J. gen. Virol. (1988), 69, 1345-1350. Printed in Great Britain
1345
Key words: WD V]geminivirus/priming
Priming of Complementary DNA Synthesis in vitro by Small DNA
Molecules Tightly Bound to Virion DNA of Wheat Dwarf Virus
By R. J. H A Y E S , H. M A C D O N A L D , t R. H. A. C O U T T S AND K. W. B U C K *
Department of Pure and Applied Biology, Imperial College of Science and Technology,
London S W 7 2BB, U.K.
(Accepted 26 February 1988)
SUMMARY
DNA isolated from purified preparations of wheat dwarf virus (WDV) has been
shown to contain tightly bound small DNA molecules which can act as primers for the
synthesis of full-length complementary DNA in vitro. The small DNA molecules are
bound in the terminating intergenic region of the WDV genome between the end of an
open reading frame encoding a putative protein of Mr 17 292 and a conserved 'A-T' box
containing putative transcriptional polyadenylation signals. Evidence that the small
DNA molecules contain ribonucleotides at their 5' termini is presented and their
possible role in the priming of virus DNA synthesis in vivo is discussed.
The Geminivirus group (Matthews, 1982) is composed of plant viruses with unique doubleicosahedral capsids and genomes of circular ssDNA molecules of 2-5 to 3.0 kilobases (for recent
reviews, see Harrison, 1985; Stanley, 1985; Lazarowitz, 1987). Two subgroups of geminiviruses
can be distinguished on the basis of their insect vectors, genome structure and host range: (i)
whitefly-transmitted viruses which have bipartite genomes and dicotyledonous hosts, e.g.
African cassava mosaic virus (ACMV) (synonym cassava latent virus) (Stanley & Gay, 1983;
Stanley, 1983), bean golden mosaic virus (Morinaga et al., 1983; Howarth et al., 1985), tomato
golden mosaic virus (Hamilton et al., 1983, 1984) and (ii) leafhopper-transmitted viruses which
have unipartite genomes and monocotyledonous hosts, e.g. maize streak virus (MSV)
(Mullineaux et al., 1984; Howell, 1985; Grimsley et al., 1987), wheat dwarf virus (WDV)
(MacDowell et al., 1985). A third subgroup may be needed to accommodate beet curly top virus
(BCTV), which is leafhopper-transmitted and has a unipartite genome but whose host range is
limited to dicotyledonous plants. Its genome organization resembles more closely that of the
larger DNA species of subgroup (i) viruses, but its coat protein is more closely related to those of
subgroup (ii) viruses (Stanley et al., 1986).
Maize streak virus virion DNA contains a tightly bound complementary DNA sequence of 80
nucleotides with ribonucleotides attached to its 5' end. This molecule is able to serve as a primer
for second strand DNA synthesis in vitro and may serve a similar function in vivo (Donson et al.,
1984). In contrast no such primer molecules could be detected in ACMV virion DNA (Stanley &
Townsend, 1985). To determine whether possession of a bound primer constitutes a general
difference between virion DNA of subgroups (i) and (ii) of the geminiviruses, further examples
need to be studied. We now report that WDV virion DNA, like that of MSV, contains a bound
primer molecule.
Wheat tissue, Triticum aestivum L. cv. Diamant, infected with a Swedish isolate of WDV by
the leafhopper vector Psammotettix alienus, was kindly supplied by Dr K. Lindsten. WDV
virions were extracted and purified as described by Lindsten et al. (1980) except that the first
virus pellet was obtained by centrifugation through a 10~ (w/v) sucrose cushion. Viral DNA
was obtained by heating virions to 65 °C for 15 min in 10 mM-Tris-HCl pH 8.0 containing 1~o
t Present address: Friedrich Miescher-Institut, P.O. Box 2543, CH-4002 Basel, Switzerland.
0000-8111 © 1988 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23
1346
Short communication
SDS and 1 mM-EDTA, extraction twice with an equal volume of phenol-chloroform (1:1 v/v)
and precipitation with two volumes of ethanol. The major DNA species in the virions, as judged
by its electrophoretic mobility in agarose gels and by its sensitivity to S1 nuclease, was genomic
length ssDNA. A virus-specific ssDNA of subgenomic length was also detected in some
preparations in variable amounts.
Complementary strand DNA was synthesized using virion DNA as a template without the
addition of exogenous primers. Virion DNA (50 ng) was incubated with [c~-32p]dCTP (5 pCi, 400
to 600 Ci/mmot; Amersham) and 2 units DNA polymerase I Klenow fragment (Amersham) in
15 mM-Tris-HC1 pH 8.3 containing 10 mM-MgC12, 50 ~tg/ml bovine serum albumin, 1 mMdithiothreitol, 100 mM-dATP, dGTP and dTTP in a total volume of 10 ~tl. The reaction products
at different times and temperatures were analysed by agarose gel electrophoresis (Fig. 1). After 1
min at room temperature most of the label was associated with DNA species with the same
mobility as virion ssDNA (lane 1). After 5 min lower mobility material was also labelled (lane 2)
and after 30 min a clear band with the mobility of genomic length open circular dsDNA was
produced (lane 3), together with other material. Increasing the temperature of incubation to
42 °C resulted in a small increase in the amount of label incorporated (lane 4). Digestion of the
reaction products with restriction endonuclease E c o R I confirmed that full length circular
dsDNA had been produced. Two fragments of approximately 2-2 kbp and 0.5 kbp were
obtained (lane 5). The sizes o f E c o R I fragments predicted from the nucleotide sequence of WDV
DNA (MacDowell et aL, 1985) are 2212 bp and 537 bp.
Experiments to prove that the products of primer extension reactions were virus-specific and
to determine their polarity were done by hybridization of WDV-specific clones. Firstly the
products of a reaction using unlabelled dCTP were detected on a Southern blot by hybridization
with 32p-labelled, nick-translated (Rigby et al., 1977) WDV DNA cloned in pEMBL9
(MacDowell et al., 1985). Secondly when the products of reaction using labelled dCTP were
denatured by boiling for 10 min and then used to probe ss recombinant M13 clones spotted onto
GeneScreen Plus membrane as described by the manufacturer (New England Nuclear), the
labelled DNA hybridized preferentially to clones carrying inserts with the same polarity as
virion DNA. Hence the DNA synthesized was complementary to the virion DNA.
To determine their size by gel electrophoresis the primer molecules were first labelled at their
5' ends with [7-32p]ATP and polynucleotide kinase. WDV virion DNA (100 ng) was treated with
calf intestinal phosphatase (0.03 units, Bethesda Research Laboratories Molecular Biology
Grade) in 10 mM-Tris-HCl pH 8-0 buffer containing 1 mM-MgC12 for 15 min at 37 °C and for 15
min at 56 °C. Reactions were terminated by incubation at 68 °C for 15 min. Kinase labelling was
then carried out as described by Maniatis et al. (1982). When electrophoresed in 1 ~ agarose gels
containing 0-5 p.g/ml ethidium bromide, the labelled DNA species comigrated with virion
ssDNA. However on electrophoresis in a 6 ~ (w/v) denaturing polyacrylamide gel (Sanger &
Coulson, 1978) most of the label was associated with a population of small DNA molecules up to
76 nucleotides long (Fig. 2). These small molecules were also detected when the end-labelled
virion DNA was purified by electrophoresis in, and elution from, an agarose gel prior to
electrophoresis in the denaturing gel, confirming that they are tightly bound to the virion
ssDNA. The labelled material that remained at the top of the denaturing gel was probably linear
genomic length ssDNA which is often found in preparations of geminivirus virion DNA
(Harrison et al., 1977; Hamilton et al., 1981).
It was found that the small DNA molecules tightly bound to WDV virion ssDNA could also
act as primers for dideoxy sequencing (Sanger et al., 1977), enabling their location on the
genome to be determined. Reverse transcriptase was found to yield better results than DNA
polymerase I Klenow fragment. Four separate reactions were performed for 20 min at 42 °C in a
total volume of 15 gl each containing 100 mM-Tris-HC1 pH 8-3, 140 mM-KCI, 10 mM-MgClz, 5
gCi [c~-32p]dCTP (12.5 pmol), dGTP (2.5 nmol), dTTP (2.5 nmol), dATP (2.5 nmol), reverse
transcriptase (10 units, NBL Enzymes Ltd., Northumbria Biochemicals, Cramlington, U.K.)
and one of the following: ddATP (0.5 nmol), ddTTP (0.5 nmol), ddGTP (0.8 nmol), ddCTP (0.01
nmol). After addition of 1 gl of a solution containing 0.2 mM-dATP, 0.2 mM-dGTP, 0-2 mgdTTP, 1 mM-dCTP, 4 units reverse transcriptase and incubation at 42 °C for a further 15 rain the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23
Short communication
1347
(b)
(a)
1
2
3
4
1
75-70 m
65-OC
2.2--
SS
0,6--
Fig.1.
Fig. 2.
Fig. 1. Gel electrophoresis and restriction endonuclease analysis of the products of primer extension
reactions. Aliquots (2 ~tl)were electrophoresed in a 1~ agarose gel. The gel was dried and subjected to
autoradiography. Incubation times were : lane 1, 1 min, lane 2, 5 min, laries 3 and 4, 30 min. Samples in
lanes 1 to 3 were incubated at room temperature, the sample in lane 4 at 42 °C. Lane 5, sample as in lane
4 digested with EcoRI. The positions of size markers (kbp) are shown on the right hand side of the gel.
oc, genomic open circular dsDNA; ss, genomic ssDNA.
Fig. 2. Sequencing gel. (a) M 13 dideoxy sequencing ladder. N ucleotide lengths are shown on the left.
Lanes 1 to 4 show A, T, C, G respectively. (b) End-labelled small DNA molecules; the amount loaded in
lane 1 is five times that in lane 2.
reaction products were analysed by electrophoresis in 6 ~ (w/v) d e n a t u r i n g polyacrylamide gels
(Sanger & Coulson, 1978).
A characteristic feature of the s e q u e n c i n g patterns was the presence of a region devoid of G
a n d C residues c o r r e s p o n d i n g to the ' A - T ' box located from nucleotides 1277 to 1299 inclusive in
the t e r m i n a t i n g intergenic region in the W D V D N A sequence ( M a c D o w e l l et al., 1985). T h e
sequencing ladders c o n t a i n e d some a m b i g u i t i e s ( b a n d s in all four lanes) a n d hence are n o t
shown. H o w e v e r from a consensus sequence derived from five gels the largest p r i m e r was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23
1348
Short communication
1
2
3
4
5
6
7
--223
--200
--180
--163
--159
Fig. 3. Determination of the 5' terminus of the short DNA molecules. Autoradiograph of
polyacrylamidegel. Lane l, 223 base MluI-Ddel fragment ofWDV DNA; lanes 2 to 5, M13 dideoxy
sequencing ladders (A, C, G and T respectively); lane 6, MluI-cut DNA, treated with alkali; lane 7,
MluI-cut DNA. Nucleotide lengths are shown on the right of the gel.
located to a region of WDV D N A between nucleotides 1409 and 1334 inclusive. The same result
was obtained when the products of the sequencing reactions were treated with alkali (0.3 ~lNaOH, 65 °C, 30 min) to remove any ribonucleotides, followed by neutralization with HC1,
prior to electrophoresis, indicating the absence of ribonucleotides at the 5' end of the primer in
this preparation of viral DNA.
To confirm the position of the 5' end of the small D N A molecules, a primer extension reaction
was carried out with [~-32p]dCTP as described above and the products were separated by gel
electrophoresis. The band with the mobility of genomic length open circular dsDNA was
extracted from the gel using Geneclean (Stratech) according to the manufacturer's instructions,
and then cleaved with restriction endonuclease MluI. The products were analysed by
electrophoresis in 6 ~ (w/w) denaturing polyacrylamide gels (Sanger & Coulson, 1978) alongside
D N A markers of known size. A single band, 163 nucleotides in length, was detected (Fig. 3).
There is only one MluI site in WDV D N A (MacDowell et al., 1985). The enzyme cleaves the
complementary D N A strand between nucleotides 1250 and 1251 (numbered as in the virion
D N A sense). Hence the 5' end of the primer is complementary to nucleotide 1413 in the virion
DNA. The formation of a single band indicates a single 5' end. Therefore the size heterogeneity
of the small D N A molecules (Fig. 1) is due to heterogeneity at the 3' end.
When the product of MluI digestion was treated with alkali prior to electrophoresis, as
described above, a single band of 159 nucleotides was detected (Fig. 3). This indicates that the
primer in this virion D N A preparation had four ribonucleotides at its 5' end, the D N A part of
the molecule starting at nucleotide 1409.
It is noteworthy that the dideoxy sequencing and MluI cleavage experiments were carried out
with virion D N A prepared from two different batches of infected plants and that
ribonucleotides were detected at the 5' end of the small D N A molecules in only one of the
preparations. It is likely that ribonucleotides had been cleaved from the 5' end of the small D N A
molecules in the other preparation either in vivo or during the extraction procedure. The D N A
sequences of the primers bound to the virion D N A of the two preparations both start at
nucleotide 1409.
The small D N A molecules bound to WDV ssDNA are located in the terminating
intergenic region of the WDV genome between the end of an open reading frame encoding a
putative protein of Mr 17292 and the ' A - T ' box containing putative transcriptional
polyadenylation signals (Fig. 4). The small D N A molecules bound to MSV ssDNA are located
in a similar position on the MSV genome, except that in MSV the 5' ends of the molecules overlap
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23
1349
Short communication
17292
A $ "Q *
5'
rrrr~CTCAGGGTGTTGTATTTCGTTTI[CCGATGTCATTGTGTA
3' CGAAGCGTCACTGACAGGATCGCGCCTGCCGCATGTCAAAGATATTTACATIATAGAGTCCCACAACATAAAGCAAAAGGCTACAGTAACACAT
1450
1430
1410
1390
1370
AGGGTTGTTGTTTGTTATATTTGGTTTGTC TTTGCT 3'
TCCCAACAACAAACAATATAAACCAAACAGAAACGAGCATCGGCTCGGAGACATTAGCTTACTGTACTCTATTTATTTTATAATAAAATAAT 5'
1350
1330
1310
t290
Fig. 4. Nucleotide sequence of the longest of the small D N A molecules bound to ssDNA isolated from
WDV virus particles. The sequence is shown aligned with the WDV D N A sequence (MacDowell et at.,
1985). All the bases are deoxyribonucleotides except for the four ribonucleotides marked (r). The
position of the stop codon (*) and the single letter codes of the three C-terminal amino acids of the
putative protein of Mr 12292 are shown. The ' A - T ' box is underlined.
the C terminus of the corresponding MSV protein of M r 17768 (Donson et al., 1984). Since the
present paper was submitted for publication, it has been reported that digitaria streak virus
(DSV), another geminivirus of subgroup (ii), also has small DNA molecules bound to the virion
DNA in the terminating intergenic region (Donson et al., 1987). Two inverted repeat sequences
in MSV DNA 5' of the small DNA molecules (in the complementary DNA sense) with the
potential to form stable hairpin loop structures with AG of -22-4 kcal/mol and - 15-8 kcal/mol
(Mullineaux et al., 1984) were not conserved in the corresponding region of the WDV or DSV
genomes.
The occurrence of small DNA molecules bound to virion DNA of WDV, DSV and MSV
suggests that they may be a characteristic feature of subgroup (ii) geminiviruses. Small DNA
molecules could not be detected in ACMV DNA employing the methods used to detect them in
MSV (Stanley & Townsend, 1985). It is noteworthy that ACMV, other subgroup (i)
geminiviruses and BCTV lack the terminating intergenic region within which the MSV, WDV
and DSV small DNA molecules bind. It will be interesting to determine whether virionassociated small DNA molecules are present only in virus genomes having a terminating
intergenic region.
A possible reason for the presence of virion-associated small DNA molecules in WDV and
MSV is that these viruses may encode their own primases. Since conversion of ssDNA to
dsDNA is a prerequisite for viral transcription and hence formation of virus-coded proteins in
the early stages of an infection cycle, primase would need to be synthesized during a previous
infection cycle and priming take place prior to the formation of virus particles. The function of
the primase would be to synthesize a short RNA molecule to act as a primer for a DNA
polymerase (Kornberg, 1980). Formation of a short ds region could then be a signal for
encapsidation. Termination of complementary DNA synthesis as a result of encapsidation
would be expected to be imprecise and could explain the heterogeneity of the 3' ends of the small
DNA molecules. The small DNA molecules would then act as primers for second strand
synthesis after uncoating in a subsequent infection. Possible candidates for virus-encoded
primases are the 10145, 10906 and 12111 Mr predicted proteins of WDV, MSV and DSV
respectively (MacDowell et al., 1985; Mullineaux et al., 1984; Donson et al., 1987). These ORFs
have no counterparts in the subgroup (i) geminiviruses or in BCTV which may use a host RNA
polymerase or primase for priming of second-strand DNA synthesis in vivo.
We thank Dr K. Lindsten for supplying WDV-infected leaves and the Science and Engineering Research
Council for a research grant. The work was carried out under M A F F licence no. PHF 29A/143.
REFERENCES
DONSON,J., MORRIS-KRSINICH,B. A. M., MULLINEAUX,P. M., BOULTON,M. I. & DAVIES,J. W. (1984). A putative primer
for second-strand D N A synthesis of maize streak virus is virion-associated. EMBO Journal 3, 3069-3073.
DONSON, J., ACCOTTO,G. P., BOULTON,M. L, MULLINEAUX,P. M. & DAVIES,J. W. (1987). The nucleotide sequence of a
geminivirus from Digitaria sanguinatis. Virology 161, 160-169.
GRtMSLEY, N., HonN, T., DAVIES, I. W. & ~OHN, ~. (1987). Agrobacterium-mediated delivery of infectious maize
streak virus into maize plants. Nature, London 325, 177-179.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23
1350
Short communication
HAMILTON, W. O. O., SANDERS, R. C., COUTI'S, R. H. A. & BUCK, K. W. (1981). Characterization of tomato golden
mosaic virus as a geminivirus. FEMS Microbiology Letters 11, 263-267.
HAMILTON,W. D. O., BISARO, D. M., COUTTS,R. H. A. & BUCK, K. W. (1983). Demonstration of the bipartite nature of
the genome of a single-stranded D N A plant virus by infection with the cloned D N A components. Nucleic
Acids Research l l , 7387-7396.
HAMILTON, W. D. O., STEIN, V. E., COUTTS, R. H. A. & BUCK, K. W. (1984). Complete nucleotide sequence of the
infectious cloned D N A components of tomato golden mosaic virus: potential coding regions and regulatory
sequences. EMBO Journal 3, 2197-2205.
HARRISON, B. D. (1985). Advances in geminivirus research. Annual Review of Phytopathology 23, 55-82.
HARRISON, B. D., BARKER,H., BOCK, K. R., GUTHRIE, E. J., MEREDITH, G. & ATK1NSON,M. (1977). Plant viruses with
genomes of circular single-stranded D N A . Nature, London 270, 76~762.
HOWARTH,A. J., CATON,J., BOSSERT,M. & GOODMAN,R. M. (1985). Nucleotide sequence of bean golden mosaic virus
and a model for gene regulation in the geminiviruses. Proceedingsof the National Academy of Sciences, U.S.A.
82, 3572-3576.
HOWELL, S. (1985). Physical structure and genetic organisation of maize streak virus (Kenyan isolate). Nucleic
Acids Research 13, 3018-3019.
KORNBERG, A. (1980). DNA Replication. San Francisco: Freeman.
LAZAROWITZ,S. G. (1987). The molecular characterisation of geminiviruses. Plant Molecular Biology Reporter 4,
177 192.
LINDSTEN, K., LINDSTEN, B., ABDELMOETI,M. & JUNTTI, N. (1980). Purification and some properties of wheat dwarf
virus. Proceedings of the Third Conference on Virus Diseases of Graminae in Europe (28-30 M a y 1980),
Rothamsted, U.K., pp. 27-33.
MACDOWELL,S. W., MACDONALD,H., HAMILTON, W. D. O., COUTTS, R. H. A. & BUCK, K. W. (1985). T h e nucleotide
sequence of cloned wheat dwarf virus D N A . EMBO Journal 4, 2173-2180.
MANIATIS, T., FRITSCH, E. F. & SAMBROOK,J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold
Spring Harbor Laboratory.
MATTHEWS, R. E. F. (1982). Classification and nomenclature of viruses. Intervirology 17, 1-199.
MORINAGA, T., IKEGAMI, i . & MIURA, K. (1983). Infectivity of the cloned D N A s from multiple components of bean
golden mosaic virus. Proceedings of the Japan Academy 59B, 363-366.
MULLINEAUX, P. M., DONSON, J., MORRIS-KRSINICH,B. A. M., BOULTON,M. I. & DAVIES, J. W. (1984). The nucleotide
sequence of maize streak virus D N A . EMBO Journal 3, 3063-3068.
RIGBY, P. W. J., DIECKMANN, M., RHODES, C. & BERG, P. (1977). Labelling deoxyribonucleic acid to high specific
activity in vitro by nick translation with D N A polymerase I. Journal of Molecular Biology 113, 237-251.
SANGER, F. & COULSON, A. R. (1978). The use of thin acrylamide gels for D N A sequencing. FEBS Letters 87,
107-110.
SANGER, F., NICKLEN, S. & COULSON,A. R. (1977). D N A sequencing with chain-terminating inhibitors. Proceedings
of the National Academy of Sciences, U.S.A. 74, 5463-5467.
STANLEY, J. (1983). Infectivity of the cloned geminivirus genome requires sequences from both D N A s . Nature,
London 305, 643-645.
STANLEY, J. (1985). T h e molecular biology of geminiviruses. Advances in Virus Research 30, 139-177.
STANLEY, J. & GAY, M. R. (1983). Nucleotide sequence of cassava latent virus D N A . Nature, London 301, 260-262.
STANLEY,J. & TOWNSEND,R. (1985). Characterisation of D N A forms associated with cassava latent virus infection.
Nucleic Acids Research 13, 2189-2206.
STANLEY, J., MARKHAM,P. G., CALLIS,R. J. & PINNER, M. S. (1986). The nucleotide sequence of beet curly top virus
D N A . EMBO Journal 5, 1761-1767.
(Received 20 October 1987)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 31 Jul 2017 13:48:23