Turkish Journal of Biology
Turk J Biol
(2016) 40: 150-159
© TÜBİTAK
doi:10.3906/biy-1502-12
http://journals.tubitak.gov.tr/biology/
Research Article
Control of Tomato yellow leaf curl virus disease by Enterobacter asburiae
BQ9 as a result of priming plant resistance in tomatoes
1,2,*
Hongwei LI
1,3,*
1,2
1,2
1,2
, Xueling DING , Chao WANG , Hongjiao KE , Zhou WU ,
4
1,2,**
1,2
Yunpeng WANG , Hongxia LIU
, Jianhua GUO
1
Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Nanjing, P.R. China
2
Key Laboratory of Integrated Pest Management in Crops in Eastern China (Nanjing Agricultural University), Ministry of Agriculture,
Nanjing, P.R. China
3
Institute of Plant Protection, Fujian Academy of Agricultural Science, Fuzhou, P.R. China
4
College of Life Science and Chemical Engineering, Huaiyin Institute of Technology, Huai’an, P.R. China
Received: 05.02.2015
Accepted/Published Online: 08.06.2015
Final Version: 05.01.2016
Abstract: Enterobacter asburiae BQ9, a plant-growth–promoting rhizobacterium, was shown to promote tomato plant growth and
induce resistance to Tomato yellow leaf curl virus (TYLCV) under greenhouse conditions. Compared with mock-treated tomato plants,
plants that were pretreated with BQ9 had increased fresh mass and significantly reduced disease severity and 52% biocontrol efficacy
was achieved 30 days after inoculation. The expression of defense-related genes PR1a and PR1b and the H2O2 burst were quickly induced
in BQ9 pretreated plants. Antioxidase activity analysis showed that the activities of phenylalanine ammonia lyase, peroxidase, catalase,
and superoxide dismutase increased significantly in BQ9 pretreated plants. Our results suggest that the plant-growth–promoting
rhizobacterium BQ9 induced a priming of the plant defense responses to TYLCV by increasing the expression of defense response
genes, and the induced resistance was mechanistically connected to the expression of antioxidant enzymes and the production of H2O2.
Key words: Enterobacter asburiae, growth promotion, induced resistance, Tomato yellow leaf curl virus, H2O2 burst
1. Introduction
Tomato yellow leaf curl virus (TYLCV) disease is one
of the most devastating viral diseases in tomato plants
(Solanum lycopersicum L.) across the globe (Hanssen et
al., 2010). This emerging disease is caused by isolates of
several single-stranded DNA-containing geminiviruses
(family Geminiviridae) in the genus Begomovirus and is
transmitted by the whitefly Bemisia tabaci [Gennadius
(Hemiptera, Aleyrodidae)] in a persistent circulative
manner (Czosnek and Ghanim, 2005). All TYLCVassociated begomoviruses induced stunted growth,
yellowing, and the upward curling of the leaves on infected
tomato plants. Tomato fruits are symptomless, although
they are sometimes smaller than usual; if infection occurs
at an early growth stage, flower abortion can result in total
yield loss (Picó et al., 1996).
Controlling TYLCV is difficult and is mainly based on
intensive insecticide treatments that are used to control
the vector populations (Palumbo et al., 2001). However,
this method is harmful to the environment (Navot et
al., 1991) and has limited success because it selects for
insecticide-resistant populations in B. tabaci (Cahill et al.,
1996; Elbert and Nauen, 2000). Crop management and the
use of physical barriers or UV-absorbing plastic films and
screens to protect crops can also help to control TYLCV
(Antignus et al., 2001). Although the use of virus-resistant
cultivars is currently the best alternative for controlling
TYLCV, limited sources of useful resistance are available
at the commercial level, which greatly limits the possibility
of crop breeding. TYLCV resistance is under complex
genetic control, which is difficult to manage in breeding
programs (Lapidot and Friedmann, 2002). The most
widespread form of resistance used commercially is based
on the partially dominant Ty-1 resistance gene which is
derived from the S. chilense (Dunal) Reiche accession
LA1969 (Zamir et al., 1994). The resistance in these plants
resulted in substantially reduced symptoms and virus
accumulation in infected plants (Michelson et al., 1994),
but resistance breaks down under high disease pressure
(Lapidot and Friedmann, 2002). In recent decades,
* Authors contributed equally to this work and are regarded as joint first authors.
** Correspondence: [email protected]
150
LI et al. / Turk J Biol
much attention has been devoted to plant and microbial
metabolites with antiviral properties because of their
ecosafety advantage over chemical pesticides (Baranwal
and Verma, 1997). These antiviral metabolites are reported
to inhibit the virus in vitro or induce plant resistance to
the pathogen; the latter mode of action involves a broad
spectrum of plant defense responses, and is thus a more
effective strategy for disease control (Murphy et al., 1999;
Kloepper et al., 2004).
In many plants, induced systemic resistance (ISR) can
be stimulated by abiotic or biotic elicitors that increase
the capacity of the plant to resist pathogens (Murphy
et al., 1999; Beckers and Conrath, 2007). Among the
various inducers of resistance, plant-growth–promoting
rhizobacteria (PGPR) attract much attention because
of their advantages over other inducers, which include
broad-spectrum antimicrobial activity, high levels of
colonization on plant tissues, and growth-promoting
capacity (Lian et al., 2011). Rhizobacteria-mediated ISR
has been demonstrated in a variety of plants, including
beans, carnations, cucumbers, radishes, tobacco, tomatoes,
and the model plant Arabidopsis thaliana (Van Loon et
al., 1998). The rhizobacterium Bacillus amyloliquefaciens
strain EXTN-1 can induce resistance to anthracnose
activity in cucumber plants and can induce the expression
of a defense-related gene (PR-1a) in tobacco plants (Jeun
et al., 2001; Park et al., 2001). Wang et al. (2009) found that
treatment with B. subtilis G1 enhanced the expression level
of the PR-Ia and PR-Ib genes and of plant-defense–related
genes NPR1 and CoiI, after TMV-challenged inoculation.
Beneficial rhizobacteria such as PGPR can also trigger
ISR by potentiating the activation of specific molecular
and cellular defense responses, which are activated more
quickly and potently than those activated during more
common infections (Ton et al., 2005; Ahn et al., 2007). The
cellular defense responses include the oxidative burst (Iriti
and Faoro, 2003), cell-wall reinforcement (Benhamou,
1996), accumulation of defense-related enzymes (Brisset
et al., 2000), and production of secondary metabolites
(Yedidia et al., 2003).
We previously isolated Enterobacter asburiae BQ9.
This rhizobacterium was shown to significantly reduce
the symptoms caused by TYLCV in tomato plants. In
the present study, we focused on its role in BQ9-induced
resistance to TYLCV and growth promotion in tomato
plants. We measured curling symptoms and defensive
responses through ROS accumulation, H2O2-scavenging
enzymes, and the expression of defense-related genes. This
study addressed the role of BQ9 in priming the defense
response to infection by TYLCV in tomato plants.
2. Materials and methods
2.1. Plants materials and bacterial strain
Tomato seeds (Hezuo 903, a TYLCV-susceptible cultivar)
were sown in seed trays. Three-week-old seedlings were
transferred into 300-mL pots containing a vermiculite
potting soil mixture that had been autoclaved for 20 min
at 121 °C twice on two consecutive days. Plants were
cultivated in a growth chamber at 25 ± 2 °C with a 14 h/10
h (day/night) photoperiod.
The PGPR used in this experiment, Enterobacter
asburiae BQ9, was originally isolated from the forest soil
in Dongguan City, Guangdong Province, China. BQ9
was grown on Luria–Bertani (LB) agar plates at 28 °C
for 24 h. Subsequently, bacterial cells were collected by
centrifugation and then resuspended in a sterile 0.85%
NaCl solution adjusted to 5 × 107 CFU mL–1 for use. The
TYLCV infectious Agrobacterium tumefaciens strain
EHA105, which was transformed with pB-TY-XH-1.8A,
was grown in liquid LB medium containing 50 mg L–1
rifampicin and 50 mg L–1 kanamycin at 28 °C overnight
and was adjusted to 5 × 107 CFU mL–1 for use.
2.2. Assessment of the induction of systemic resistance
and plant growth
After 1 week of growth in pots, four-leaf-stage tomato
seedlings were subjected to induction treatments.
Seedlings were treated in 1 of 4 ways: a pretreatment with
BQ9 followed by challenging inoculation with TYLCV,
a BQ9 pretreated control, a TYLCV control, and a mock
treatment. Each treatment consisted of 24 plants. For
the plants receiving BQ9 treatments, 20 mL of a 5 × 107
CFU mL–1 cell suspension of BQ9 was poured on the soil
around the roots of the tomato plants in each pot. For the
two treatments that were not receiving BQ9, plants were
treated with 20 mL of sterile 0.85% NaCl solution in the
same manner. Seven days later, the seedlings receiving
TYLCV treatments were challenged and inoculated with
TYLCV as described (Zhou et al., 2003), using a fine needle
to inject 0.2 mL of EHA105 culture (5 × 107 CFU mL–1)
into the stems or petioles. Fifteen days after the challenge
inoculation, the plants were scored every day to determine
their disease rating (DR) on a scale of 0–4, as described
by Lapidot et al. (2006). Disease severity and biocontrol
efficacy were calculated as follows:
Disease severity (%) = [∑(the number of diseased
plants in disease rating i × disease rating i)/(total number
of plants investigated × highest disease rating)] × 100;
Biocontrol efficacy (%) = [(disease severity of viral
control treatment – disease severity of antagonist
treatment)/disease severity of viral control treatment] ×
100.
Twenty days after treatment with BQ9, the tomato
plants of BQ9 pretreated control and mock treatment were
collected to measure their roots, shoots, and fresh mass:
151
LI et al. / Turk J Biol
Fresh mass increase (%) = [(fresh mass of BQ9
pretreated control – fresh mass of mock treatment)/fresh
mass of mock treatment] × 100.
2.3. Impact of antagonistic bacterium BQ9 on the viral
load in tomato plants
To study the impact of BQ9 on the viral load in the
host plant, a PCR experiment was conducted. After the
challenging inoculation, the plants were tested every
day to determine the viral load. Using a plant gene
extraction kit (SBS, Shanghai), plant DNA was extracted
from 0.1 g of the youngest leaves from plants in each
treatment. The TYLCV fragment was amplified using
the specific primer pair PF/PR (Deng et al., 1994), where
PA: 5’-TAATATTACCKGWKGVCCSC-3’ and PB:
5’-TGGACYTTRCAWGGBCCGCACA-3’. Primers were
synthesized by Shanghai Biological Technology (SBS).
Cycling was performed as follows: an initial denaturation
for 4 min at 95 °C, followed by 34 cycles of 1 min at 94 °C, 1
min at 55 °C, and 1 min at 72 °C followed by annealing for
10 min at 72 °C. After the reaction was complete, the PCR
products were subjected to electrophoresis on 1% agarose
gel in Tris-acetate-EDTA (TAE) buffer and then stained
with ethidium bromide (EB).
2.4. Analysis of gene expression by RT-PCR
To analyze the expression of the PR1a and PR1b genes,
RT-PCR was performed according to the manufacturers’
instructions for the Prime Script First-Strand cDNA
synthesis kit (TaKaRa Biotech, Dalian, China). Total RNA
was extracted from tomato leaves using TRIzol reagent
(Invitrogen, San Diego, CA, USA). Using the Oligo dT
primer, first-strand cDNA was synthesized from 500 ng
of total RNA. An independent PCR with 25 cycles was
performed using aliquots (1 μL) of the cDNA samples
and the PR1a and PR1b specific primers. A constitutively
expressed gene, EF1α, was used as a quantitative control in
the RT-PCR analysis. Primer Premier 5.00 was employed
to design specific primer pairs for EF1α (forward
primer: ATGTTGGGTTCAATGTTAAG, reverse primer:
ATCACACTGCACAGTTCAC), PR1a (forward primer:
TCTCCATTTTCGTTGCTTGTTTCATTACC,
reverse
primer: GGATCATAATTGCACGTTATAAAAACCCAC),
and PR1b (forward primer: GGATTTAGCGGACTTCCTTCTG, reverse primer: ATGCCAAGGCTTGTACTAGAGAATG).
2.5. Detection and quantification of H2O2
H2O2 levels were determined as previously described
(Loreto and Velikova, 2001) with minor modifications.
Leaf samples (70 mg) were homogenized in 2.0 mL of
0.1% (w/v) trichloroacetic acid, and the homogenate was
centrifuged at 14,000 × g for 15 min at 4 °C. From each
supernatant sample, an aliquot of 0.5 mL was added to 0.5
mL of 10 mM phosphate buffer (pH 7.0) and 1.0 mL of 1
M KI, and the absorbance was measured at 390 nm with
152
a UV1000 spectrophotometer. The concentration of H2O2
was quantified, taking into account a calibration curve
using solutions with known H2O2 concentrations.
2.6. Assay of defense enzymes
Three leaf samples were collected from each treatment
at 0, 1, 2, 3, 4, and 5 days postinoculation (dpi); and 0.2
g (FW) of each sample was placed into a mortar with 2
mL of 50 mM ice-cold phosphate buffered saline (pH
7.8) containing 1 mM ethylene diamine tetraacetic acid
(EDTA). The mixture was homogenized with a pestle, and
the homogenate was centrifuged at 15,000 × g for 15 min
at 4 °C. The enzyme extract was in the supernatant which
was used in the following enzyme assays. All enzymatic
assays were performed at 4 °C using freshly prepared
enzyme extracts that were kept on ice until analysis.
The superoxide dismutase (SOD) activity was
determined according to the Beyer and Fridovich (1987)
method. Peroxidase (POD) activity was measured
according to the procedure described by McAdam et al.
(1992). Phenylalanine ammonia lyase (PAL) activity was
determined using the method described by D’Cunha et
al. (1996). Catalase (CAT) activity was determined by the
decrease in H2O2 levels (Aebi, 1983).
2.7. Data analysis
Data were analyzed using Excel 2007, and the differences
in these data among treatments were analyzed for
significance (P < 0.05) using the statistical software Data
Processing System (DPS, version 7.05). The viral load was
analyzed using Image J.
3. Results
3.1. Effects of Enterobacter asburiae BQ9 on systemic
protection against TYLCV in tomato plants
The bioprotection capacity of Enterobacter asburiae
BQ9 was assessed in tomato plants according to their
phenotypic responses and the severity of their symptoms.
Twenty-five days after the plants were challenged through
inoculation with TYLCV, the plants developed typical
TYLCV symptoms consisting of stunting, yellowing, and
the upward curling of leaves. In plants that were pretreated
with BQ9, the appearance of symptoms was delayed for 7
days (data not shown), and the symptoms that developed
on leaves were milder and less distinct than those in the
viral control (Figure 1a). In addition, the results of the
disease severity investigation showed that BQ9 pretreated
plants had significantly reduced disease severity when
compared to the viral control; accordingly, 30 days after
inoculation with TYLCV the biocontrol efficacy of BQ9
in controlling the viral disease caused by TYLCV reached
58.7%. After 45 days, the protection conferred by BQ9 was
weakened; however, it still provided significant disease
reduction (42%) (Figure 1b).
Disease severity (%)
LI et al. / Turk J Biol
Figure 1. The bioprotection capacity of antagonistic bacterium BQ9 to TYLCV. Control: pathogen control; BQ9: BQ9 pretreated plants
challenged with TYLCV. a) Representative plants for treatments with BQ9 or a control were photographed 30 days after inoculation
challenge (DAC). b) For each treatment, disease severity in plants was determined according to the disease rating measured at 30 and
45 DAC. Disease severity of each treatment was determined according to the disease rating. Values are means with standard errors from
24 plants. Different letters indicate statistically significant differences between the treatments (Fisher’s least significant difference test; P
< 0.05). All experiments were conducted three times with similar results.
3.2. Effect of BQ9 on promoting the growth of tomato
plants
BQ9 was assessed for its ability to promote the growth
of tomato plants under greenhouse conditions. Twenty
days after treatment, plants that were pretreated with BQ9
exhibited increases in shoot length, root length, and fresh
mass when compared with plants of the mock treatment;
BQ9 treatment also increased the fresh mass of the plants
by 37.84% (Table; Figure 2).
3.3. Impact of antagonistic bacterium BQ9 on the viral
load in tomato plant
Seven days after the tomato plants were challenged
through inoculation, viral particles were detected in the
viral control (Figure 3a). A small amount of the virus was
detected in the BQ9 pretreated plants after 9 days, and the
viral load was almost one-third of that in the viral control
(Figure 3b), indicating that BQ9 could induce plant
resistance to virus proliferation in the leaf.
3.4. Expression of defense-related genes induced by BQ9
and TYLCV inoculation in tomato plants
Reverse-transcription polymerase chain reaction (RTPCR) was used to analyze the expression patterns of the
defense-related genes PR1a and PR1b in tomato plants
that had been treated with BQ9. Transcripts of all tested
genes were detected 1–5 days post-BQ9 treatment (dpt)
in the plant leaves where the expression of these genes
was evident (Figure 4a). PR1a transcripts accumulated
in the leaves from 2 to 5 dpt. The expression of the PR1b
gene began at 3 dpt and reached maximum levels at 4 dpt
(Figure 4a). By contrast, the transcription of these genes
was undetected in the leaves of mock-treatment plants
(Figure 3a).
RT-PCR was also used to analyze the transcription
of these genes in the tomato plants that were inoculated
only with TYLCV and in plants that were pretreated with
BQ9 and then challenged by inoculation with TYLCV.
Table. Promotion of tomato plant growth by BQ9. The data are from a representative experiment that was repeated three times with
similar results. Different letters indicate statistically significant differences between the treatments (Fisher’s least significant difference
test; P < 0.05).
Treatment
Shoot length (cm)
Root length (cm)
Fresh mass (g)
Fresh mass increase (%)
BQ9
26.40 ± 1.77a
13.57 ± 1.81a
7.03 ± 0.45a
37.84
Mock
21.03 ± 1.83b
9.40 ± 1.08b
5.10 ± 0.26b
--
153
LI et al. / Turk J Biol
Figure 2. Promotion of tomato plant growth by BQ9. Representative plants for each treatment were photographed
20 days posttreatment.
Figure 3. Impact of antagonistic bacterium BQ9 on viral load in tomato leaves. The RA value was analyzed using Image J.
Figure 4. Expression of PR1a and PR1b genes in tomato plants in response to BQ9 treatment (a) or in combination with TYLCV
inoculation (b). dpt = days posttreatment, hpi = hours postinoculation.
Transcripts of all tested genes were detected 12–96 h
postinoculation (hpi) in the leaves of plants that had
been inoculated only with TYLCV; however, they were
detected 6–96 hpi in BQ9 pretreated plants. The PR1a gene
transcript reached maximum levels at 24 hpi in the leaves
of plants only inoculated with TYLCV and as soon as 12
hpi in BQ9 pretreated plants challenged by inoculation
154
with TYLCV (Figure 4b). The PR1b gene transcript was
more highly expressed in BQ9 pretreated plants challenged
by inoculation with TYLCV than in those only inoculated
with TYLCV. This indicates that the transcription of these
genes occurred more quickly in plants that were pretreated
with BQ9 and challenged by inoculation with TYLCV.
Furthermore, across all time points, both genes were more
LI et al. / Turk J Biol
highly expressed in BQ9 pretreated plants challenged by
inoculation with TYLCV than in plants that were only
inoculated with TYLCV (Figure 4b).
3.5. BQ9 induced the priming of cellular defense
responses in tomato plants
BQ9 was examined to determine the mechanism by
which it primes tomato plants to potentiate the activation
of cellular defense responses. H2O2 accumulation was
detected 6 hpi in the leaves of plants that were treated
with BQ9 and inoculated with TYLCV, but neither BQ9
treatment nor TYLCV inoculation alone resulted in a
cellular defense response at the same time point (Figure 5).
In plants that were treated with BQ9 and inoculated with
TYLCV, the extent of H2O2 accumulation was significantly
greater than in plants that were only treated with BQ9,
plants that were only inoculated with TYLCV, and in
mock-treated plants (Figure 5).
3.6. BQ9 induced defense enzymes in tomato plants
CAT activity reached maximum levels at 4 dpi and 3 dpi in
plants that were pretreated with BQ9 and then challenged
by inoculation with TYLCV and in those that were
inoculated with TYLCV alone, respectively (Figure 6a).
POD activity was observed in plants that were pretreated
with BQ9 and challenged by inoculation with TYLCV, and
the activity reached maximum levels at 2 dpi; however,
activity was lower in plants that were inoculated with
6h
12 h
Figure 5. Effect of BQ9 and TYLCV treatments on H2O2
accumulation in tomato leaves. Different letters indicate
statistically significant differences between the treatments
(Fisher’s least significant difference test; P < 0.05). All experiments
were repeated three times, and similar results were obtained.
TYLCV alone (Figure 6b). PAL showed a similar pattern of
activity that reached maximum levels at 3 dpi in plants that
were pretreated with BQ9 and challenged by inoculation
with TYLCV (Figure 6c). Similarly, for tomato plants that
were inoculated with TYLCV alone, a slight increase in
PAL activity was recorded. In the SOD assay, the activity
Figure 6. Effect of BQ9 treatment on CAT (a), POD (b), PAL (c), and SOD (d) activities in tomato leaves. Different letters
indicate statistically significant differences among treatments (Fisher’s least significant difference test; P < 0.05). Vertical bars
indicate standard deviations of three replications.
155
LI et al. / Turk J Biol
of SOD appeared as two peaks, 2 dpi and 4 dpi, in plants
that were treated with BQ9 and inoculated with TYLCV,
but only one peak appeared for plants that were inoculated
with TYLCV alone (Figure 6d).
4. Discussion
Tomato yellow leaf curl virus (TYLCV) is undoubtedly one
of the most damaging pathogens in tomato plants, and it
limits the production of tomatoes in many tropical and
subtropical areas of the world. Insecticides are commonly
applied to suppress whitefly populations and to indirectly
reduce the spread of TYLCV. Rhizobacteria, as potential
biological control candidates, could be used to directly
control the spread of TYLCV. In this study, we investigated
the effectiveness of the rhizobacterium Enterobacter
asburiae BQ9 against TYLCV in tomato plants. In the
evidence presented here, tomato plants that were pretreated
with BQ9 triggered a resistant response, including the
expression of defense-related genes, production of H2O2,
and activation of defense enzymes, when challenged by
inoculation with TYLCV. In addition, BQ9-treated plants
exhibited statistically significant increases in fresh mass
compared with mock-treated plants, suggesting that BQ9 is
a PGPR. As for plant disease management, the induction
of plant resistance by PGPR has become a trend in recent
years. Although a large number of studies have focused on
PGPR-induced resistance to various bacterial and fungal
pathogens (Van Loon et al., 1998; Kloepper et al., 2004), only
a few studies have investigated application of PGPR strains
for plant viral disease control under greenhouse and/or
field conditions (Raupach et al., 1996; DeMeyer et al., 1999;
Udaya Shankar et al., 2009; Wang et al., 2009). These studies
are mostly associated with bacteria from the genus Bacillus
that are in contact with plants to control TMV or CMV via
ISR and other mechanisms (Kloepper et al., 2004; Zhou
et al., 2008). This study addressed the role of E. asburiae
BQ9 in priming the defense response to infection by
TYLCV in tomato plants. This study is the first to describe
an Enterobacter asburiae PGPR that triggers tomato plant
resistance to TYLCV and promotes plant growth.
PGPRs, predominantly Bacillus and Pseudomonas
spp., colonize the rhizosphere and promote plant growth
by synthesizing phytohormones, facilitating the uptake of
nutrients, producing antagonistic substances, or inducing
resistance to phytopathogenic organisms (Glick, 1995;
Beneduzi et al., 2012). For naturally growing plants, it
is difficult to distinguish whether an apparent growth
promotion was bacterially stimulated or was caused by
the suppression of deleterious soil microorganisms (Van
Loon, 2007). Induced systemic resistance (ISR), which
was first described by Van Peer et al. (1991), could be
explained as follows: rhizobacteria can reduce the activity
of pathogenic microorganisms not only through microbial
156
antagonism but also by activating the plant to better
defend itself (Van Loon, 2007). In the current study, ISR
triggered by BQ9 conferred lasting protection against
TYLCV with a reduction in disease of 42%, even at 45 dpi,
and it was proposed that the plants may remain protected
for a considerable part of their lifetime once ISR has been
triggered (Van Loon et al., 1998).
When treated with BQ9, the roots of tomato plants
should produce a local signal that moves to the leaves in
order to activate a systemic enhanced defensive capacity
in the plant, although the nature of the mobile signal
triggered by BQ9 has so far remained elusive. In the
leaves of tomato plants pretreated with BQ9, the H2O2
burst occurred more rapidly and to a greater extent upon
challenge with TYLCV than the burst that occurred in the
leaves of viral control plants, and this finding supports
the above assertion. H2O2 has important functions in
the infected plants; it is an early molecular signal that
systemically induces resistance in the fortification of
apoptotic tissues and causes apoptosis of infested cells
(Ahn et al., 2011). The H2O2 burst, an essential signal that
primes defense responses, is a typical response to pathogen
infection in primed plants (Zhang et al., 2009). It has been
well documented that rhizobacteria-mediated ISR is often
associated with priming for the enhanced activation of
cellular defense responses upon pathogen attack, such as
the rapid accumulation of hydrogen peroxide (Conrath et
al., 2002; Van Wees et al., 2008; Niu et al., 2011). In this
study, H2O2 accumulation was detected 6 hpi in the leaves
of plants that were pretreated with BQ9 and challenged
by inoculation with TYLCV, but not in leaves treated
with BQ9 or TYLCV alone. At 12 hpi, the response was
observed in plants that had been inoculated with TYLCV
alone, but still not in plants treated with BQ9 alone
(Figure 5). This implies that BQ9 primed the plant for an
accelerated and enhanced capacity to systemically activate
cellular defense responses, which were induced only upon
pathogen attack. While we inferred that treatment with
the BQ9 strain protected tomato plants from TYLCV
infection through priming defense-related mechanisms,
the same phenomenon was determined in the tomato–
Pseudomonas putida strain LSW17S interaction (Ahn
et al., 2011) and the Arabidopsis–Bacillus cereus strain
AR156 interaction (Niu et al., 2011).
The activation of certain pathogenesis-related (PR)
genes in some plant–PGPR interactions suggested that
the systemic resistance induced by the rhizobacteria was
similar to pathogen-induced systemic acquired resistance
(SAR) (Wang et al., 2005). The enhanced defensive capacity
that is characteristic of SAR is always associated with the
accumulation of PR genes. PR-1, notably PR1a and PR1b,
is a dominant group of PR genes and is commonly used as
a marker for SAR (Kessmann et al., 1994). PR1a transcripts
LI et al. / Turk J Biol
accumulated in leaves of BQ9-treated plants 2 to 5 dpt, the
transcription of PR1b began 3 dpt, and transcription of
both genes reached their maximums levels at 4 dpt, while
neither transcript was detected in mock-treatment plants
(Figure 4a). Furthermore, when challenged by inoculation
with TYLCV, the leaves of plants that were pretreated with
BQ9 had more rapid and extensive transcription of the
PR1 genes than plants that were not pretreated. Altogether,
these observations suggest that BQ9 primed SAR in
tomato plants.
The generation of active oxygen species (AOS) is one of
the initial responses of plants to pathogens (Mehdy, 1994;
Vanacker et al., 2000). As a major scavenger in antioxidant
enzyme systems that protect cellular membranes and
organelles from AOS in plants, SOD converts superoxide
anion radicals to hydrogen peroxide and oxygen by
disproportion (Fridovich, 1986). Considering the high
density of AOS that is generated in tomato plants after
TYLCV invasion, strong SOD activity was assumed to
scavenge AOS, and the relatively low activity of CAT
may be explained by the downstream functions of SOD.
POD can oxidize phenolic compounds into antimicrobial
quinones, which inhibit viruses by inactivating viral
RNA (Lamb and Dixon, 1997). This may account for the
stronger POD activity, compared to CAT, during the first
two days post-TYLCV inoculation. PAL, a key enzyme
in phenylpropanoid metabolism, plays a significant role
in the synthesis of various secondary metabolites (e.g.,
phenols, phenylpropanoids, and lignin and salicylic acid
monomers) that are involved in plant immunity and
induce resistance by PGPR (Gerasimova et al., 2005;
Harish et al., 2008). The accumulation of these secondary
metabolites was thought to restrict virus invasion (Lian
et al., 2011), which may account for the increased PAL
activity in tomato plants treated with strain BQ9 prior to
inoculation with TYLCV.
Acknowledgments
This research was supported by the Special Fund for AgroScientific Research in the Public Interest (201003065,
201303028) and the Joint Innovation Fund Project
(BY2014128-05).
References
Aebi H (1983). Catalase. In: Bergmeyer H, editor. Methods in
Enzymatic Analysis. 2nd ed. New York, NY, USA: Academic
Press, pp. 276–286.
Ahn IP, Kim S, Lee YH, Suh SC (2007). Vitamin B1-induced priming
is dependent on hydrogen peroxide and the NPR1 gene in
Arabidopsis. Plant Physiol 143: 838–848.
Ahn IP, Lee SW, Kim MG, Park SR, Hwang DJ, Bae SC (2011). Priming
by rhizobacterium protects tomato plants from biotrophic and
necrotrophic pathogen infections through multiple defense
mechanisms. Mol Cells 32: 7–14.
Antignus Y, Nestel D, Cohen S, Lapidot M (2001). Ultravioletdeficient greenhouse environment affects whitefly attraction
and flight-behavior. Environ Entomol 30: 394–399.
Baranwal VK, Verma HN (1997). Characteristics of a virus inhibitor
from the leaf extract of Celosia cristata. Plant Pathol 46: 523–
529.
Beckers GJM, Conrath U (2007). Priming for stress resistance: from
the lab to the field. Curr Opin Plant Biol 10: 425–431.
Beneduzi A, Ambrosini A, Passaglia LMP (2012). Plant growthpromoting rhizobacteria (PGPR): their potential as antagonists
and biocontrol agents. Genet Mol Biol 35: 1044–1051.
Benhamou N (1996). Elicitor-induced plant defence pathways.
Trends Plant Sci 1: 233–240.
Beyer WF Jr, Fridovich I (1987). Assaying for superoxide dismutase
activity: some large consequences of minor changes in
conditions. Anal Biochem 161: 559–566.
Brisset MN, Cesbron S, Thomson SV, Paulin JP (2000). AcibenzolarS-methyl induces the accumulation of defense-related enzymes
in apple and protects from fire blight. Eur J Plant Pathol 106:
529–536.
Cahill M, Gorman K, Day S, Denholm I (1996). Baseline
determination and detection of resistance to imidacloprid in
Bemisia tabaci (Homoptera: Aleyrodidae). Bull Entomol Res
86: 343–349.
Conrath U, Pieterse CMJ, Mauch-Mani B (2002). Priming in plantpathogen interactions. Trends Plant Sci 7: 210–216.
Czosnek H, Ghanim M, Ghanim M (2002). The circulative pathway
of begomoviruses in the whitefly vector Bemisia tabaci—
insights from studies with Tomato yellow leaf curl virus. Ann
Appl Biol 140: 215–231.
D’Cunha GB, Satyanarayan V, Madhusudanan NP (1996).
Stabilization of phenylalanine ammonia lyase containing
Rhodotorula glutinis cells for the continuous synthesis of
l-phenylalanine methyl ester. Enzyme Microb Technol 19:
421–427.
DeMeyer G, Audenaert K, Höfte M (1999). Pseudomonas aeruginosa
7NSK2-induced systemic resistance in tobacco depends on in
planta salicylic acid accumulation but is not associated with
PR1a expression. Eur J Plant Pathol 105: 513–517.
Elbert A, Nauen R (2000). Resistance of Bemisia tabaci (Homoptera:
Aleyrodidae) to insecticides in southern Spain with special
reference to neonicotinoids. Pest Manag Sci 56: 60–64.
Foyer CH, Lelandais M, Kunert KJ (1994). Photooxidative stress in
plants. Physiol Plantarum 92: 696–717.
157
LI et al. / Turk J Biol
Fridovich I (1986). Biological effects of the superoxide radical. Arch
Biochem Biophys 247: 1–11.
Gerasimova NG, Pridvorova SM, Ozeretskovskaya OL (2005). Role
of L-phenylalanine ammonia lyase in the induced resistance
and susceptibility of sotato plants. Appl Biochem Microbiol 41:
103–105.
Glick BR (1995). The enhancement of plant growth by free-living
bacteria. Can J Microbiol 41: 109–117.
Hanssen IM, Lapidot M, Thomma BPHJ (2010). Emerging viral
diseases of tomato crops. Mol Plant Microbe Interaction 23:
539–548.
Harish S, Kavino M, Kumar N, Saravanakumar D,
Soorianathasundaram K, Samiyappan R (2008). Biohardening
with plant growth promoting rhizosphere and endophytic
bacteria induces systemic resistance against Banana bunchy
top virus. Appl Soil Ecol 39: 187–200.
Iriti M, Faoro F (2003). Benzothiadiazole (BTH) induces cell-death
independent resistance in Phaseolus vulgaris against Uromyces
appendiculatus. J Phytopathol 151: 171–180.
Jeun YC, Park K, Kim CH (2001). Different mechanisms of induced
systemic resistance and systemic acquired resistance against
Colletotrichum orbiculare on the leaves of cucumber plants.
Mycobiology 29: 19–26.
Kessmann H, Staub T, Ligon J, Oostendorp M, Ryals J (1994).
Activation of systemic acquired disease resistance in plants.
Eur J Plant Pathol 100: 359–369.
Kloepper JW, Ryu CM, Zhang S (2004). Induced systemic resistance
and promotion of plant growth by Bacillus spp. Phytopathology
94: 1259–1266.
Lapidot M, Ben-Joseph R, Cohen L, Machbash Z, Levy D (2006).
Development of a scale for evaluation of Tomato yellow leaf
curl virus resistance level in tomato plants. Phytopathology 96:
1404–1408.
Lapidot M, Friedmann M (2002). Breeding for resistance to whiteflytransmitted geminiviruses. Ann Appl Biol 140: 109–127.
Lian L, Xie L, Zheng L, Lin Q (2011). Induction of systemic
resistance in tobacco against Tobacco mosaic virus by Bacillus
spp. Biocontrol Sci Technol 21: 281–292.
Loreto F, Velikova V (2001). Isoprene produced by leaves protects
the photosynthetic apparatus against ozone damage, quenches
ozone products, and reduces lipid peroxidation of cellular
membranes. Plant Physiol 127: 1781–1787.
MacAdam JW, Nelson CJ, Sharp RE (1992). Peroxidase activity in
the leaf elongation zone of tall fescue I. Spatial distribution of
ionically bound peroxidase activity in genotypes differing in
length of the elongation zone. Plant Physiol 99: 872–878.
Mehdy MC (1994). Active oxygen species in plant defense against
pathogens. Plant Physiol 105: 467.
Michelson I, Zamir D, Czosnek H (1994). Accumulation and
translocation of Tomato yellow leaf curl virus (TYLCV) in a
Lycopersicon esculentum breeding line containing the L. chilense
TYLCV tolerance gene Ty-1. Phytopathology 84: 928–933.
158
Murphy AM, Chivasa S, Singh DP, Carr JP (1999). Salicylic acidinduced resistance to viruses and other pathogens: a parting of
the ways? Trends Plant Sci 4: 155–160.
Navot N, Pichersky E, Zeidan M, Czosnek H (1991). Tomato yellow
leaf curl virus: a whitefly-transmitted geminivirus with a single
genomic component. Virology 185: 151–161.
Niu DD, Liu HX, Jiang CH, Wang YP, Wang QY, Jin HL, Guo JH
(2011). The plant growth-promoting rhizobacterium Bacillus
cereus AR156 induces systemic resistance in Arabidopsis
thaliana by simultaneously activating salicylate- and
jasmonate/ethylene-dependent signaling pathways. Mol Plant
Microbe Interaction 24: 533–542.
Palumbo JC, Horowitz AR, Prabhaker N (2001). Insecticidal control
and resistance management for Bemisia tabaci. Crop Prot 20:
739–765.
Park KS, Ahn IP, Kim CH (2001). Systemic resistance and expression
of the pathogenesis-related genes mediated by the plant growthpromoting rhizobacterium Bacillus amyloliquefaciens EXTN-1
against anthracnose disease in cucumber. Mycobiology 29:
48–53.
Picó B, Díez MJ, Nuez F (1996). Viral diseases causing the greatest
economic losses to the tomato crop. II. The Tomato yellow leaf
curl virus—a review. Sci Hort-Amsterdam 67: 151–196.
Raupach GS, Liu L, Murphy JF, Tuzun S, Kloepper JW (1996).
Induced systemic resistance in cucumber and tomato against
Cucumber mosaic cucumovirus using plant growth-promoting
rhizobacteria (PGPR). Plant Dis 80: 891–894.
Ton J, Jakab G, Toquin V, Flors V, Iavicoli A, Maeder MN, Métrauxc
JP, Mauch-Mania B (2005). Dissecting the β-aminobutyric
acid-induced priming phenomenon in Arabidopsis. Plant Cell
17: 987–999.
Udaya Shankar AC, Chandra Nayaka S, Niranjan-Raj S, Bhuvanendra
Kumar H, Reddy MS, Niranjana SR, Prakash HS (2009).
Rhizobacteria-mediated resistance against the blackeye cowpea
mosaic strain of Bean common mosaic virus in cowpea (Vigna
unguiculata). Pest Manag Sci 65: 1059–1064.
Vanacker H, Carver TLW, Foyer CH (2000). Early H2O2 accumulation
in mesophyll cells leads to induction of glutathione during
the hyper-sensitive response in the barley–powdery mildew
interaction. Plant Physiol 123: 1289–1300.
Van Loon LC (2007). Plant responses to plant growth-promoting
rhizobacteria. Eur J Plant Pathol 119: 243–254.
Van Loon LC, Bakker P, Pieterse CMJ (1998). Systemic resistance
induced by rhizosphere bacteria. Annu Rev Phytopathol 36:
453–483.
Van Peer R, Niemann GJ, Schippers B (1991). Induced resistance and
phytoalexin accumulation in biological control of Fusarium
wilt of carnation by Pseudomonas sp. strain WCS 417r.
Phytopathology 81: 728–734.
Van Wees S, Van der Ent S, Pieterse CMJ (2008). Plant immune
responses triggered by beneficial microbes. Curr Opin Plant
Biol 11: 443–448.
LI et al. / Turk J Biol
Wang S, Wu HJ, Qiao JQ, Ma LL, Liu J, Xia YF, Gao XW (2009).
Molecular mechanism of plant growth promotion and induced
systemic resistance to Tobacco mosaic virus by Bacillus spp. J
Microbiol Biotechnol 19: 1250–1258.
Zamir D, Ekstein-Michelson I, Zakay Y, Navot N, Zeidan M, Eshed Y,
Harel E, Pleban T, Van-Oss H, Kedar N et al. (1994). Mapping
and introgression of a Tomato yellow leaf curl virus tolerance
gene, Ty-1. Theor Appl Genet 88: 141–146.
Wang Y, Ohara Y, Nakayashiki H, Tosa Y, Mayama S (2005).
Microarray analysis of the gene expression profile induced
by the endophytic plant growth-promoting rhizobacteria,
Pseudomonas fluorescens FPT9601-T5 in Arabidopsis. Mol
Plant Microbe Interaction 18: 385–396.
Zhang S, Yang X, Sun M, Sun F, Deng S, Dong H (2009). Riboflavininduced priming for pathogen defense in Arabidopsis thaliana.
J Integr Plant Biol 51: 167–174.
Yedidia I, Shoresh M, Kerem Z, Benhamou N, Kapulnik Y, Chet
I (2003). Concomitant induction of systemic resistance
to Pseudomonas syringae pv. lachrymans in cucumber
by Trichoderma asperellum (T-203) and accumulation of
phytoalexins. Appl Environ Microbiol 69: 7343–7353.
Zhou WW, Zhang LX, Zhang B, Wang F, Liang Z, Niu T (2008).
Isolation and characterization of ZH14 with antiviral activity
against Tobacco mosaic virus. Can J Microbiol 54: 441–449.
Zhou X, Xie Y, Tao X, Zhang Z, Li Z, Claude MF (2003).
Characterization of DNAβ associated with begomoviruses in
China and evidence for co-evolution with their cognate viral
DNA-A. J Gen Virol 84: 237–247.
159