant and yeast cells. J Biol Chem 275: 33158-33166
Clough SJ, Bent AF. (1998). Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J. 16:735-43
de Almeida Engler J, De Groodt R, Van Montagu M, Engler G. (2001). In situ
hybridization to mRNA of Arabidopsis tissue sections. Methods 23:325-34
De Veylder L, Beeckman T, Beemster GTS, Krols L, Terras F, Landrieu I, Van Der
Schueren E, Maes S, Naudts M, Inzé D (2001) Functional analysis of
cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 1653-1667
Doelling JH, Gaudino RJ, Pikaard CS. (1993) Functional analysis of Arabidopsis thaliana
rRNA gene and spacer promoters in vivo and by transient expression. Proc Natl
Acad Sci U S A. 90:7528-32
Erickson RO (1976) Modeling of plant growth. Ann. Rev. Plant Physiol. 27: 407–434
Ferreira PC, Hemerly AS, Engler JD, van Montagu M, Engler G, Inzé D (1994)
Developmental expression of the Arabidopsis cyclin gene cyc1At. Plant Cell 6:
1763-74
Fiorani F and Beemster GTS (2006) Quantitative analyses of cell division in
plants. Plant Molecular Biology 60:963–979
Gendrel AV, Lippman Z, Martienssen R, Colot V (2005) Profiling histone modification
patterns in plants using genomic tiling microarray. Nat Methods 2: 219-24
Gietz D, St Jean A, Woods RA, Schiestl RH (1992) Improved method for high efficiency
transformation of intact yeast cells. Nucleic Acids Res 20: 1425
Karimi M, Inzé D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated
plant transformation. Trends Plant Sci. 7:193-5.
Jwa, N. S., Park, S. G., Park, C. H., Kim, S. O., Ahn, I. P.,Park, S. Y., Yoon, C. H., and
Lee, Y. H. (2000) Cloning and expression of a rice cDNA encoding a Lls1
homologue of maize. Plant Pathol. J. 16: 151-155
Logemann J, Schell J, Willmitzer L (1987) Improved method for the isolation of RNA
from plant tissues. Anal Biochem 163: 16-20
Mendez, J, Stillman, B (2000) Chromatin association of human origin recognition
complex, cdc6, and minichromosome maintenance proteins during the cell cycle:
assembly of prereplication complexes in late mitosis. Mol. Cell. Biol. 20, 86028612.
Menges M and Murray JAH (2002) Synchronous Arabidopsis suspension cultures for
analysis of cell-cycle gene activity. The Plant Journal, 30(2): 203-212.
Nagata, T., Nemoto, Y. and Hasezawa, S. (1992) Tobacco BY-2 cell line as the `HeLa'
cell in the cell biology of higher plants. Int. Rev. Cytol. 132, 1±30.
Shaul O, Mironov V, Burssens S, Van Montagu M, Inze D. (1996). Two Arabidopsis
cyclin promoters mediate distinctive transcriptional oscillation in synchronized
tobacco BY-2 cells. Proc Natl Acad Sci U S A. 93:4868-72.
Tarun SZJr, Sachs AB (1996) Association of the yeast poly(A) tail binding protein with
translation initiation factor eIF-4G. EMBO J 15: 7168-77.