Available online at www.sciencedirect.com
Biochimica et Biophysica Acta 1779 (2008) 3 – 16
www.elsevier.com/locate/bbagrm
Review
Human chromosome fragility
T. Lukusa, J.P. Fryns ⁎
Center for Human Genetics, University of Leuven, Herestraat 49, B-3000 Leuven, Belgium
Received 6 February 2007; received in revised form 2 October 2007; accepted 3 October 2007
Available online 3 December 2007
Abstract
Fragile sites are heritable specific chromosome loci that exhibit an increased frequency of gaps, poor staining, constrictions or breaks when
chromosomes are exposed to partial DNA replication inhibition. They constitute areas of chromatin that fail to compact during mitosis.
They are classified as rare or common depending on their frequency within the population and are further subdivided on the basis of their specific
induction chemistry into different groups differentiated as folate sensitive or non-folate sensitive rare fragile sites, and as aphidicolin, bromodeoxyuridine
(BrdU) or 5-azacytidine inducible common fragile sites. Most of the known inducers of fragility share in common their potentiality to inhibit the
elongation of DNA replication, particularly at fragile site loci.
Seven folate sensitive (FRA10A, FRA11B, FRA12A, FRA16A, FRAXA, FRAXE and FRAXF) and two non-folate sensitive (FRA10B and
FRA16B) fragile sites have been molecularly characterized. All have been found to represent expanded DNA repeat sequences resulting from a dynamic
mutation involving the normally occurring polymorphic CCG/CGG trinucleotide repeats at the folate sensitive and AT-rich minisatellite repeats at the
non-folate sensitive fragile sites. These expanded repeats were demonstrated, first, to have the potential, under certain conditions, to form stable
secondary non-B DNA structures (intra-strand hairpins, slipped strand DNA or tetrahelical structures) and to present highly flexible repeat sequences,
both conditions which are expected to affect the replication dynamics, and second, to decrease the efficiency of nucleosome assembly, resulting in
decondensation defects seen as fragile sites. Thirteen aphidicolin inducible common fragile sites (FRA2G, FRA3B, FRA4F, FRA6E, FRA6F, FRA7E,
FRA7G, FRA7H, FRA7I, FRA8C, FRA9E, FRA16D and FRAXB) have been characterized at a molecular level and found to represent relatively ATrich DNA areas, but without any expanded repeat motifs. Analysis of structural characteristics of the DNA at some of these sites (FRA2G, FRA3B,
FRA6F, FRA7E, FRA7G, FRA7H, FRA7I, FRA16D and FRAXB) showed that they contained more areas of high DNA torsional flexibility with more
highly AT-dinucleotide-rich islands than neighbouring non-fragile regions. These islands were shown to have the potential to form secondary non-B
DNA structures and to interfere with higher-order chromatin folding. Therefore, a common fragility mechanism, characterized by high flexibility and the
potential to form secondary structures and interfere with nucleosome assembly, is shared by all the cloned classes of fragile sites.
From the clinical point of view, the folate sensitive rare fragile site FRAXA is the most important fragile site as it is associated with the fragile X
syndrome, the most common form of familial mental retardation, affecting about 1/4000 males and 1/6000 females. Mental retardation in this syndrome
is considered as resulting from the abolition of the FMR1 gene expression due to hypermethylation of the gene CpG islands adjacent to the expanded
methylated trinucleotide repeat. FRAXE is associated with X-linked non-specific mental retardation, and FRA11B with Jacobsen syndrome. There is
also some evidence that fragile sites, especially common fragile sites, are consistently involved in the in vivo chromosomal rearrangements related to
cancer, whereas the possible implication of common fragile sites in neuropsychiatric and developmental disorders is still poorly documented.
© 2007 Elsevier B.V. All rights reserved.
Keywords: Rare fragile site; Common fragile site; CCG/CGG trinucleotide repeat; AT-rich minisatellite repeat; Dynamic mutation; DNA torsional flexibility
1. Introduction
The first description of non-random human chromosome fragility was reported in 1965 in cells from a woman previously
⁎ Corresponding author. Tel.: +32 16 345899; fax: +32 16 346051.
E-mail address: [email protected] (J.P. Fryns).
1874-9399/$ - see front matter © 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.bbagrm.2007.10.005
irradiated [1]. To date, according to the Genome Database and to
the recent review by Schwartz et al. [2], more than 120 different
fragile sites have been identified in the human genome. These
sites can be defined as heritable specific loci on human chromosomes that exhibit non-random gaps, constrictions or breaks
when chromosomes are exposed to specific cell culture conditions
[2–5].
4
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
Fragile sites are classified as rare or common, according to
their expression frequency within the population [2,6,7]. Rare
fragile sites are seen in the chromosomes of only a small fraction
(b5%) of the population, whereas common fragile sites are
considered to be an intrinsic part of the normal chromosome
structure as they appear to be present in all individuals.
Fragile sites in each category are further classified according to
their specific mode of induction in vitro, i.e. their culture requirements [6,7]. Rare fragile sites are subdivided into folate sensitive and non-folate sensitive fragile sites. Folate sensitive rare
fragile sites are induced by thymidylate stress, whereas non-folate
sensitive ones are obtained after exposure to distamycin A (distamycin A-inducible) or to bromodeoxyuridine (BrdU-requiring).
Most of the common fragile sites are induced by aphidicolin
(aphidicolin inducible), whereas others are BrdU inducible (addition of BrdU) or 5-azacytidine inducible (addition of 5-azacytidine). In any way, significant cytogenetic expression of all
known fragile sites requires an induction process during tissue
culture, with the exception of some cases of spontaneously expressed FRA16B and FRA17A. On the other hand, the proportion
of cells with visible fragile sites after induction is never 100%,
apart from FRA16B under some culture conditions [8]. It is
essential to underline that all the inducers of fragile sites can
potentially stop elongation of DNA replication. In practice, only
concentrations that partially inhibit the replication without
arresting the cell cycle are used [3–5].
It has been shown that, after in vitro induction, fragile sites
were often involved in deletions and translocations [9,10], in
sister chromatid exchanges [11–16], in intrachromosomal gene
amplification [17] and in plasmid integration [18]. They were also
found to be involved in the in vivo occurrence of duplications and
amplifications [19–21] or other chromosomal changes associated
with human congenital diseases [22,23]. There is also some
evidence that these loci are involved in the in vivo chromosomal
rearrangements related to tumour: some fragile sites, especially
common sites, have been found to colocalize with breakpoints
resulting in in vivo deletions [24–28] and translocations [29–31]
in various tumours.
The understanding of the mechanism and the molecular basis
of fragile sites is thus highly important for the comprehension
and management of a series of human pathologies.
Here we give an overview of the different categories of fragile
sites, their known molecular basis and their clinical significance
in human genetic diseases.
Examples of individuals with more than one expressed rare fragile
sites are known [36,37].
2.1. Folate sensitive rare fragile sites
The majority of the rare fragile sites (24/31) are folate
sensitive (Table 1), being induced either by a culture medium
deficient in folic acid and thymidine, and hence a medium with
lowered levels of dTTP or dCTP, two immediate components of
DNA, or by a medium enriched either in methotrexate, an
inhibitor of folate metabolism, or in fluorodeoxyuridine (FrdU),
an inhibitor of thymidylate synthesis [38]. Since expression of
these fragile sites requires lowered levels of components involved in DNA synthesis, it was considered that these sites
might be regions with special sequence composition which,
under these induction conditions, could not allow completion of
DNA synthesis simultaneously with the surrounding regions
[39]. Further replication analysis at the folate sensitive fragile
sites Xq27.3 and Xq28 revealed that the genomic regions in
normal alleles undergo replication very late in the S phase, while
the replication of these genomic regions in alleles expressing the
fragile sites was further delayed into G2, especially under thymidylate stress conditions. The domain of the delayed replication
was large, expanding approximately along 1 Mb (FRAXA) and
300 kb (FRAXE) of DNA at the fragile site region [40,41].
Table 1
Classification of rare fragile sites
Sub-group
Fragile site
Location
Folate sensitive (n = 24)
FRA1M
FRA2A
FRA2B
FRA2K
FRA2L
FRA5G
FRA6A
FRA7A
FRA8A
FRA9A
FRA9B
FRA10A
FRA11A
FRA11B
FRA12A
FRA12D
FRA16A
FRA18C
FRA19B
FRA20A
FRA22A
FRAXA
FRAXE
FRAXF
FRA8E
FRA11I
FRA16E
FRA16B
FRA17A
FRA10B
FRA12C
1p21.3
2q11.2
2q13
2q22.3
2p11.2
5q35
6p23
7p11.2
8q22.3
9p21
9q32
10q23.3
11q13.3
11q23.3
12q13.1
12q24.13
16p13.11
18q22.1
19p13
20.11.23
22q13
Xq27.3
Xq28
Xq28
8q24.1
11p15.1
16p12.1
16q22.1
17p12
10q25.2
12q24.2
2. Rare fragile sites
Up to date, 31 rare fragile sites have been documented in
different specific families [2] where they segregate in a Mendelian
codominant fashion, with an incidence ranging from one in several thousands to one in 20 individuals [6,32]. The rare FRA1M
(1p21.3) has been reported only once [33]. The population
frequency of cytogenetic expression of rare fragile sites is variable: 1/80 chromosomes for FRA10B in the Australian population
[34], about 1/40 chromosomes (0.027) for FRA16B in the German
population [35]. The FRA16B can be expressed in almost 100% of
metaphases when induced with berenil in some carriers [7].
Distamycin A-inducible (n = 3)
Distamycin A/BrdU inducible (n = 2)
BrdU requiring (n = 2)
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
2.1.1. Molecular basis
Up to now, seven folate sensitive fragile sites have been
characterized at the molecular level: FRA10A at 10q23.3 [42],
FRA11B at 11q23.3 [22], FRA16A at 16p13.11 [43], FRAXA
at Xq27.3 [44–47], FRAXE at Xq28 [48], FRAXF at Xq28
[49,50] and, more recently, FRA12A at 12q13.1 [51]. All have
been found to represent loci with expansive mutations of the
normally occurring CCG/CGG trinucleotide repeat sequences
adjacent to a CpG island [7,32,52]. In fact, normal alleles at
these loci have short tracts of CCG/CGG repeats, with a copy
number variation between individuals: 4–55 copies for
FRAXA [45], 6–25 for FRAXE [48], 6–38 for FRAXF
[49,50,53], 8–13 for FRA10A [42], 8–80 for FRA11B [22], 6–
23 for FRA12A [51] and 16–50 for FRA16A [43]. These repeat
sequences undergo progressive increases in copy number,
possibly due to failure of mismatch repair, to unequal crossing
over or to replication slippage [7,54,55]. This expansion is
unstable and dependent upon the length of the repeat tract: the
longer the tract, the higher the instability and probability of
further expansion. Also, the purity of the repeats favours the
instability: most stable alleles in the FRAXA loci are composed
of CCG/CGG repeats interspersed with AGG triplets which are
believed to have a stabilizing effect, while alleles with
expanded 3′ or 5′ CCG/CGG arrays that show fewer or no
such interruptions exhibit the greatest instability in repeat copy
number [56–63]. This progressive process constitutes a
“dynamic mutation”. It results in a repeat-copy number
polymorphism. At a certain moment, the copy number reaches
a level above the normal range, but not enough to cause
fragility expression (55–230 for FRAXA, 50–200 for FRAXE,
85–100 for FRA11B, 50–200 for FRA16A). During this
“premutation phase”, the CCG/CGG repeats become highly
unstable when transmitted to the next generation. The offspring
may then have a longer or a shorter extension of the repeat
sequence than the parent. Once the copy number passes a
critical limit (N 230 repeats for FRAXA), it becomes a full
mutation. At least in the case of FRAXA, this expansion of a
premutation into a full mutation appears to occur exclusively in
the female ovary during oogenesis [55]. Indeed, maternal
premutation repeat size is known to be positively correlated
with the risk of full mutation in the offspring, whereas paternal
premutation repeat size is positively correlated with the
offspring's repeat size. This led to the hypothesis that a
premeiotic selection against germ cells that contain the full
mutation in favour of those containing a premutation occurs in
the male fetus testis whereas full mutations persist in the ovary
of the female fetus [64].
As a consequence of the repeat expansion, the adjacent CpG
island is hypermethylated [7,43]. Normally, the adjacent CpG
island is completely methylated in full mutations [45], and
hypermethylation of the CpG island neighbouring the expanded
CCG/CGG repeats appears to be a requirement for the fragility
expression [22,43,45,65,66].
In summary, expression of the rare folate sensitive fragile
sites has at least two requirements: a methylated fully mutated
CCG/CGG repeat and a limiting concentration of either dTTP
or dCTP at the time of DNA synthesis.
5
2.1.2. Mechanisms for cytogenetic expression
The cytogenetic expression of the fragility at these sites has
been postulated to be determined by at least three intrinsic
characteristics of the expanded trinucleotide repeat sequences.
First, expanded single strand CCG/CGG repeat sequences can
form stable secondary non-B DNA structures such as intrastrand hairpins [67–69], slipped strand DNA or S-DNA [70,71]
or tetrahelical structures [72]. This propensity to form stable,
unusual DNA secondary structures is dependent on the length of
the repeat tract and on its purity [68,71,73], in the same way as
for the repeat expansion process. The resulting non-B DNA
structures have been shown to perturb the elongation of DNA
replication, i.e. to affect the replication dynamics in vitro and in
vivo [74,75]. Second, conformational investigations conducted
on DNA fragments containing CGG/CCG triplet repeat sequences demonstrated that these repeats are more flexible and
writhed than random B-DNA. Highly flexible trinucleotide
repeat sequences are expected to perturb the replication process
by acting as sinks for the accumulation of superhelical density
generated in front of the progressing replication fork [76,77].
Third, it was shown that the elongation of CCG/CGG trinucleotide repeat tract strongly decreases the efficiency of nucleosome assembly in vitro [78] and that this effect was further
enhanced by the methylation of these repeats [79]. This results
in decondensation defects at the fragile sites, which cytogenetically manifest as gaps or constrictions.
2.1.3. Clinical significance
Only two folate sensitive rare fragile sites are of proven clinical
significance. Indeed, the expression of gonosomal FRAXA
(Xq27.3) and FRAXE (Xq28) are associated with mental retardation, whereas the expressions of FRA10A (10q23.3), FRA12A
(12q13.1) and FRA16A (16p13.11) have not yet been shown to
correlate with any disease [6,43,80]. FRAXF (X28) was first
identified in a family with developmental delay [81]. However, no
consistent association with any specific phenotype could be
unequivocally established after further investigations of this third
gonosomal fragile site as a causative factor in non-specific or in
syndromic mental retardation, in autism or in other pervasive
developmental disorders [82,83]. It is now considered as a rare
fragile site with no associated pathological phenotype [84]. A
third folate sensitive rare fragile site, the autosomal FRA11B, is
possibly implicated in the generation of abnormal offsprings.
Indeed, the chromosomal deletion in a proportion of patients with
Jacobsen syndrome maps at 11q23.3, where this fragile site is
located [22,23,65], indicating that this rare fragile site could have
caused instability and constitutional chromosomal breakage in
vivo [22]. However, FRA11B has been estimated to be carried
only by 1 in 5000 individuals [8], and the majority of Jacobsen
syndrome deletion breakpoints have been found to map away
from the FRA11B [85,86].
FRAXA is the most important of the fragile sites with a well
documented clinical impact: it is associated with the fragile X
syndrome (FRAXA syndrome), the most common form of familial severe mental retardation [46,87], affecting about 1/4000
males and 1/6000 females [88]. The prevalence of female premutation carriers is 1/260 in the general population [89]. The
6
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
defective gene in this syndrome, the FMR1 [46,90], has been
found to be involved in 15–20% of all X-linked forms of mental
retardation (XLMR) [88]. Fragile X patients with intragenic
deletions [91,92] or point mutations [93] in the FMR1 gene have
been identified, hereby demonstrating that fragile X syndrome is
in fact a single gene disorder resulting from extinction of FMR1
function, whatever the involved pathogenic mechanism.
FRAXE is associated with X-linked non-specific mental
retardation (MRX), a mild form of mental retardation [48,94,95],
and FMR2 is the defective gene in these patients [96].
In FRAX patients, the CCG/CGG repeat is in the 5′ untranslated (5′UTR) region located 250 bp distal to the CpG island of
the FMR1 gene [45,97]. Its expansion leads to CpG island
hypermethylation which is the major determinant in abolishing
the FMR1 gene expression [98], with loss of transcription,
absence of FMR1 mRNA and subsequent absence of the FMRP,
the encoded protein of this gene. This lack of FMRP protein is
considered as responsible for the mental retardation in the
fragile X syndrome [99–101].
Similarly, in FRAXE patients, amplification of the CCG/
CGG repeat located in the 5′ untranslated region next to the
CpG island of the FMR2 gene leads to hypermethylation of this
CpG island with subsequent silencing of the gene and mild
mental retardation [48,95,96,102].
The fragile X syndrome is an X-linked semidominant disorder,
with the presence of clinical manifestations in all male carriers of
full mutation and in about 35% of female heterozygous carriers of
full mutation. Females are usually less severely affected than
males, presumably because of X-inactivation [103]. The most
prominent phenotypic feature is mental retardation. The other
clinical characteristics mainly include a long face with prominent
mandible, large ears, macro-orchidism in postpubertal males and
abnormal behaviour with hyperactivity, short attention span, poor
eye contact and stereotypic behaviour. A few other manifestations
have also been recorded: epilepsy, strabismus, finger joint hyperextensibility, pectus excavatum and heart mitral valve prolapse.
Normally, premutation carriers of FRAXA and FRAXE
should not have clinical expression, given that their repeat sequence is not methylated and can be transcribed and produce
protein. Nevertheless, an association has been established between FRAXA premutation and premature ovarian failure (POF).
Indeed, in fragile X families, up to 20–25% of female FRAXA
premutation carriers are susceptible to premature ovarian failure
(POF) while full mutation carriers do not appear to present with
such a risk [63,104–107]. A similar association was ascertained
when screening women with POF: FRAXA premutation was
found up to ten times more frequently than expected [108–110]. It
was first suggested that such a risk was just correlated to paternally inherited premutation [107], but such an imprinting effect
was not confirmed by other studies [111,112]. These differing
findings are probably attributable to demographic selection biases
[113]. The mechanism of the association between FRAXA premutation and POF is not yet clearly established. Elevated levels of
FMR1 mRNA have been found in females carrying the FMR1
premutated allele [110,114], leading investigators to hypothesize
a correlation between premutated FMR1 mRNA and POF manifestation [110].
On the other hand, premutation carriers, especially older
adult male carriers, have been recently reported to present a
multisystem, progressive neurodegenerative disorder including
intentional tremor, gait ataxia, parkinsonism, autonomic dysfunction and cognitive decline, the so-called fragile-X-associated
tremor/ataxia syndrome (FXTAS) [115–119]. This syndrome has
not been observed among older adults with full mutation,
and its penetrance is relatively low in female premutation carriers, very likely in part because of the partial protection afforded
by X-inactivation of the premutation allele [118].
FXTAS represents a new form of inclusion disorder characterized by pathognomonic presence in neurons and astrocytes
throughout the brain of not yet completely identified intranuclear ubiquitin-positive inclusions postulated to be initiated
by abnormal FMR1 mRNA accumulation [118,120]. Indeed, in
contrast to the affected male full mutation carriers with loss of
transcription, subsequent absence of FMR1 mRNA and total
lack of FMR protein (FMRP), male premutation carriers were
found to show increased transcription of the mutant FMR1 gene
resulting in accumulation of FMR1 mRNA in peripheral blood
leukocytes and CNS tissue with, however, normal or reduced
FMRP production due to reduced translational efficiency of
this expanded-repeat FMR1 mRNA [118,121,122]. This peculiar accumulation of FMR1 mRNA led investigators to propose
an RNA “toxic gain-of-function” model to explain FXTAS
[116,120,123], a model in which the neurological disorder is
caused by the accumulated FMR1 mRNA itself, with subsequent cellular sequestration of important RNA-binding proteins
and eventually cell death. Consistent with this model, the FMR1
mRNA [124] and at least two RNA-binding proteins [125] have
recently been identified within the intranuclear inclusions isolated from post-mortem brain tissues of a limited number of
FXTAS patients. These findings, although interesting, need to
be confirmed in a larger number of FXTAS patients.
The mutation rate for this familial syndrome seems to be
rather low. Generally, each affected patient has a mother with
at least a premutation, and it has been suggested that the
different affected individuals in a population stem from a few
ancestors. In other words, there should be a pool of founder
chromosomes or predisposed normal haplotypes from which
most FRAXA sites arise [126]. A similar conclusion was
proposed for FRAXE by Ritchie et al. [80] who, by comparing
the FRAXE allele sizes in different normal populations, found
similar mean repeat array sizes between populations, with a
major mode of 16–18 repeats, thus pointing to a few
predisposing alleles in the population pools, from which the
expanded alleles would derive.
2.2. Non-folate sensitive fragile sites
Seven fragile sites are listed in this category: FRA8E,
FRA10B, FRA11I, FRA12C, FRA16B, FRA16E and FRA17A
(Table 1). They are induced by distamycin A and related compounds and/or by bromodeoxyuridine (BrdU), an analog of
thymidine [2,4,7].
Distamycin A and related compounds berenil, netropsin and
Hoechst 33258 are known to bind DNA with a high affinity in
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
the minor groove of AT-rich sequences, impeding DNA replication [127–129].
BrdU can stop DNA replication after incorporating itself into
the DNA sequence in substitution for thymidine during synthesis [130]. For fragile site induction, low BrdU concentrations
which only partially inhibit replication should be used [3].
Three groups can be considered depending on the specific
mode of induction:
(1) Distamycin A/BrdU-inducible rare fragile sites: the fragile
sites of this group, FRA16B (16q22.1) and FRA17A
(17p12), are inducible both by distamycin A and related
compounds and by BrdU [2,4,7]. FRA16B is the most
common of all rare autosomal fragile sites in man. It is
carried by about 5% of European as well as Australian
population [35,37,131].
(2) Distamycin A-inducible/BrdU-insensitive rare fragile sites:
three fragile sites pertain to this group: FRA8E (8q24.1),
FRA11I (11p15.1) and FRA16E (16p12.1). These fragile
sites can be induced by distamycin A and related
compounds berenil, netropsin and Hoechst 33258, but
not by BrdU [2,7,29,132,133]. They have been recorded
only in the Japanese population [8,133]. The FRA8E
mutation was confirmed in two families to be heritable as a
Mendelian codominant trait [132].
(3) BrdU-requiring/distamycin A-insensitive rare fragile sites:
this group includes 2 fragile sites, FRA10B (10q25.2) and
FRA12C (12q24.2), which require the specific presence of
BrdU or BrdC (bromodeoxycytidine) in the culture medium [2,3,7], whereas they are not inducible by AT-minor
groove binders. FRA10B is present in about 1/40
individuals of the Australian population [34].
In fact, distamycin A inducible and, less frequently, BrdU
requiring fragile sites can show spontaneous expression in vitro,
and addition of inducers serve to further enhance the expression
[4,134]. Analysis of the spontaneous replication timing at some
of these sites revealed late replication or replication delay in the
fragile site expressing alleles as compared to nonexpressing
alleles. Replication occurred in the mid-S phase for the FRA10B
nonexpressing allele while it was delayed in the S3–G2 phase on
the distal side of the expressing allele. It occurred in the very lateS phase for the FRA16B nonexpressing allele while a shift to
later replication was noted in the expressing alleles [134].
2.2.1. Molecular basis
Two non-folate sensitive rare fragile sites, FRA10B [135] and
FRA16B [136], have been cloned to date were and found to
comprise polymorphic AT-rich minisatellite repeats. Their
expression is associated with expansion of one or more repeats,
showing increase of up to several kilobases of DNA [135,136].
Their expanded repeats are highly similar, sharing up to 31
identical bases, with the highest homology being found in the 5′ends of the repeats which share 12 identical base pairs including
an inverted 11-bp sequence which is present in three copies.
These inverted AT/TA repeats are able to form secondary hairpin
structures that are difficult to replicate [135,137].
7
The FRA10B region consists of a highly AT-rich (91%)
region in the centre, containing minisatellite repeats of different
lengths, 16–52 bp, with a 42-bp consensus sequence (GATATAATATATCATATATATTATATATGATATATTATATAT)
shared by the different expanded repeats [2,135,137], and of
non-repetitive flanking regions with less high AT content (up to
58%). The number of the minisatellite repeat copies varies
between individuals, showing thus a high polymorphism in the
normal population, with small normal alleles (0.8–1 kb) comprising up to 66% of alleles, intermediate normal alleles (1–
4 kb) representing up to 33% of alleles and large normal alleles
(4–5 kb) including up to 1% alleles [135]. It has been shown
that the large alleles are derived from the intermediate alleles,
which in turn are derived from short normal alleles. Such
founder effects, which are similar to the ones observed previously for trinucleotide repeats, support an expansion model
based on a dynamic mutation process [135,137]. Once the
repeat copy number passes a threshold of 5 kb, i.e. about 75
copies, the allele is expressed. It was demonstrated that repetitive
sequences in the expressing alleles are caused by expansion in
copy number of at least one of the minisatellite repeats present in
the FRA10B locus and sharing the 42-bp motif [135]. Some
alleles comprised a mixture of different expanded repeat motifs,
but in each expressing allele at least four repeats were uninterrupted. In some cases, the expressing alleles could extend
over 100 kb in length. A variation in repeat size and composition
between different families was observed, indicating multiple
independent expansion events. Both intergenerational and
somatic instability of the expanded FRA10B sequences was
seen [135].
The AT-rich minisatellite repeats of the FRA16B region
display a sequence polymorphism, being composed of variable
26–33 bp-long sequences in normal alleles. All these sequences
conform, however, to a 33-bp consensus sequence (ATATATTATATATTATATCTAAT AATATAT(C/A)TA) except for a single
C/A base substitution at position 31 [136]. Normal alleles
contain 7–12 copies of repeat sequences, thus showing repeatcopy number polymorphism in the normal population. The
minisatellite copies in the expressing alleles are all 33 bp-long,
indicating that fragile sites would result from expansion of
perfect repeat copies of a 33 bp-long AT-rich repeat located at
the fragile site locus. This expansion yields remarkably large
(15–70 kb) expressing alleles which can contain up to 2000
copies [136]. These expressing alleles differ clearly between
families but are of similar size within families. Neither
intergenerational nor somatic instability in carriers of this
fragile site could be accurately investigated on such large (at
least 15 kb) expansion sequences [55,136] and no definite
relationship could be established between expanded alleles and
a “pool” of premutated alleles indicating predisposition to
expansion.
2.2.2. Mechanisms for cytogenetic expression
It has been hypothesized that lesions at fragile sites arise as a
result of replication failure at chromosomal points that are
unusually sensitive to interference during DNA synthesis [138].
For the non-folate sensitive rare fragile sites, a complex
8
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
multifactorial mechanism appears to be involved in replication
failure leading to cytogenetic expression of the fragility. First,
the extraordinary expansion of the AT-rich repeats in the
expressing fragile sites may generate perturbation of DNA
replication [134]. This replication perturbation was found to
extend along a large genomic region flanking the expanded
repeats [134].
Furthermore, the expanded inverted AT-rich repeats are prone
to form hairpin structures that may contribute to their further
expansion and are difficult to replicate [135,136]. The binding of
AT-rich DNA minor groove ligands, or the replication hindrance
caused by incorporation of BrdU in replacement of thymidine in
this highly AT-rich region, may further emphasize the replication
failure. This failure may lead to incomplete chromosome condensation either because the DNA polymerase complex which is still
present on late-replicating DNA causes steric inhibition, thus
hindering chromosome condensation, or because non-replicated
DNA resulting from this failure remains uncondensed in the G2
phase of the cell cycle, after condensation of the remaining chromosome is already signalled [138].This failure of chromosome
condensation along a genomic region may create unstable chromatin at this region and be manifested in metaphase chromosomes
as gaps, breaks or poor staining. Hsu and Wang [139] demonstrated, for FRA16B, that both the expanded 33-bp AT-rich repeats
at this site and the presence of the ligand distamycin contribute to
exclude nucleosome formation. This phenomenon happened
essentially in a distamycin-dependent manner, but increasing the
copy number of these repeats was found to further enhance
the inhibition of nucleosome assembly. In fact, distamycin has
been demonstrated to alter the rotational positioning of the
nucleosome-assembled DNA [140]. As the AT-rich FRA16B
DNA sequences contain contiguous distamycin binding sites,
these DNA sequences might not be able, when the amount of
distamycin is sufficient to highly saturate the binding sites, to
adopt a rotational positioning favourable for nucleosome assembly [139].
2.2.3. Clinical significance
No proven phenotypic effects have been recorded in individuals expressing non-folate sensitive rare fragile sites. Homozygotes for FRA10B, FRA16B and FRA17A have been
identified as normal individuals, indicating that these three fragile
sites have no clinical significance [37,141,142] and, although the
genomic region of FRA8E has been shown to be involved in
various chromosomal rearrangements associated with Langer–
Giedion syndrome [143–145], most FRA8E carriers recorded to
date were healthy subjects [146], thus implying that the FRA8E
mutation is not linked to a particular disease.
3. Common fragile sites
Up today, at least 88 common fragile sites have been recorded
and classified on human chromosomes (Table 2), with variable
prevalence and expression levels [5,147]. They are expressed in
cells grown under culture conditions that inhibit DNA replication, e.g. conditions of thymidylate and folate stress, or presence
of appropriate doses of aphidicolin [5,9,148,149]. They are seen
in all individuals as part of the normal chromosome structure, but
the proportion of cells with cytogenetic expression varies from
individual to individual, reaching in some individuals levels of
expression up to 30% [7]. The cytogenetic expression of these
sites is visible over wide chromosomal regions of megabases in
size. Common fragile sites seem therefore to represent regions of
fragility, rather than specific loci [137]. FRA3B (3p14.2) is the
most highly inducible common fragile site, found in treated
metaphases from most humans [150]. FRA6E (6q26), FRA7H
(7q32.3), FRA16D (16q23) and FRAXB (Xp22.3) are also
highly expressed in human lymphocytes [5,24].
Several common fragile sites have been implicated as breakpoints in the in vivo chromosomal rearrangements related to
cancer [147,149]. They are also regions of potential genome
instability [148], being hotspots for deletions and translocations
[9,10], increased rates of sister chromatid exchanges [11,13,14],
plasmid or viral integration [18,151–153] and intrachromosomal gene amplification [17,21,154].
Common fragile sites fall into 3 groups: those induced by
aphidicolin, those induced by 5-azacytidine and those induced
by BrdU (Table 2).
(1) Common aphidicolin inducible fragile sites: aphidicolin,
a specific inhibitor of the replicative DNA polymerases α
and δ, is a major inducing agent for common fragile sites.
It interferes with replication fork progression [5].
Aphidicolin inducible fragile sites can be spontaneously
expressed, but induction by aphidicolin enhances their
expression in a dose-dependant manner [5]. They can
also be induced by the addition of fluorodeoxyuridine
(FdUrd), an inhibitor of thymidylate synthesis, to the
culture medium, thus causing a depletion of cellular
dNTP pools [147]. In addition, their expression can be
enhanced by using folate deficient culture medium or
medium enriched in methotrexate, an inhibitor of folate
metabolism [5,147]. To achieve a good induction, low
concentrations of aphidicolin, which only partially
inhibit replication without arresting the cell cycle, should
be used. The majority of accepted common fragile sites
(77/88) belong to this group (Table 2).
(2) Common BrdU-inducible fragile sites: seven common
fragile sites (Table 2) are specifically induced by BrdU.
They map to different genomic regions than the BrdUinducible rare fragile sites. The timing of exposure to BrdU
is critical for the fragile site expression, the optimal timing
being 6–12 h exposure [155].
(3) Common 5-azacytidin inducible fragile sites: The four
fragile sites FRA1H (1q42), FRA1J (1q12), FRA9F
(9q12) and FRA19A (19q13) are induced by 5azacytidin, an analogue of cytisine that is incorporated
into the DNA sequence in substitution of cytosine
during replication [155].
3.1. Molecular basis
At present, thirteen common fragile sites have been cloned
and characterized at molecular level in various ways: FRA2G at
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
Table 2
Classification of common fragile sites
9
Table 2 (continued)
Sub-group
Fragile site
Location
Aphidicolin inducible (n = 77)
FRA1A
FRA1B
FRA1C
FRA1D
FRA1E
FRA1F
FRA1G
FRA1I
FRA1K
FRA1L
FRA2C
FRA2D
FRA2E
FRA2F
FRA2G
FRA2H
FRA2I
FRA2J
FRA3A
FRA3B
FRA3C
FRA3D
FRA4A
FRA4C
FRA4D
FRA4F
FRA5C
FRA5D
FRA5E
FRA5F
FRA6B
FRA6C
FRA6E
FRA6F
FRA6G
FRA7B
FRA7C
FRA7D
FRA7E
FRA7F
FRA7G
FRA7H
FRA7I
FRA7J
FRA8B
FRA8C
FRA8D
FRA9D
FRA9E
FRA10D
FRA10E
FRA10F
FRA10G
FRA11C
FRA11D
FRA11E
FRA11F
FRA11G
FRA11H
FRA12B
FRA12E
FRA13A
FRA13C
FRA13D
1p36
1p32
1p31.2
1p22
1p21.2
1q21
1q25.1
1q44
1q31
1p31
2p24.2
2p16.2
2p13
2q21.3
2q31
2q32.1
2q33
2q37.3
3p24.2
3p14.2
3q27
3q25
4p16.1
4q31.1
4p15
4q22
5q31.1
5q15
5p14
5q21
6p25.1
6p22.2
6q26
6q21
6q15
7p22
7p14.4
7p13
7q21.2
7q22
7q31.2
7q32.3
7q36
7q11
8q22.1
8q24.1
8q24.3
9q22.1
9q32
10q22.1
10q25.2
10q26.1
10q11.2
11p15.1
11p14.2
11p13
11q14.2
11q23.3
11q13
12q21.3
12q24
13q13.2
13q21.2
13q32
(continued on next page)
Sub-group
Fragile site
Location
Aphidicolin inducible (n = 77)
FRA14B
FRA14C
FRA15A
FRA16C
FRA16D
FRA17B
FRA18A
FRA18B
FRA20B
FRA22B
FRAXB
FRAXC
FRAXD
FRA4B
FRA5A
FRA5B
FRA6D
FRA9C
FRA10C
FRA13B
FRA1H
FRA1J
FRA9F
FRA19A
14q23
14q24.1
15q22
16q22.1
16q23.2
17q23.1
18q12.2
18q21.3
20p12.2
22q12.2
Xp22.31
Xq22.1
Xq27.2
4q12
5p13
5q15
6q13
9p21
10q21
13q21
1q42
1q12
9q12
19q13
BrdU inducible (n = 7)
5-Azacytidine inducible (n = 4)
2q31, FRA3B at 3p14.2, FRA4F at 4q22, FRA6E at 6q26,
FRA6F at 6q21, FRA7E at 7q21.2, FRA7G at 7q31.2, FRA7H
at 7q32.3, FRA7I at 7q36, FRA8C at 8q24.1, FRA9E at 9q32,
FRA16D at 16q23.2 and FRAXB at Xp22.31 [2]. All are
aphidicolin inducible, and genomic breakage and instability at
these fragile sites occur along a large genomic region extending
over at least 500 kb [156,157]. All are relatively AT-rich areas
[157–159], but they do not show any repeat motifs such as
expanded trinucleotide or minisatellite repeats that could
predispose to fragility as has been demonstrated in the rare
fragile sites [24,153,2,160].
To understand the molecular mechanism of fragility at these
sites, another investigation approach was adopted in which
structural characteristics of the DNA rather than their sequence
per se was examined.
When measuring local fluctuations at the twist angle
between consecutive base pairs along the DNA molecule backbone, it was found that the common fragile site regions analysed
to date, namely FRA2G, FRA3B, FRA6F, FRA7E, FRA7G,
FRA7H, FRA7I, FRA16D and FRAXB, contain more areas of
high DNA torsional flexibility, termed flexibility peaks, than
non-fragile regions mapped to the same band [24,27,153,158,
161–164]. These flexibility peaks, which can present as
“clusters of flexibility peaks” when including at least three
close-set peaks [164], are composed of interrupted ATdinucleotide-rich sequences of various lengths termed ATdinucleotide-rich flexibility islands. These islands, which are
significantly more AT-dinucleotide-rich than their nonflexible
flanking sequences, have the potential to form unusual DNA
secondary structures that can perturb replication [164]. They
have been shown, in vivo, to influence the level of chromatin
10
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
higher-order folding [165,166]. The sequences of these
flexibility islands, with a high AT content composition and a
high level of AT/TA-dinucleotides, are similar to AT-rich
repeats in the rare FRA10B and FRA16B. However, expanded
alleles of rare fragile sites comprise up to several kilobases of
uninterrupted repeats, while flexibility peaks of common fragile
sites are interrupted clusters of short AT-dinucleotide rich
islands [166]. The secondary structures generated by the
sequences at the flexibility islands can contribute to the
mechanism of fragility at common fragile sites in the same
way as the secondary hairpin structures of expanded AT-rich
minisatellite repeats that underlie the fragility of the rare
FRA16B and FRA10B. Moreover, long AT-rich flexibility
islands have been identified both in the FRA10B and FRA16B
regions [166]. Accordingly, a shared mechanism, conferred by
sequences with a potential to form secondary structures, can
perturb replication and lead to fragility at both rare fragile sites
harbouring AT-rich minisatellite repeats and aphidicolininduced common fragile sites [166].
3.2. Mechanisms for cytogenetic expression
There are lines of evidence suggesting that aphidicolininduced common fragile sites represent unreplicated DNA
resulting from stalled replication forks [167,168]. These sites
replicate late during S phase, even under normal culture conditions [169,170], indicating that their sequences include intrinsic
features that might lead to delay in replication. Aphidicolin acts
by inducing further delay in replication progression that causes a
significant portion of the fragile region to remain unreplicated in
G2 [21,168–170]. The AT-rich-dinucleotide flexibility islands
constitute one of the postulated intrinsic features of common
aphidicolin-inducible fragile sites that might generate replication
perturbation either because of their high DNA flexibility [171], or
because of their potential to form DNA secondary structures that
can perturb the progression of the replication fork [164,172].
Highly flexible DNA sequences would be expected, by analogy to
the mechanism proposed for the highly flexible trinucleotide
repeat sequences [76,77], to act as sinks for the accumulation of
superhelical density generated in front of the progressing replication fork. The subsequent superhelical density can hamper
efficient topoisomerase activity and reduce the polymerase complex progression [77]. The activity of the polymerase complex is
expected to be further inhibited by adding low doses of aphidicolin to the culture medium. The subsequent unreplicated DNA
regions may locally affect chromatin structure, leading to instability as well as recombinogenic properties of fragile sites. Thus,
the cytogenetic appearance of gaps and constrictions at common
fragile sites might reflect incomplete or delayed resolution of
stalled replication forks [164,167]. The inconsistency in replication progression between fragile and flanking non-fragile regions
might contribute to occurrence of breaks at these fragile sites.
3.3. Clinical significance
Common fragile sites have been implicated as breakpoints in
chromosomal rearrangements observed in malignant cells
[27,147,149,173,174], suggesting a role in tumorigenesis for
some genes associated to fragile sites [149]. For instance, FRA3B,
the most active common fragile site on human metaphase
chromosomes, maps to a 3p region associated with deletions or
translocation breakpoints in human lung cancer [175], in breast
carcinoma [176], in oesophageal adenocarcinoma [177,178], in
pancreatic tumours [179] or in renal cell carcinoma [180–182].
The FHIT (fragile histidine triad) gene maps to the same chromosomal region [151,183] and is considered as a multiple
suppressor gene [183,184]. It has been shown that this gene is
frequently deleted [176,183,185,186] or involved in translocation
breakpoints [178,183] in a large number of tumour types. Other
common fragile sites have been implicated in homologous
deletions or loss of heterozygosity (LOH) observed in a number of
tumours. These include FRA6E [25], FRA7G [187] and FRA9E
[188] in ovarian cancer, FRA16D in breast cancer [173,189–191],
in gastric adenocarcinoma and multiple myeloma [26], in prostate
[192] and hepatocellular [193] carcinoma. A gene, the WWOX
gene, has been cloned in the FRA16D region [194] and shown
to decrease tumour growth in vivo [195]. These findings are
consistent with the suggestion that common fragile sites are
generally unstable and may lead to gene inactivation in cancer
cells [196]. Associations between common fragile sites and
neuropsychiatric disorders have been postulated, especially between FRA6E and autosomal recessive juvenile parkinsonism
[25], and FRA13A and idiopathic autism [197,198]. This may
suggest that frequent recombination events at these sites could
destabilize genes involved in the development and function of the
central nervous system. However, the involvement of these sites
and other common fragile sites in the generation of mutations
responsible for these disorders is still poorly substantiated.
4. Conclusion
Late and/or delayed replication appears to be associated with
induced as well as spontaneous fragility at both rare and common fragile sites.
By comparing the molecular anatomy of the different classes
of human chromosome fragile sites, it could be expected to
identify features that are common to all classes and that might
constitute the essential requirements for replication perturbation
and fragile site expression. Although no common DNA sequence motif that could account for all the classes of fragile
sites can be identified, a general molecular mechanism for
replication failure and fragility appears to emerge from the
intrinsic characteristics of the sequences, either CCG/CGG
trinucleotide repeats, AT-rich minisatellite repeats or ATdinucleotide-rich islands, which were found at the different
sites cloned to date: all are prone to form stable secondary DNA
structures capable of perturbing the DNA replication, all have
been shown to contain highly flexible DNA sequences which
have the potential to impede the progressing replication fork
and to affect the chromatin organisation, all have been found to
disfavour nucleosome assembly. These properties can be
amplified by replication stress conditions, leading to failure of
chromatin condensation along a large genomic region and to
subsequent fragility.
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
Apart from the folate sensitive rare fragile sites FRAXA
and FRAXE which are directly associated with mental retardation, and the FRA11B which is possibly implicated in generation of some cases of Jacobsen syndrome, the other fragile
sites have not yet been consistently associated with any specific
phenotype. However, associations between fragile sites, especially common fragile sites, and cancer have been consistently
documented.
Further cloning and molecular characterization of rare and
common fragile sites is expected to improve our comprehension of the involvement of these sites in human genetic
disorders.
References
[1] A. Dekaban, Persisting clone of cells with an abnormal chromosome in a
woman previously irradiated, J. Nucl. Med. 6 (1965) 740–746.
[2] M. Schwartz, E. Zlotorynski, B. Kerem, The molecular basis of common
and rare fragile sites, Cancer Lett. 232 (2006) 13–26 Review.
[3] G.R. Sutherland, E. Baker, R.S. Seshadri, Heritable fragile sites on human
chromosomes. V. A new class of fragile site requiring BrdU for expression, Am. J. Hum. Genet. 32 (1980) 542–548.
[4] G.R. Sutherland, P.B. Jacky, E.G. Baker, Heritable fragile sites on human
chromosomes. XI. Factors affecting expression of fragile sites at 10q25,
16q22, and 17p12, Am. J. Hum. Genet. 36 (1984) 110–122.
[5] T.W. Glover, C. Berger, J. Coyle, B. Echo, DNA polymerase alpha
inhibition by aphidicolin induces gaps and breaks at common fragile sites
in human chromosomes, Hum. Genet. 67 (1984) 136–142.
[6] G.R. Sutherland, F. Hecht, Fragile sites on human chromosomes, In:
Oxford Monographs on Medical Genetics, Oxford University Press,
Oxford, U.K., 1985
[7] G.R. Sutherland, R.I. Richards, The molecular basis of fragile sites in
human chromosomes, Curr. Opin. Genet. Dev. 5 (1995) 323–327.
[8] G.R. Sutherland, E. Baker, The clinical significance of fragile sites on
human chromosomes, Clin. Genet. 58 (2000) 1–7.
[9] T.W. Glover, C.K. Stein, Chromosome breakage and recombination at
fragile sites, Am. J. Hum. Genet. 43 (1988) 265–273.
[10] L. Wang, W. Paradee, C. Mullins, R. Shridhar, R. Rosati, C.M. Wilke, T.W.
Glover, D.I. Smith, Aphidicolin-induced FRA3B breakpoints cluster in two
distinct regions. Genomics 41 (1997) 485–488.
[11] T.W. Glover, C.K. Stein, Induction of sister chromatid exchanges at
common fragile sites, Am. J. Hum. Genet. 41 (1987) 882–890.
[12] M. Schmid, W. Feichtinger, T. Haaf, The fragile site (16)(q22). II. Sister
chromatid exchanges, Hum. Genet. 76 (1987) 365–368.
[13] W. Feichtinger, M. Schmid, Increased frequencies of sister chromatid
exchanges at common fragile sites (1)(q42) and (19)(q13), Hum. Genet.
83 (1989) 145–745.
[14] B. Hirsch, Sister chromatid exchanges are preferentially induced at
expressed and nonexpressed common fragile sites, Hum. Genet. 87 (1991)
302–306.
[15] T. Lukusa, E. Meulepas, J.P. Fryns, H. Van den Berghe, J.J. Cassiman,
“Spontaneous” FRA16B is a hot spot for sister chromatid exchanges,
Hum. Genet. 87 (1991) 583–586.
[16] H. Tsuji, A. Hitomi, E. Takahashi, M. Murata, T. Ikeuchi, K. Yamamoto,
S. Tsuji, T. Hori, Induction of distamycin A-inducible rare fragile sites
and increased sister chromatid exchanges at the fragile site, Hum. Genet.
87 (1991) 254–260.
[17] A. Coquelle, E. Pipiras, F. Toledo, G. Buttin, M. Debatisse,
Expression of fragile sites triggers intrachromosomal mammalian
gene amplification and sets boundaries to early amplicons, Cell 89
(1997) 215–225.
[18] F.V. Rassool, T.W. McKeithan, M.E. Neilly, E. van Melle, R.D. Espinosa,
M.M. Le Beau, Preferential integration of marker DNA into the
chromosomal fragile site at 3p14: an approach to cloning fragile sites,
Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 6657–6661.
11
[19] N. Villa, L. Dalpra, L. Larizza, Expression of three rare fragile sites:
chromosomal truncation, amplification of distal segment and telomeric
renewal, Chromosoma 106 (1997) 400–404.
[20] D. Kotzot, M.J. Martinez, G. Bagci, S. Basaran, A. Baumer, F. Binkert, L.
Brecevic, C. Castellan, K. Chrzanowska, F. Dutly, A. Gutkowska, S.B.
Karauzum, M. Krajewska-Walasek, G. Luleci, P. Miny, M. Riegel, S.
Schuffenhauer, H. Seidel, A. Schinzel, Parental origin and mechanisms of
formation of cytogenetically recognisable de novo direct and inverted
duplications, J. Med. Genet. 37 (2000) 281–286.
[21] A. Hellman, E. Zlotorynski, S.W. Scherer, J. Cheung, J.B. Vincent, D.I.
Smith, L. Trakhtenbrot, B. Kerem, A role for common fragile site
induction in amplification of human oncogenes, Cancer Cell 1 (2002)
89–97.
[22] C. Jones, L. Penny, T. Mattina, S. Yu, E. Baker, L. Voullaire, W.Y.
Langdon, G.R. Sutherland, R.I. Richards, A. Tunnacliffe, Association of
a chromosome deletion syndrome with a fragile site within the protooncogene CBL2, Nature 376 (6536) (1995) 145–149.
[23] L.A. Penny, M. Dell'Aquila, M.C. Jones, J. Bergoffen, C. Cunniff, J.-P.
Fryns, E. Grace, J.M. Graham, B. Kouseff, T. Mattina, J. Syme, L.
Voullaire, L. Zelante, J. Zenger-Hain, O.W. Jones, G.A. Evans, Clinical
and molecular characterization of patients with distal 11q deletions, Am.
J. Hum. Genet. 56 (3) (1995) 676–683.
[24] M.F. Arlt, D.E. Miller, D.G. Beer, T.W. Glover, Molecular characterization of FRAXB and comparative common fragile site instability in cancer
cells. Genes Chromosomes Cancer 33 (2002) 82–92.
[25] S.R. Denison, G. Callahan, N.A. Becker, L.A. Phillips, D.I. Smith,
Characterization of FRA6E and its potential role in autosomal recessive
juvenile parkinsonism and ovarian cancer, Genes Chromosomes Cancer
38 (2003) 40–52.
[26] M. Mangelsdorf, K. Ried, E. Woollatt, S. Dayan, H. Eyre, M. Finnis, L.
Hobson, J. Nancarrow, D. Venter, E. Baker, R.I. Richards, Chromosomal
fragile site FRA16D and DNA instability in cancer, Cancer Res. 60
(2000) 1683–1689.
[27] K. Mimori, T. Druck, H. Inoue, H. Alder, L. Berk, M. Mori, K. Huebner,
C.M. Croce, Cancer-specific chromosome alterations in the constitutive
fragile region FRA3B, Proc. Natl. Acad. Sci. U. S. A. 96 (1999)
7456–7461.
[28] L. Wang, J. Darling, J.S. Zhang, C.P. Qian, L. Hartmann, C. Conover, R.
Jenkins, D.I. Smith, Frequent homozygous deletions in the FRA3B
region in tumor cell lines still leave the FHIT exons intact. Oncogene 16
(1998) 635–642.
[29] E. Takahashi, Y. Kaneko, T. Ishihara, M. Minamihisamatsu, M. Murata,
T. Hori, A new rare distamycin A-inducible fragile site, fra(11) (p15.1),
found in two acute nonlymphocytic leukemia (ANLL) patients with t
(7;11)(p15-p13;p15), Hum. Genet. 80 (1988) 124–126.
[30] C.M. Wilke, S.W. Guo, B.K. Hall, F. Boldog, R.M. Gemmill, S.C.
Chandrasekharappa, C.L. Barcroft, H.A. Drabkin, T.W. Glover, Multicolor FISH mapping of YAC clones in 3p14 and identification of YAC
spanning both FRA3B and the t(3;8) associated with hereditary renal cell
carcinoma, Genomics 22 (1994) 319–326.
[31] K.A. Krummel, L.R. Roberts, M. Kawakami, T.W. Glover, D.I. Smith, The
characterization of the common fragile site FRA16D and its involvement in
multiple myeloma translocations, Genomics 69 (2000) 37–46.
[32] G.R. Sutherland, Rare fragile sites, Cytogenet. Genome Res. 100 (2003)
77–84.
[33] E. Baker, G.R. Sutherland, A new folate sensitive fragile site at 1p21.3,
J. Med. Genet. 28 (1991) 356–357.
[34] G.R. Sutherland, Heritable fragile sites on human chromosomes. IX.
Population cytogenetics and segregation analysis of the BrdU requiring
fragile site at 10q25, Am. J. Hum. Genet. 34 (1982) 753–756.
[35] M. Schmid, W. Feichtinger, A. Jeβberger, J. Köhler, R. Lange, The
fragile site (16)(q22) I. Induction by AT-specific DNA-ligands and
population frequency, Hum. Genet. 74 (1986) 67–73.
[36] G.R. Sutherland, E. Baker, Unusual behaviour of a human autosome having
two rare folate sensitive fragile sites, Ann. Genet. 36 (1993) 159–162.
[37] T. Hocking, W. Feichtinger, M. Schmid, E.A. Haan, E. Baker, G.R.
Sutherland, Homozygotes for FRA16B are normal, Chromosome Res. 7
(1999) 553–556.
12
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
[38] G.R. Sutherland, Heritable fragile sites on human chromosomes. I.
Factors affecting expression in lymphocyte culture, Am. J. Hum. Genet.
31 (1979) 125–135.
[39] G.R. Sutherland, The role of nucleotides in human fragile site expression,
Mutat. Res. 200 (1988) 207–213.
[40] P.S. Subramanian, D.L. Nelson, A.C. Chinault, Large domains of apparent
delayed replication timing associated with triplet repeat expansion at
FRAXA and FRAXE. Am. J. Hum. Genet. 59 (1996) 407–416.
[41] R.S. Hansen, T.K. Canfield, A.D. Fjeld, S. Mumm, C.D. Laird, S.M.
Gartler, A variable domain of delayed replication in FRAXA fragile X
chromosomes: X inactivation-like spread of late replication, Proc. Natl.
Acad. Sci. U. S. A. 94 (1997) 4587–4592.
[42] T. Sarafidou, C. Kahl, I. Martinez-Garay, M. Mangelsdorf, S. Gesk, E.
Baker, M. Kokkinaki, P. Talley, E.L. Maltby, L. French, L. Harder, B.
Hinzmann, C. Nobile, K. Richkind, M. Finnis, P. Deloukas, G.R. Sutherland,
K. Kutsche, N.K. Moschonas, R. Siebert, J. Gécz, Folate-sensitive fragile
site FRA10A is due to an expansion of a CGG repeat in a novel gene,
FRA10AC1, encoding a nuclear protein, Genomics 84 (2004) 69–81.
[43] J.K. Nancarrow, E. Kremer, K. Holman, H. Eyre, N.A. Doggett, D. Le
Paslier, D.F. Callen, G.R. Sutherland, R.I. Richards, Implications of
FRA16A structure for the mechanism of chromosomal fragile site
genesis, Science 264 (1994) 1938–1941.
[44] E.J. Kremer, M. Pritchard, M. Lynch, S. Yu, K. Holman, E. Baker, S.T.
Warren, D. Schlessinger, G.R. Sutherland, R.I. Richards, Mapping of
DNA instability at the fragile X to a trinucleotide repeat sequence p
(CCG)n, Science 252 (1991) 1711–1714.
[45] I. Oberlé, F. Rousseau, D. Heitz, C. Kretz, D. Devys, A. Hanauer, J. Boué,
M.F. Bertheas, J.-L. Mandel, Instability of a 550-base pair DNA segment
and abnormal methylation in fragile X syndrome, Science 252 (1991)
1097–1102.
[46] A.J. Verkerk, M. Pieretti, J.S. Sutcliffe, Y.H. Fu, D.P. Kuhl, A. Pizzuti, O.
Reiner, S. Richards, M.F. Victoria, F. Zang, B.E. Eussen, G.-J.B. van
Ommen, L.A.J. Blonden, G.J. Riggins, J.L. Chastain, C.B. Kunst, H.
Galjaard, C.T. Caskey, D.L. Nelson, B.A. Oostra, S.T. Warren,
Identification of a gene (FMR-1) containing a CGG repeat coincident
with a breakpoint cluster region exhibiting length variation in fragile X
syndrome, Cell 65 (1991) 905–914.
[47] S. Yu, M. Pritchard, E. Kremer, M. Lynch, J. Nancarrow, E. Baker, K.
Holman, J.C. Mulley, S.T. Warren, D. Schlessinger, G.R. Sutherland, R.I.
Richard, Fragile X genotype characterized by an unstable region of DNA,
Science 252 (1991) 1179–1181.
[48] S.J.L. Knight, A.V. Flannery, M.C. Hirst, L. Campbell, Z. Christodoulou,
S.R. Phelps, J. Pointon, H.R. Middleton-Price, A. Barnicoat, M.E.
Pembry, J. Holland, B.A. Oostra, M. Bobrow, K.E. Davies, Trinucleotide
repeat amplification and hypermethylation of a CpG island in FRAXE
mental retardation, Cell 74 (1993) 127–134.
[49] J.E. Parrish, B.A. Oostra, A.J. Verkerk, C.S. Richards, J. Reynolds, A.S.
Spikes, L.G. Shaffer, D.L. Nelson, Isolation of a GCC repeat showing
expansion in FRAXF, a fragile site distal to FRAXA and FRAXE, Nat.
Genet. 8 (1994) 229–235.
[50] R.J. Ritchie, S.J.L. Knight, M.C. Hirst, P.K. Grewal, M. Bobrow, G.S.
Cross, K.E. Davies, The cloning of FRAXF: trinucleotide repeat
expansion and methylation at a third fragile site in distal Xqter, Hum.
Mol. Genet. 3 (1994) 2115–2121.
[51] B. Winnepenninckx, K. Debacker, J. Ramsay, D. Smeets, A. Smits, D.R.
FitzPatrick, R.F. Kooy, CGG-repeat expansion in the DIP2B gene is
associated with the fragile site FRA12A on chromosome 12q13.1, Am. J.
Hum. Genet. 80 (2007) 221–231.
[52] R.I. Richards, G.R. Sutherland, Simple repeat DNA is not replicated
simply, Nature Genet. 6 (1994) 114–116.
[53] J.J. Holden, M. Walker, M. Chalifoux, B.N. White, Trinucleotide repeats
at the FRAXF locus: frequency and distribution in the general population,
Am. J. Med. Genet. 64 (1996) 424–427.
[54] R.R. Sinden, Biological implications of the DNA structures associated
with disease-causing triplet repeats, Am. J. Hum. Genet. 64 (1999)
346–353 Review.
[55] G.R. Sutherland, R.I. Richards, Fragile sites—cytogenetic similarity with
molecular diversity, Am. J. Hum. Genet. 64 (1999) 354–359.
[56] K. Snow, D.J. Tester, K.E. Kruckeberg, D.J. Schaid, S.N. Thibodeau,
Sequence analysis of the fragile X trinucleotide repeat: implications for
the origin of the fragile X mutation, Hum. Mol. Genet. 3 (1994)
1543–1551.
[57] C.B. Kunst, S.T. Warren, Cryptic and polar variation of the fragile X repeat
could result in predisposing normal alleles, Cell 77 (1994) 853–861.
[58] E.E. Eichler, J.J.A. Holden, B.W. Popovich, A.L. Reiss, K. Snow, S.N.
Thiebodeau, C.S. Richards, P.A. Ward, D.L. Nelson, Length of
uninterrupted CGG repeats determines instability in the FMR1 gene,
Nature Genet. 8 (1994) 88–94.
[59] M.C. Hirst, P.K. Grewal, K.E. Davies, Precursor arrays for triplet repeat
expansion at the fragile X locus, Hum. Mol. Genet. 3 (1994) 1553–1560.
[60] G.S. Fisch, K. Snow, S.N. Thibodeau, D.L.M. Chalifaux, J.J.A. Holden,
D.L. Nelson, P.N. Howard-Peebles, A. Maddalena, The fragile X
premutation in carriers and its effect on mutation size in offspring, Am.
J. Hum. Genet. 56 (1995) 1147–1155.
[61] J.K. Nancarrow, K. Holman, M. Mangelsdorf, T. Hori, M. Denton, G.R.
Sutherland, R.I. Richards, Molecular basis of p(CCG) repeat instability at
the FRA16A fragile site locus, Hum. Mol. Genet. 4 (1995) 367–372.
[62] D.C. Crawford, F. Zhang, B. Wilson, S.T. Warren, S.L. Sherman, Fragile
X CGG repeat structures among African-Americans: identification of a
novel factor responsible for repeat instability, Hum. Mol. Genet. 9 (2000)
1759–1769.
[63] S.L. Nolin, W.T. Brown, A. Glicksman, G.E. Houck, A.D. Gargano, A.
Sullivan, V. Biancalana, K. Bröndum-Nielsen, H. Hjalgrim, E. HolinskiFeder, F. Kooy, J. Longshore, J. Macpherson, J-L. Mandel, G. Matthijs, F.
Rousseau, P. Steinbach, M-L. Väisänen, H. von Koskull, S.L. Sherman,
Expansion of the fragile X CGG repeat in females with premutation or
intermediate alleles, Am. J. Hum. Genet. 72 (2003) 454–464.
[64] A.E. Ashley-Koch, H. Robinson, A.E. Glicksman, S.L. Nolin, C.E.
Schwartz, W.T. Brown, G. Turner, S.L. Sherman, Examination of factors
associated with instability of the FMR1 CGG repeat, Am. J. Hum. Genet.
63 (1998) 776–785.
[65] C. Jones, P. Slijepcevic, S. Marsh, E. Baker, W.Y. Langdon, R.I. Richards,
A. Tunnacliffe, Physical linkage of the fragile site FRA11B and a
Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum.
Mol. Genet. 3 (1994) 2123–2130.
[66] C.E. Pearson, R.R. Sinden, Trinucleotide repeat DNA structures: dynamic
mutations from dynamic DNA, Curr. Opin. Struct. Biol. 8 (1998) 321–330.
[67] X. Chen, S.V. Mariappan, P. Catasti, R. Ratliff, R.K. Moyzis, A. Laayoun,
S.S. Smith, E.M. Bradbury, G. Gupta, Hairpins are formed by the single
DNA strands of the fragile X triplet repeats: structure and biological
implications, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 5199–5203.
[68] A.M. Gacy, G. Goellner, N. Juranic, S. Macura, C.T. McMurray, Trinucleotide repeats that expand in human disease form hairpin structures in
vitro, Cell 81 (1995) 533–540.
[69] Y. Nadel, P. Weisman-Shomer, M. Fry, The fragile X syndrome single
strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures, J. Biol. Chem. 270 (1995) 28970–28977.
[70] C.E. Pearson, R.R. Sinden, Alternative structures in duplex DNA formed
within the trinucleotide repeats of the myotonic dystrophy and fragile X
loci, Biochemistry 35 (1996) 5041–5053.
[71] C.E. Pearson, E.E. Eichler, D. Lorenzetti, S.F. Kramer, H.Y. Zoghbi, D.L.
Nelson, R.R. Sinden, Interruptions in the triplet repeats of SCA1 and
FRAXA reduce the propensity and complexity of slipped strand DNA
(S-DNA) formation, Biochemistry 37 (1998) 2701–2708.
[72] M. Fry, L.A. Loeb, The fragile X syndrome d(CGG)n nucleotide repeats
form a stable tetrahelical structure, Proc. Natl. Acad. Sci. U. S. A. 91
(1994) 4950–4954.
[73] P. Weisman-Shomer, E. Cohen, M. Fry, Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical
structures, Nucleic Acids Res. 28 (2000) 1535–1541.
[74] K. Usdin, K.J. Woodford, CGG repeats associated with DNA instability
and chromosome fragility form structures that block DNA synthesis in
vitro, Nucleic Acids Res. 23 (1995) 4202–4209.
[75] G.M. Samadashwily, G. Raca, S.M. Mirkin, Trinucleotide repeats affect
DNA replication in vivo, Nat. Genet. 17 (1997) 298–304.
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
[76] A. Bacolla, R. Gellibolian, M. Shimizu, S. Amirhaeri, S. Kang, K. Ohshima,
J.E. Larson, S.C. Harvey, B.D. Stollar, R.D. Wells, Flexible DNA:
genetically unstable CTG.CAG and CGG.CCG from human hereditary
neuromuscular disease genes, J. Biol. Chem. 272 (1997) 16783–16792.
[77] R. Gellibolian, A. Bacolla, R.D. Wells, Triplet repeat instability and DNA
topology: an expansion model based on statistical mechanics, J. Biol.
Chem. 272 (1997) 16793–16797.
[78] Y.-H. Wang, R. Gellibolian, M. Shimizu, R.D. Wells, J. Griffith, Long
CCG triplet repeat blocks exclude nucleosomes: a possible mechanism
for the nature of fragile sites in chromosomes, J. Mol. Biol. 263 (1996)
511–516.
[79] Y.-H. Wang, J. Griffith, Methylation of expanded CCG triplet repeat
DNA from fragile X syndrome patients enhances nucleosome exclusion,
J. Biol. Chem. 271 (1996) 22937–22940.
[80] R.J. Ritchie, L. Chakrabarti, S.J. Knight, R.M. Harding, K.E. Davies,
Population genetics of the FRAXE and FRAXF GCC repeats, and a novel
CGG repeat, in Xq28, Am. J. Med. Genet. 73 (1997) 463–469.
[81] M.C. Hirst, A. Barnicoat, G. Flynn, Q. Wang, M. Daker, V.J. Buckle, K.E.
Davies, M. Bobrow, The identification of a third fragile site, FRAXF, in
Xq27-q28 distal to both FRAXA and FRAXE, Hum. Mol. Genet. 2
(1993) 197–200.
[82] A.M. Vianna-Morgante, C. Mingroni-Nett, A.C. Barbosa, P.A. Otto, C.
Rosenberg, FRAXF in a patient with chromosome 8 duplication, J. Med.
Genet. 33 (1996) 611–614.
[83] J.J. Holden, M. Wing, M. Chalifoux, C. Julien-Inalsingh, C. Schutz, P.
Robinson, P. Szatmari, B.N. White, FRAXF in a patient with chromosome 8 duplication, J. Med. Genet. 33 (1996) 611–614.
[84] S.J.L. Knight, R.J. Ritchie, L. Chakrabarti, G. Cross, G.R. Taylor, R.F.
Muller, J. Paterson, J.R.F. Yates, D.J. Dow, J. Hurst, K.E. Davies, A study of
FRAXE in mentally retarded individuals referred for fragile X syndrome
(FRAXA) testing in the UK, Am. J. Hum. Genet. 58 (1996) 906–913.
[85] R.C. Michaelis, G.V. Velagaleti, C. Jones, E.K. Pivnick, M.C. Phelan, E.
Boyd, J. Tarleton, R.S. Wilroy, A. Tunnacliffe, A.T. Tharapel, Most
Jacobsen syndrome deletion breakpoints occur distal to FRA11B, Am. J.
Med. Genet. 76 (1998) 222–228.
[86] A. Tunnacliffe, C. Jones, D. Le Paslier, R. Todd, D. Cherif, M. Birdsall, L.
Devenish, C. Yousry, F.E. Cotter, M.R. James, Localization of Jacobsen
syndrome breakpoints on a 40-Mb physical map of distal chromosome 11q,
Genome Res. 9 (1999) 44–52.
[87] G.R. Sutherland, Marker X chromosomes and mental retardation,
N. Engl. J. Med. 296 (1977) 1415.
[88] G. Turner, T. Webb, S. Wake, H. Robinson, Prevalence of fragile X
syndrome, Am. J. Med. Genet. 64 (1996) 196–197.
[89] F. Rousseau, P. Rouillard, M.L. Morel, E.W. Khandjian, K. Morgan,
Prevalence of carriers of premutation-size alleles of the FMRI gene—and
implications for the population genetics of the fragile X syndrome, Am. J.
Hum. Genet. 57 (1995) 1006–1018.
[90] Y.H. Fu, D.P. Kuhl, A. Pizzuti, M. Pieretti, J.S. Sutcliffe, S. Richards, A.J.
Verkerk, J.J. Holden, R.G. Fenwick Jr., S.T. Warren, B.A. Oostra, D.L.
Nelson, C.T. Caskey, Variation of the CGG repeat at the fragile X site
results in genetic instability: resolution of the Sherman paradox, Cell 67
(1991) 1047–1058.
[91] A.K. Gedeon, E. Baker, H. Robinson, M.W. Partington, B. Gross, A.
Manca, B. Korn, A. Poustka, S. Yu, G.R. Sutherland, J.C. Mulley, Fragile
X syndrome without CCG amplification has an FMR1 deletion, Nat.
Genet. 1 (1992) 341–344.
[92] D. Wohrle, D. Kotzot, M.C. Hirst, A. Manca, B. Korn, A. Schmidt, G.
Barbi, H.D. Rott, A. Poustka, K.E. Davies, P. Steibach, A microdeletion
of less than 250 kb, including the proximal part of the FMR-I gene and the
fragile-X site, in a male with the clinical phenotype of fragile X syndrome, Am. J. Hum. Genet. 51 (1992) 299–306.
[93] K. De Boulle, A.J. Verkerk, E. Reyniers, L. Vits, J. Hendrickx, B. Van
Roy, F. Van den Bos, E. de Graaff, B.A. Oostra, P.J. Willems, A point
mutation in the FMR-1 gene associated with fragile X mental retardation,
Nat. Genet. 3 (1993) 31–35.
[94] S.J.L. Knight, M.A. Voelckel, M.C. Hirst, A.V. Flannery, A. Moncla, K.E.
Davies, Triplet repeat expansion at the FRAXE locus and X-linked mild
mental handicap, Am. J. Hum. Genet. 55 (1994) 81–86.
13
[95] J.C. Mulley, S. Yu, D.Z. Loesch, D.A. Hay, A. Donnelly, A.K. Gedeon, P.
Carbonell, I. Lopez, G. Glover, J. Gabarron, P.W.L. Yu, E. Bake, E.A.
Haan, A. Hockey, S.L. Knight, K.E. Davies, R.I. Richards, G.R.
Sutherland, FRAXE and mental retardation, J. Med. Genet. 32 (1995)
162–169.
[96] J. Gecz, A.K. Gedeon, G.R. Sutherland, J.C. Mulley, Identification of the
gene FMR2, associated with FRAXE mental retardation, Nat. Genet. 13
(1996) 105–108.
[97] A.J. Verkerk, B.H. Eussen, J.O. Van Hemel, B.A. Oostra, Limited size of
the fragile X site shown by fluorescence in situ hybridization, Am. J.
Med. Genet. 43 (1992) 187–191.
[98] V. Strelnikov, M. Nemtsova, G. Chesnokova, N. Kuleshov, D. Zaletayev,
A simple multiplex FRAXA, FRAXE, and FRAXF PCR assay convenient
for wide screening programs, Hum. Mutat. 13 (1999) 166–169.
[99] M. Pieretti, F. Zhang, Y.-H. Fu, S.T. Warren, B.A. Oostra, C.T. Caskey, D.L.
Nelson, Absence of expression of the FMR-1 gene in fragile X syndrome,
Cell 66 (1991) 817–822.
[100] T.C. Caskey, A. Pizzuti, H.-Y. Fu, R.G. Fenwick, D.L. Nelson, Triplet
repeat mutation in human disease, Science 256 (1992) 784–788.
[101] C. Verheij, C.E. Bakker, E. De Graaff, J. Keulemans, R. Willemsen, A.J.M.H.
Verkerk, H. Galjaard, A.J.J. Reuser, A.T. Hoogeveen, B.A. Oostra, Characterisation and localisation of the FMR1 gene product associated with fragile
X syndrome, Nature 363 (1993) 722–724.
[102] Y. Gu, Y. Shen, R.A. Gibbs, D.L. Nelson, Identification of FMR2, a novel
gene associated with the FRAXE CCG repeat and CpG island, Nat.
Genet. 13 (1996) 109–113.
[103] D.C. Crawford, J.M. Acuña, S.L. Sherman, FMR1 and the fragile X
syndrome: human genome epidemiology review, Genet. Med. 3 (2001)
359–371.
[104] M.W. Partington, D.Y. Moore, G.M. Turner, Confirmation of early
menopause in fragile X carriers, Am. J. Med. Genet. 64 (1996) 370–372.
[105] D.J. Allingham-Hawkins, R. Babul-Hirji, D. Chitayat, J.J.A. Holden,
K.T. Yang, C. Lee, R. Hudson, H. Gorwill, S.L. Nolin, A. Glicksman,
E.C. Jenkins, W.T. Brown, P.N. Howard-Peebles, C. Becchi, E. Cummings,
L. Fallon, S. Seitz, S.H. Black, A.M. Vianna-Morgante, S.S. Costa, P.A.
Otto, R.C. Mingroni-Netto, A. Murray, J. Webb, F. MacSwinney, N.
Dennis, P.A. Jacobs, M. Syrrou, I. Georgiou, P.C. Patsalis, M.L.G.
Uzielli, S. Guarducci, E. Lapi, A. Cecconi, U. Ricci, G. Ricotti, C.
Biondi, B. Scarselli, F. Vieri, Fragile X premutation is a significant risk
factor for premature ovarian failure: the international collaborative POF
in fragile X study — preliminary data, Am. J. Med. Genet. 83 (1999)
322–325.
[106] A.K. Sullivan, M. Marcus, M.P. Epstein, E.G. Allen, A.E. Anido, J.J.
Paquin, M. Yadav-Shah, S.L. Sherman, Association of FMR1 repeat size
with ovarian dysfunction, Hum. Reprod. 20 (2005) 402–412.
[107] R.D. Hundscheid, E.A. Sistermans, C.M. Thomas, D.D. Braat, H.
Straatman, L.A. Kiemeney, B.A. Oostra, A.P. Smits, Imprinting effect in
premature ovarian failure confined to paternally inherited fragile X
premutations, Am. J. Hum. Genet. 66 (2000) 413–418.
[108] G.S. Conway, N.N. Payne, J. Webb, A. Murray, P.A. Jacobs, Fragile X
premutation screening in women with premature ovarian failure, Hum.
Reprod. 13 (1998) 1184–1187.
[109] S.L. Sherman, Premature ovarian failure in the fragile X syndrome, Am.
J. Med. Genet. 97 (2000) 189–194.
[110] B. Bodega, S. Bione, L. Dalpra, D. Toniolo, F. Ornaghi, W. Vegetti, E.
Ginelli, A. Marozzi, Influence of intermediate and uninterrupted FMR1
CGG expansions in premature ovarian failure manifestation, Hum.
Reprod. 21 (2006) 952–957.
[111] A. Murray, S. Ennis, N. Morton, No evidence for parent of origin
influencing premature ovarian failure in fragile X premutation carriers,
Am. J. Hum. Genet. 67 (2000) 253–254.
[112] A.M. Vianna-Morgante, S.S. Costa, Premature ovarian failure is associated
with maternally and paternally inherited premutation in Brazilian families
with fragile X, Am. J. Hum. Genet. 67 (2000) 254–255.
[113] S.L. Sherman, Premature ovarian failure among fragile X premutation
carriers: parent-of-origin effect? Am. J. Hum. Genet. 67 (2000) 11–13.
[114] E. Garcia-Alegria, B. Ibanez, M. Minguez, M. Poch, A. Valiente, A.
Sanz-Parra, C. Martinez-Bouzas, E. Beristain, M.I. Tejada, Analysis of
14
[115]
[116]
[117]
[118]
[119]
[120]
[121]
[122]
[123]
[124]
[125]
[126]
[127]
[128]
[129]
[130]
[131]
[132]
[133]
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
FMR1 gene expression in female premutation carriers using robust
segmented linear regression models, RNA 13 (2007) 756–762.
P.J. Hagerman, C.M. Greco, R.J. Hagerman, A cerebellar tremor/ataxia
syndrome among fragile X premutation carriers, Cytogenet. Genome Res.
100 (2003) 206–212 Review.
S. Jacquemont, R.J. Hagerman, M. Leehey, J. Grigsby, L. Zhang, J.A.
Brunberg, C. Greco, V. Des Portes, T. Jardini, R. Levine, E. Berry-Kravis,
W.T. Brown, S. Schaeffer, J. Kissel, F. Tassone, P.J. Hagerman, Fragile X
premutation tremor/ataxia syndrome: molecular, clinical, and neuroimaging correlates, Am. J. Hum. Genet. 72 (2003) 869–878.
S. Jacquemont, R.J. Hagerman, M.A. Leehey, D.A. Hall, R.A. Levine, J.A.
Brunberg, L. Zhang, T. Jardini, L.W. Gane, S.W. Harris, K. Herman, J.
Grigsby, C.M. Greco, E. Berry-Kravis, F. Tassone, P.J. Hagerman, Penetrance of the fragile X-associated tremor/ataxia syndrome in a premutation
carrier population, JAMA 291 (2004) 460–469.
P.J. Hagerman, R.J. Hagerman, The fragile-X premutation: a maturing
perspective, Am. J. Hum. Genet. 74 (2004) 805–816.
R.J. Hagerman, B.R. Leavitt, F. Farzin, S. Jacquemont, C.M. Greco,
J.A. Brunberg, F. Tassone, D. Hessl, S.W. Harris, L. Zhang, T.
Jardini, L. Gane, J. Ferranti, L. Ruiz, M.A. Leehey, J. Grigsby, P.J.
Hagerman, Fragile-X-associated tremor/ataxia syndrome (FXTAS) in
females with the FMR1 premutation, Am. J. Hum. Genet. 74 (2004)
1051–1056.
C.M. Greco, R.J. Hagerman, F. Tassone, A.E. Chudley, M.R. Del Bigio,
S. Jacquemont, M. Leehey, P.J. Hagerman, Neuronal intranuclear inclusions in a new cerebellar tremor/ataxia syndrome among fragile X carriers, Brain 125 (2002) 1760–1771.
Y. Feng, F. Zhang, L.K. Lokey, J.L. Chastain, L. Lakkis, D. Eberhart, S.T.
Warren, Translational suppression by trinucleotide repeat expansion at
FMR1, Science 268 (1995) 731–734.
F. Tassone, A. Beilina, C. Carosi, S. Albertosi, C. Bagni, L. Li, K. Glover,
D. Bentley, P.J. Hagerman, Elevated FMR1 mRNA in premutation
carriers is due to increased transcription, RNA 13 (2007) 555–562.
R.J. Hagerman, M. Leehey, W. Heinrichs, F. Tassone, R. Wilson, J. Hills,
J. Grigsby, B. Gage, P.J. Hagerman, Intention tremor, parkinsonism, and
generalized brain atrophy in male carriers of fragile X, Neurology 57
(2001) 127–130.
F. Tassone, C. Iwahashi, P.J. Hagerman, FMR1 RNA within the intranuclear
inclusions of fragile X-associated tremor/ataxia syndrome (FXTAS), RNA
Biol. 1 (2004) 103–105.
C.K. Iwahashi, D.H. Yasui, H.J. An, C.M. Greco, F. Tassone, K. Nannen,
B. Babineau, C.B. Lebrilla, R.J. Hagerman, P.J. Hagerman, Protein
composition of the intranuclear inclusions of FXTAS, Brain 129 (2006)
256–271.
R.I. Richards, K. Holman, K. Friend, E. Kremer, D. Hillen, A. Staples, W.T.
Brown, P. Goonewardena, J. Tarleton, C. Schwartz, G.R. Sutherland, Evidence of founder chromosomes in fragile X syndrome, Nat. Genet. 1 (1992)
257–260.
J. Portugal, M.J. Waring, Comparison of binding sites in DNA for berenil,
netropsin and distamycin. A footprinting study, Eur. J. Biochem. 167
(1987) 281–289.
J. Portugal, M.J. Waring, Assignment of DNA binding sites for 4′,6diamidine-2-phenylindole and bisbenzimide (Hoechst 33258). A comparative footprinting study, Biochim. Biophys. Acta 949 (1988)
158–168.
A. Abu-Daya, P.M. Brown, K.R. Fox, DNA sequence preference of
several AT-selective minor groove binding ligands, Nucleic Acids Res. 23
(1995) 3385–3392.
R. Fetni, R. Drouin, C.L. Richer, N. Lemieux, Complementary replication
R- and G-band patterns induced by cell blocking at the R-band/G-band
transition, a possible regulatory checkpoint within the S phase of the cell
cycle, Cytogenet. Cell Genet. 75 (1996) 172–179.
G.R. Sutherland, E. Baker, Peek-a-boo fragile sites? Not really, Am. J.
Med. Genet. 96 (2000) 429–431.
E. Takahashi, T. Hori, M. Murata, A new rare heritable fragile site at
8q24.1 found in a Japanese population, Clin. Genet. 33 (1988) 91–94.
G.R. Sutherland, D.H. Ledbetter, Report of the committee on cytogenetic
markers, Cytogenet. Cell Genet. 51 (1989) 452–458 Review.
[134] O. Handt, E. Baker, S. Dayan, S.M. Gartler, E. Woollatt, R.I. Richards,
R.S. Hansen, Analysis of replication timing at the FRA10B and FRA16B
fragile site loci, Chromosome Res. 8 (2000) 677–688.
[135] D.R. Hewett, O. Handt, L. Hobson, M. Mangelsdorf, H.J. Eyre, E. Baker,
G.R. Sutherland, S. Schuffenhauer, J.I. Mao, R.I. Richards, FRA10B
structure reveals common elements in repeat expansion and chromosomal
fragile site genesis, Mol. Cell. 1 (1998) 773–781.
[136] S. Yu, M. Mangelsdorf, D. Hewett, L. Hobson, E. Baker, H.J. Eyre, N.
Lapsys, D. Le Paslier, N.A. Doggett, G.R. Sutherland, R.I. Richards,
Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat, Cell 88 (1997) 367–374.
[137] O. Handt, G.R. Sutherland, R.I. Richards, Fragile sites and minisatellite
repeat instability, Mol. Genet. Metab. 70 (2000) 99–105 Review.
[138] C.D. Laird, E. Jaffe, G. Karpen, M. Lamb, R. Nelson, Fragile sites in
human chromosomes as regions of late replicating DNA, Trends Genet. 3
(1987) 274–281.
[139] Y.Y. Hsu, Y.H. Wang, Human fragile site FRA16B DNA excludes nucleosomes in the presence of distamycin, J. Biol. Chem. 277 (2002) 17315–17319.
[140] P.M. Brown, K.R. Fox, Minor groove binding ligands alter the rotational
positioning of DNA fragments on nucleosome core particles, J. Mol. Biol.
262 (1996) 671–685.
[141] J.M. Berg, J.A. Faunch, M.J. Pendrey, L.S. Penrose, M.A. Ridler, A.
Shapiro, A homozygous chromosomal variant, Lancet 1 (1969) 531.
[142] G.R. Sutherland, Heritable fragile sites on human chromosomes. VII.
Children homozygous for the BrdU-requiring fra(10)(q25) are phenotypically normal, Am. J. Hum. Genet. 33 (1981) 946–949.
[143] E.M. Buhler, N.J. Malik, The tricho-rhino-phalangeal syndrome(s):
chromosome 8 long arm deletion: is there a shortest region of overlap
between reported cases? TRP I and TRP II syndromes: are they separate
entities? Am. J. Med. Genet. 19 (1984) 113–119.
[144] H.J. Lüdecke, C. Johnson, M.J. Wagner, D.E. Wells, C. Turleau, N.
Tommerup, A. Latos-Bielenska, K.R. Sandig, P. Meinecke, B. Zabel, B.
Horsthemke, Molecular definition of the shortest region of deletion overlap in
the Langer–Giedion syndrome, Am. J. Hum. Genet. 49 (1991) 1197–1206.
[145] J. Hou, J. Parrish, H.J. Ludecke, M. Sapru, Y. Wang, W. Chen, A. Hill, J.
Siegel-Bartelt, H. Northrup, F.F.B. Elder, C. Chinault, B. Horsthemke,
M.J. Wagner, D.E. Wells, A 4-megabase YAC contig that spans the Langer–
Giedion syndrome region on human chromosome 8q24.1: use in refining
the location of the trichorhinophalangeal syndrome and multiple exostoses
genes (TRPS1 and EXT1), Genomics 29 (1995) 87–97.
[146] E. Takahashi, T. Hori, M. Murata, Population cytogenetics of rare fragile
sites in Japan, Hum. Genet. 78 (1988) 121–126.
[147] J.J. Yunis, A.L. Soreng, Constitutive fragile sites and cancer, Science 226
(1984) 1199–1204.
[148] T.W. Glover, Instability at chromosomal fragile sites, Recent Results
Cancer Res. 154 (1998) 185–199 Review.
[149] T.W. Glover, Common fragile sites, Cancer Letters 232 (2006) 4–12.
[150] D.F.C.M. Smeets, J.M.J.C. Scheres, T.W.J. Hustinx, The most common
fragile site in man is 3p14, Hum. Genet. 72 (1986) 215–220.
[151] C.M. Wilke, B.K. Hall, A. Hoge, W. Paradee, D.I. Smith, T.W. Glover,
FRA3B extends over a broad region and contains a spontaneous HPV16
integration site: direct evidence for the coincidence of viral integration
sites and fragile sites, Hum. Mol. Genet. 5 (1996) 187–195.
[152] H. Huang, J. Qian, J. Proffit, K. Wilber, R. Jenkins, D.I. Smith, FRA7G
extends over a broad region: coincidence of human endogenous retroviral
sequences (HERV-H) and small polydispersed circular DNAs (spcDNA)
and fragile sites, Oncogene 16 (1998) 2311–2319.
[153] D. Mishmar, A. Rahat, S.W. Scherer, G. Nyakatura, B. Hinzmann, Y.
Kohwi, Y. Mandel-Gutfroind, J.R. Lee, B. Drescher, D.E. Sas, H.
Margalit, M. Platzer, A. Weiss, L.C. Tsui, A. Rosenthal, B. Kerem,
Molecular characterization of a common fragile site (FRA7H) on human
chromosome 7 by the cloning of a simian virus 40 integration site, Proc.
Natl. Acad. Sci. U. S. A. 95 (1998) 8141–8146.
[154] M. Debatisse, A. Coquelle, F. Toledo, G. Buttin, Gene amplification
mechanisms: the role of fragile sites, Recent Results Cancer Res. 154
(1998) 216–226.
[155] G.R. Sutherland, M.I. Parslow, E. Baker, New classes of fragile sites
induced by 5-azacytidine and BrdU, Hum. Genet. 69 (1985) 233–237.
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
[156] W. Paradee, C.M. Wilke, L. Wang, R. Shridhar, C.M. Mullins, A.
Hoge, T.W. Glover, D.I. Smith, A 350-kb cosmid contig in 3p14.2 that
crosses the t(3;8) hereditary renal cell carcinoma translocation breakpoint and 17 aphidicolin-induced FRA3B breakpoints, Genomics 35
(1996) 87–93.
[157] F. Boldog, R.M. Gemmill, J. West, M. Robinson, L. Robinson, E. Li, J.
Roche, S. Todd, B. Waggoner, R. Lundstrom, J. Jacobson, M.R.
Mullokandov, H. Klinger, H.A. Drabkin, Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B, Hum. Mol. Genet. 6
(1997) 193–203.
[158] K. Ried, M. Finnis, L. Hobson, M. Mangelsdorf, S. Dayan, J.K.
Nancarrow, E. Woollatt, G. Kremmidiotis, A. Gardner, D. Venter, E.
Baker, R.I. Richards, Common chromosomal fragile site FRA16D
sequence: identification of the FOR gene spanning FRA16D and
homozygous deletions and translocation breakpoints in cancer cells,
Hum. Mol. Genet. 9 (2000) 1651–1663.
[159] T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W.
Miller, K. Huebner, C.M. Croce, Sequence conservation at human and
mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/
Fhit, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 5722–5727.
[160] W. Paradee, V. Jayasankar, C. Mullins, C. Wilke, T.W. Glover, D.I. Smith,
Molecular characterization of the 3p14.2 constitutive fragile site, Am. J.
Hum. Genet. 55 (1994) A115.
[161] D. Mishmar, Y. Mandel-Gutfroind, H. Margalit, B. Kerem, Common
fragile sites: G-band characteristics within an R-band, Am. J. Hum.
Genet. 64 (1999) 908–910.
[162] C. Morelli, E. Karayianni, C. Magnanini, A.J. Mungall, E. Thorland, M.
Negrini, D.I. Smith, G. Barbanti-Brodano, Cloning and characterization
of the common fragile site FRA6F harboring a replicative senescence
gene and frequently deleted in human tumors, Oncogene 21 (2002)
7266–7276.
[163] M.Z. Limongi, F. Pelliccia, A. Rocchi, Characterization of the human
common fragile site FRA2G, Genomics 81 (2003) 93–97.
[164] E. Zlotorynski, A. Rahat, J. Skaug, N. Ben-Porat, E. Ozeri, R. Hershberg,
A. Levi, S.W. Scherer, H. Margalit, B. Kerem, Molecular basis for
expression of common and rare fragile sites, Mol. Cell. Biol. 23 (2003)
7143–7151.
[165] W.A. Krajewski, Alterations in the internucleosomal DNA helical twist in
chromatin of human erythroleukemia cells in vivo influences the
chromatin higher-order folding, FEBS Lett. 361 (1995) 149–152.
[166] W.A. Krajewski, J. Ausio, Relationship between chromatin high-order
folding and nucleosomal linker twist in nuclei of human HeLa s3 cells,
J. Biomol. Struct. Dyn. 14 (1997) 641–649.
[167] A.M. Casper, P. Nghiem, M.F. Arlt, T.W. Glover, ATR regulates fragile
site stability, Cell 111 (2002) 779–789.
[168] L. Wang, J. Darling, J.S. Zhang, H. Huang, W. Liu, D.I. Smith, Allelespecific late replication and fragility of the most active common fragile
site, FRA3B, Hum. Mol. Genet. 8 (1999) 431–437.
[169] M.M. Le Beau, F.V. Rassool, M.E. Neilly, R. III Espinosa, T.W. Glover,
D.I. Smith, T.W. McKeithan, Replication of a common fragile site, FRA3B,
occurs late in S phase and is delayed further upon induction: implications
for the mechanism of fragile site induction, Hum. Mol. Genet. 7 (1998)
755–761.
[170] A. Hellman, A. Rahat, S.W. Scherer, A. Darvasi, L.C. Tsui, B. Kerem,
Replication delay along FRA7H, a common fragile site on human chromosome 7, leads to chromosomal instability, Mol. Cell. Biol. 20 (2000)
4420–4427.
[171] H.H. Chen, D.C. Rau, E. Charney, The flexibility of alternating dA-dT
sequences, J. Biomol. Struct. Dyn. 2 (1985) 709–719.
[172] R.J. LaDuca, P.J. Fay, C. Chuang, C.S. McHenry, R.A. Bambara, Sitespecific pausing of deoxyribonucleic acid synthesis catalyzed by four
forms of Escherichia coli DNA polymerase III, Biochemistry 22 (1983)
5177–5188.
[173] T. Chen, A. Sahin, C.M. Aldaz, Deletion map of chromosome 16q in
ductal carcinoma in situ of the breast: refining a putative tumor suppressor
gene region, Cancer Res. 56 (1996) 5605–5609.
[174] J.A. Engelman, X.L. Zhang, M.P. Lisanti, Genes encoding human
caveolin-1 and -2 are co-localized to the D7S522 locus (7q31.1), a known
[175]
[176]
[177]
[178]
[179]
[180]
[181]
[182]
[183]
[184]
[185]
[186]
[187]
[188]
[189]
[190]
[191]
[192]
15
fragile site (FRA7G) that is frequently deleted in human cancers, FEBS
Lett. 436 (1998) 403–410.
K. Hibi, T. Takahashi, K. Yamakawa, R. Ueda, Y. Sekido, Y. Ariyoshi, M.
Suyama, H. Takagi, Y. Nakamura, T. Takahashi, Three distinct regions
involved in 3p deletion in human lung cancer, Oncogene 7 (1992) 445–449.
M. Negrini, C. Monaco, I. Vorechovsky, M. Ohta, T. Druck, R. Baffa, K.
Huebner, C.M. Croce, The FHIT gene at 3p14.2 is abnormal in breast
carcinomas, Cancer Res. 56 (1996) 3173–3179.
D. Michael, D.G. Beer, C.W. Wilke, D.E. Miller, T.W. Glover, Frequent
deletions of FHIT and FRA3B in Barrett's metaplasia and esophageal
adenocarcinomas, Oncogene 15 (1997) 1653–1659.
J.M. Fang, M.F. Arlt, A.C. Burgess, S.L. Dagenais, D.G. Beer, T.W.
Glover, Translocation breakpoints in FHIT and FRA3B in both homologs
of chromosome 3 in an esophageal adenocarcinoma, Genes Chromosomes Cancer 30 (2001) 292–298.
R. Shridhar, V. Shridhar, X. Wang, W. Paradee, M. Dugan, F. Sarkar, C.
Wilke, T.W. Glover, V.K. Vaitkevicius, D. Smith, Frequent breakpoints in
the 3p14.2 fragile site, FRA3B, in pancreatic tumors, Cancer Res. 56
(1996) 4347–4350.
B. Zbar, H. Brauch, C. Talmadge, M. Linehan, Loss of alleles of loci on
the short arm of chromosome 3 in renal cell carcinoma, Nature 327 (1987)
721–724.
V. Shridhar, L. Wang, R. Rosati, W. Paradee, R. Shridhar, C. Mullins, W.
Sakr, D. Grignon, O.J. Miller, Q.C. Sun, J. Petros, D.I. Smith, Frequent
breakpoints in the region surrounding FRA3B in sporadic renal cell
carcinomas, Oncogene 14 (1997) 1269–1277.
T.W. Glover, J.F. Coyle-Morris, F.P. Li, R.S. Brown, C.S. Berger, R.M.
Gemmill, F. Hecht, Translocation t(3;8)(p14.2;q24.1) in renal cell
carcinoma affects expression of the common fragile site at 3p14
(FRA3B) in lymphocytes, Cancer Genet. Cytogenet. 31 (1988) 69–73.
M. Ohta, H. Inoue, M.G. Cotticelli, K. Kastury, R. Baffa, J. Palazzo, Z.
Siprashvili, M. Mori, P. McCue, T. Druck, C.M. Croce, K. Huebner,
The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal
carcinoma-associated t (3;8) breakpoint, is abnormal in digestive tract
cancers, Cell 84 (1996) 587–597.
K. Huebner, P. Hadaczek, Z. Siprashvili, T. Druck, C.M. Croce, The FHIT
gene, a multiple tumor suppressor gene encompassing the carcinogen
sensitive chromosome fragile site, FRA3B, Biochim. Biophys. Acta 1332
(1997) M65–M70 Review.
G. Sozzi, M.L. Veronese, M. Negrini, R. Baffa, M.G. Cotticelli, H. Inoue,
S. Tornielli, S. Pilotti, L. De Gregorio, U. Pastorino, M.A. Pierotti, M.
Ohta, K. Huebner, C.M. Croce, The FHIT gene 3p14.2 is abnormal in
lung cancer, Cell 85 (1996) 17–26.
L. Virgilio, M. Shuster, S.M. Gollin, M.L. Veronese, M. Ohta, K. Huebner,
C.M. Croce, FHIT gene alterations in head and neck squamous cell
carcinomas, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 9770–9775.
H. Huang, C.P. Reed, A. Mordi, G. Lomberk, L. Wang, V. Shridhar, L.
Hartmann, Frequent deletions within FRA7G at 7q31.2 in invasive
epithelial ovarian cancer, Genes Chromosomes Cancer 24 (1999) 48–55.
G. Callahan, S.R. Denison, L.A. Phillips, V. Shridhar, D.I. Smith,
Characterization of the common fragile site FRA9E and its potential role
in ovarian cancer, Oncogene 22 (2003) 590–601.
T. Sato, A. Tanigami, K. Yamakawa, F. Akiyama, F. Kasumi, G.
Sakamoto, Y. Nakamura, Allelotype of breast cancer: cumulative allele
losses promote tumor progression in primary breast cancer, Cancer Res.
50 (1990) 7184–7189.
H. Tsuda, D.F. Callen, T. Fukutomi, Y. Nakamura, S. Hirohashi, Allele
loss on chromosome 16q24.2-qter occurs frequently in breast cancers
irrespectively of differences in phenotype and extent of spread, Cancer
Res. 54 (1994) 513–517.
C.M. Aldaz, T. Chen, A. Sahin, J. Cunningham, M. Bondy, Comparative
allelotype of in situ and invasive human breast cancer: high frequency of
microsatellite instability in lobular breast carcinomas, Cancer Res. 55
(1995) 3976–3981.
B.S. Carter, C.M. Ewing, W.S. Ward, B.F. Treiger, T.W. Aalders, J.A.
Schalken, J.I. Epstein, W.B. Isaacs, Allelic loss of chromosomes 16q and
10q in human prostate cancer, Proc. Natl. Acad. Sci. U. S. A. 87 (1990)
8751–8755.
16
T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16
[193] N. Nishida, Y. Fukuda, H. Kokuryu, T. Sadamoto, G. Isowa, K. Honda,
Y. Yamaoka, M. Ikenaga, H. Imura, K. Ishizaki, Accumulation of
allelic loss on arms of chromosomes 13q, 16q and 17p in the advanced
stages of human hepatocellular carcinoma, Int. J. Cancer 51 (1992)
862–868.
[194] A.K. Bednarek, K.J. Laflin, R.L. Daniel, Q. Liao, K.A. Hawkins, C.M.
Aldaz, WOX, a novel WW domain-containing protein mapping to human
chromosome 16q23.3-24.1, a region frequently affected in breast cancer,
Cancer Res. 60 (2000) 2140–2145.
[195] D. Ramos, C.M. Aldaz, WWOX, a chromosomal fragile site gene and its
role in cancer, Adv. Exp. Med. Biol. 587 (2006) 149–159 Review.
[196] K. Huebner, C.M. Croce, FRA3B and other common fragile sites: the
weakest links, Nat. Rev. Cancer 1 (2001) 214–221.
[197] L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, The neurobeachin
gene spans the common fragile site FRA13A, Hum. Genet. 118 (2006) 1–8.
[198] L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, Low-frequency
common fragile sites: link to neuropsychiatric disorders? Cancer Lett.
232 (2006) 58–69.