Planta
DOI 10.1007/s00425-013-1893-1
ORIGINAL ARTICLE
A phytase gene is overexpressed in root nodules cortex
of Phaseolus vulgaris–rhizobia symbiosis
under phosphorus deficiency
Mohamed Lazali • Mainassara Zaman-Allah •
Laurie Amenc • Ghania Ounane • Josiane Abadie
Jean-Jacques Drevon
•
Received: 10 March 2013 / Accepted: 29 April 2013
Ó Springer-Verlag Berlin Heidelberg 2013
Abstract Phosphorus is an essential nutrient for rhizobial
symbioses to convert N2 into NH4 usable for N nutrition in
legumes and N cycle in ecosystems. This N2 fixation process occurs in nodules with a high energy cost. Phytate is
the major storage form of P and accounts for more than
50 % of the total P in seeds of cereals and legumes. The
phytases, a group of enzymes widely distributed in plant
and microorganisms, are able to hydrolyze a variety of
inositol phosphates. Recently, phytase activity was discovered in nodules. However, the gene expression localization and its role in N2-fixing nodules are still unknown.
In this work, two recombinant inbred lines (RILs) of
common bean (Phaseolus vulgaris L.), selected as contrasting for N2 fixation under P deficiency, namely RILs
115 (P-efficient) and 147 (P-inefficient) were inoculated
with Rhizobium tropici CIAT 899, and grown under hydroaeroponic conditions with sufficient versus deficient P
supply. With in situ RT-PCR methodology, we found that
phytase transcripts were particularly abundant in the nodule cortex and infected zone of both RILs. Under P deficiency, phytase transcripts were significantly more
abundant for RIL115 than for RIL147, and more in the
outer cortex than in the infected zone. Additionally, the
high expression of phytase among nodule tissues for the
P-deficient RIL115 was associated with an increase in
phytase (33 %) and phosphatase (49 %) activities and
efficiency in use of the rhizobial symbiosis (34 %). It is
argued that phytase activity in nodules would contribute to
the adaptation of the rhizobia–legume symbiosis to low-P
environments.
Keywords Phytase Phosphorus deficiency Recombinant inbred line Transcript Nitrogen Nodule Rhizobia Symbiosis
J.-J. Drevon
e-mail: [email protected]
Abbreviations
N
Nitrogen
P
Phosphorus
RILs
Recombinant inbred lines
SNF
Symbiotic nitrogen fixation
CIAT International center of tropical agriculture
DAT
Days after transplantation
EURS Efficiency in use of the rhizobial symbiosis
APase Acid phosphatase
M. Lazali G. Ounane
Département de Phytotechnie, Ecole Nationale Supérieure
Agronomique (ENSA), Avenue Hassan Badi,
16200 El Harrach-Alger, Algeria
Introduction
M. Lazali
Faculté des Sciences de la Nature et de la Vie & des Sciences de
la Terre, Université de Khemis Miliana, Route Theniet El Had,
Soufay, 44225 Khemis Miliana, Algeria
Phosphorus (P) is one of the most important nutrients for
plant growth and metabolism. It is the least accessible
macronutrient in many soils because it readily forms
M. Lazali (&) M. Zaman-Allah L. Amenc J. Abadie J.-J. Drevon (&)
Institut National de la Recherche Agronomique (INRA), UMR
1222 Eco&Sols, Ecologie Fonctionnelle & Biogéochimie des
Sols et Agroécosystèmes, INRA-IRD-CIRAD-SupAgro. Place
Pierre Viala, 34060 Montpellier, France
e-mail: [email protected]
123
Planta
insoluble complexes with calcium in alkaline soils, or with
iron and aluminum oxides in acidic soils. Consequently, it
is inaccessible to plants since they later meet their P
requirement by the root uptake of soil P in inorganic form
(Richardson et al. 2009). Thus, most of the P applied to soil
can be converted into unavailable forms that cannot be
easily utilized by plants. It is estimated that P availability to
plant roots is limited in two-thirds of the cultivated soils in
the world.
However, 50–80 % of the soil P exists as organic
compounds (Turner et al. 2002), with phytate as a major
constituent in soil. Organic forms of P are unavailable to
plants unless mineralization takes place. The accumulation
of phytate in soil is attributed to its invulnerability to most
phosphatases hydrolysis (Tang et al. 2006), and to its tight
adsorption to various soil components, once it is released
from plant residues or manures, because of its high negative charge (Lung and Lim 2006). Several plant species
have shown the ability of increasing the activity of phytases in the rhizosphere in response to P deficiency (Li
et al. 1997). In chickpea, significantly higher acid phosphatase (APase) activity allowed the plant to mobilize
more organic P in both hydroponic and soil cultures,
resulting in an improvement of the utilization of organic P
in maize/chickpea intercropping (Li et al. 2004).
APases form a key group of enzymes that are able to
mobilize inorganic orthophosphate (Pi) from organic P
compounds as they catalyze the hydrolysis of phosphate
esters to release Pi in acidic environment. APases are
commonly classified as constitutive if their expression is
not dependent on external Pi concentrations (Weber and
Pitt 1997) or inducible if they are expressed in response to
environmental constraints such as P deficiency. With the
exception of phytases, most APases are not substrate
dependent and are able to release Pi from various phosphorylated substrates over a wide pH range (Wyss et al.
1999). Phytases are capable of hydrolyzing phytate to a
series of lower phosphate esters of myo-inositol and
phosphate. They belong to a special group of APases with
four categories based on differences in their catalytic
mechanism: histidine acid phosphatase (HAP), cysteine
phytase, purple acid phosphatase (PAP) and b-propeller
phytase (BPP) (Mullaney and Ullah 2007).
In plants, phytate seems to play relevant roles in phosphate storage and retrieval in plant tissues, as an anti-oxidant, and as metabolic pool in inositol phosphate and
pyrophosphate pathways, in ATP regeneration, in RNA
export and DNA repair (Raboy 2003). P may be a limiting
nutrient of legumes under low-nutrient environments
because there is a substantial need for P in the N2 fixation
process (Schulze et al. 2006; Tsvetkova and Georgiev
2007). The latter is consistent with the high rates of energy
transfer that must take place in the nodule. In P. vulgaris
123
nodules, increase of phytase activities is considered as an
adaptive mechanism to tolerate P-deficient conditions
(Araújo et al. 2008). However, little is known about the
structure and functions of these enzymes. Their physiological role in P acquisition within the nodules is still
poorly understood.
Thus, the aim of the present study was to localize the
phytase gene expression in P. vulgaris nodules to better
understand the role of this enzyme in the P nutrition and
functioning. We also addressed whether the corresponding
expression level correlates with phytase activity measured
on nodule extracts, and whether it varies significantly
between two recombinant inbred lines (RILs) contrasting
in utilization of P for symbiotic nitrogen fixation (SNF).
Materials and methods
Biological material and growth conditions
This study was carried out using two RILs 115 and 147,
originating from the International Center of Tropical
Agriculture (CIAT). The RIL115 has been characterized as
P-efficient for N2 fixation, whereas RIL147 has been categorized as P-inefficient for N2 fixation based on plant
growth and seed yield in relation to the availability of P
(Drevon et al. 2011).
Seeds were surface-sterilized with 3 % calcium hypochlorite for 10 min and rinsed by five washings with sterile
distilled water. They were then transferred for germination
on soft agar with 100 ml Bergersen solution containing 5 g
mannitol and 7 g agar in 1 l of distilled water that was
sterilized at 120 °C for 20 min. After germination, the
inoculation was performed by soaking 4-day-old seedlings
for 30 min in a suspension of R. tropici CIAT 899 containing approximately 109 bacteria ml-1. The inoculum
was prepared from rhizobia culture preserved at 4 °C on
agar yeast extract mannitol medium and maintained at
28 °C for 24 h prior to inoculation.
Twenty inoculated seedlings were transferred into each
40 l container, 0.2 m large, 0.4 m long and 0.2 m high, for
hydroaeroponic pre-culture for 28 days. P was supplied
weekly in the form of KH2PO4, at 75 versus 250 lmol
plant-1 as P deficiency versus P sufficiency, to the nutrient
solution (Vadez et al. 1996). The oxygenation of the culture
solution was ensured by a permanent flow of 400 ml min-1
of compressed air. The pH was adjusted to a value of 6.8 with
CaCO3 (0.2 g l-1). A supply of urea was provided with
2 mmol plant-1 in the initial solution and 1 mmol plant-1 at
the first change of solution after 2 weeks, to optimize nodulation (Hernandez and Drevon 1991). The plants were then
grown in N-free nutrient solution. The whole experiment was
carried out in a glasshouse under temperature conditions of
Planta
28/20 °C during 16/8 h day/night cycle with an additional
illumination of 400 lmol photons m-2 s-1 and 70 % relative humidity during the day.
Phytase gene primers design
The design of the phytase gene primers was performed
online at the National Center of Biotechnology Information
(NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi). A BLAST
search was performed with the known mRNA sequence of
the phytase gene of Medicago truncatula (GenBank
accession number: AY878355.1; Xiao et al. 2005) and
Glycine max (GenBank accession number: AF272346.1;
Hegeman and Grabau 2001). Thereafter, high homologous
regions were retained and two pairs of primers were
designed for use in the in situ RT-PCR approach.
Total nodule RNA was reverse-transcribed using Moloney murine leukemia virus (M-MLV) reverse transcriptase H- (Promega, Madison, WI, USA) following the
manufacturers’ recommendations. The different primer
pairs were used to amplify gene products through 30 cycles
of 95 °C for 45 s, 60 °C for 30 s, and 72 °C for 45 °C,
with a final extension at 72 °C for 2 min, using cDNA and
gDNA as templates. The amplified bands were ligated
using bacteriophage T4 DNA Ligase and recombinant
plasmids were transformed and cloned into a pGEMÒ-T
Easy vector (Promega, Madison, WI, USA) in E. coli strain
grown in LB/ampicillin/IPTG/X-Gal plates at 37 °C for
24 h. The PCR products were sequenced (Beckman Coulter Genomics, UK) to verify the amplification of
the desired gene. We finally used the primers phytase dir
(50 -GGACATGTTCATGCCTATGAG-30 ) and phytase rev
(50 -TTCACCTCTAGAATCCCAT-30 ) to localize the
P. vulgaris gene for phytase.
In situ RT-PCR of phytase transcripts
Nodules of 3 mm diameter for each RIL and P treatment
were carefully detached from roots at 42 days after
transplantation (DAT), thoroughly washed with diethyl
pyrocarbonate (DEPC) treated water, then fixed in 4 %
(v/v) paraformaldehyde, 45 % (v/v) ethanol and 5 % (v/v)
acetic acid, kept for 2 h under vacuum, and stored overnight at 4 °C. Fixed nodules were extensively rinsed with
four washings of DEPC treated water over 30 min
(2 9 5 min and 2 9 10 min) with agitation. Thereafter,
the fixed nodules were included in low melting 9 % (m/v)
agarose dissolved in filtered phosphate-buffered saline
(PBS; 5 mM Na2HPO4, 300 mM NaCl, pH 7.5) and cut
using a microtome into 50 lm thick sections. The resulting
sections were collected into tubes containing 0.2 ml of
PBS and freed from residual agarose by three washes with
PBS at 70 °C.
For reverse transcription (RT), the fixed sections
were transferred to PCR tubes and incubated in 40 ll
RT mix containing the gene-specific reverse primer
(50 -TTCACCTCTAGAATCCCAT-30 ). The samples were
then heated at 65 °C for 5 min, transferred on ice for 2 min
and added with M-MLV reverse transcriptase followed by
incubation at 42 °C during 1 h. Negative controls were
prepared by omitting the reverse transcriptase. The reverse
transcriptase mix was removed and 40 ll of PCR mix was
added including 0.25 lM each of the gene-specific primer
pair (forward: 50 -GGACATGTTCATGCCTATGAG-30 ;
reverse: 50 -TTCACCTCTAGA ATCCCAT-30 ). Thermocycling was performed using 30 cycles of 95 °C for 30 s,
60 °C for 30 s and 72 °C for 45 s, with extension at 72 °C
for 2 min.
For the detection of the amplified cDNA, the PCR mix
was removed after amplification, and the samples were
washed three times each for 10 min in 200 ll PBS under
gentle agitation, and then incubated in 100 ll blocking
solution for 30 min under gentle agitation in darkness at
37 °C. Then the blocking solution was removed and
replaced by 100 ll of alkaline phosphatase-conjugated antidioxygenin-Fab fragment (Roche Diagnostics) diluted
1:1,000 in 2 % BSA. The samples were incubated at room
temperature for 90 min and then washed three times for
10 min in PBS to remove excess antibody. Detection of
alkaline phosphatase was carried out using the ELF-97
(enzyme-labeled fluorescent) endogenous phosphatase
detection kit (Molecular Probes, Leiden, the Netherlands).
The ELF substrate was diluted 1:40 in the alkaline detection
buffer (Molecular Probes, Leiden, the Netherlands), vigorously shaken, and then filtered through a 0.22-lm filter
(MillexÒ-GV, Millipore, Bedford, USA) to remove any
aggregates of the substrate that may have formed during
storage. Samples were incubated in 20 ll ELF substrate–
buffer solution for 20 min in the dark and transferred to
washing buffer (PBS with 25 mM EDTA and 5 mM levamisole, pH 8.0). Three washings of 1 min were performed,
before the samples were mounted. Observations were made
using an Olympus BX61Ò microscope (Olympus, Hamburg, Germany) equipped with an epifluorescence condenser, a Hoechst/DAPI filter set and gray View IIÒ camera
(ORCA AG; Hamamastu). Image analysis was performed
using ImageJ software as an image analysis program.
Phytase and APase assays
Samples of nodules of 3 mm diameter of each plant corresponding to 60 mg of nodules fresh weight were carefully detached from roots at 42 DAT. Each nodule sample
was ground in vibrating mill (FastPrepÒ-24) with an
extraction mixture consisting of 900 ll sodium acetate
buffer (50 mM, pH 5.5) containing 5 mM dithiothreitol.
123
Planta
The material was centrifuged at 22,000g during 6 min, and
three aliquots of 100 ll of the supernatant were taken for
enzyme assays.
For APase activity, 100 ll of nodule crude extract was
incubated during 20 min at 37 °C with a mixture of 300 ll
acetate buffer (0.2 M, pH 5.5) and 100 ll p-nitrophenyl
phosphate (p-NPP). The reaction was stopped by the
addition of 500 ll of 1 N NaOH, and the APase activity
was measured spectrophotometrically at 410 nm wavelength. APase activity was defined as the amount of protein
hydrolyzing 1 nmol of p-NPP per minute per gram of fresh
nodule.
For phytase activity, 100 ll of nodules crude extract was
incubated for 90 min at 37 °C with a mixture of 300 ll
sodium acetate buffer (0.2 M, pH 5.5) and 100 ll of substrate (phytic acid 0.2 % as corn sodium salt sigma CAS
14306-25-3). The reaction was stopped by the addition of
0.5 ml of 10 % trichloroacetic acid, and the mixture was
centrifuged at 20,000g for 6 min. Another aliquot of 100 ll
of nodule extract received 300 ll sodium acetate buffer
(0.2 M, pH 5.5) and 100 ll of the phytic acid substrate, but
the reaction was stopped immediately without incubation
and the mixture was centrifuged. Concentration of Pi in the
extracts was measured spectrophotometrically at 630 nm
using malachite green. The phytase activity was calculated
as the difference between the Pi in the extracts with and
without incubation and expressed in nmol of Pi released
per minute per gram of nodule fresh mass.
same letter were designated as not significantly different at
the level of 5 % probability. The relationship between
nodule and shoot biomass was tested by regression
analysis.
Results
Localization of phytase gene expression
In the phylogenetic tree (Fig. 1) constructed by the
neighbor joining method, the phytase cDNA sequence of P.
vulgaris was found in the class of PAP phytase and had
96 % identity with PAP phytase characterized in Vigna
radiata, 93 % identity with PAP phytase characterized in
Plant P and N contents and statistical analysis
Plants were harvested at 42 DAT, and shoots, roots and
nodules dry weights were determined after drying for
3 days at 70 °C. Thereafter, dry samples were ground to a
fine powder in a vibrating mill for determination of plant
and nodules P and N contents. Dry weight samples of
50 mg of shoots and nodules were digested in concentrated
HNO3 in microwave oven (ETHOS, Milestone) at 40 bars
for 15 min for subsequent colorimetric dosage with vanado-molybdate in spectrophotometer at 460 nm wavelength.
For N determination, dry weight samples of 1.5 ± 0.5 mg
(nodules) and of 2 ± 0.5 mg (shoots) were analyzed using
mass spectrometer.
The efficiency in use of the rhizobial symbiosis (EURS)
was estimated by the slope of the regression model of shoot
biomass as a function of nodule biomass (y = ax ? b),
where a corresponds to the EURS and b corresponds to the
plant biomass production without nodules (Zaman-Allah
et al. 2007).
Statistical analysis was performed by the R (2.11.0)
software. The data were analyzed using ANOVAs and
subsequent comparison of means was performed using the
Fisher’s LSD test at 5 % probability. Data followed by the
123
Fig. 1 Phylogenetic analysis of phytase sequences. The plant
sequences, accession numbers, and percentage identities to the
phytase cDNA sequence of P. vulgaris L. are: Vigna radiate PAP,
EU871632.1, 96 %; Glycine max clone GmPhy07 phytase,
GQ4227774.1, 93 %; Glycine max phytase (LOC547600),
NM_001248259.1, 93 %; Glycine max phytase mRNA,
AF272346.1, 93 %; Glycine max gene, EU715238.1, 93 %; Lupinus
albus mRNA for phytase, AB508806.1, 89 %, respectively. The
phytase cDNA sequence of P. vulgaris L. is: TTCATGCCTATGA
GAGGTCCAATCGGGTTTACAATTACAGTTTAGATCCATGTG
GTCCTGTCCATATTGCAGTTGGGGATGGGGGTAACAGAGA
GAAGATGGCAATCAAATTTGCAGACGAGCCTGGTCATTGT
CCTGATCCATTAAGTACTCCTGATCCTTATATGGGTGGCTT
TTGTGCAACAAATTTTACATTTGGTCCAGAGAGTGAGTTTT
GTTGGGATCACCAGCCAGATTACAGTGCTTTCAGAGAAACT
AGCTTTGGCTATGGGATTCTAGAGGTGAAAATCAC
Planta
Fig. 2 In situ localization of phytase transcript (green spot) in nodule
of two common bean RILs 115 (a, c, e) and 147 (b, d, f) inoculated
with R. tropici CIAT899 and grown under P sufficient (c, d) and
P-deficient conditions (e, f). a, b The negative controls (without
reverse transcription). IZ infected zone, VT vascular trace, IC inner
cortex, E endodermis, OC outer cortex
G. max and 89 % identity with PAP phytase characterized
in Lupinus albus.
The data in Fig. 2 show that gene phytase was expressed
in the cell layers between the vascular traces and the
infected zone, namely the inner cortex of nodule, and to a
less extent in non-infected cells of the infected zone.
Under P sufficiency, the fluorescent signal, as assessment of number of transcripts, had similar intensity in both
RILs even though the signal seemed to be slightly more
intense for RIL115 (Fig. 2c, d). P deficiency increased the
fluorescent signal in nodules of both RILs though the
increase was more than two-fold higher for RIL115 than
for RIL147 (Fig. 2e, f).
APase activity showed the same trend as phytase
(Fig. 3b), with a significant (p \ 0.05) increase under P
deficiency for both RILs.
Phytase and APase activities
Under P sufficiency, both RILs showed similar phytase
activity in their nodule extracts (Fig. 3a). This activity
increased significantly (p \ 0.05) under P deficiency,
though this effect was more pronounced for RIL115 (33 %)
than for RIL147 (13 %).
Phosphorus use efficiency for SNF
Results in Fig. 3c show that under P sufficiency, nodule
total P content was higher for RIL115 (7.3 mg g-1 dry weight) than for RIL147 (6.8 mg g-1 dry weight). P deficiency decreased nodule total P content for both RILs,
though this decrease was significant (p \ 0.05) for RIL115,
only. The quantity of nitrogen fixed by plant was higher for
both RILs under P sufficiency than P deficiency (Fig. 3d).
However, the negative impact of P deficiency was more
pronounced for RIL147 (30 %) than for RIL115 (16 %).
To assess the variability in phosphorus use efficiency
(PUE) for SNF, the ratio of N2 fixed per nodule total P
content was calculated. This parameter had previously been
shown to vary with P supply (Vadez et al. 1999). Under P
sufficiency, PUE for SNF was comparable for both RILs
with a mean of 23 mg N2 fixed/mg-1 nodule P. P
123
Planta
b Fig. 3 Phytase (a), APase (b) activities, total P content (c), N2 fixed
(d), nodule (e) and shoot (f) biomass of common bean RILs 115 and
147 inoculated with R. tropici CIAT899 and grown under sufficient
(white) versus deficient (gray) P supply. Data are mean and standard
deviation of five replicates harvested at 42 DAT. Mean values labeled
with the same letter were not significantly different at P \ 0.05
deficiency induced an increase of this ratio from 26 to
32 mg N2 fixed/mg-1 nodule P from RIL147 to RIL115.
Efficiency in use of the rhizobial symbiosis for plant
growth
Nodule biomass as the best parameter for nodulation
assessment did not show significant variation between the
two RILs under P sufficiency, although there was a trend of
higher nodule biomass for RIL115 (Fig. 2e). P deficiency
decreased nodule biomass for both RILs though in higher
extent for RIL147 (38 %) than for RIL115 (19 %)
(Fig. 3e). Thus, under P deficiency, nodule biomass was
higher for RIL115 than for RIL147.
Regarding growth, shoot biomass was significantly
(p \ 0.05) higher for RIL115 than for RIL147 under P
sufficiency (Fig. 3f). P deficiency decreased this parameter
for both RILs, though this effect was more pronounced for
RIL147 (32 %) than for RIL115 (18 %). Overall, there was
a significant (p \ 0.05) reduction of nodulation and shoot
biomass for both RILs under P deficiency. However, the
decrease in both nodule and shoot biomass was higher for
the RIL147 than for RIL115.
The EURS was evaluated by testing the correlation
between plant and nodule biomass as illustrated in Fig. 4
with the regression slope as an estimate of the EURS.
Shoot and nodule biomass of the RILs 115 and 147 were
positively correlated (up to R2 = 0.76) under both P
treatments. Under P sufficiency, the RIL115 was the most
efficient, whereas P deficiency decreased the EURS similarly for both RILs by ca. 33 %.
Discussion
Our detection of a phytase transcript in common bean
nodules (Fig. 1) is, to our knowledge, the first observation
of this gene expression among APase genes that are known
to be over expressed in legume nodules in response to P
deficiency. Although all PAP genes may not exhibit phytase activity (Bozzo et al. 2004), the localization in the
phylogenic tree (Fig. 1) of the cDNA sequence that we
amplified from bean nodule among the 29 (Li et al. 2002)
and 35 (Li et al. 2012) PAP genes is found in Arabidopsis
and soybean genomes. In addition, the positive correlation
between phytase activity (Fig. 3a) and signal intensity of
123
Planta
Fig. 4 Efficiency in use of the rhizobial symbiosis (EURS) of
common bean RILs 115 and 147 inoculated with R. tropici CIAT899
and grown under sufficient (white) versus deficient (gray) P supply.
Data are mean and standard deviation of five replicates harvested at
42 DAT
PAP transcript (Fig. 2) in nodules substantiates that the
cDNA we have sequenced does correspond to a phytase.
This nodule phytase activity is excluded to be due to R.
tropici CIAT 899 in this symbiosis since none of the four
families of microbial phytase (Lim et al. 2007) was found
in a BlastP search of the R. tropici CIAT 899 genome
(Ormeño-Orrillo et al. 2012). The increase in phytase
transcripts under P deficiency in nodules of both RILs
(Fig. 2e, f) is consistent with the increase in nodule phytase
and total APase activities (Fig. 3a, b), and agrees with
results of Araújo et al. (2008). Also, the higher value of
nodule phytase activity for bean RIL115 suggests that
phytase may be involved in the tolerance of rhizobial
symbiosis to P deficiency. The later may constitute an
adaptative mechanism for N2-fixing legumes to P deficiency by increasing the utilization of the scarce P within
nodules. Thus, this plant phytase might play a role for
internal plant metabolism. This contrasts with secreted
phytases that were unable to release Pi from phytates fixed
to various soil components although they could hydrolyze
soluble phytates supplied in agar (Tang et al. 2006).
The high level of phytase transcripts in inner cortex cells
and infected cells next to the inner cortex (Fig. 2e, f)
suggests a functional role in supplying large amount of Pi
for nodule function. P partitioning between plant cell and
bacteroids may respond to bacteroidal requirement for
metabolism and survival, as well as bacteria multiplication
during growth and ramification of infection thread. Furthermore, phytase expression in the inner cortex may play a
role in the dependence of SNF upon O2 flux (Hunt and
Layzell 1993; Minchin 1997) that is postulated to be osmoregulated (Schulze and Drevon 2005). Thus, the increase in
APase activity in nodule under P deficiency may enlarge
the availability of Pi for plant and bacteria. This agrees
with the conclusion that optimum symbiotic interaction
between the host-plant and rhizobia depends on an efficient
allocation and use of available P (Israel 1987). Indeed, the
hydrolysis of phosphate esters by APases is a critical
process in the energy metabolism and metabolic regulation
of plant cell (Duff et al. 1994; Bozzo et al. 2002), including
in nodules where at least 16 ATPs are consumed per N2
reduced (Salsac et al. 1984). Also Vincent et al. (1992)
concluded that APases activities affect P remobilization in
plants and play major roles in PUE under P deficiency.
Also Duff et al. (1994) suggested that vacuolar APase in
plants is involved in routine utilization of Pi reserves or
other P-containing compounds. Under P deficiency, the
correlation of high phytase enzyme activity and transcripts,
especially in inner cortex, with increases in EURS (Fig. 4)
suggests high regulation between EURS and the nodule P
requirement (Fig. 3c), probably in relation to the high
energy requirement of the SNF process. This is substantiated by the significant correlation between PUE for N2
fixation and nodule APase activity for the RILs and the
higher slope of this relation for RIL115 than RIL147, under
P deficiency.
Overall, our results suggest that the high tolerance of the
RIL115 to P deficiency, as compared to RIL 147, is associated with better capacity to maintain SNF under low
supply of P in relation with the capacity of RIL115 to
maintain a higher phytase activity. We conclude that the
effect of phytase expression and activity in nodules on SNF
is worthy of investigation to better understand the adaptation of nodulated beans to low-P soils, and that the in situ
RT-PCR might be a powerful tool to localize and quantify
the expression of genes involved in the nodule functioning.
Acknowledgments This work was supported by the Great Federative Project of Agropolis named FABATROPIMED under the reference ID 1001-009 and framework of Algeria-French cooperation
AUF-PCSI 63113PS012 for the stay of Mohamed Lazali in Montpellier. The authors thank Saber Kouas, Claude Plassard and Catherine Pernot (INRA Montpellier, France) for their assistance.
References
Araújo AP, Plassard C, Drevon JJ (2008) Phosphatase and phytase
activities in nodules of common bean genotypes at different
levels of phosphorus supply. Plant Soil 312:129–138
123
Planta
Bozzo GG, Raghothama KG, Plaxton WC (2002) Purification and
characterization of two secreted purple acid phosphatase
isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures. Eur J Biochem 269:6278–6286
Bozzo GG, Raghothama KG, Plaxton WC (2004) Structural and
kinetic properties of a novel purple acid phosphatase from
phosphate-starved tomato (Lycopersicon esculentum) cell cultures. Biochem J 377:419–428
Drevon JJ, Alkama N, Araújo A, Beebe B, Blair MW, Hamza H,
Jaillard B, Lopez A, Martinez-Romero E, Rodino P, Tajini F,
Zaman-Allah M (2011) Nodular diagnosis for ecological engineering of the symbiotic nitrogen fixation with legumes. Proc
Environ Sci 9:40–46
Duff SMG, Sarath G, Plaxton WC (1994) The role of acid
phosphatase in plant phosphorus metabolism. Physiol Plant 90:
791–800
Hegeman CE, Grabau EA (2001) A novel phytase with sequence
similarity to purple acid phosphatases is expressed in cotyledons
of germinating soybean seedlings. Plant Physiol 126:1598–1608
Hernandez G, Drevon JJ (1991) Influence of oxygen and acetylene
during in situ open-flow assays of nitrogenase activity (C2H2
reduction) in Phaseolus vulgaris root nodules. J Plant Physiol
138:587–590
Hunt S, Layzell DB (1993) Gas exchange of legume nodules and the
regulation of nitrogenase activity. Ann Rev Plant Physiol Plant
Mol Biol 44:483–511
Israel DW (1987) Investigation of the role of phosphorus in symbiotic
dinitrogen fixation. Plant Physiol 84:835–840
Li M, Osaki M, Rao IM, Tadano T (1997) Secretion of phytase from
the roots of several plant species under phosphorus-deficient
conditions. Plant Soil 195:161–169
Li D, Zhu H, Liu K, Liu X, Leggewie G, Udvardi M, Wang D (2002)
Purple acid phosphatases of Arabidopsis thaliana. Comparative
analysis and differential regulation by phosphate deprivation.
J Biol Chem 277:27772–27781
Li SM, Li L, Zhang FS, Tang C (2004) Acid phosphatase role in
chickpea/maize intercropping. Ann Bot 94:297–303
Li C, Gui S, Yang T, Walk T, Wang X, Liao H (2012) Identification
of soybean purple acid phosphatase genes and their expression
responses to phosphorus availability and symbiosis. Ann Bot
109:275–285
Lim BL, Yeung P, Cheng C, Hill JE (2007) Distribution and diversity
of phytate-mineralizing bacteria. ISME J 1:321–330
Lung SC, Lim BL (2006) Assimilation of phytate-phosphorus by the
extracellular phytase activity of tobacco (Nicotiana tabacum) is
affected by the availability of soluble phytate. Plant Soil
279:187–199
Minchin FR (1997) Regulation of O2 diffusion in legume nodules.
Soil Biol Biochem 29:881–888
Mullaney EJ, Ullah AHJ (2007) Phytases: attributes, catalytic
mechanisms and applications. In: Turner BL, Richardson AE,
Mullaney EJ (eds) Inositol phosphates: linking agriculture and
the environment. CAB International, UK, pp 97–110
123
Ormeño-Orrillo E, Menna P, Almeida LGP, Ollero FJ, Nicolás MF,
Rodrigues EP, Nakatani AS, Batista JSS, Chueire LMO, Souza
RC, Vasconcelos ATR, Megı́as M, Hungria M, MartinezRomero E (2012) Genomic basis of broad host range and
environmental adaptability of Rhizobium tropici CIAT 899 and
Rhizobium sp. PRF 81 which are used in inoculants for common
bean (Phaseolus vulgaris L.). BMC Genomics 13:735
Raboy V (2003) Myo-inositol-1,2,3,4,5,6-hexakisphosphate. Phytochemistry 64:1033–1043
Richardson AE, Hocking PJ, Simpson RJ, George TS (2009) Plant
mechanisms to optimize access to soil phosphorus. Crop Pasture
Sci 60:124–143
Salsac L, Drevon JJ, Zengbe M, Cleyet-Marel JC, Obaton M (1984)
Energy requirement of symbiotic nitrogen fixation. Physiololgie
Vegetale 22:509–521
Schulze J, Drevon JJ (2005) P-deficiency increases the O2 uptake per
N2 reduced in alfalfa. J Exp Bot 56:1779–1784
Schulze J, Temple G, Temple SJ, Beschow H, Vance CP (2006)
Nitrogen fixation by white lupin under phosphorus deficiency.
Ann Bot 98:731–740
Tang J, Leung A, Leung C, Lim BL (2006) Hydrolysis of precipitated
phytate by three distinct families of phytases. Soil Biol Biochem
38:1316–1324
Tsvetkova GE, Georgiev GI (2007) Changes in phosphate fractions
extracted from different organs of phosphorus starved nitrogen
fixing pea plants. J Plant Nutr 30:2129–2140
Turner BL, Paphazy MJ, Haygarth PM, Mckelvie ID (2002) Inositol
phosphates in the environment. Phil Trans R Soc Lond B
357:449–469
Vadez V, Rodier F, Payre H, Drevon JJ (1996) Nodule permeability
to O2 and nitrogenase-linked respiration in bean genotypes
varying in the tolerance of N2 fixation to P deficiency. Plant
Physiol Biochem 34:871–878
Vadez V, Lasso JH, Beck DP, Drevon JJ (1999) Variability of
N2-fixation in common bean (Phaseolus vulgaris L.) under P
deficiency is related to P use efficiency. Euphytica 106:231–242
Vincent JB, Crowder MW, Averill BA (1992) Hydrolysis of
phosphate monoesters: a biological problem with multiple
chemical solutions. Trends Biochem Sci 17:105–110
Weber RWS, Pitt D (1997) Purification, characterization and exit
routes of two acid phosphatases secreted by Botrytis cinerea.
Mycol Res 101:1431–1439
Wyss M, Brugger R, Kronenberger A, Remy R, Fimbel R, Oesterhelt
G, Lehmann M, van Loon APGM (1999) Biochemical characterization of fungal phytases (myo-inositol hexakisphosphate
phosphohydrolases): catalytic properties. App Environ Microbio
65:367–373
Xiao K, Harrison MJ, Wang ZY (2005) Transgenic expression of a
novel M. truncatula phytase gene results in improved acquisition
of organic phosphorus by Arabidopsis. Planta 222:27–36
Zaman-Allah M, Sifi B, L’Taief B, El-Aouni MH, Drevon JJ (2007)
Symbiotic response to low phosphorus supply in two common
bean (Phaseolus vulgaris L.) genotypes. Symbiosis 44:109–113