Available online at www.sciencedirect.com Biochimica et Biophysica Acta 1779 (2008) 3 – 16 www.elsevier.com/locate/bbagrm Review Human chromosome fragility T. Lukusa, J.P. Fryns ⁎ Center for Human Genetics, University of Leuven, Herestraat 49, B-3000 Leuven, Belgium Received 6 February 2007; received in revised form 2 October 2007; accepted 3 October 2007 Available online 3 December 2007 Abstract Fragile sites are heritable specific chromosome loci that exhibit an increased frequency of gaps, poor staining, constrictions or breaks when chromosomes are exposed to partial DNA replication inhibition. They constitute areas of chromatin that fail to compact during mitosis. They are classified as rare or common depending on their frequency within the population and are further subdivided on the basis of their specific induction chemistry into different groups differentiated as folate sensitive or non-folate sensitive rare fragile sites, and as aphidicolin, bromodeoxyuridine (BrdU) or 5-azacytidine inducible common fragile sites. Most of the known inducers of fragility share in common their potentiality to inhibit the elongation of DNA replication, particularly at fragile site loci. Seven folate sensitive (FRA10A, FRA11B, FRA12A, FRA16A, FRAXA, FRAXE and FRAXF) and two non-folate sensitive (FRA10B and FRA16B) fragile sites have been molecularly characterized. All have been found to represent expanded DNA repeat sequences resulting from a dynamic mutation involving the normally occurring polymorphic CCG/CGG trinucleotide repeats at the folate sensitive and AT-rich minisatellite repeats at the non-folate sensitive fragile sites. These expanded repeats were demonstrated, first, to have the potential, under certain conditions, to form stable secondary non-B DNA structures (intra-strand hairpins, slipped strand DNA or tetrahelical structures) and to present highly flexible repeat sequences, both conditions which are expected to affect the replication dynamics, and second, to decrease the efficiency of nucleosome assembly, resulting in decondensation defects seen as fragile sites. Thirteen aphidicolin inducible common fragile sites (FRA2G, FRA3B, FRA4F, FRA6E, FRA6F, FRA7E, FRA7G, FRA7H, FRA7I, FRA8C, FRA9E, FRA16D and FRAXB) have been characterized at a molecular level and found to represent relatively ATrich DNA areas, but without any expanded repeat motifs. Analysis of structural characteristics of the DNA at some of these sites (FRA2G, FRA3B, FRA6F, FRA7E, FRA7G, FRA7H, FRA7I, FRA16D and FRAXB) showed that they contained more areas of high DNA torsional flexibility with more highly AT-dinucleotide-rich islands than neighbouring non-fragile regions. These islands were shown to have the potential to form secondary non-B DNA structures and to interfere with higher-order chromatin folding. Therefore, a common fragility mechanism, characterized by high flexibility and the potential to form secondary structures and interfere with nucleosome assembly, is shared by all the cloned classes of fragile sites. From the clinical point of view, the folate sensitive rare fragile site FRAXA is the most important fragile site as it is associated with the fragile X syndrome, the most common form of familial mental retardation, affecting about 1/4000 males and 1/6000 females. Mental retardation in this syndrome is considered as resulting from the abolition of the FMR1 gene expression due to hypermethylation of the gene CpG islands adjacent to the expanded methylated trinucleotide repeat. FRAXE is associated with X-linked non-specific mental retardation, and FRA11B with Jacobsen syndrome. There is also some evidence that fragile sites, especially common fragile sites, are consistently involved in the in vivo chromosomal rearrangements related to cancer, whereas the possible implication of common fragile sites in neuropsychiatric and developmental disorders is still poorly documented. © 2007 Elsevier B.V. All rights reserved. Keywords: Rare fragile site; Common fragile site; CCG/CGG trinucleotide repeat; AT-rich minisatellite repeat; Dynamic mutation; DNA torsional flexibility 1. Introduction The first description of non-random human chromosome fragility was reported in 1965 in cells from a woman previously ⁎ Corresponding author. Tel.: +32 16 345899; fax: +32 16 346051. E-mail address: [email protected] (J.P. Fryns). 1874-9399/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagrm.2007.10.005 irradiated [1]. To date, according to the Genome Database and to the recent review by Schwartz et al. [2], more than 120 different fragile sites have been identified in the human genome. These sites can be defined as heritable specific loci on human chromosomes that exhibit non-random gaps, constrictions or breaks when chromosomes are exposed to specific cell culture conditions [2–5]. 4 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 Fragile sites are classified as rare or common, according to their expression frequency within the population [2,6,7]. Rare fragile sites are seen in the chromosomes of only a small fraction (b5%) of the population, whereas common fragile sites are considered to be an intrinsic part of the normal chromosome structure as they appear to be present in all individuals. Fragile sites in each category are further classified according to their specific mode of induction in vitro, i.e. their culture requirements [6,7]. Rare fragile sites are subdivided into folate sensitive and non-folate sensitive fragile sites. Folate sensitive rare fragile sites are induced by thymidylate stress, whereas non-folate sensitive ones are obtained after exposure to distamycin A (distamycin A-inducible) or to bromodeoxyuridine (BrdU-requiring). Most of the common fragile sites are induced by aphidicolin (aphidicolin inducible), whereas others are BrdU inducible (addition of BrdU) or 5-azacytidine inducible (addition of 5-azacytidine). In any way, significant cytogenetic expression of all known fragile sites requires an induction process during tissue culture, with the exception of some cases of spontaneously expressed FRA16B and FRA17A. On the other hand, the proportion of cells with visible fragile sites after induction is never 100%, apart from FRA16B under some culture conditions [8]. It is essential to underline that all the inducers of fragile sites can potentially stop elongation of DNA replication. In practice, only concentrations that partially inhibit the replication without arresting the cell cycle are used [3–5]. It has been shown that, after in vitro induction, fragile sites were often involved in deletions and translocations [9,10], in sister chromatid exchanges [11–16], in intrachromosomal gene amplification [17] and in plasmid integration [18]. They were also found to be involved in the in vivo occurrence of duplications and amplifications [19–21] or other chromosomal changes associated with human congenital diseases [22,23]. There is also some evidence that these loci are involved in the in vivo chromosomal rearrangements related to tumour: some fragile sites, especially common sites, have been found to colocalize with breakpoints resulting in in vivo deletions [24–28] and translocations [29–31] in various tumours. The understanding of the mechanism and the molecular basis of fragile sites is thus highly important for the comprehension and management of a series of human pathologies. Here we give an overview of the different categories of fragile sites, their known molecular basis and their clinical significance in human genetic diseases. Examples of individuals with more than one expressed rare fragile sites are known [36,37]. 2.1. Folate sensitive rare fragile sites The majority of the rare fragile sites (24/31) are folate sensitive (Table 1), being induced either by a culture medium deficient in folic acid and thymidine, and hence a medium with lowered levels of dTTP or dCTP, two immediate components of DNA, or by a medium enriched either in methotrexate, an inhibitor of folate metabolism, or in fluorodeoxyuridine (FrdU), an inhibitor of thymidylate synthesis [38]. Since expression of these fragile sites requires lowered levels of components involved in DNA synthesis, it was considered that these sites might be regions with special sequence composition which, under these induction conditions, could not allow completion of DNA synthesis simultaneously with the surrounding regions [39]. Further replication analysis at the folate sensitive fragile sites Xq27.3 and Xq28 revealed that the genomic regions in normal alleles undergo replication very late in the S phase, while the replication of these genomic regions in alleles expressing the fragile sites was further delayed into G2, especially under thymidylate stress conditions. The domain of the delayed replication was large, expanding approximately along 1 Mb (FRAXA) and 300 kb (FRAXE) of DNA at the fragile site region [40,41]. Table 1 Classification of rare fragile sites Sub-group Fragile site Location Folate sensitive (n = 24) FRA1M FRA2A FRA2B FRA2K FRA2L FRA5G FRA6A FRA7A FRA8A FRA9A FRA9B FRA10A FRA11A FRA11B FRA12A FRA12D FRA16A FRA18C FRA19B FRA20A FRA22A FRAXA FRAXE FRAXF FRA8E FRA11I FRA16E FRA16B FRA17A FRA10B FRA12C 1p21.3 2q11.2 2q13 2q22.3 2p11.2 5q35 6p23 7p11.2 8q22.3 9p21 9q32 10q23.3 11q13.3 11q23.3 12q13.1 12q24.13 16p13.11 18q22.1 19p13 20.11.23 22q13 Xq27.3 Xq28 Xq28 8q24.1 11p15.1 16p12.1 16q22.1 17p12 10q25.2 12q24.2 2. Rare fragile sites Up to date, 31 rare fragile sites have been documented in different specific families [2] where they segregate in a Mendelian codominant fashion, with an incidence ranging from one in several thousands to one in 20 individuals [6,32]. The rare FRA1M (1p21.3) has been reported only once [33]. The population frequency of cytogenetic expression of rare fragile sites is variable: 1/80 chromosomes for FRA10B in the Australian population [34], about 1/40 chromosomes (0.027) for FRA16B in the German population [35]. The FRA16B can be expressed in almost 100% of metaphases when induced with berenil in some carriers [7]. Distamycin A-inducible (n = 3) Distamycin A/BrdU inducible (n = 2) BrdU requiring (n = 2) T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 2.1.1. Molecular basis Up to now, seven folate sensitive fragile sites have been characterized at the molecular level: FRA10A at 10q23.3 [42], FRA11B at 11q23.3 [22], FRA16A at 16p13.11 [43], FRAXA at Xq27.3 [44–47], FRAXE at Xq28 [48], FRAXF at Xq28 [49,50] and, more recently, FRA12A at 12q13.1 [51]. All have been found to represent loci with expansive mutations of the normally occurring CCG/CGG trinucleotide repeat sequences adjacent to a CpG island [7,32,52]. In fact, normal alleles at these loci have short tracts of CCG/CGG repeats, with a copy number variation between individuals: 4–55 copies for FRAXA [45], 6–25 for FRAXE [48], 6–38 for FRAXF [49,50,53], 8–13 for FRA10A [42], 8–80 for FRA11B [22], 6– 23 for FRA12A [51] and 16–50 for FRA16A [43]. These repeat sequences undergo progressive increases in copy number, possibly due to failure of mismatch repair, to unequal crossing over or to replication slippage [7,54,55]. This expansion is unstable and dependent upon the length of the repeat tract: the longer the tract, the higher the instability and probability of further expansion. Also, the purity of the repeats favours the instability: most stable alleles in the FRAXA loci are composed of CCG/CGG repeats interspersed with AGG triplets which are believed to have a stabilizing effect, while alleles with expanded 3′ or 5′ CCG/CGG arrays that show fewer or no such interruptions exhibit the greatest instability in repeat copy number [56–63]. This progressive process constitutes a “dynamic mutation”. It results in a repeat-copy number polymorphism. At a certain moment, the copy number reaches a level above the normal range, but not enough to cause fragility expression (55–230 for FRAXA, 50–200 for FRAXE, 85–100 for FRA11B, 50–200 for FRA16A). During this “premutation phase”, the CCG/CGG repeats become highly unstable when transmitted to the next generation. The offspring may then have a longer or a shorter extension of the repeat sequence than the parent. Once the copy number passes a critical limit (N 230 repeats for FRAXA), it becomes a full mutation. At least in the case of FRAXA, this expansion of a premutation into a full mutation appears to occur exclusively in the female ovary during oogenesis [55]. Indeed, maternal premutation repeat size is known to be positively correlated with the risk of full mutation in the offspring, whereas paternal premutation repeat size is positively correlated with the offspring's repeat size. This led to the hypothesis that a premeiotic selection against germ cells that contain the full mutation in favour of those containing a premutation occurs in the male fetus testis whereas full mutations persist in the ovary of the female fetus [64]. As a consequence of the repeat expansion, the adjacent CpG island is hypermethylated [7,43]. Normally, the adjacent CpG island is completely methylated in full mutations [45], and hypermethylation of the CpG island neighbouring the expanded CCG/CGG repeats appears to be a requirement for the fragility expression [22,43,45,65,66]. In summary, expression of the rare folate sensitive fragile sites has at least two requirements: a methylated fully mutated CCG/CGG repeat and a limiting concentration of either dTTP or dCTP at the time of DNA synthesis. 5 2.1.2. Mechanisms for cytogenetic expression The cytogenetic expression of the fragility at these sites has been postulated to be determined by at least three intrinsic characteristics of the expanded trinucleotide repeat sequences. First, expanded single strand CCG/CGG repeat sequences can form stable secondary non-B DNA structures such as intrastrand hairpins [67–69], slipped strand DNA or S-DNA [70,71] or tetrahelical structures [72]. This propensity to form stable, unusual DNA secondary structures is dependent on the length of the repeat tract and on its purity [68,71,73], in the same way as for the repeat expansion process. The resulting non-B DNA structures have been shown to perturb the elongation of DNA replication, i.e. to affect the replication dynamics in vitro and in vivo [74,75]. Second, conformational investigations conducted on DNA fragments containing CGG/CCG triplet repeat sequences demonstrated that these repeats are more flexible and writhed than random B-DNA. Highly flexible trinucleotide repeat sequences are expected to perturb the replication process by acting as sinks for the accumulation of superhelical density generated in front of the progressing replication fork [76,77]. Third, it was shown that the elongation of CCG/CGG trinucleotide repeat tract strongly decreases the efficiency of nucleosome assembly in vitro [78] and that this effect was further enhanced by the methylation of these repeats [79]. This results in decondensation defects at the fragile sites, which cytogenetically manifest as gaps or constrictions. 2.1.3. Clinical significance Only two folate sensitive rare fragile sites are of proven clinical significance. Indeed, the expression of gonosomal FRAXA (Xq27.3) and FRAXE (Xq28) are associated with mental retardation, whereas the expressions of FRA10A (10q23.3), FRA12A (12q13.1) and FRA16A (16p13.11) have not yet been shown to correlate with any disease [6,43,80]. FRAXF (X28) was first identified in a family with developmental delay [81]. However, no consistent association with any specific phenotype could be unequivocally established after further investigations of this third gonosomal fragile site as a causative factor in non-specific or in syndromic mental retardation, in autism or in other pervasive developmental disorders [82,83]. It is now considered as a rare fragile site with no associated pathological phenotype [84]. A third folate sensitive rare fragile site, the autosomal FRA11B, is possibly implicated in the generation of abnormal offsprings. Indeed, the chromosomal deletion in a proportion of patients with Jacobsen syndrome maps at 11q23.3, where this fragile site is located [22,23,65], indicating that this rare fragile site could have caused instability and constitutional chromosomal breakage in vivo [22]. However, FRA11B has been estimated to be carried only by 1 in 5000 individuals [8], and the majority of Jacobsen syndrome deletion breakpoints have been found to map away from the FRA11B [85,86]. FRAXA is the most important of the fragile sites with a well documented clinical impact: it is associated with the fragile X syndrome (FRAXA syndrome), the most common form of familial severe mental retardation [46,87], affecting about 1/4000 males and 1/6000 females [88]. The prevalence of female premutation carriers is 1/260 in the general population [89]. The 6 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 defective gene in this syndrome, the FMR1 [46,90], has been found to be involved in 15–20% of all X-linked forms of mental retardation (XLMR) [88]. Fragile X patients with intragenic deletions [91,92] or point mutations [93] in the FMR1 gene have been identified, hereby demonstrating that fragile X syndrome is in fact a single gene disorder resulting from extinction of FMR1 function, whatever the involved pathogenic mechanism. FRAXE is associated with X-linked non-specific mental retardation (MRX), a mild form of mental retardation [48,94,95], and FMR2 is the defective gene in these patients [96]. In FRAX patients, the CCG/CGG repeat is in the 5′ untranslated (5′UTR) region located 250 bp distal to the CpG island of the FMR1 gene [45,97]. Its expansion leads to CpG island hypermethylation which is the major determinant in abolishing the FMR1 gene expression [98], with loss of transcription, absence of FMR1 mRNA and subsequent absence of the FMRP, the encoded protein of this gene. This lack of FMRP protein is considered as responsible for the mental retardation in the fragile X syndrome [99–101]. Similarly, in FRAXE patients, amplification of the CCG/ CGG repeat located in the 5′ untranslated region next to the CpG island of the FMR2 gene leads to hypermethylation of this CpG island with subsequent silencing of the gene and mild mental retardation [48,95,96,102]. The fragile X syndrome is an X-linked semidominant disorder, with the presence of clinical manifestations in all male carriers of full mutation and in about 35% of female heterozygous carriers of full mutation. Females are usually less severely affected than males, presumably because of X-inactivation [103]. The most prominent phenotypic feature is mental retardation. The other clinical characteristics mainly include a long face with prominent mandible, large ears, macro-orchidism in postpubertal males and abnormal behaviour with hyperactivity, short attention span, poor eye contact and stereotypic behaviour. A few other manifestations have also been recorded: epilepsy, strabismus, finger joint hyperextensibility, pectus excavatum and heart mitral valve prolapse. Normally, premutation carriers of FRAXA and FRAXE should not have clinical expression, given that their repeat sequence is not methylated and can be transcribed and produce protein. Nevertheless, an association has been established between FRAXA premutation and premature ovarian failure (POF). Indeed, in fragile X families, up to 20–25% of female FRAXA premutation carriers are susceptible to premature ovarian failure (POF) while full mutation carriers do not appear to present with such a risk [63,104–107]. A similar association was ascertained when screening women with POF: FRAXA premutation was found up to ten times more frequently than expected [108–110]. It was first suggested that such a risk was just correlated to paternally inherited premutation [107], but such an imprinting effect was not confirmed by other studies [111,112]. These differing findings are probably attributable to demographic selection biases [113]. The mechanism of the association between FRAXA premutation and POF is not yet clearly established. Elevated levels of FMR1 mRNA have been found in females carrying the FMR1 premutated allele [110,114], leading investigators to hypothesize a correlation between premutated FMR1 mRNA and POF manifestation [110]. On the other hand, premutation carriers, especially older adult male carriers, have been recently reported to present a multisystem, progressive neurodegenerative disorder including intentional tremor, gait ataxia, parkinsonism, autonomic dysfunction and cognitive decline, the so-called fragile-X-associated tremor/ataxia syndrome (FXTAS) [115–119]. This syndrome has not been observed among older adults with full mutation, and its penetrance is relatively low in female premutation carriers, very likely in part because of the partial protection afforded by X-inactivation of the premutation allele [118]. FXTAS represents a new form of inclusion disorder characterized by pathognomonic presence in neurons and astrocytes throughout the brain of not yet completely identified intranuclear ubiquitin-positive inclusions postulated to be initiated by abnormal FMR1 mRNA accumulation [118,120]. Indeed, in contrast to the affected male full mutation carriers with loss of transcription, subsequent absence of FMR1 mRNA and total lack of FMR protein (FMRP), male premutation carriers were found to show increased transcription of the mutant FMR1 gene resulting in accumulation of FMR1 mRNA in peripheral blood leukocytes and CNS tissue with, however, normal or reduced FMRP production due to reduced translational efficiency of this expanded-repeat FMR1 mRNA [118,121,122]. This peculiar accumulation of FMR1 mRNA led investigators to propose an RNA “toxic gain-of-function” model to explain FXTAS [116,120,123], a model in which the neurological disorder is caused by the accumulated FMR1 mRNA itself, with subsequent cellular sequestration of important RNA-binding proteins and eventually cell death. Consistent with this model, the FMR1 mRNA [124] and at least two RNA-binding proteins [125] have recently been identified within the intranuclear inclusions isolated from post-mortem brain tissues of a limited number of FXTAS patients. These findings, although interesting, need to be confirmed in a larger number of FXTAS patients. The mutation rate for this familial syndrome seems to be rather low. Generally, each affected patient has a mother with at least a premutation, and it has been suggested that the different affected individuals in a population stem from a few ancestors. In other words, there should be a pool of founder chromosomes or predisposed normal haplotypes from which most FRAXA sites arise [126]. A similar conclusion was proposed for FRAXE by Ritchie et al. [80] who, by comparing the FRAXE allele sizes in different normal populations, found similar mean repeat array sizes between populations, with a major mode of 16–18 repeats, thus pointing to a few predisposing alleles in the population pools, from which the expanded alleles would derive. 2.2. Non-folate sensitive fragile sites Seven fragile sites are listed in this category: FRA8E, FRA10B, FRA11I, FRA12C, FRA16B, FRA16E and FRA17A (Table 1). They are induced by distamycin A and related compounds and/or by bromodeoxyuridine (BrdU), an analog of thymidine [2,4,7]. Distamycin A and related compounds berenil, netropsin and Hoechst 33258 are known to bind DNA with a high affinity in T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 the minor groove of AT-rich sequences, impeding DNA replication [127–129]. BrdU can stop DNA replication after incorporating itself into the DNA sequence in substitution for thymidine during synthesis [130]. For fragile site induction, low BrdU concentrations which only partially inhibit replication should be used [3]. Three groups can be considered depending on the specific mode of induction: (1) Distamycin A/BrdU-inducible rare fragile sites: the fragile sites of this group, FRA16B (16q22.1) and FRA17A (17p12), are inducible both by distamycin A and related compounds and by BrdU [2,4,7]. FRA16B is the most common of all rare autosomal fragile sites in man. It is carried by about 5% of European as well as Australian population [35,37,131]. (2) Distamycin A-inducible/BrdU-insensitive rare fragile sites: three fragile sites pertain to this group: FRA8E (8q24.1), FRA11I (11p15.1) and FRA16E (16p12.1). These fragile sites can be induced by distamycin A and related compounds berenil, netropsin and Hoechst 33258, but not by BrdU [2,7,29,132,133]. They have been recorded only in the Japanese population [8,133]. The FRA8E mutation was confirmed in two families to be heritable as a Mendelian codominant trait [132]. (3) BrdU-requiring/distamycin A-insensitive rare fragile sites: this group includes 2 fragile sites, FRA10B (10q25.2) and FRA12C (12q24.2), which require the specific presence of BrdU or BrdC (bromodeoxycytidine) in the culture medium [2,3,7], whereas they are not inducible by AT-minor groove binders. FRA10B is present in about 1/40 individuals of the Australian population [34]. In fact, distamycin A inducible and, less frequently, BrdU requiring fragile sites can show spontaneous expression in vitro, and addition of inducers serve to further enhance the expression [4,134]. Analysis of the spontaneous replication timing at some of these sites revealed late replication or replication delay in the fragile site expressing alleles as compared to nonexpressing alleles. Replication occurred in the mid-S phase for the FRA10B nonexpressing allele while it was delayed in the S3–G2 phase on the distal side of the expressing allele. It occurred in the very lateS phase for the FRA16B nonexpressing allele while a shift to later replication was noted in the expressing alleles [134]. 2.2.1. Molecular basis Two non-folate sensitive rare fragile sites, FRA10B [135] and FRA16B [136], have been cloned to date were and found to comprise polymorphic AT-rich minisatellite repeats. Their expression is associated with expansion of one or more repeats, showing increase of up to several kilobases of DNA [135,136]. Their expanded repeats are highly similar, sharing up to 31 identical bases, with the highest homology being found in the 5′ends of the repeats which share 12 identical base pairs including an inverted 11-bp sequence which is present in three copies. These inverted AT/TA repeats are able to form secondary hairpin structures that are difficult to replicate [135,137]. 7 The FRA10B region consists of a highly AT-rich (91%) region in the centre, containing minisatellite repeats of different lengths, 16–52 bp, with a 42-bp consensus sequence (GATATAATATATCATATATATTATATATGATATATTATATAT) shared by the different expanded repeats [2,135,137], and of non-repetitive flanking regions with less high AT content (up to 58%). The number of the minisatellite repeat copies varies between individuals, showing thus a high polymorphism in the normal population, with small normal alleles (0.8–1 kb) comprising up to 66% of alleles, intermediate normal alleles (1– 4 kb) representing up to 33% of alleles and large normal alleles (4–5 kb) including up to 1% alleles [135]. It has been shown that the large alleles are derived from the intermediate alleles, which in turn are derived from short normal alleles. Such founder effects, which are similar to the ones observed previously for trinucleotide repeats, support an expansion model based on a dynamic mutation process [135,137]. Once the repeat copy number passes a threshold of 5 kb, i.e. about 75 copies, the allele is expressed. It was demonstrated that repetitive sequences in the expressing alleles are caused by expansion in copy number of at least one of the minisatellite repeats present in the FRA10B locus and sharing the 42-bp motif [135]. Some alleles comprised a mixture of different expanded repeat motifs, but in each expressing allele at least four repeats were uninterrupted. In some cases, the expressing alleles could extend over 100 kb in length. A variation in repeat size and composition between different families was observed, indicating multiple independent expansion events. Both intergenerational and somatic instability of the expanded FRA10B sequences was seen [135]. The AT-rich minisatellite repeats of the FRA16B region display a sequence polymorphism, being composed of variable 26–33 bp-long sequences in normal alleles. All these sequences conform, however, to a 33-bp consensus sequence (ATATATTATATATTATATCTAAT AATATAT(C/A)TA) except for a single C/A base substitution at position 31 [136]. Normal alleles contain 7–12 copies of repeat sequences, thus showing repeatcopy number polymorphism in the normal population. The minisatellite copies in the expressing alleles are all 33 bp-long, indicating that fragile sites would result from expansion of perfect repeat copies of a 33 bp-long AT-rich repeat located at the fragile site locus. This expansion yields remarkably large (15–70 kb) expressing alleles which can contain up to 2000 copies [136]. These expressing alleles differ clearly between families but are of similar size within families. Neither intergenerational nor somatic instability in carriers of this fragile site could be accurately investigated on such large (at least 15 kb) expansion sequences [55,136] and no definite relationship could be established between expanded alleles and a “pool” of premutated alleles indicating predisposition to expansion. 2.2.2. Mechanisms for cytogenetic expression It has been hypothesized that lesions at fragile sites arise as a result of replication failure at chromosomal points that are unusually sensitive to interference during DNA synthesis [138]. For the non-folate sensitive rare fragile sites, a complex 8 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 multifactorial mechanism appears to be involved in replication failure leading to cytogenetic expression of the fragility. First, the extraordinary expansion of the AT-rich repeats in the expressing fragile sites may generate perturbation of DNA replication [134]. This replication perturbation was found to extend along a large genomic region flanking the expanded repeats [134]. Furthermore, the expanded inverted AT-rich repeats are prone to form hairpin structures that may contribute to their further expansion and are difficult to replicate [135,136]. The binding of AT-rich DNA minor groove ligands, or the replication hindrance caused by incorporation of BrdU in replacement of thymidine in this highly AT-rich region, may further emphasize the replication failure. This failure may lead to incomplete chromosome condensation either because the DNA polymerase complex which is still present on late-replicating DNA causes steric inhibition, thus hindering chromosome condensation, or because non-replicated DNA resulting from this failure remains uncondensed in the G2 phase of the cell cycle, after condensation of the remaining chromosome is already signalled [138].This failure of chromosome condensation along a genomic region may create unstable chromatin at this region and be manifested in metaphase chromosomes as gaps, breaks or poor staining. Hsu and Wang [139] demonstrated, for FRA16B, that both the expanded 33-bp AT-rich repeats at this site and the presence of the ligand distamycin contribute to exclude nucleosome formation. This phenomenon happened essentially in a distamycin-dependent manner, but increasing the copy number of these repeats was found to further enhance the inhibition of nucleosome assembly. In fact, distamycin has been demonstrated to alter the rotational positioning of the nucleosome-assembled DNA [140]. As the AT-rich FRA16B DNA sequences contain contiguous distamycin binding sites, these DNA sequences might not be able, when the amount of distamycin is sufficient to highly saturate the binding sites, to adopt a rotational positioning favourable for nucleosome assembly [139]. 2.2.3. Clinical significance No proven phenotypic effects have been recorded in individuals expressing non-folate sensitive rare fragile sites. Homozygotes for FRA10B, FRA16B and FRA17A have been identified as normal individuals, indicating that these three fragile sites have no clinical significance [37,141,142] and, although the genomic region of FRA8E has been shown to be involved in various chromosomal rearrangements associated with Langer– Giedion syndrome [143–145], most FRA8E carriers recorded to date were healthy subjects [146], thus implying that the FRA8E mutation is not linked to a particular disease. 3. Common fragile sites Up today, at least 88 common fragile sites have been recorded and classified on human chromosomes (Table 2), with variable prevalence and expression levels [5,147]. They are expressed in cells grown under culture conditions that inhibit DNA replication, e.g. conditions of thymidylate and folate stress, or presence of appropriate doses of aphidicolin [5,9,148,149]. They are seen in all individuals as part of the normal chromosome structure, but the proportion of cells with cytogenetic expression varies from individual to individual, reaching in some individuals levels of expression up to 30% [7]. The cytogenetic expression of these sites is visible over wide chromosomal regions of megabases in size. Common fragile sites seem therefore to represent regions of fragility, rather than specific loci [137]. FRA3B (3p14.2) is the most highly inducible common fragile site, found in treated metaphases from most humans [150]. FRA6E (6q26), FRA7H (7q32.3), FRA16D (16q23) and FRAXB (Xp22.3) are also highly expressed in human lymphocytes [5,24]. Several common fragile sites have been implicated as breakpoints in the in vivo chromosomal rearrangements related to cancer [147,149]. They are also regions of potential genome instability [148], being hotspots for deletions and translocations [9,10], increased rates of sister chromatid exchanges [11,13,14], plasmid or viral integration [18,151–153] and intrachromosomal gene amplification [17,21,154]. Common fragile sites fall into 3 groups: those induced by aphidicolin, those induced by 5-azacytidine and those induced by BrdU (Table 2). (1) Common aphidicolin inducible fragile sites: aphidicolin, a specific inhibitor of the replicative DNA polymerases α and δ, is a major inducing agent for common fragile sites. It interferes with replication fork progression [5]. Aphidicolin inducible fragile sites can be spontaneously expressed, but induction by aphidicolin enhances their expression in a dose-dependant manner [5]. They can also be induced by the addition of fluorodeoxyuridine (FdUrd), an inhibitor of thymidylate synthesis, to the culture medium, thus causing a depletion of cellular dNTP pools [147]. In addition, their expression can be enhanced by using folate deficient culture medium or medium enriched in methotrexate, an inhibitor of folate metabolism [5,147]. To achieve a good induction, low concentrations of aphidicolin, which only partially inhibit replication without arresting the cell cycle, should be used. The majority of accepted common fragile sites (77/88) belong to this group (Table 2). (2) Common BrdU-inducible fragile sites: seven common fragile sites (Table 2) are specifically induced by BrdU. They map to different genomic regions than the BrdUinducible rare fragile sites. The timing of exposure to BrdU is critical for the fragile site expression, the optimal timing being 6–12 h exposure [155]. (3) Common 5-azacytidin inducible fragile sites: The four fragile sites FRA1H (1q42), FRA1J (1q12), FRA9F (9q12) and FRA19A (19q13) are induced by 5azacytidin, an analogue of cytisine that is incorporated into the DNA sequence in substitution of cytosine during replication [155]. 3.1. Molecular basis At present, thirteen common fragile sites have been cloned and characterized at molecular level in various ways: FRA2G at T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 Table 2 Classification of common fragile sites 9 Table 2 (continued) Sub-group Fragile site Location Aphidicolin inducible (n = 77) FRA1A FRA1B FRA1C FRA1D FRA1E FRA1F FRA1G FRA1I FRA1K FRA1L FRA2C FRA2D FRA2E FRA2F FRA2G FRA2H FRA2I FRA2J FRA3A FRA3B FRA3C FRA3D FRA4A FRA4C FRA4D FRA4F FRA5C FRA5D FRA5E FRA5F FRA6B FRA6C FRA6E FRA6F FRA6G FRA7B FRA7C FRA7D FRA7E FRA7F FRA7G FRA7H FRA7I FRA7J FRA8B FRA8C FRA8D FRA9D FRA9E FRA10D FRA10E FRA10F FRA10G FRA11C FRA11D FRA11E FRA11F FRA11G FRA11H FRA12B FRA12E FRA13A FRA13C FRA13D 1p36 1p32 1p31.2 1p22 1p21.2 1q21 1q25.1 1q44 1q31 1p31 2p24.2 2p16.2 2p13 2q21.3 2q31 2q32.1 2q33 2q37.3 3p24.2 3p14.2 3q27 3q25 4p16.1 4q31.1 4p15 4q22 5q31.1 5q15 5p14 5q21 6p25.1 6p22.2 6q26 6q21 6q15 7p22 7p14.4 7p13 7q21.2 7q22 7q31.2 7q32.3 7q36 7q11 8q22.1 8q24.1 8q24.3 9q22.1 9q32 10q22.1 10q25.2 10q26.1 10q11.2 11p15.1 11p14.2 11p13 11q14.2 11q23.3 11q13 12q21.3 12q24 13q13.2 13q21.2 13q32 (continued on next page) Sub-group Fragile site Location Aphidicolin inducible (n = 77) FRA14B FRA14C FRA15A FRA16C FRA16D FRA17B FRA18A FRA18B FRA20B FRA22B FRAXB FRAXC FRAXD FRA4B FRA5A FRA5B FRA6D FRA9C FRA10C FRA13B FRA1H FRA1J FRA9F FRA19A 14q23 14q24.1 15q22 16q22.1 16q23.2 17q23.1 18q12.2 18q21.3 20p12.2 22q12.2 Xp22.31 Xq22.1 Xq27.2 4q12 5p13 5q15 6q13 9p21 10q21 13q21 1q42 1q12 9q12 19q13 BrdU inducible (n = 7) 5-Azacytidine inducible (n = 4) 2q31, FRA3B at 3p14.2, FRA4F at 4q22, FRA6E at 6q26, FRA6F at 6q21, FRA7E at 7q21.2, FRA7G at 7q31.2, FRA7H at 7q32.3, FRA7I at 7q36, FRA8C at 8q24.1, FRA9E at 9q32, FRA16D at 16q23.2 and FRAXB at Xp22.31 [2]. All are aphidicolin inducible, and genomic breakage and instability at these fragile sites occur along a large genomic region extending over at least 500 kb [156,157]. All are relatively AT-rich areas [157–159], but they do not show any repeat motifs such as expanded trinucleotide or minisatellite repeats that could predispose to fragility as has been demonstrated in the rare fragile sites [24,153,2,160]. To understand the molecular mechanism of fragility at these sites, another investigation approach was adopted in which structural characteristics of the DNA rather than their sequence per se was examined. When measuring local fluctuations at the twist angle between consecutive base pairs along the DNA molecule backbone, it was found that the common fragile site regions analysed to date, namely FRA2G, FRA3B, FRA6F, FRA7E, FRA7G, FRA7H, FRA7I, FRA16D and FRAXB, contain more areas of high DNA torsional flexibility, termed flexibility peaks, than non-fragile regions mapped to the same band [24,27,153,158, 161–164]. These flexibility peaks, which can present as “clusters of flexibility peaks” when including at least three close-set peaks [164], are composed of interrupted ATdinucleotide-rich sequences of various lengths termed ATdinucleotide-rich flexibility islands. These islands, which are significantly more AT-dinucleotide-rich than their nonflexible flanking sequences, have the potential to form unusual DNA secondary structures that can perturb replication [164]. They have been shown, in vivo, to influence the level of chromatin 10 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 higher-order folding [165,166]. The sequences of these flexibility islands, with a high AT content composition and a high level of AT/TA-dinucleotides, are similar to AT-rich repeats in the rare FRA10B and FRA16B. However, expanded alleles of rare fragile sites comprise up to several kilobases of uninterrupted repeats, while flexibility peaks of common fragile sites are interrupted clusters of short AT-dinucleotide rich islands [166]. The secondary structures generated by the sequences at the flexibility islands can contribute to the mechanism of fragility at common fragile sites in the same way as the secondary hairpin structures of expanded AT-rich minisatellite repeats that underlie the fragility of the rare FRA16B and FRA10B. Moreover, long AT-rich flexibility islands have been identified both in the FRA10B and FRA16B regions [166]. Accordingly, a shared mechanism, conferred by sequences with a potential to form secondary structures, can perturb replication and lead to fragility at both rare fragile sites harbouring AT-rich minisatellite repeats and aphidicolininduced common fragile sites [166]. 3.2. Mechanisms for cytogenetic expression There are lines of evidence suggesting that aphidicolininduced common fragile sites represent unreplicated DNA resulting from stalled replication forks [167,168]. These sites replicate late during S phase, even under normal culture conditions [169,170], indicating that their sequences include intrinsic features that might lead to delay in replication. Aphidicolin acts by inducing further delay in replication progression that causes a significant portion of the fragile region to remain unreplicated in G2 [21,168–170]. The AT-rich-dinucleotide flexibility islands constitute one of the postulated intrinsic features of common aphidicolin-inducible fragile sites that might generate replication perturbation either because of their high DNA flexibility [171], or because of their potential to form DNA secondary structures that can perturb the progression of the replication fork [164,172]. Highly flexible DNA sequences would be expected, by analogy to the mechanism proposed for the highly flexible trinucleotide repeat sequences [76,77], to act as sinks for the accumulation of superhelical density generated in front of the progressing replication fork. The subsequent superhelical density can hamper efficient topoisomerase activity and reduce the polymerase complex progression [77]. The activity of the polymerase complex is expected to be further inhibited by adding low doses of aphidicolin to the culture medium. The subsequent unreplicated DNA regions may locally affect chromatin structure, leading to instability as well as recombinogenic properties of fragile sites. Thus, the cytogenetic appearance of gaps and constrictions at common fragile sites might reflect incomplete or delayed resolution of stalled replication forks [164,167]. The inconsistency in replication progression between fragile and flanking non-fragile regions might contribute to occurrence of breaks at these fragile sites. 3.3. Clinical significance Common fragile sites have been implicated as breakpoints in chromosomal rearrangements observed in malignant cells [27,147,149,173,174], suggesting a role in tumorigenesis for some genes associated to fragile sites [149]. For instance, FRA3B, the most active common fragile site on human metaphase chromosomes, maps to a 3p region associated with deletions or translocation breakpoints in human lung cancer [175], in breast carcinoma [176], in oesophageal adenocarcinoma [177,178], in pancreatic tumours [179] or in renal cell carcinoma [180–182]. The FHIT (fragile histidine triad) gene maps to the same chromosomal region [151,183] and is considered as a multiple suppressor gene [183,184]. It has been shown that this gene is frequently deleted [176,183,185,186] or involved in translocation breakpoints [178,183] in a large number of tumour types. Other common fragile sites have been implicated in homologous deletions or loss of heterozygosity (LOH) observed in a number of tumours. These include FRA6E [25], FRA7G [187] and FRA9E [188] in ovarian cancer, FRA16D in breast cancer [173,189–191], in gastric adenocarcinoma and multiple myeloma [26], in prostate [192] and hepatocellular [193] carcinoma. A gene, the WWOX gene, has been cloned in the FRA16D region [194] and shown to decrease tumour growth in vivo [195]. These findings are consistent with the suggestion that common fragile sites are generally unstable and may lead to gene inactivation in cancer cells [196]. Associations between common fragile sites and neuropsychiatric disorders have been postulated, especially between FRA6E and autosomal recessive juvenile parkinsonism [25], and FRA13A and idiopathic autism [197,198]. This may suggest that frequent recombination events at these sites could destabilize genes involved in the development and function of the central nervous system. However, the involvement of these sites and other common fragile sites in the generation of mutations responsible for these disorders is still poorly substantiated. 4. Conclusion Late and/or delayed replication appears to be associated with induced as well as spontaneous fragility at both rare and common fragile sites. By comparing the molecular anatomy of the different classes of human chromosome fragile sites, it could be expected to identify features that are common to all classes and that might constitute the essential requirements for replication perturbation and fragile site expression. Although no common DNA sequence motif that could account for all the classes of fragile sites can be identified, a general molecular mechanism for replication failure and fragility appears to emerge from the intrinsic characteristics of the sequences, either CCG/CGG trinucleotide repeats, AT-rich minisatellite repeats or ATdinucleotide-rich islands, which were found at the different sites cloned to date: all are prone to form stable secondary DNA structures capable of perturbing the DNA replication, all have been shown to contain highly flexible DNA sequences which have the potential to impede the progressing replication fork and to affect the chromatin organisation, all have been found to disfavour nucleosome assembly. These properties can be amplified by replication stress conditions, leading to failure of chromatin condensation along a large genomic region and to subsequent fragility. T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 Apart from the folate sensitive rare fragile sites FRAXA and FRAXE which are directly associated with mental retardation, and the FRA11B which is possibly implicated in generation of some cases of Jacobsen syndrome, the other fragile sites have not yet been consistently associated with any specific phenotype. However, associations between fragile sites, especially common fragile sites, and cancer have been consistently documented. Further cloning and molecular characterization of rare and common fragile sites is expected to improve our comprehension of the involvement of these sites in human genetic disorders. References [1] A. Dekaban, Persisting clone of cells with an abnormal chromosome in a woman previously irradiated, J. Nucl. Med. 6 (1965) 740–746. [2] M. Schwartz, E. Zlotorynski, B. Kerem, The molecular basis of common and rare fragile sites, Cancer Lett. 232 (2006) 13–26 Review. [3] G.R. Sutherland, E. Baker, R.S. Seshadri, Heritable fragile sites on human chromosomes. V. A new class of fragile site requiring BrdU for expression, Am. J. Hum. Genet. 32 (1980) 542–548. [4] G.R. Sutherland, P.B. Jacky, E.G. Baker, Heritable fragile sites on human chromosomes. XI. Factors affecting expression of fragile sites at 10q25, 16q22, and 17p12, Am. J. Hum. Genet. 36 (1984) 110–122. [5] T.W. Glover, C. Berger, J. Coyle, B. Echo, DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes, Hum. Genet. 67 (1984) 136–142. [6] G.R. Sutherland, F. Hecht, Fragile sites on human chromosomes, In: Oxford Monographs on Medical Genetics, Oxford University Press, Oxford, U.K., 1985 [7] G.R. Sutherland, R.I. Richards, The molecular basis of fragile sites in human chromosomes, Curr. Opin. Genet. Dev. 5 (1995) 323–327. [8] G.R. Sutherland, E. Baker, The clinical significance of fragile sites on human chromosomes, Clin. Genet. 58 (2000) 1–7. [9] T.W. Glover, C.K. Stein, Chromosome breakage and recombination at fragile sites, Am. J. Hum. Genet. 43 (1988) 265–273. [10] L. Wang, W. Paradee, C. Mullins, R. Shridhar, R. Rosati, C.M. Wilke, T.W. Glover, D.I. Smith, Aphidicolin-induced FRA3B breakpoints cluster in two distinct regions. Genomics 41 (1997) 485–488. [11] T.W. Glover, C.K. Stein, Induction of sister chromatid exchanges at common fragile sites, Am. J. Hum. Genet. 41 (1987) 882–890. [12] M. Schmid, W. Feichtinger, T. Haaf, The fragile site (16)(q22). II. Sister chromatid exchanges, Hum. Genet. 76 (1987) 365–368. [13] W. Feichtinger, M. Schmid, Increased frequencies of sister chromatid exchanges at common fragile sites (1)(q42) and (19)(q13), Hum. Genet. 83 (1989) 145–745. [14] B. Hirsch, Sister chromatid exchanges are preferentially induced at expressed and nonexpressed common fragile sites, Hum. Genet. 87 (1991) 302–306. [15] T. Lukusa, E. Meulepas, J.P. Fryns, H. Van den Berghe, J.J. Cassiman, “Spontaneous” FRA16B is a hot spot for sister chromatid exchanges, Hum. Genet. 87 (1991) 583–586. [16] H. Tsuji, A. Hitomi, E. Takahashi, M. Murata, T. Ikeuchi, K. Yamamoto, S. Tsuji, T. Hori, Induction of distamycin A-inducible rare fragile sites and increased sister chromatid exchanges at the fragile site, Hum. Genet. 87 (1991) 254–260. [17] A. Coquelle, E. Pipiras, F. Toledo, G. Buttin, M. Debatisse, Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons, Cell 89 (1997) 215–225. [18] F.V. Rassool, T.W. McKeithan, M.E. Neilly, E. van Melle, R.D. Espinosa, M.M. Le Beau, Preferential integration of marker DNA into the chromosomal fragile site at 3p14: an approach to cloning fragile sites, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 6657–6661. 11 [19] N. Villa, L. Dalpra, L. Larizza, Expression of three rare fragile sites: chromosomal truncation, amplification of distal segment and telomeric renewal, Chromosoma 106 (1997) 400–404. [20] D. Kotzot, M.J. Martinez, G. Bagci, S. Basaran, A. Baumer, F. Binkert, L. Brecevic, C. Castellan, K. Chrzanowska, F. Dutly, A. Gutkowska, S.B. Karauzum, M. Krajewska-Walasek, G. Luleci, P. Miny, M. Riegel, S. Schuffenhauer, H. Seidel, A. Schinzel, Parental origin and mechanisms of formation of cytogenetically recognisable de novo direct and inverted duplications, J. Med. Genet. 37 (2000) 281–286. [21] A. Hellman, E. Zlotorynski, S.W. Scherer, J. Cheung, J.B. Vincent, D.I. Smith, L. Trakhtenbrot, B. Kerem, A role for common fragile site induction in amplification of human oncogenes, Cancer Cell 1 (2002) 89–97. [22] C. Jones, L. Penny, T. Mattina, S. Yu, E. Baker, L. Voullaire, W.Y. Langdon, G.R. Sutherland, R.I. Richards, A. Tunnacliffe, Association of a chromosome deletion syndrome with a fragile site within the protooncogene CBL2, Nature 376 (6536) (1995) 145–149. [23] L.A. Penny, M. Dell'Aquila, M.C. Jones, J. Bergoffen, C. Cunniff, J.-P. Fryns, E. Grace, J.M. Graham, B. Kouseff, T. Mattina, J. Syme, L. Voullaire, L. Zelante, J. Zenger-Hain, O.W. Jones, G.A. Evans, Clinical and molecular characterization of patients with distal 11q deletions, Am. J. Hum. Genet. 56 (3) (1995) 676–683. [24] M.F. Arlt, D.E. Miller, D.G. Beer, T.W. Glover, Molecular characterization of FRAXB and comparative common fragile site instability in cancer cells. Genes Chromosomes Cancer 33 (2002) 82–92. [25] S.R. Denison, G. Callahan, N.A. Becker, L.A. Phillips, D.I. Smith, Characterization of FRA6E and its potential role in autosomal recessive juvenile parkinsonism and ovarian cancer, Genes Chromosomes Cancer 38 (2003) 40–52. [26] M. Mangelsdorf, K. Ried, E. Woollatt, S. Dayan, H. Eyre, M. Finnis, L. Hobson, J. Nancarrow, D. Venter, E. Baker, R.I. Richards, Chromosomal fragile site FRA16D and DNA instability in cancer, Cancer Res. 60 (2000) 1683–1689. [27] K. Mimori, T. Druck, H. Inoue, H. Alder, L. Berk, M. Mori, K. Huebner, C.M. Croce, Cancer-specific chromosome alterations in the constitutive fragile region FRA3B, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 7456–7461. [28] L. Wang, J. Darling, J.S. Zhang, C.P. Qian, L. Hartmann, C. Conover, R. Jenkins, D.I. Smith, Frequent homozygous deletions in the FRA3B region in tumor cell lines still leave the FHIT exons intact. Oncogene 16 (1998) 635–642. [29] E. Takahashi, Y. Kaneko, T. Ishihara, M. Minamihisamatsu, M. Murata, T. Hori, A new rare distamycin A-inducible fragile site, fra(11) (p15.1), found in two acute nonlymphocytic leukemia (ANLL) patients with t (7;11)(p15-p13;p15), Hum. Genet. 80 (1988) 124–126. [30] C.M. Wilke, S.W. Guo, B.K. Hall, F. Boldog, R.M. Gemmill, S.C. Chandrasekharappa, C.L. Barcroft, H.A. Drabkin, T.W. Glover, Multicolor FISH mapping of YAC clones in 3p14 and identification of YAC spanning both FRA3B and the t(3;8) associated with hereditary renal cell carcinoma, Genomics 22 (1994) 319–326. [31] K.A. Krummel, L.R. Roberts, M. Kawakami, T.W. Glover, D.I. Smith, The characterization of the common fragile site FRA16D and its involvement in multiple myeloma translocations, Genomics 69 (2000) 37–46. [32] G.R. Sutherland, Rare fragile sites, Cytogenet. Genome Res. 100 (2003) 77–84. [33] E. Baker, G.R. Sutherland, A new folate sensitive fragile site at 1p21.3, J. Med. Genet. 28 (1991) 356–357. [34] G.R. Sutherland, Heritable fragile sites on human chromosomes. IX. Population cytogenetics and segregation analysis of the BrdU requiring fragile site at 10q25, Am. J. Hum. Genet. 34 (1982) 753–756. [35] M. Schmid, W. Feichtinger, A. Jeβberger, J. Köhler, R. Lange, The fragile site (16)(q22) I. Induction by AT-specific DNA-ligands and population frequency, Hum. Genet. 74 (1986) 67–73. [36] G.R. Sutherland, E. Baker, Unusual behaviour of a human autosome having two rare folate sensitive fragile sites, Ann. Genet. 36 (1993) 159–162. [37] T. Hocking, W. Feichtinger, M. Schmid, E.A. Haan, E. Baker, G.R. Sutherland, Homozygotes for FRA16B are normal, Chromosome Res. 7 (1999) 553–556. 12 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 [38] G.R. Sutherland, Heritable fragile sites on human chromosomes. I. Factors affecting expression in lymphocyte culture, Am. J. Hum. Genet. 31 (1979) 125–135. [39] G.R. Sutherland, The role of nucleotides in human fragile site expression, Mutat. Res. 200 (1988) 207–213. [40] P.S. Subramanian, D.L. Nelson, A.C. Chinault, Large domains of apparent delayed replication timing associated with triplet repeat expansion at FRAXA and FRAXE. Am. J. Hum. Genet. 59 (1996) 407–416. [41] R.S. Hansen, T.K. Canfield, A.D. Fjeld, S. Mumm, C.D. Laird, S.M. Gartler, A variable domain of delayed replication in FRAXA fragile X chromosomes: X inactivation-like spread of late replication, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 4587–4592. [42] T. Sarafidou, C. Kahl, I. Martinez-Garay, M. Mangelsdorf, S. Gesk, E. Baker, M. Kokkinaki, P. Talley, E.L. Maltby, L. French, L. Harder, B. Hinzmann, C. Nobile, K. Richkind, M. Finnis, P. Deloukas, G.R. Sutherland, K. Kutsche, N.K. Moschonas, R. Siebert, J. Gécz, Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein, Genomics 84 (2004) 69–81. [43] J.K. Nancarrow, E. Kremer, K. Holman, H. Eyre, N.A. Doggett, D. Le Paslier, D.F. Callen, G.R. Sutherland, R.I. Richards, Implications of FRA16A structure for the mechanism of chromosomal fragile site genesis, Science 264 (1994) 1938–1941. [44] E.J. Kremer, M. Pritchard, M. Lynch, S. Yu, K. Holman, E. Baker, S.T. Warren, D. Schlessinger, G.R. Sutherland, R.I. Richards, Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p (CCG)n, Science 252 (1991) 1711–1714. [45] I. Oberlé, F. Rousseau, D. Heitz, C. Kretz, D. Devys, A. Hanauer, J. Boué, M.F. Bertheas, J.-L. Mandel, Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome, Science 252 (1991) 1097–1102. [46] A.J. Verkerk, M. Pieretti, J.S. Sutcliffe, Y.H. Fu, D.P. Kuhl, A. Pizzuti, O. Reiner, S. Richards, M.F. Victoria, F. Zang, B.E. Eussen, G.-J.B. van Ommen, L.A.J. Blonden, G.J. Riggins, J.L. Chastain, C.B. Kunst, H. Galjaard, C.T. Caskey, D.L. Nelson, B.A. Oostra, S.T. Warren, Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome, Cell 65 (1991) 905–914. [47] S. Yu, M. Pritchard, E. Kremer, M. Lynch, J. Nancarrow, E. Baker, K. Holman, J.C. Mulley, S.T. Warren, D. Schlessinger, G.R. Sutherland, R.I. Richard, Fragile X genotype characterized by an unstable region of DNA, Science 252 (1991) 1179–1181. [48] S.J.L. Knight, A.V. Flannery, M.C. Hirst, L. Campbell, Z. Christodoulou, S.R. Phelps, J. Pointon, H.R. Middleton-Price, A. Barnicoat, M.E. Pembry, J. Holland, B.A. Oostra, M. Bobrow, K.E. Davies, Trinucleotide repeat amplification and hypermethylation of a CpG island in FRAXE mental retardation, Cell 74 (1993) 127–134. [49] J.E. Parrish, B.A. Oostra, A.J. Verkerk, C.S. Richards, J. Reynolds, A.S. Spikes, L.G. Shaffer, D.L. Nelson, Isolation of a GCC repeat showing expansion in FRAXF, a fragile site distal to FRAXA and FRAXE, Nat. Genet. 8 (1994) 229–235. [50] R.J. Ritchie, S.J.L. Knight, M.C. Hirst, P.K. Grewal, M. Bobrow, G.S. Cross, K.E. Davies, The cloning of FRAXF: trinucleotide repeat expansion and methylation at a third fragile site in distal Xqter, Hum. Mol. Genet. 3 (1994) 2115–2121. [51] B. Winnepenninckx, K. Debacker, J. Ramsay, D. Smeets, A. Smits, D.R. FitzPatrick, R.F. Kooy, CGG-repeat expansion in the DIP2B gene is associated with the fragile site FRA12A on chromosome 12q13.1, Am. J. Hum. Genet. 80 (2007) 221–231. [52] R.I. Richards, G.R. Sutherland, Simple repeat DNA is not replicated simply, Nature Genet. 6 (1994) 114–116. [53] J.J. Holden, M. Walker, M. Chalifoux, B.N. White, Trinucleotide repeats at the FRAXF locus: frequency and distribution in the general population, Am. J. Med. Genet. 64 (1996) 424–427. [54] R.R. Sinden, Biological implications of the DNA structures associated with disease-causing triplet repeats, Am. J. Hum. Genet. 64 (1999) 346–353 Review. [55] G.R. Sutherland, R.I. Richards, Fragile sites—cytogenetic similarity with molecular diversity, Am. J. Hum. Genet. 64 (1999) 354–359. [56] K. Snow, D.J. Tester, K.E. Kruckeberg, D.J. Schaid, S.N. Thibodeau, Sequence analysis of the fragile X trinucleotide repeat: implications for the origin of the fragile X mutation, Hum. Mol. Genet. 3 (1994) 1543–1551. [57] C.B. Kunst, S.T. Warren, Cryptic and polar variation of the fragile X repeat could result in predisposing normal alleles, Cell 77 (1994) 853–861. [58] E.E. Eichler, J.J.A. Holden, B.W. Popovich, A.L. Reiss, K. Snow, S.N. Thiebodeau, C.S. Richards, P.A. Ward, D.L. Nelson, Length of uninterrupted CGG repeats determines instability in the FMR1 gene, Nature Genet. 8 (1994) 88–94. [59] M.C. Hirst, P.K. Grewal, K.E. Davies, Precursor arrays for triplet repeat expansion at the fragile X locus, Hum. Mol. Genet. 3 (1994) 1553–1560. [60] G.S. Fisch, K. Snow, S.N. Thibodeau, D.L.M. Chalifaux, J.J.A. Holden, D.L. Nelson, P.N. Howard-Peebles, A. Maddalena, The fragile X premutation in carriers and its effect on mutation size in offspring, Am. J. Hum. Genet. 56 (1995) 1147–1155. [61] J.K. Nancarrow, K. Holman, M. Mangelsdorf, T. Hori, M. Denton, G.R. Sutherland, R.I. Richards, Molecular basis of p(CCG) repeat instability at the FRA16A fragile site locus, Hum. Mol. Genet. 4 (1995) 367–372. [62] D.C. Crawford, F. Zhang, B. Wilson, S.T. Warren, S.L. Sherman, Fragile X CGG repeat structures among African-Americans: identification of a novel factor responsible for repeat instability, Hum. Mol. Genet. 9 (2000) 1759–1769. [63] S.L. Nolin, W.T. Brown, A. Glicksman, G.E. Houck, A.D. Gargano, A. Sullivan, V. Biancalana, K. Bröndum-Nielsen, H. Hjalgrim, E. HolinskiFeder, F. Kooy, J. Longshore, J. Macpherson, J-L. Mandel, G. Matthijs, F. Rousseau, P. Steinbach, M-L. Väisänen, H. von Koskull, S.L. Sherman, Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles, Am. J. Hum. Genet. 72 (2003) 454–464. [64] A.E. Ashley-Koch, H. Robinson, A.E. Glicksman, S.L. Nolin, C.E. Schwartz, W.T. Brown, G. Turner, S.L. Sherman, Examination of factors associated with instability of the FMR1 CGG repeat, Am. J. Hum. Genet. 63 (1998) 776–785. [65] C. Jones, P. Slijepcevic, S. Marsh, E. Baker, W.Y. Langdon, R.I. Richards, A. Tunnacliffe, Physical linkage of the fragile site FRA11B and a Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum. Mol. Genet. 3 (1994) 2123–2130. [66] C.E. Pearson, R.R. Sinden, Trinucleotide repeat DNA structures: dynamic mutations from dynamic DNA, Curr. Opin. Struct. Biol. 8 (1998) 321–330. [67] X. Chen, S.V. Mariappan, P. Catasti, R. Ratliff, R.K. Moyzis, A. Laayoun, S.S. Smith, E.M. Bradbury, G. Gupta, Hairpins are formed by the single DNA strands of the fragile X triplet repeats: structure and biological implications, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 5199–5203. [68] A.M. Gacy, G. Goellner, N. Juranic, S. Macura, C.T. McMurray, Trinucleotide repeats that expand in human disease form hairpin structures in vitro, Cell 81 (1995) 533–540. [69] Y. Nadel, P. Weisman-Shomer, M. Fry, The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures, J. Biol. Chem. 270 (1995) 28970–28977. [70] C.E. Pearson, R.R. Sinden, Alternative structures in duplex DNA formed within the trinucleotide repeats of the myotonic dystrophy and fragile X loci, Biochemistry 35 (1996) 5041–5053. [71] C.E. Pearson, E.E. Eichler, D. Lorenzetti, S.F. Kramer, H.Y. Zoghbi, D.L. Nelson, R.R. Sinden, Interruptions in the triplet repeats of SCA1 and FRAXA reduce the propensity and complexity of slipped strand DNA (S-DNA) formation, Biochemistry 37 (1998) 2701–2708. [72] M. Fry, L.A. Loeb, The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4950–4954. [73] P. Weisman-Shomer, E. Cohen, M. Fry, Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures, Nucleic Acids Res. 28 (2000) 1535–1541. [74] K. Usdin, K.J. Woodford, CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro, Nucleic Acids Res. 23 (1995) 4202–4209. [75] G.M. Samadashwily, G. Raca, S.M. Mirkin, Trinucleotide repeats affect DNA replication in vivo, Nat. Genet. 17 (1997) 298–304. T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 [76] A. Bacolla, R. Gellibolian, M. Shimizu, S. Amirhaeri, S. Kang, K. Ohshima, J.E. Larson, S.C. Harvey, B.D. Stollar, R.D. Wells, Flexible DNA: genetically unstable CTG.CAG and CGG.CCG from human hereditary neuromuscular disease genes, J. Biol. Chem. 272 (1997) 16783–16792. [77] R. Gellibolian, A. Bacolla, R.D. Wells, Triplet repeat instability and DNA topology: an expansion model based on statistical mechanics, J. Biol. Chem. 272 (1997) 16793–16797. [78] Y.-H. Wang, R. Gellibolian, M. Shimizu, R.D. Wells, J. Griffith, Long CCG triplet repeat blocks exclude nucleosomes: a possible mechanism for the nature of fragile sites in chromosomes, J. Mol. Biol. 263 (1996) 511–516. [79] Y.-H. Wang, J. Griffith, Methylation of expanded CCG triplet repeat DNA from fragile X syndrome patients enhances nucleosome exclusion, J. Biol. Chem. 271 (1996) 22937–22940. [80] R.J. Ritchie, L. Chakrabarti, S.J. Knight, R.M. Harding, K.E. Davies, Population genetics of the FRAXE and FRAXF GCC repeats, and a novel CGG repeat, in Xq28, Am. J. Med. Genet. 73 (1997) 463–469. [81] M.C. Hirst, A. Barnicoat, G. Flynn, Q. Wang, M. Daker, V.J. Buckle, K.E. Davies, M. Bobrow, The identification of a third fragile site, FRAXF, in Xq27-q28 distal to both FRAXA and FRAXE, Hum. Mol. Genet. 2 (1993) 197–200. [82] A.M. Vianna-Morgante, C. Mingroni-Nett, A.C. Barbosa, P.A. Otto, C. Rosenberg, FRAXF in a patient with chromosome 8 duplication, J. Med. Genet. 33 (1996) 611–614. [83] J.J. Holden, M. Wing, M. Chalifoux, C. Julien-Inalsingh, C. Schutz, P. Robinson, P. Szatmari, B.N. White, FRAXF in a patient with chromosome 8 duplication, J. Med. Genet. 33 (1996) 611–614. [84] S.J.L. Knight, R.J. Ritchie, L. Chakrabarti, G. Cross, G.R. Taylor, R.F. Muller, J. Paterson, J.R.F. Yates, D.J. Dow, J. Hurst, K.E. Davies, A study of FRAXE in mentally retarded individuals referred for fragile X syndrome (FRAXA) testing in the UK, Am. J. Hum. Genet. 58 (1996) 906–913. [85] R.C. Michaelis, G.V. Velagaleti, C. Jones, E.K. Pivnick, M.C. Phelan, E. Boyd, J. Tarleton, R.S. Wilroy, A. Tunnacliffe, A.T. Tharapel, Most Jacobsen syndrome deletion breakpoints occur distal to FRA11B, Am. J. Med. Genet. 76 (1998) 222–228. [86] A. Tunnacliffe, C. Jones, D. Le Paslier, R. Todd, D. Cherif, M. Birdsall, L. Devenish, C. Yousry, F.E. Cotter, M.R. James, Localization of Jacobsen syndrome breakpoints on a 40-Mb physical map of distal chromosome 11q, Genome Res. 9 (1999) 44–52. [87] G.R. Sutherland, Marker X chromosomes and mental retardation, N. Engl. J. Med. 296 (1977) 1415. [88] G. Turner, T. Webb, S. Wake, H. Robinson, Prevalence of fragile X syndrome, Am. J. Med. Genet. 64 (1996) 196–197. [89] F. Rousseau, P. Rouillard, M.L. Morel, E.W. Khandjian, K. Morgan, Prevalence of carriers of premutation-size alleles of the FMRI gene—and implications for the population genetics of the fragile X syndrome, Am. J. Hum. Genet. 57 (1995) 1006–1018. [90] Y.H. Fu, D.P. Kuhl, A. Pizzuti, M. Pieretti, J.S. Sutcliffe, S. Richards, A.J. Verkerk, J.J. Holden, R.G. Fenwick Jr., S.T. Warren, B.A. Oostra, D.L. Nelson, C.T. Caskey, Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox, Cell 67 (1991) 1047–1058. [91] A.K. Gedeon, E. Baker, H. Robinson, M.W. Partington, B. Gross, A. Manca, B. Korn, A. Poustka, S. Yu, G.R. Sutherland, J.C. Mulley, Fragile X syndrome without CCG amplification has an FMR1 deletion, Nat. Genet. 1 (1992) 341–344. [92] D. Wohrle, D. Kotzot, M.C. Hirst, A. Manca, B. Korn, A. Schmidt, G. Barbi, H.D. Rott, A. Poustka, K.E. Davies, P. Steibach, A microdeletion of less than 250 kb, including the proximal part of the FMR-I gene and the fragile-X site, in a male with the clinical phenotype of fragile X syndrome, Am. J. Hum. Genet. 51 (1992) 299–306. [93] K. De Boulle, A.J. Verkerk, E. Reyniers, L. Vits, J. Hendrickx, B. Van Roy, F. Van den Bos, E. de Graaff, B.A. Oostra, P.J. Willems, A point mutation in the FMR-1 gene associated with fragile X mental retardation, Nat. Genet. 3 (1993) 31–35. [94] S.J.L. Knight, M.A. Voelckel, M.C. Hirst, A.V. Flannery, A. Moncla, K.E. Davies, Triplet repeat expansion at the FRAXE locus and X-linked mild mental handicap, Am. J. Hum. Genet. 55 (1994) 81–86. 13 [95] J.C. Mulley, S. Yu, D.Z. Loesch, D.A. Hay, A. Donnelly, A.K. Gedeon, P. Carbonell, I. Lopez, G. Glover, J. Gabarron, P.W.L. Yu, E. Bake, E.A. Haan, A. Hockey, S.L. Knight, K.E. Davies, R.I. Richards, G.R. Sutherland, FRAXE and mental retardation, J. Med. Genet. 32 (1995) 162–169. [96] J. Gecz, A.K. Gedeon, G.R. Sutherland, J.C. Mulley, Identification of the gene FMR2, associated with FRAXE mental retardation, Nat. Genet. 13 (1996) 105–108. [97] A.J. Verkerk, B.H. Eussen, J.O. Van Hemel, B.A. Oostra, Limited size of the fragile X site shown by fluorescence in situ hybridization, Am. J. Med. Genet. 43 (1992) 187–191. [98] V. Strelnikov, M. Nemtsova, G. Chesnokova, N. Kuleshov, D. Zaletayev, A simple multiplex FRAXA, FRAXE, and FRAXF PCR assay convenient for wide screening programs, Hum. Mutat. 13 (1999) 166–169. [99] M. Pieretti, F. Zhang, Y.-H. Fu, S.T. Warren, B.A. Oostra, C.T. Caskey, D.L. Nelson, Absence of expression of the FMR-1 gene in fragile X syndrome, Cell 66 (1991) 817–822. [100] T.C. Caskey, A. Pizzuti, H.-Y. Fu, R.G. Fenwick, D.L. Nelson, Triplet repeat mutation in human disease, Science 256 (1992) 784–788. [101] C. Verheij, C.E. Bakker, E. De Graaff, J. Keulemans, R. Willemsen, A.J.M.H. Verkerk, H. Galjaard, A.J.J. Reuser, A.T. Hoogeveen, B.A. Oostra, Characterisation and localisation of the FMR1 gene product associated with fragile X syndrome, Nature 363 (1993) 722–724. [102] Y. Gu, Y. Shen, R.A. Gibbs, D.L. Nelson, Identification of FMR2, a novel gene associated with the FRAXE CCG repeat and CpG island, Nat. Genet. 13 (1996) 109–113. [103] D.C. Crawford, J.M. Acuña, S.L. Sherman, FMR1 and the fragile X syndrome: human genome epidemiology review, Genet. Med. 3 (2001) 359–371. [104] M.W. Partington, D.Y. Moore, G.M. Turner, Confirmation of early menopause in fragile X carriers, Am. J. Med. Genet. 64 (1996) 370–372. [105] D.J. Allingham-Hawkins, R. Babul-Hirji, D. Chitayat, J.J.A. Holden, K.T. Yang, C. Lee, R. Hudson, H. Gorwill, S.L. Nolin, A. Glicksman, E.C. Jenkins, W.T. Brown, P.N. Howard-Peebles, C. Becchi, E. Cummings, L. Fallon, S. Seitz, S.H. Black, A.M. Vianna-Morgante, S.S. Costa, P.A. Otto, R.C. Mingroni-Netto, A. Murray, J. Webb, F. MacSwinney, N. Dennis, P.A. Jacobs, M. Syrrou, I. Georgiou, P.C. Patsalis, M.L.G. Uzielli, S. Guarducci, E. Lapi, A. Cecconi, U. Ricci, G. Ricotti, C. Biondi, B. Scarselli, F. Vieri, Fragile X premutation is a significant risk factor for premature ovarian failure: the international collaborative POF in fragile X study — preliminary data, Am. J. Med. Genet. 83 (1999) 322–325. [106] A.K. Sullivan, M. Marcus, M.P. Epstein, E.G. Allen, A.E. Anido, J.J. Paquin, M. Yadav-Shah, S.L. Sherman, Association of FMR1 repeat size with ovarian dysfunction, Hum. Reprod. 20 (2005) 402–412. [107] R.D. Hundscheid, E.A. Sistermans, C.M. Thomas, D.D. Braat, H. Straatman, L.A. Kiemeney, B.A. Oostra, A.P. Smits, Imprinting effect in premature ovarian failure confined to paternally inherited fragile X premutations, Am. J. Hum. Genet. 66 (2000) 413–418. [108] G.S. Conway, N.N. Payne, J. Webb, A. Murray, P.A. Jacobs, Fragile X premutation screening in women with premature ovarian failure, Hum. Reprod. 13 (1998) 1184–1187. [109] S.L. Sherman, Premature ovarian failure in the fragile X syndrome, Am. J. Med. Genet. 97 (2000) 189–194. [110] B. Bodega, S. Bione, L. Dalpra, D. Toniolo, F. Ornaghi, W. Vegetti, E. Ginelli, A. Marozzi, Influence of intermediate and uninterrupted FMR1 CGG expansions in premature ovarian failure manifestation, Hum. Reprod. 21 (2006) 952–957. [111] A. Murray, S. Ennis, N. Morton, No evidence for parent of origin influencing premature ovarian failure in fragile X premutation carriers, Am. J. Hum. Genet. 67 (2000) 253–254. [112] A.M. Vianna-Morgante, S.S. Costa, Premature ovarian failure is associated with maternally and paternally inherited premutation in Brazilian families with fragile X, Am. J. Hum. Genet. 67 (2000) 254–255. [113] S.L. Sherman, Premature ovarian failure among fragile X premutation carriers: parent-of-origin effect? Am. J. Hum. Genet. 67 (2000) 11–13. [114] E. Garcia-Alegria, B. Ibanez, M. Minguez, M. Poch, A. Valiente, A. Sanz-Parra, C. Martinez-Bouzas, E. Beristain, M.I. Tejada, Analysis of 14 [115] [116] [117] [118] [119] [120] [121] [122] [123] [124] [125] [126] [127] [128] [129] [130] [131] [132] [133] T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 FMR1 gene expression in female premutation carriers using robust segmented linear regression models, RNA 13 (2007) 756–762. P.J. Hagerman, C.M. Greco, R.J. Hagerman, A cerebellar tremor/ataxia syndrome among fragile X premutation carriers, Cytogenet. Genome Res. 100 (2003) 206–212 Review. S. Jacquemont, R.J. Hagerman, M. Leehey, J. Grigsby, L. Zhang, J.A. Brunberg, C. Greco, V. Des Portes, T. Jardini, R. Levine, E. Berry-Kravis, W.T. Brown, S. Schaeffer, J. Kissel, F. Tassone, P.J. Hagerman, Fragile X premutation tremor/ataxia syndrome: molecular, clinical, and neuroimaging correlates, Am. J. Hum. Genet. 72 (2003) 869–878. S. Jacquemont, R.J. Hagerman, M.A. Leehey, D.A. Hall, R.A. Levine, J.A. Brunberg, L. Zhang, T. Jardini, L.W. Gane, S.W. Harris, K. Herman, J. Grigsby, C.M. Greco, E. Berry-Kravis, F. Tassone, P.J. Hagerman, Penetrance of the fragile X-associated tremor/ataxia syndrome in a premutation carrier population, JAMA 291 (2004) 460–469. P.J. Hagerman, R.J. Hagerman, The fragile-X premutation: a maturing perspective, Am. J. Hum. Genet. 74 (2004) 805–816. R.J. Hagerman, B.R. Leavitt, F. Farzin, S. Jacquemont, C.M. Greco, J.A. Brunberg, F. Tassone, D. Hessl, S.W. Harris, L. Zhang, T. Jardini, L. Gane, J. Ferranti, L. Ruiz, M.A. Leehey, J. Grigsby, P.J. Hagerman, Fragile-X-associated tremor/ataxia syndrome (FXTAS) in females with the FMR1 premutation, Am. J. Hum. Genet. 74 (2004) 1051–1056. C.M. Greco, R.J. Hagerman, F. Tassone, A.E. Chudley, M.R. Del Bigio, S. Jacquemont, M. Leehey, P.J. Hagerman, Neuronal intranuclear inclusions in a new cerebellar tremor/ataxia syndrome among fragile X carriers, Brain 125 (2002) 1760–1771. Y. Feng, F. Zhang, L.K. Lokey, J.L. Chastain, L. Lakkis, D. Eberhart, S.T. Warren, Translational suppression by trinucleotide repeat expansion at FMR1, Science 268 (1995) 731–734. F. Tassone, A. Beilina, C. Carosi, S. Albertosi, C. Bagni, L. Li, K. Glover, D. Bentley, P.J. Hagerman, Elevated FMR1 mRNA in premutation carriers is due to increased transcription, RNA 13 (2007) 555–562. R.J. Hagerman, M. Leehey, W. Heinrichs, F. Tassone, R. Wilson, J. Hills, J. Grigsby, B. Gage, P.J. Hagerman, Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X, Neurology 57 (2001) 127–130. F. Tassone, C. Iwahashi, P.J. Hagerman, FMR1 RNA within the intranuclear inclusions of fragile X-associated tremor/ataxia syndrome (FXTAS), RNA Biol. 1 (2004) 103–105. C.K. Iwahashi, D.H. Yasui, H.J. An, C.M. Greco, F. Tassone, K. Nannen, B. Babineau, C.B. Lebrilla, R.J. Hagerman, P.J. Hagerman, Protein composition of the intranuclear inclusions of FXTAS, Brain 129 (2006) 256–271. R.I. Richards, K. Holman, K. Friend, E. Kremer, D. Hillen, A. Staples, W.T. Brown, P. Goonewardena, J. Tarleton, C. Schwartz, G.R. Sutherland, Evidence of founder chromosomes in fragile X syndrome, Nat. Genet. 1 (1992) 257–260. J. Portugal, M.J. Waring, Comparison of binding sites in DNA for berenil, netropsin and distamycin. A footprinting study, Eur. J. Biochem. 167 (1987) 281–289. J. Portugal, M.J. Waring, Assignment of DNA binding sites for 4′,6diamidine-2-phenylindole and bisbenzimide (Hoechst 33258). A comparative footprinting study, Biochim. Biophys. Acta 949 (1988) 158–168. A. Abu-Daya, P.M. Brown, K.R. Fox, DNA sequence preference of several AT-selective minor groove binding ligands, Nucleic Acids Res. 23 (1995) 3385–3392. R. Fetni, R. Drouin, C.L. Richer, N. Lemieux, Complementary replication R- and G-band patterns induced by cell blocking at the R-band/G-band transition, a possible regulatory checkpoint within the S phase of the cell cycle, Cytogenet. Cell Genet. 75 (1996) 172–179. G.R. Sutherland, E. Baker, Peek-a-boo fragile sites? Not really, Am. J. Med. Genet. 96 (2000) 429–431. E. Takahashi, T. Hori, M. Murata, A new rare heritable fragile site at 8q24.1 found in a Japanese population, Clin. Genet. 33 (1988) 91–94. G.R. Sutherland, D.H. Ledbetter, Report of the committee on cytogenetic markers, Cytogenet. Cell Genet. 51 (1989) 452–458 Review. [134] O. Handt, E. Baker, S. Dayan, S.M. Gartler, E. Woollatt, R.I. Richards, R.S. Hansen, Analysis of replication timing at the FRA10B and FRA16B fragile site loci, Chromosome Res. 8 (2000) 677–688. [135] D.R. Hewett, O. Handt, L. Hobson, M. Mangelsdorf, H.J. Eyre, E. Baker, G.R. Sutherland, S. Schuffenhauer, J.I. Mao, R.I. Richards, FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis, Mol. Cell. 1 (1998) 773–781. [136] S. Yu, M. Mangelsdorf, D. Hewett, L. Hobson, E. Baker, H.J. Eyre, N. Lapsys, D. Le Paslier, N.A. Doggett, G.R. Sutherland, R.I. Richards, Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat, Cell 88 (1997) 367–374. [137] O. Handt, G.R. Sutherland, R.I. Richards, Fragile sites and minisatellite repeat instability, Mol. Genet. Metab. 70 (2000) 99–105 Review. [138] C.D. Laird, E. Jaffe, G. Karpen, M. Lamb, R. Nelson, Fragile sites in human chromosomes as regions of late replicating DNA, Trends Genet. 3 (1987) 274–281. [139] Y.Y. Hsu, Y.H. Wang, Human fragile site FRA16B DNA excludes nucleosomes in the presence of distamycin, J. Biol. Chem. 277 (2002) 17315–17319. [140] P.M. Brown, K.R. Fox, Minor groove binding ligands alter the rotational positioning of DNA fragments on nucleosome core particles, J. Mol. Biol. 262 (1996) 671–685. [141] J.M. Berg, J.A. Faunch, M.J. Pendrey, L.S. Penrose, M.A. Ridler, A. Shapiro, A homozygous chromosomal variant, Lancet 1 (1969) 531. [142] G.R. Sutherland, Heritable fragile sites on human chromosomes. VII. Children homozygous for the BrdU-requiring fra(10)(q25) are phenotypically normal, Am. J. Hum. Genet. 33 (1981) 946–949. [143] E.M. Buhler, N.J. Malik, The tricho-rhino-phalangeal syndrome(s): chromosome 8 long arm deletion: is there a shortest region of overlap between reported cases? TRP I and TRP II syndromes: are they separate entities? Am. J. Med. Genet. 19 (1984) 113–119. [144] H.J. Lüdecke, C. Johnson, M.J. Wagner, D.E. Wells, C. Turleau, N. Tommerup, A. Latos-Bielenska, K.R. Sandig, P. Meinecke, B. Zabel, B. Horsthemke, Molecular definition of the shortest region of deletion overlap in the Langer–Giedion syndrome, Am. J. Hum. Genet. 49 (1991) 1197–1206. [145] J. Hou, J. Parrish, H.J. Ludecke, M. Sapru, Y. Wang, W. Chen, A. Hill, J. Siegel-Bartelt, H. Northrup, F.F.B. Elder, C. Chinault, B. Horsthemke, M.J. Wagner, D.E. Wells, A 4-megabase YAC contig that spans the Langer– Giedion syndrome region on human chromosome 8q24.1: use in refining the location of the trichorhinophalangeal syndrome and multiple exostoses genes (TRPS1 and EXT1), Genomics 29 (1995) 87–97. [146] E. Takahashi, T. Hori, M. Murata, Population cytogenetics of rare fragile sites in Japan, Hum. Genet. 78 (1988) 121–126. [147] J.J. Yunis, A.L. Soreng, Constitutive fragile sites and cancer, Science 226 (1984) 1199–1204. [148] T.W. Glover, Instability at chromosomal fragile sites, Recent Results Cancer Res. 154 (1998) 185–199 Review. [149] T.W. Glover, Common fragile sites, Cancer Letters 232 (2006) 4–12. [150] D.F.C.M. Smeets, J.M.J.C. Scheres, T.W.J. Hustinx, The most common fragile site in man is 3p14, Hum. Genet. 72 (1986) 215–220. [151] C.M. Wilke, B.K. Hall, A. Hoge, W. Paradee, D.I. Smith, T.W. Glover, FRA3B extends over a broad region and contains a spontaneous HPV16 integration site: direct evidence for the coincidence of viral integration sites and fragile sites, Hum. Mol. Genet. 5 (1996) 187–195. [152] H. Huang, J. Qian, J. Proffit, K. Wilber, R. Jenkins, D.I. Smith, FRA7G extends over a broad region: coincidence of human endogenous retroviral sequences (HERV-H) and small polydispersed circular DNAs (spcDNA) and fragile sites, Oncogene 16 (1998) 2311–2319. [153] D. Mishmar, A. Rahat, S.W. Scherer, G. Nyakatura, B. Hinzmann, Y. Kohwi, Y. Mandel-Gutfroind, J.R. Lee, B. Drescher, D.E. Sas, H. Margalit, M. Platzer, A. Weiss, L.C. Tsui, A. Rosenthal, B. Kerem, Molecular characterization of a common fragile site (FRA7H) on human chromosome 7 by the cloning of a simian virus 40 integration site, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 8141–8146. [154] M. Debatisse, A. Coquelle, F. Toledo, G. Buttin, Gene amplification mechanisms: the role of fragile sites, Recent Results Cancer Res. 154 (1998) 216–226. [155] G.R. Sutherland, M.I. Parslow, E. Baker, New classes of fragile sites induced by 5-azacytidine and BrdU, Hum. Genet. 69 (1985) 233–237. T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 [156] W. Paradee, C.M. Wilke, L. Wang, R. Shridhar, C.M. Mullins, A. Hoge, T.W. Glover, D.I. Smith, A 350-kb cosmid contig in 3p14.2 that crosses the t(3;8) hereditary renal cell carcinoma translocation breakpoint and 17 aphidicolin-induced FRA3B breakpoints, Genomics 35 (1996) 87–93. [157] F. Boldog, R.M. Gemmill, J. West, M. Robinson, L. Robinson, E. Li, J. Roche, S. Todd, B. Waggoner, R. Lundstrom, J. Jacobson, M.R. Mullokandov, H. Klinger, H.A. Drabkin, Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B, Hum. Mol. Genet. 6 (1997) 193–203. [158] K. Ried, M. Finnis, L. Hobson, M. Mangelsdorf, S. Dayan, J.K. Nancarrow, E. Woollatt, G. Kremmidiotis, A. Gardner, D. Venter, E. Baker, R.I. Richards, Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells, Hum. Mol. Genet. 9 (2000) 1651–1663. [159] T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W. Miller, K. Huebner, C.M. Croce, Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/ Fhit, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 5722–5727. [160] W. Paradee, V. Jayasankar, C. Mullins, C. Wilke, T.W. Glover, D.I. Smith, Molecular characterization of the 3p14.2 constitutive fragile site, Am. J. Hum. Genet. 55 (1994) A115. [161] D. Mishmar, Y. Mandel-Gutfroind, H. Margalit, B. Kerem, Common fragile sites: G-band characteristics within an R-band, Am. J. Hum. Genet. 64 (1999) 908–910. [162] C. Morelli, E. Karayianni, C. Magnanini, A.J. Mungall, E. Thorland, M. Negrini, D.I. Smith, G. Barbanti-Brodano, Cloning and characterization of the common fragile site FRA6F harboring a replicative senescence gene and frequently deleted in human tumors, Oncogene 21 (2002) 7266–7276. [163] M.Z. Limongi, F. Pelliccia, A. Rocchi, Characterization of the human common fragile site FRA2G, Genomics 81 (2003) 93–97. [164] E. Zlotorynski, A. Rahat, J. Skaug, N. Ben-Porat, E. Ozeri, R. Hershberg, A. Levi, S.W. Scherer, H. Margalit, B. Kerem, Molecular basis for expression of common and rare fragile sites, Mol. Cell. Biol. 23 (2003) 7143–7151. [165] W.A. Krajewski, Alterations in the internucleosomal DNA helical twist in chromatin of human erythroleukemia cells in vivo influences the chromatin higher-order folding, FEBS Lett. 361 (1995) 149–152. [166] W.A. Krajewski, J. Ausio, Relationship between chromatin high-order folding and nucleosomal linker twist in nuclei of human HeLa s3 cells, J. Biomol. Struct. Dyn. 14 (1997) 641–649. [167] A.M. Casper, P. Nghiem, M.F. Arlt, T.W. Glover, ATR regulates fragile site stability, Cell 111 (2002) 779–789. [168] L. Wang, J. Darling, J.S. Zhang, H. Huang, W. Liu, D.I. Smith, Allelespecific late replication and fragility of the most active common fragile site, FRA3B, Hum. Mol. Genet. 8 (1999) 431–437. [169] M.M. Le Beau, F.V. Rassool, M.E. Neilly, R. III Espinosa, T.W. Glover, D.I. Smith, T.W. McKeithan, Replication of a common fragile site, FRA3B, occurs late in S phase and is delayed further upon induction: implications for the mechanism of fragile site induction, Hum. Mol. Genet. 7 (1998) 755–761. [170] A. Hellman, A. Rahat, S.W. Scherer, A. Darvasi, L.C. Tsui, B. Kerem, Replication delay along FRA7H, a common fragile site on human chromosome 7, leads to chromosomal instability, Mol. Cell. Biol. 20 (2000) 4420–4427. [171] H.H. Chen, D.C. Rau, E. Charney, The flexibility of alternating dA-dT sequences, J. Biomol. Struct. Dyn. 2 (1985) 709–719. [172] R.J. LaDuca, P.J. Fay, C. Chuang, C.S. McHenry, R.A. Bambara, Sitespecific pausing of deoxyribonucleic acid synthesis catalyzed by four forms of Escherichia coli DNA polymerase III, Biochemistry 22 (1983) 5177–5188. [173] T. Chen, A. Sahin, C.M. Aldaz, Deletion map of chromosome 16q in ductal carcinoma in situ of the breast: refining a putative tumor suppressor gene region, Cancer Res. 56 (1996) 5605–5609. [174] J.A. Engelman, X.L. Zhang, M.P. Lisanti, Genes encoding human caveolin-1 and -2 are co-localized to the D7S522 locus (7q31.1), a known [175] [176] [177] [178] [179] [180] [181] [182] [183] [184] [185] [186] [187] [188] [189] [190] [191] [192] 15 fragile site (FRA7G) that is frequently deleted in human cancers, FEBS Lett. 436 (1998) 403–410. K. Hibi, T. Takahashi, K. Yamakawa, R. Ueda, Y. Sekido, Y. Ariyoshi, M. Suyama, H. Takagi, Y. Nakamura, T. Takahashi, Three distinct regions involved in 3p deletion in human lung cancer, Oncogene 7 (1992) 445–449. M. Negrini, C. Monaco, I. Vorechovsky, M. Ohta, T. Druck, R. Baffa, K. Huebner, C.M. Croce, The FHIT gene at 3p14.2 is abnormal in breast carcinomas, Cancer Res. 56 (1996) 3173–3179. D. Michael, D.G. Beer, C.W. Wilke, D.E. Miller, T.W. Glover, Frequent deletions of FHIT and FRA3B in Barrett's metaplasia and esophageal adenocarcinomas, Oncogene 15 (1997) 1653–1659. J.M. Fang, M.F. Arlt, A.C. Burgess, S.L. Dagenais, D.G. Beer, T.W. Glover, Translocation breakpoints in FHIT and FRA3B in both homologs of chromosome 3 in an esophageal adenocarcinoma, Genes Chromosomes Cancer 30 (2001) 292–298. R. Shridhar, V. Shridhar, X. Wang, W. Paradee, M. Dugan, F. Sarkar, C. Wilke, T.W. Glover, V.K. Vaitkevicius, D. Smith, Frequent breakpoints in the 3p14.2 fragile site, FRA3B, in pancreatic tumors, Cancer Res. 56 (1996) 4347–4350. B. Zbar, H. Brauch, C. Talmadge, M. Linehan, Loss of alleles of loci on the short arm of chromosome 3 in renal cell carcinoma, Nature 327 (1987) 721–724. V. Shridhar, L. Wang, R. Rosati, W. Paradee, R. Shridhar, C. Mullins, W. Sakr, D. Grignon, O.J. Miller, Q.C. Sun, J. Petros, D.I. Smith, Frequent breakpoints in the region surrounding FRA3B in sporadic renal cell carcinomas, Oncogene 14 (1997) 1269–1277. T.W. Glover, J.F. Coyle-Morris, F.P. Li, R.S. Brown, C.S. Berger, R.M. Gemmill, F. Hecht, Translocation t(3;8)(p14.2;q24.1) in renal cell carcinoma affects expression of the common fragile site at 3p14 (FRA3B) in lymphocytes, Cancer Genet. Cytogenet. 31 (1988) 69–73. M. Ohta, H. Inoue, M.G. Cotticelli, K. Kastury, R. Baffa, J. Palazzo, Z. Siprashvili, M. Mori, P. McCue, T. Druck, C.M. Croce, K. Huebner, The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t (3;8) breakpoint, is abnormal in digestive tract cancers, Cell 84 (1996) 587–597. K. Huebner, P. Hadaczek, Z. Siprashvili, T. Druck, C.M. Croce, The FHIT gene, a multiple tumor suppressor gene encompassing the carcinogen sensitive chromosome fragile site, FRA3B, Biochim. Biophys. Acta 1332 (1997) M65–M70 Review. G. Sozzi, M.L. Veronese, M. Negrini, R. Baffa, M.G. Cotticelli, H. Inoue, S. Tornielli, S. Pilotti, L. De Gregorio, U. Pastorino, M.A. Pierotti, M. Ohta, K. Huebner, C.M. Croce, The FHIT gene 3p14.2 is abnormal in lung cancer, Cell 85 (1996) 17–26. L. Virgilio, M. Shuster, S.M. Gollin, M.L. Veronese, M. Ohta, K. Huebner, C.M. Croce, FHIT gene alterations in head and neck squamous cell carcinomas, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 9770–9775. H. Huang, C.P. Reed, A. Mordi, G. Lomberk, L. Wang, V. Shridhar, L. Hartmann, Frequent deletions within FRA7G at 7q31.2 in invasive epithelial ovarian cancer, Genes Chromosomes Cancer 24 (1999) 48–55. G. Callahan, S.R. Denison, L.A. Phillips, V. Shridhar, D.I. Smith, Characterization of the common fragile site FRA9E and its potential role in ovarian cancer, Oncogene 22 (2003) 590–601. T. Sato, A. Tanigami, K. Yamakawa, F. Akiyama, F. Kasumi, G. Sakamoto, Y. Nakamura, Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer, Cancer Res. 50 (1990) 7184–7189. H. Tsuda, D.F. Callen, T. Fukutomi, Y. Nakamura, S. Hirohashi, Allele loss on chromosome 16q24.2-qter occurs frequently in breast cancers irrespectively of differences in phenotype and extent of spread, Cancer Res. 54 (1994) 513–517. C.M. Aldaz, T. Chen, A. Sahin, J. Cunningham, M. Bondy, Comparative allelotype of in situ and invasive human breast cancer: high frequency of microsatellite instability in lobular breast carcinomas, Cancer Res. 55 (1995) 3976–3981. B.S. Carter, C.M. Ewing, W.S. Ward, B.F. Treiger, T.W. Aalders, J.A. Schalken, J.I. Epstein, W.B. Isaacs, Allelic loss of chromosomes 16q and 10q in human prostate cancer, Proc. Natl. Acad. Sci. U. S. A. 87 (1990) 8751–8755. 16 T. Lukusa, J.P. Fryns / Biochimica et Biophysica Acta 1779 (2008) 3–16 [193] N. Nishida, Y. Fukuda, H. Kokuryu, T. Sadamoto, G. Isowa, K. Honda, Y. Yamaoka, M. Ikenaga, H. Imura, K. Ishizaki, Accumulation of allelic loss on arms of chromosomes 13q, 16q and 17p in the advanced stages of human hepatocellular carcinoma, Int. J. Cancer 51 (1992) 862–868. [194] A.K. Bednarek, K.J. Laflin, R.L. Daniel, Q. Liao, K.A. Hawkins, C.M. Aldaz, WOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3-24.1, a region frequently affected in breast cancer, Cancer Res. 60 (2000) 2140–2145. [195] D. Ramos, C.M. Aldaz, WWOX, a chromosomal fragile site gene and its role in cancer, Adv. Exp. Med. Biol. 587 (2006) 149–159 Review. [196] K. Huebner, C.M. Croce, FRA3B and other common fragile sites: the weakest links, Nat. Rev. Cancer 1 (2001) 214–221. [197] L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, The neurobeachin gene spans the common fragile site FRA13A, Hum. Genet. 118 (2006) 1–8. [198] L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, Low-frequency common fragile sites: link to neuropsychiatric disorders? Cancer Lett. 232 (2006) 58–69.
© Copyright 2025 Paperzz