Biochimica et Biophysica Acta 1832 (2013) 2322–2331
Contents lists available at ScienceDirect
Biochimica et Biophysica Acta
journal homepage: www.elsevier.com/locate/bbadis
MitoQ, a mitochondria-targeted antioxidant, delays disease progression
and alleviates pathogenesis in an experimental autoimmune
encephalomyelitis mouse model of multiple sclerosis
Peizhong Mao a,b, Maria Manczak a, Ulziibat P. Shirendeb a, P. Hemachandra Reddy a,b,⁎
a
b
Neurogenetics Laboratory, Division of Neuroscience, Oregon National Primate Research Center, Oregon Health & Science University, 505 NW 185th Avenue, Beaverton, OR 97006, USA
Department of Physiology and Pharmacology, Oregon Health & Science University, 3181 SW Sam Jackson Park Road, Portland, OR 97239, USA
a r t i c l e
i n f o
Article history:
Received 13 July 2013
Received in revised form 26 August 2013
Accepted 12 September 2013
Available online 19 September 2013
Keywords:
Mitochondrial dysfunction
Oxidative stress
Multiple sclerosis
Inflammation
Mitochondria-targeted antioxidant
Neuron
a b s t r a c t
Oxidative stress and mitochondrial dysfunction are involved in the progression and pathogenesis of multiple
sclerosis (MS). MitoQ is a mitochondria-targeted antioxidant that has a neuroprotective role in several mitochondrial and neurodegenerative diseases, including Alzheimer's disease and Parkinson's disease. Here we sought
to determine the possible effects of a systematic administration of MitoQ as a therapy, using an experimental
autoimmune encephalomyelitis (EAE) mouse model. We studied the beneficial effects of MitoQ in EAE mice
that mimic MS like symptoms by treating EAE mice with MitoQ and pretreated C57BL6 mice with MitoQ plus
EAE induction. We found that pretreatment and treatment of EAE mice with MitoQ reduced neurological disabilities associated with EAE. We also found that both pretreatment and treatment of the EAE mice with MitoQ significantly suppressed inflammatory markers of EAE, including the inhibition of inflammatory cytokines and
chemokines. MitoQ treatments reduced neuronal cell loss in the spinal cord, a factor underlying motor disability
in EAE mice. The neuroprotective role of MitoQ was confirmed by a neuron-glia co-culture system designed
to mimic the mechanism of MS and EAE in vitro. We found that axonal inflammation and oxidative stress are
associated with impaired behavioral functions in the EAE mouse model and that treatment with MitoQ can
exert protective effects on neurons and reduce axonal inflammation and oxidative stress. These protective effects
are likely via multiple mechanisms, including the attenuation of the robust immune response. These results suggest that MitoQ may be a new candidate for the treatment of MS.
© 2013 Elsevier B.V. All rights reserved.
1. Introduction
Multiple sclerosis (MS), an autoimmune demyelinating disease with
highly disabling consequences, affects over 2.5 million people worldwide, especially young people. It is characterized by chronic inflammation and axonal loss in the central nervous system (CNS) [1–5].
The hallmark pathology in MS is inflammation of the myelin, the
fatty sheath that insulates nerve cells. The inflammation denudes and
scars the myelin, often resulting in permanent damage to the nerves.
The cause of MS is enigmatic, although most investigators believe that
the immune system attacks the white matter of brain [6]. Recent studies
have found extensive demyelination in the cerebral cortex, in MS
patients [7–9], even in early stages of disease progression [10]. In active
gray matter lesions, activated microglia were reported to appose and
ensheath apical dendrites, neurites, and neuronal perikarya [11]. Activated microglia are a major source of cytokines and oxidizing radicals,
⁎ Corresponding author at: Neuroscience Division, Oregon National Primate Research
Center, West Campus, Oregon Health & Science University, 505 NW 185th Avenue,
Beaverton, OR 97006, USA. Tel.: +1 503 629 4045; fax: +1 503 418 2701.
E-mail address: [email protected] (P.H. Reddy).
0925-4439/$ – see front matter © 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.bbadis.2013.09.005
e.g., superoxides, hydroxyl radicals, hydrogen peroxide, and nitric oxide
[4,12,13], which have been found to damage cell components.
Further, the extent of lipid and DNA oxidation correlated significantly
with inflammation in brain lesions of patients with MS [14]. Mechanisms
of axonal degeneration that researchers have proposed in MS include
cytosolic and (subsequent) mitochondrial Ca2+ overload, the accumulation of pathologic reactive oxygen species (ROS), and mitochondrial
dysfunction, any of which could lead to cell death [4,15].
To reduce myelin inflammation and subsequent denuding of myelin,
researchers have turned to immunomodulatory or immunosuppressive
therapy [16]. However, these treatments are not always successful, and
patients have had severe, adverse effects. IFN-β and glatiramer have
shown therapeutic benefits in about 50% of patients with MS, who experienced reduced relapse at a rate of about 30%, and a slowed progression
of disability. Although these results are encouraging, especially since the
advancements in treatment have all occurred within years the search
for new compounds to reduce or to prevent autoimmune inflammation,
without causing significant side effects, continues.
Since ROS has been identified as being involved in the pathology of
MS in humans and in animal models of MS, an antioxidant therapy
has been proposed to reduce ROS in patients with MS. One such therapy
2323
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
is mitochondrial CoQ10 (MitoQ), a derivative of coenzyme Q10, that
is conjugated to triphenylphosphonium cation [17]. MitoQ has been
found to promote the uptake of CoQ10 into mitochondria in a cell and
animal model of Alzheimer's disease and in ischemia, where it was
found to combat ROS originating in mitochondria [17,18]. Several researchers reported that MitoQ has an anti-oxidant role in vitro [18]
and in vivo [17]. In addition, when high levels of MitoQ orally were
given to wild-type mice (C57BL/6 strain) or up to 28 weeks, the mice
exhibited no measurable adverse effects [19]. However, the effects of
MitoQ in animal models of MS or in patients with MS have not yet
been investigated.
In the current study, we studied the effects of MitoQ on the development and progression of an experimental autoimmune encephalomyelitis (EAE) mouse model, the most widely used animal model of MS.
We also investigated the possible underlying mechanisms of MitoQ in
the EAE mouse model.
2. Material and methods
2.1. EAE mouse model
Ten-week-old -old C57BL/6 mice (25 to 35 g) were purchased from
Taconic Farms (New York, NY) and housed in the animal facility of the
Oregon National Primate Center at Oregon Health & Science University
(OHSU). We used these mice for EAE induction and MitoQ treatments.
The OHSU Institutional Animal Care and Use Committee approved all
procedures for animal care according to guidelines set forth by the National Institutes of Health.
We studied 4 groups of mice (10 mice in each group): 1. Normal
control mice - C57BL6 strain, 2. EAE mice (vehicle treated), 3. MitoQ
pretreated/EAE mice and 4. EAE mice for 1) clinical course of EAE, 2)
mRNA expression of inflammatory, apoptotic and oxidative stress
genes in tissues from spinal cord, and 3) immunohistochemistry of the
spinal cords.
2.2. MOG induction
EAE induction was performed as described previously [20,21]. The
C57BL6 mice were injected at ~10 weeks of age with 200 μg MOG
peptide amino acids 35–55 in complete Freund's adjuvant (CFA) with
Mycobacterium tuberculosis H37RA. MOG peptides were mixed with
the adjuvant to yield a 1 mg/ml emulsion of the antigen and of CFA.
As an immunization, 2 × 100 μl emulsion was delivered subcutaneously to each mouse at two different sites in the trunk. Pertussis toxin
(400 ng/mouse) was injected twice intra-peritoneal (i.p.), in 500 μl
PBS at the time of the immunization and 72 h later. To understand
behavioral changes in the progression of EAE in mice, we scored the
behavioral deficits daily for all mice, using the following 5-point behavioral scoring scale: Grade 0, normal (no clinical signs of EAE); Grade 1,
flaccid tail; Grade 2, mild hindlimb weakness (fast righting reflex);
Grade 3, severe hindlimb weakness (slow righting reflex); Grade 4,
hindlimb paralysis; Grade 5, hindlimb and forelimb weakness or paralysis, moribundity, or death.
We determined 100 nmole per mouse i.p. injection twice per week,
based on our earlier preliminary study. Briefly, we tested 2 doses of
MitoQ in 2-month-old C57BL6 mice (n = 6 for each dose), one with
100 nmole per mouse i.p. and the other with 2 μmol per mouse
i.p., twice per week for 3 weeks. In a higher dose (2 μmol per mouse
i.p., twice per week), one mouse became sick, in contrast to the mice
on low dosage of MitoQ, all of which were active and healthy for
3 weeks. Therefore, we chose 100 nmole per mouse i.p. twice per
week for our experimental groups.
2.4. RNA isolation and real-time RT-PCR
Messenger RNA changes of several MS-associated genes were isolated from the spinal cord of the non-treated EAE mice and the MitoQtreated EAE mice (Table 1). Using primer express software (Applied
Biosystems, Foster City, CA), the oligonucleotide primers were designed
for β-actin and GAPDH (housekeeping genes) and for MBP, CD4, C8,
CD11b, CD11c, IL1, IL6, IL10, IL17, TGFβ, TNFα, STAT3, NOS, NFkB, and
INFγ. The real-time RT-PCR oligonucleotide primers were designed,
using primer express and primer sequences; amplicon sizes are listed
in Table 1. We measured mRNA expression of the genes mentioned
above, using SYBR-Green chemistry-based quantitative real-time RTPCR, as described in Manczak et al. [22] and Reddy et al. [23]. Briefly,
2 μg of DNAse-treated total RNA was used as starting material, to
which we added 1 μl of oligo (dT), 1 μl of 10 mM dNTPs, 4 μl of 5×
first strand buffer, 2 μl of 0.1 M DTT, and 1 μl RNAse out. The reagents
RNA, dT, and dNTPs were mixed first, then heated at 65 °C for 5 min,
and finally chilled on ice until the remaining components were added.
The samples were incubated at 42 °C for 2 min, and then 1 μl of Superscript III (40 U/μl) was added. The samples were incubated again at
42 °C, but for 50 min, at which time the reaction was inactivated by
heating the samples at 70 °C for 15 min.
Table 1
Summary of real-time RT-PCR oligonucleotide primers used in measuring mRNA expression in inflammatory markers between C57BL6 and EAE mice, C57BL6 and MitoQ + EAE
mice, and C57BL6 + EAE + MitoQ treated mice.
Marker
DNA sequence (5′-3′)
PCR product size
MBP
Forward primer ACAGAGACACGGGCATCCTT
Reverse primer CACCCCTGTCACCGCTAAAG
Forward primer AGGGAGAGTCAGCGGAGTTCT
Reverse primer CTCCCCACCCGTTTTCCT
Forward primer CGAAAGCGTGTTTGCAAATG
Reverse primer TGGGCTTGCCTTCCTGTCT
Forward primer AAACCACAGTCCCGCAGAGA
Reverse primer CGTGTTCACCAGCTGGCTTA
Forward primer CCTGAGGGTGGGCTGGAT
Reverse primer GCCAATTTCCTCCGGACAT
Forward primer CCATGGCACATTCTGTTCAAA
Reverse primer GCCCATCAGAGGCAAGGA
Forward primer CCACGGCCTTCCCTACTTC
Reverse primer TTGGGAGTGGTATCCTCTGTGA
Forward primer GATGCCCCAGGCAGAGAA
Reverse primer CACCCAGGGAATTCAAATGC
Forward Primer CCTGGCGGCTACAGTGAAG
Reverse primer TTTGGACACGCTGAGCTTTG
Forward primer AGAGCTCGAGGCGAGATTTG
Reverse primer TTCTGATCACCACTGGCATATGT
Forward primer TTCGGCTACCCCAAGTTCAT
Reverse primer CGCACGTAGTTCCGCTTTC
Forward primer CCCGACAGTGAAGTGGCTACTA
Reverse primer TTCCCTAGCGGGCACATG
Forward primer GGATCTTCCCAGGCAACCA
Reverse primer CAATCCACAACTCGCTCCAA
Forward primer CCAGCTTCCGTGTTTGTTCA
Reverse primer AGGGTTTCGGTTCACTAGTTTCC
Forward primer ACGGCCAGGTCATCACTATTC
Reverse primer AGGAAGGCTGGAAAAGAGCC
Forward primer TTCCCGTTCAGCTCTGGG
Reverse primer CCCTGCATCCACTGGTGC
56
CD4
CD8
CD11b
CD11C
IL1
IL6
IL10
IL17
2.3. Treatment of EAE mice with MitoQ
TGFβ
In the preventive treatment group of mice, we injected vehicle (PBS)
or MitoQ (100 nmol/mouse, i.p. injection) 10 days before immunization with MOG and continued treating mice with MitoQ or vehicle for
another 30 days, twice a week (total treatment days 40) (pretreatment
with MitoQ). In therapeutic group of mice, we injected EAE mice with
vehicle or MitoQ (100 nmol/mouse, i.p. twice a week) 14 days after
we induced them with MOG, and we continued treating them with
MitoQ for total 30 days (therapeutic treatment after disease onset). The
duration of treatment – for pre- and post-EAE – is standard and acceptable to determine MitoQ protective effects against EAE in mice.
TNFα
STAT3
NOS
NFkB
Beta actin
GAPDH
59
54
57
50
55
60
58
56
62
55
58
60
63
65
59
2324
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
The CT-values of β-actin and GAPDH were tested to determine the
unregulated endogenous reference gene in experimental animals and
control animals. The CT-value, described in Manczak et al. [22] and
Reddy et al. [23], is an important quantitative parameter in real-time
PCR analysis. All RT-PCR reactions were carried out in triplicate and
with no template control. The mRNA transcript level was normalized
against β-actin and GAPDH at each dilution. The standard curve was
the normalized mRNA transcript level, plotted against the log-value of
the input cDNA concentration at each dilution. Briefly, the comparative
CT method involved averaging triplicate samples, which were taken
as the CT values for β-actin, GAPDH, and mitochondrial genes. β-actin
normalization was used because β-actin and CT values were similar
for mitochondrial structural genes, and also it allows us to avoid the
values of GAPDH. The ΔCT-value was obtained by subtracting the average β-actin CT value from the average CT-value for the mitochondrial
structural genes. The ΔCT of the controls was used as the calibrator.
The fold change was calculated according to the formula 2−(ΔΔC)T,
where ΔΔCT is the difference between ΔCT and the ΔCT calibrator value.
2.5. Histochemistry and quantification of inflammatory responses
To determine the protective effects of MitoQ in microglial activity
and oxidative stress, we used immunohistochemistry and immunofluorescence analyses of several selective cytokine markers that are differentially expressed in EAE mice. All mice that were used to examine
behavioral analyses were sacrificed by cervical dislocation, and then
the spinal cord was frozen quickly and histological examinations were
conducted in the spinal cord. Briefly, we fixed the fresh-frozen tissues
by dipping them into a 4% paraformaldehyde solution for 10 min at
room temperature. The sections were incubated overnight at room temperature with cytokine antibodies. Details of antibodies are given in
Table 2. On the next day, the sections were incubated with the secondary antibody conjugated with HRP or biotin-labeled secondary antibody
for 1 h. Spinal cord sections were incubated with tyramide-labeled or
streptavidin-conjugated fluorescent dye, Alexa 488 (green) (Molecular
Probes, Eugene, OR). Photographs of spinal cord were taken with a fluorescence microscope.
To quantify the immunoreactivity of microglial markers Iba1 and IL6,
and neuronal marker NeuN for each animal, ten sections from each
mouse of the spinal cord were stained (as described above), and the immunoreactive signals were quantified. From immunostained sections,
several photographs were taken at 10× and 40× (the original) magnification of the spinal cord. Positive immunoreactive fluorescence signal
intensity of microglia was measured using the red–green and blue
(RGB) method, as described in Manczak et al. [22] and Reddy et al.
[24]. The signal intensity of immunoreactivity for several randomly selected images of each mouse was quantified, and statistical significance
was assessed for each marker in the EAE mice, MitoQ-pretreated,
MitoQ-treated (therapeutic) mice, and normal control mice.
2.6. Co-culture of cortical neurons and microglia
Cortical neurons from wild-type mice (C57BL6; embryonic day 18
[E18]) were plated at 1 × 105 cells/well on poly-D-lysine-coated 24well plates in a neurobasal medium (Invitrogen, San Diego, CA, USA)
containing a supplement of 2% B-27 and 0.6 mM L-glutamine. The
cells were incubated in humidified air of 5% CO2 [21,25,26]. Microglia
from the BV2 cell line (American Type Culture Collection, Manassas,
VA, USA) were cultured in RPMI 1640 (Invitrogen) supplemented
with 10% heat-inactivated FBS and 1% penicillin/streptomycin. The
cells were then cultured in humidified air containing 5% CO2. Twentyfour hours after the plating, MitoQ (40 nM final concentration) was
added to the neuronal culture from the treatment groups. After another
24 h, microglia (1 × 105 cells/well) were seeded with primary neuronal cultures. At this point, the medium containing MitoQ was removed
from the “pretreatment” plates and stimulated with 1 μg/ml lipopolysaccharide for 60 h. Cells were subjected to a 3-(4,5-Dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay or fixed with 4%
paraformaldehyde for 20 min and stained with a NeuN/β3-tubulin antibody (Covance, Princeton, NJ, USA; 1:500) and a proper second antibody. The numbers of NeuN/β3-tubulin-positive cells were quantified
in triplicate in three independent experiments.
2.7. Statistical analysis
Data were expressed as the mean ± SEM, except where otherwise
indicated. Data were compared using ANOVA and Student's t-test with
SigmaStat 3.5 software; P b 0.05 was considered statistically significant.
3. Results
3.1. Reduction of neurological disability in the MitoQ-treated EAE mice
To determine the possible role and mechanisms of MitoQ therapy
administered to an EAE mouse model of MS, we first examined whether
MitoQ affects behavioral deficits associated with a chronic form of EAE:
forelimb and hindlimb paralysis. We followed a standard procedure to
induce EAE by immunizing wild-type (C57BL6) mice with MOG.
Consistent with previous reports [20,21,27,28], our vehicle-treated
EAE mice developed a typical course of EAE neurological disability,
which became obvious around two weeks after immunization. The disabilities persisted for at least 8 weeks (Fig. 1). However, our EAE mice
that were pretreated with MitoQ showed a modest but statistically
significant delay in the onset of behavioral deficits (Fig. 1A), as well
as an attenuation of symptoms over the course of EAE development
(Fig. 1A, P b 0.05). Interestingly, EAE mice that received MitoQ treatment (after day 12 i.p.) had received significantly reduced scores for
their symptoms (Fig. 1B). These findings point to a protective role for
MitoQ in the EAE mouse model.
Table 2
Summary of antibody dilutions and conditions used in the immunohistochemistry/immunofluorescence analysis in EAE mouse.
Marker
Primary antibody — species and dilution
Purchased from company, state
Secondary antibody, dilution, Alexa fluor dye
Purchased from company, city & state
Iba1
Mouse monoclonal 1:200
Abcam,
Cambridge, MA
KPL, Gaithersburg, MD
Vector Laboratories Inc., Burlingame, CA
Molecular Probes, Eugene, OR
IL-6
Rabbit polyclonal 1:200
Abcam,
Cambridge, MA
NeuN
Mouse monoclonal 1:200
EMD — Millipore,
Billerica, MA
Goat anti-mouse
Biotin 1:300, HRP-Streptavidin
(1: 100),
TSA-Alexa488
Goat anti-rabbit
Biotin 1:300, HRP-Streptavidin
(1: 100),
TSA-Alexa488
Goat anti-mouse
Biotin 1:300, HRP-Streptavidin
(1: 100),
TSA-Alexa488
KPL, Gaithersburg, MD
Vector Laboratories Inc., Burlingame, CA
Molecular Probes, Eugene, OR
KPL, Gaithersburg, MD
Vector Laboratories Inc., Burlingame, CA
Molecular Probes, Eugene, OR
2325
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
Fig. 1. MitoQ treatments modestly delayed the onset and significantly attenuated the behavioral deficits of EAE. EAE was induced, disease activity was monitored daily, and the mean
EAE score was calculated for vehicle-treated (filled squares, n = 10), Mito-Q pretreated, and Mito-Q EAE mice and normal control mice (filled diamonds, without MOG immunization,
n = 10). The results shown are representative of 3 separate experiments.
3.2. MitoQ treatment decreases inflammation in the spinal cords of EAE
mice
To determine the effects of MitoQ on EAE mice, we prepared RNA
from spinal cords of control C57BL6 mice, MitoQ + EAE mice, and
EAE + MitoQ mice. We compared gene expression levels, using realtime RT-PCR analysis, and we measured mRNA levels of genes that are
associated with central nervous system inflammation, including MBP,
CD4, CD8, CD11b, CD11c, IL1, IL6, IL10, IL17, TGFβ, TNFα, STAT3, NOS,
NFkB, and INFγ.
3.2.1. MBP (myelin basic protein)
Comparing mRNA levels of MBP in EAE-induced C57BL6 mice with
C57BL6 mice, we found mRNA expression levels decreased in MBP
by 2.7 fold. However, mRNA expression levels were decreased in the
MitoQ + EAE mice and EAE + MitoQ-treated mice relative to the
C57BL6 mice (Table 3). These findings suggest that MitoQ treatment
increases MBP expression in EAE mice.
3.2.2. CD4, CD8 and CD11b
As shown in Table 3, mRNA analysis of the spinal cords of EAE mice
compared to the spinal cords of C57BL6 mice showed mRNA expressions levels increased in CD4 by 2.8 fold, in CD8 by 2.5 fold, and in
CD11b by 2.6 fold, indicating that EAE induce enhance inflammatory
response genes. In contrast, in the MitoQ-pretreated plus EAE-induced
C57BL6 mice relative to the C57BL6 mice, mRNA levels were decreased
in CD4 by 2.4 fold, in CD8 by 1.7 fold, and in CD11b by 6.5 fold. Similarly,
Table 3
mRNA expression fold change in inflammatory genes of EAE mice, MitoQ pretreated EAE
mice, EAE mice treated with MitoQ relative to control, wild-type mice.
Gene
MBP
CD4
CD8
CD11b
CD11c
IL1
IL6
IL10
IL17
TGFβ
TNFα
STAT3
NOS
NFkB
INFγ
Control mice versus EAE mice, MitoQ pretreated + EAE mice
and EAE mice treated with MitoQ Spinal cord
EAE mice
MitoQ + EAE mice
EAE + MitoQ mice
−2.7
2.8
2.5
2.6
1.3
3.0
2.6
1.8
1.8
2.0
1.7
1.4
2.8
1.4
6.5
−1.3
−2.4
−1.7
−6.5
1.2
−5.4
−5.1
−6.4
−2.5
2.4
−1.9
2.5
−8.3
−1.8
5.1
−1.5
−3.0
−5.7
−5.2
1.4
−6.0
−6.0
−10.2
−7.4
1.2
−2.5
3.2
−7.9
−2.6
2.8
2326
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
in the MitoQ therapeutic mice mRNA levels were reduced in CD4 by 3.0
fold, in CD8 by 5.7 fold, and in CD11b by 5.2 fold (Table 3). These findings suggest that MitoQ markedly reduces inflammatory markers in
the spinal cords of EAE mice.
3.2.3. CD11c
mRNA levels of CD11c did not change in the EAE-induced mice
relative to the C57BL6 mice (the difference was 1.3 fold) and also
MitoQ + EAE mice (the difference is 1.2 fold) and EAE + MitoQ mice
(the difference is 1.3) relative to C57BL6 mice (Table 3).
3.2.4. IL1, IL6, IL10 and IL17
As shown in Table 3, in the spinal cords of EAE-induced C57BL6 mice
compared to the spinal cords of C57BL6 mice, mRNA expressions levels
were increased in IL1 by 3.0 fold, in IL6 by 2.6 fold, in IL10 by 1.8 fold,
and in IL17 by 1.8 fold, suggesting that the inducement of EAE enhances
inflammatory-response genes (Table 3). However, in the MitoQ-treated
plus EAE-induced C57BL6 mice relative to C57BL6 mice, mRNA levels
were decreased in IL1 by 5.4 fold, IL6 by 5.1 fold, IL10 by 6.4 fold, and
IL17 by 2.5 fold. Similarly, mRNA levels in the therapeutic mice
(EAE + MitoQ) were reduced in IL1 by 6.0 fold, IL6 by 6.0 fold, IL10
by 10.2 fold, and IL17 by 7.4 fold. These findings indicate that MitoQ can
markedly reduce inflammatory markers in the spinal cords of C57BL6
mice with EAE.
3.2.5. TNFα
Research in MS has revealed that TNFα is elevated in MS brains and
in the spinal cords of EAE mice. To determine the effects of MitoQ
on EAE mice, we studied mRNA levels in C57BL6 mice, MitoQ + EAE
mice, and EAE + MitoQ treated mice. As shown in Table 3, TNFα
mRNA levels were upregulated by 1.7 fold in the EAE mice relative
to the C57BL6 mice. However, mRNA expression was reduced in the
MitoQ + EAE mice by 1.9 fold and in the EAE + MitoQ mice by 2.5
fold (Table 3). These observations suggest that MitoQ can suppress
inflammation in EAE mice.
3.2.6. NOS2, NFkB
Similar to other inflammatory markers, the mRNA levels of NOS2,
NFkB in the EAE mice relative to the control C57BL6 mice were upregulated in NOS2 by 2.8 fold and in NFkB by 1.4 fold. These upregulated
mRNA levels were reduced for NOS by 8.3 fold in the MitoQ + EAE mice
and 7.9 fold in the EAE + MitoQ mice relative to C57BL6 mice. mRNA
levels of NFkB were also down-regulated in the MitoQ + EAE mice by
1.8 fold and in the EAE + MitoQ by 2.6 (Table 3).
3.2.7. STAT3
In STAT3, an anti-apoptotic gene, mRNA levels were upregulated by
1.4 fold in the EAE mice relative to the control C57BL6 mice. Unlike
other inflammatory markers, STAT 3 mRNA levels were upregulated in
the MitoQ + EAE mice and in the EAE + MitoQ-treated mice relative
to the control C57BL6 mice (Table 3), indicating that MitoQ enhances
STAT3 levels. STAT3 may have some protective, beneficial effects against
EAE in mice.
3.3. Immunohistochemistry analysis — Iba1
Using immunohistochemistry analysis of spinal cord sections from
all 4 groups of mice, we aimed to ascertain the treatment effects of
Fig. 2. Quantitative immunostaining analysis of Iba1 in the spinal cords of normal control C57BL6 mice, EAE mice, MitoQ + EAE mice and EAE + MitoQ mice. Panel A represents immunoreactivity of Iba1 — images A & E from control mice; images B & F from EAE mice; C & G from MitoQ-pretreated plus EAE mice and D & H from EAE mice treated with MitoQ. Images A to D
in 10× original magnification and E to H in 40× original magnification. Panel B indicates quantification of Iba1 immunoreactivity.
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
MitoQ on inflammation and demyelination. We used a specific marker,
Iba1 antibody for immunostaining of glial cells in the spinal cord because active glial cells are the main source of inflammation factors,
such as pathological cytokines and ROS. Compared to normal control
C57BL/6 mice (Fig. 2A and E), EAE mice (Fig. 2B and F) showed significantly high levels of Iba1 immunoreactivity (P = 0.001), indicating
strong inflammation in their spinal cords (Fig. 2). Compared to the
vehicle-treated EAE mice (Fig. 2B, images B and F), both MitoQ groups
– the pretreated (Fig. 2C and G; P = 0.01) the MitoQ-treated EAE
mice (Fig. 2D and H; P = 0.03) – showed significantly reduced Iba1 immunoreactivity (Fig. 2), indicating MitoQ reduced CNS inflammation.
3.4. Immunohistochemistry analysis — IL6
Interleukin-6 (IL6) plays critical roles in the pathogenesis of autoimmune diseases, including EAE [29]. Importantly IL6-deficient mice
(IL6 KO) were resistant to MOG-induced EAE [30]. Also, IL6 could cause
typical or atypical EAE in such IL6 KO mice [31,32]. Further, inhibition of
IL6 production alleviated pathogenesis of EAE [33]. Hence we selectively
examined the protein expression for IL6 in the spinal cord. Interestingly,
the changes in the RNA expression of the spinal cord IL6 (Table 3) were
confirmed by immunoreactivity of IL6 (Fig. 3). Compared to normal control mice (Fig. 3A and E), EAE mice showed significantly increased levels
of IL6 immunoreactivity (Fig. 3B and F; P = 0.003), indicating elevated
inflammation in their spinal cords of EAE mice. Compared to EAE mice
(Fig. 3B and F), both the MitoQ-pretreated EAE mice (Fig. 3C and G;
P = 0.01) and MitoQ-treated EAE mice (Fig. 3D and H; P = 0.01)
showed significantly reduced IL6 immunoreactivity, indicating that
2327
MitoQ suppressed inflammation in EAE mice and the densities of their
white matter cells were similar to those of the normal control mice.
3.5. MitoQ protective effects against neurodegeneration in EAE
mice – Immunostaining analysis of neuronal marker – NeuN
In light of the profound anti-inflammatory effects that appeared to
be induced by MitoQ treatments of EAE mice (Table 2; Fig. 1), we sought
to determine whether these effects correlated with the preservation
of neuronal cells. Our initial histological analysis indicated that the
most severe neuronal damage was most frequently in the lumbar
spinal cord sections (data not shown), consistent with previous studies
[27,34,35]. We did not find a significant difference between the MitoQpretreated and MitoQ-treated mice in terms of neuroprotection. We
then focused on sections from the lumbar spinal cord of EAE, EAEtreated with MitoQ, and normal control mice, using immunohistochemistry with an antibody against NeuN.
Immunostaining results are shown in Fig. 4. We observed a significant difference in the extent of neuronal loss across these mouse groups.
Within the spinal cord of EAE mice, significantly reduced positively
labeled with anti-NeuN antibody (Fig. 4B and F), compared to the spinal
cord neurons from the normal control mice (Fig. 4A and E). However,
we found significantly increased staining of anti-NeuN in the spinal
cord sections from the MitoQ-pretreated EAE mice (Fig. 4C and G) and
EAE mice treated with MitoQ (Fig. 4D and H). In addition, we did not
find a significant difference between the MitoQ-pretreated and the
MitoQ-treated EAE mice in terms of neuroprotection. Quantification of
NeuN positive cells in the spinal cord confirmed significant neuronal
Fig. 3. Quantitative immunostaining analysis of IL6 in the spinal cords of normal control C57BL6 mice, EAE mice, MitoQ + EAE mice and EAE + MitoQ mice. Panel A represents immunoreactivity of IL6 — images A & E from normal control mice; images B & F from EAE mice; C & G from MitoQ-pretreated plus EAE mice and D & H from EAE mice treated with MitoQ. Images
A to D in 10× original magnification and E to H in 40× original magnification. Panel B indicates quantification of IL6 immunoreactivity.
2328
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
Fig. 4. Quantitative immunostaining analysis of neuronal marker — NeuN in the spinal cords of normal control C57BL6 mice, EAE mice, MitoQ + EAE mice and EAE + MitoQ mice. Panel A
represents immunoreactivity of NeuN — images A & E from control mice; images B & F from EAE mice; C & G from MitoQ-pretreated plus EAE mice and D & H from EAE mice treated with
MitoQ. Images A to D in 10× original magnification and E to H in 40× original magnification. Panel B indicates quantification of NeuN immunoreactivity.
loss in the vehicle-treated EAE mice compared with the normal control
mice, whereas the MitoQ-pretreated mice and EAE mice treated with
MitoQ had NeuN positive cell numbers that were no different from
numbers in the normal control mice. These data suggest that MitoQ
treatment is primarily responsible for preserving demyelinated axons
and neurons in the EAE mouse model. To further understand this key
role of neuroprotection, we studied an in vitro EAE mouse model of
MS, in which there are only two kinds of brain cells: mouse primary cultured neurons and microglial cells.
3.6. MitoQ treatment attenuates neuronal damage in
lipopolysaccharide-activated microglia in vitro
To determine whether MitoQ protects against axonal damage
triggered by inflammation, we used an in vitro model of microgliamediated neurotoxicity [21,36]. As shown in Fig. 5A, cell survival was
significantly reduced when cells were exposed to lipopolysaccharide.
In the exposure of these cells to lipopolysaccharide-activated microglia,
MitoQ treatment prevented cell death and increased cell survival, as
determined by an MTT assay. This protective effect was obvious even
when MitoQ was used only as a pretreatment to neurons before neurons were co-cultured with activated microglia. Specifically, in this coculture, the number of Tuj-1 -positive cortical neurons decreased after
they were exposed to lipopolysaccharide-activated microglia (Fig. 5B
and 5C). The treatment of neurons with MitoQ attenuated the neurotoxicity triggered by lipopolysaccharide-activated microglia. Thus, together
with the in vivo immunostaining data shown in Fig. 4, these results suggest that MitoQ therapy plays a neuroprotective role that may underlie
protection against mitochondrial oxidative damage in EAE.
4. Discussion
Using an EAE mouse model of MS, we found that the pretreatment
and treatment of EAE mice with MitoQ reduced axonal loss and reduced
neurological disabilities associated with EAE, suggesting a previously
unrealized neuroprotective role for MitoQ. MitoQ also significantly
reduced neuronal inflammation and demyelination, and increased and
preserved axons in EAE lesions, all of which support the possibility
that MitoQ treatment can protect demyelinated axons from additional
degeneration. The extent of axonal protection correlated with neurological scores from these groups supporting a critical contribution of axonal
damage to EAE-associated behavioral deficits.
MitoQ consists of a lipophilic cation, triphenylphosphonium, attached to ubiquinone by a saturated 10-carbon alkyl chain. Once inside
the mitochondria, ubiquinone is reduced to its active ubiquinol form
by Complex II [37–40]. Mechanistically, the lipophilic cation is attached
to antioxidants, such as vitamin E and coenzyme Q. These lipophilic
cations attached antioxidants were preferentially taken up by mitochondria due to a charge difference between mitochondria (with a negative charge) and lipophilic cation-based antioxidants (with a positive
charge). These antioxidants accumulate first in the cytoplasm of cells,
due to a negative plasma membrane potential. They later enter mitochondria and accumulate several hundred fold within the mitochondrial
matrix [40]. They then rapidly scavenge free radicals in the mitochondria
and protect mitochondria and cells from oxidative insults. It has been
shown that MitoQ has a protective role in animal and cell models of several human disease, including Parkinson's disease [41] and Alzheimer's
disease [18,42,43]. Our current study is the first to investigate the efficacy
of MitoQ in an experimental mouse model of MS.
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
2329
Fig. 5. MitoQ attenuated neurotoxicity induced by lipopolysaccharide-activated microglia. A. MTT assay. Cultured neurons with microglia (first bar, without lipopolysaccharide), with
lipopolysaccharide stimulated microglia (second bar), with lipopolysaccharide-stimulated microglia plus 40 nM MitoQ, pretreatment only (third bar), and with lipopolysaccharidestimulated microglia plus 40 nM MitoQ (fourth bar). Statistical analysis was done by one way ANOVA. MitoQ treatment (both pretreatment alone and continuous, P b 0.05) significantly
preserved neurons co-cultured with lipopolysaccharide-activated microglia. B. Representative images showing neuron–microglial co-cultures in different conditions, in phase contrast
light microscopy. Images show cultured neurons with microglia (BV2) without lipopolysaccharide stimulation (first column), with lipopolysaccharide (second column), and with lipopolysaccharide plus 40 ng mitoQ (third column). C. Tuj-1-positively stained neurons under different conditions. MitoQ continuous treatment reduced neuronal death induced by co-culture
with lipopolysaccharide-activated microglia.
It is important to determine a safe and tolerant dosage for experimental mouse models of MS and for humans with MS. To our knowledge, the longest-term animal study with MitoQ involved regularly
feeding rats (with cardiac ischemia–reperfusion injury) with drinking
water that contained a higher dose of MitoQ (500 μM) [44]. The subsequent study also treated 3xAD Tg. mice with MitoQ in drinking
water, but at 100 μM [43]. Similarly, Wani et al. [45] used MitoQ
at 100 μmol/kg (100 nmol/g) via an intragastric method for rats. These
MitoQ-treated animals exhibited beneficial effects, indicating that a dosage between 100–500 μM was safe and well-tolerated in drinking water.
The method of i.p. injection is a convenient way to deliver MitoQ in
many in vivo studies; however, we have found no reports using i.p. to
deliver MitoQ except for our current study. As mentioned in Methods,
we used MitoQ i.p. at100 nmol/mouse (~30 g), twice per week for several weeks in our in vivo EAE mouse study. We found the 100 nmole
dosage is safe and tolerable, and our EAE mice also exhibited robust
beneficial effects in terms of the reduction of inflammation and neuronal loss in their spinal cords.
The cause and the pathology of MS, especially triggers that lead
to axonal destruction, are still unclear. Axonal damage could result
from cytotoxic T lymphocytes or soluble inflammatory mediators
directly launching an immunologic attack on axons [46], or MSrelated axonal damage could be a secondary event to inflammatory
demyelination [47]. Genetic weakness, mitochondria dysfunction,
2330
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
oxidative stress, and ion imbalance may also play an important role
in MS pathogenesis [4].
Microglia are major source of ROS and inflammatory cytokines, as
mentioned above. Notably, ROS is required for the phagocytosis of
myelin by macrophages/microglia. Further, increased ROS has been
found to be a novel therapeutic strategy that results in reduced
neuroinflammation in MS [48,49]. Further, mitochondria are the main
source of ROS; hence, mitochondria-targeted antioxidants, such as
MitoQ, are promising candidates for the treatment of diseases involving
neuroinflammation, such as MS.
In the study reported here, MitoQ therapy reduced axonal degeneration in the EAE model, suggesting this axonal damage may be mechanistically related to oxidative damage found in the CNS of patients with
MS. Thus, in EAE and MS lesions, demyelinated axons, no matter their
cause, may become vulnerable to damage by such inflammatory mediators as proteolytic enzymes, cytokines, free radicals, and oxidative
products that result from activated immune and glial cells, as proposed
previously [50,51]. Therefore, a treatment that effectively changes this
inflammatory pathology may hold therapeutic promise for patients
with MS.
How does MitoQ protect axons from degeneration? Our previous
results [18] indicated that the addition of MitoQ in a cultured neuroblastoma cells that were treated with an amyloid beta peptide decreased
free radicals and increased the energy metabolism of neurons, ultimately leading to neuronal survival. In the current study, we also
found that MitoQ attenuated neuronal toxicity that was induced by
lipopolysaccharide-activated microglia, consistent with recent observations that mitochondrial dysfunction and energy failure may be a
cause of axonal degeneration in patients with MS [4,52,53]. However, increased mitochondrial content has been found in remyelinated axons
[54]. Thus, both pretreatment and treatment administration of MitoQ
could improve the local bioenergetics of the affected neurons in EAE
mice and protect axons from degeneration. Interestingly, some pathological cytokines, such as IL6 and infiltrated microglial cells, were found to
be decreased in the MitoQ treated EAE mice. In agreement with our
study, treatment of rats with MitoQ reduced IL6 and oxidative stress,
and improved mitochondrial function [55]. In light of ample evidence
suggesting that axonal degeneration could trigger responses of microglia
(and microphage) [56], axonal degeneration may lead to microglial infiltration and activation, which may also affect the extent of axonal loss in
EAE models.
Efforts have been made to research the possible neuroprotective
effects of a variety of agents, including cytokines, growth factors, and
blockers of voltage-gated sodium channels, in EAE models [50,51]. Our
current results suggest that MitoQ is a novel, potential therapy that
may protect against oxidative degeneration, thus preventing axonal
damage in EAE models and, ultimately, in patients with MS. The observed correlations between MitoQ and the increase in MBP levels, the
prevention of axonal and neuronal damage, and the alleviation of
behavioral deficits, in particular, may prevent the decline of ATP levels
in neuronal cells from degeneratively diseased animals [17,18,57]. Further, MitoQ may also confer a profound, protective effect on axonal
and neuronal degeneration in EAE models. Although we cannot
rule out other possibilities, the protective effects of MitoQ on neurons and other cells, perhaps, oligodendrocytes, reflect the influence of
different oxidant–ATP levels resulting from MitoQ treatment. The extent
of this influence may relate to the sensitivities that neurons and nonneuronal cells may have to the cellular ATP levels.
MitoQ can readily cross the blood–brain barrier, and plasma and
mitochondria membranes [17], making MitoQ additionally attractive
as a promising neuroprotective treatment for patients with MS. Further,
we found that MitoQ regulates some key inflammatory-associated
genes, including NOS in the CNS of EAE mice. Better understanding
the homeostatic regulation of neuronal oxidant–ATP levels may allow
us to design ways to further enhance the protective effects of MitoQ
for EAE, MS, and other diseases associated with axonal degeneration.
Acknowledgments
This research was supported by NIH grants AG028072, AG042178,
and RR000163, and a grant from the Vertex Pharmaceuticals. We also
sincerely thank Dr. Mike Murphy for his generous gift of MitoQ for our
study.
References
[1] S.G. Waxman, Membranes, myelin, and the pathophysiology of multiple sclerosis,
N. Engl. J. Med. 306 (1982) 1529–1533.
[2] B.M. Keegan, J.H. Noseworthy, Multiple sclerosis, Annu. Rev. Med. (U.S.) 53 (2002)
285–302.
[3] B.D. Trapp, K.A. Nave, Multiple sclerosis: An immune or neurodegenerative disorder? Annu Rev Neurosci (United States) 31 (2008) 247–269.
[4] P. Mao, P.H. Reddy, Is multiple sclerosis a mitochondrial disease? Biochim. Biophys.
Acta 1802 (2010) 66–79.
[5] T.F. Runia, E.D. van Pelt-Gravesteijn, R.Q. Hintzen, Recent gains in clinical multiple
sclerosis research review, CNS Neurol. Disord. Drug Targets 11 (2012) 497–505.
[6] L. Steinman, R. Martin, C. Bernard, P. Conlon, J.R. Oksenberg, Multiple sclerosis:
deeper understanding of its pathogenesis reveals new targets for therapy, Annu.
Rev. Neurosci. 25 (2002) 491–505.
[7] L. Bo, C.A. Vedeler, H.I. Nyland, B.D. Trapp, S.J. Mork SJ, Subpial demyelination in the
cerebral cortex of multiple sclerosis patients, J. Neuropathol. Exp. Neurol. 62 (2003)
723–732.
[8] A. Kutzelnigg, C.F. Lucchinetti, C. Stadelmann, W. Bruck, H. Rauschka, M. Bergmann,
M. Schmidbauer, J.E. Parisi, H. Lassmann, Cortical demyelination and diffuse white
matter injury in multiple sclerosis, Brain 128 (2005) 2705–2712.
[9] M. Vercellino, F. Plano, B. Votta, R. Mutani, M.T. Giordana, P. Cavalla, Grey matter
pathology in multiple sclerosis, J. Neuropathol. Exp. Neurol. 64 (2005) 1101–1107.
[10] D. Chard, D. Miller, Grey matter pathology in clinically early multiple sclerosis:
evidence from magnetic resonance imaging, J. Neurol. Sci. 282 (2009) 5–11.
[11] J.W. Peterson, L. Bo, S. Mork, A. Chang, B.D. Trapp, Transected neurites, apoptotic
neurons, and reduced inflammation in cortical multiple sclerosis lesions, Ann. Neurol.
50 (2001) 389–400.
[12] C.A. Colton, D.L. Gilbert Microglia, An in vivo source of reactive oxygen species in the
brain, Adv. Neurol. 59 (1993) 321–326.
[13] L. Meda, M.A. Cassatella, G.I. Szendrei, L. Otvos Jr., P. Baron, M. Villalba, D. Ferrari, F.
Rossi, Activation of microglial cells by beta-amyloid protein and interferon-gamma,
Nature 374 (1995) 647–650.
[14] L. Haider, M.T. Fischer, J.M. Frischer, J. Bauer, R. Hoftberger, G. Botond, H. Esterbaue,
C.J. Binder, J.L. Witztum, H. Lassmann, Oxidative damage in multiple sclerosis lesions,
Brain 134 (2011) 1914–1924.
[15] K.G. Su, C. Savino, G. Marracci, P. Chaudhary, X. Yu, B. Morris, D. Galipeau, M. Giorgio, M.
Forte, D. Bourdette, Genetic inactivation of the p66 isoform of ShcA is neuroprotective
in a murine model of multiple sclerosis, Eur. J. Neurosci. 35 (2012) 562–571.
[16] R. Gold, B.C. Kieseier, Therapy of immune neuropathies with intravenous immunoglobulins, J. Neurol. 253 (Suppl. 5) (2006) V59–V63.
[17] R.A. Smith, M.P. Murphy, Animal and human studies with the mitochondriatargeted antioxidant MitoQ, Ann. N. Y. Acad. Sci. 1201 (2010) 96–103.
[18] M. Manczak, P. Mao, M.J. Calkins, A. Cornea, A.P. Reddy, M.P. Murphy, H.H. Szeto, B.
Park, P.H. Reddy, Mitochondria-targeted antioxidants protect against amyloid-beta
toxicity in Alzheimer's disease neurons, J. Alzheimers Dis. 20 (Suppl. 2) (2010)
S609–S631.
[19] S. Rodriguez-Cuenca, H.M. Cocheme, A. Logan, I. Abakumova, T.A. Prime, C. Rose, A.
Vidal-Puig, A.C. Smith, D.C. Rubinsztein, I.M. Fearnley, B.A. Jones, S. Pope, S.J. Heales,
B.Y. Lam, S.G. Neogi, I. McFarlane, A.M. James, R.A. Smith, M.P. Murphy, Consequences of long-term oral administration of the mitochondria-targeted antioxidant
MitoQ to wild-type mice, Free Radic. Biol. Med. 48 (2010) 161–172.
[20] S. Pluchino, A. Quattrini, E. Brambilla, A. Gritti, G. Salani, G. Dina, R. Galli, U. Del Carro,
S. Amadio, A. Bergami, R. Furlan, G. Comi, A.L. Vescovi, G. Martino, Injection of adult
neurospheres induces recovery in a chronic model of multiple sclerosis, Nature 422
(2003) 688–694.
[21] S. Kaneko, J. Wang, M. Kaneko, G. Yiu, J.M. Hurrell, T. Chitnis, S.J. Khoury, Z. He,
Protecting axonal degeneration by increasing nicotinamide adenine dinucleotide
levels in experimental autoimmune encephalomyelitis models, J. Neurosci. 26 (2006)
9794–9804.
[22] M. Manczak, P. Mao, K. Nakamura, C. Bebbington, B. Park, P.H. Reddy, Neutralization
of granulocyte macrophage colony-stimulating factor decreases amyloid beta 1-42
and suppresses microglial activity in a transgenic mouse model of Alzheimer's
disease, Hum. Mol. Genet. 18 (2009) 3876–3893.
[23] T.P. Reddy, M. Manczak, M.J. Calkins, P. Mao, A.P. Reddy, U. Shirendeb, B. Park,
P.H. Reddy, Toxicity of neurons treated with herbicides and neuroprotection
by mitochondria-targeted antioxidant SS31, Int. J. Environ. Res. Public Health 8
(2011) 203–221.
[24] P.H. Reddy, M. Manczak, W. Zhao, K. Nakamura, C. Bebbington, G. Yarranton, P. Mao,
Granulocyte–macrophage colony-stimulating factor antibody suppresses microglial
activity: Implications for anti-inflammatory effects in alzheimer's disease and multiple
sclerosis, J. Neurochem. 111 (2009) 1514–1528.
[25] P. Mao, Y.X. Tao, M. Fukaya, F. Tao, D. Li, M. Watanabe, R.A. Johns, Cloning and characterization of E-dlg, a novel splice variant of mouse homologue of the drosophila
discs large tumor suppressor binds preferentially to SAP102, IUBMB Life 60 (2008)
684–692.
P. Mao et al. / Biochimica et Biophysica Acta 1832 (2013) 2322–2331
[26] M.J. Calkins, P.H. Reddy, Assessment of newly synthesized mitochondrial DNA using
BrdU labeling in primary neurons from Alzheimer's disease mice: Implications for
impaired mitochondrial biogenesis and synaptic damage, Biochim. Biophys. Acta
1812 (2011) 1182–1189.
[27] A. Kalyvas, S. David, Cytosolic phospholipase A2 plays a key role in the pathogenesis
of multiple sclerosis-like disease, Neuron 41 (2004) 323–335.
[28] O. Aktas, A. Smorodchenko, S. Brocke, C. Infante-Duarte, U. Schulze Topphoff, J. Vogt,
T. Prozorovski, S. Meier, V. Osmanova, E. Pohl, I. Bechmann, R. Nitsch, F. Zipp,
Neuronal damage in autoimmune neuroinflammation mediated by the death ligand
TRAIL, Neuron 46 (2005) 421–432.
[29] K. Ishihara, T. Hirano, IL-6 in autoimmune disease and chronic inflammatory proliferative disease, Cytokine Growth Factor Rev. 13 (2002) 357–368.
[30] H.P. Eugster, K. Frei, M. Kopf, H. Lassmann, A. Fontana, IL-6-deficient mice resist
myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis,
Eur. J. Immunol. 28 (7) (Jul 1998) 2178–2187.
[31] Y. Okuda, S. Sakoda, H. Fujimura, Y. Saeki, T. Kishimoto, T. Yanagihara, IL-6 plays a
crucial role in the induction phase of myelin oligodendrocyte glucoprotein 35–55
induced experimental autoimmune encephalomyelitis, J. Neuroimmunol. 101 (2)
(Nov 15 1999) 188–196.
[32] M. Giralt, R. Ramos, A. Quintana, B. Ferrer, M. Erta, M. Castro-Freire, G. Comes, E.
Sanz, M. Unzeta, P. Pifarré, A. García, I.L. Campbell, J. Hidalgo, Induction of atypical
EAE mediated by transgenic production of IL-6 in astrocytes in the absence of
systemic IL-6, Glia 61 (4) (Apr 2013) 587–600.
[33] W. Wei, C. Du, J. Lv, G. Zhao, Z. Li, Z. Wu, G. Haskó, X. Xie, Blocking A2B adenosine
receptor alleviates pathogenesis of experimental autoimmune encephalomyelitis
via inhibition of IL-6 production and Th17 differentiation, J. Immunol. 190 (1) (Jan 1
2013) 138–146.
[34] M. Onuki, M.M. Ayers, C.C. Bernard, J.M. Orian, Axonal degeneration is an early pathological feature in autoimmune-mediated demyelination in mice, Microsc. Res.
Tech. 52 (2001) 731–739.
[35] T. Karnezis, W. Mandemakers, J.L. McQualter, B. Zheng, P.P. Ho, K.A. Jordan, B.M.
Murray, B. Barres, M. Tessier-Lavign, C.C. Bernard, The neurite outgrowth inhibitor
nogo A is involved in autoimmune-mediated demyelination, Nat. Neurosci. 7 (2004)
736–744.
[36] S. Lehnardt, L. Massillon, P. Follett, F.E. Jensen, R. Ratan, P.A. Rosenberg, J.J. Volpe, T.
Vartanian, Activation of innate immunity in the CNS triggers neurodegeneration
through a toll-like receptor 4-dependent pathway, Proc. Natl. Acad. Sci. U. S. A.
100 (2003) 8514–8519.
[37] R.A. Smith, C.M. Porteous, C.V. Coulter, M.P. Murphy, Selective targeting of an antioxidant to mitochondria, Eur. J. Biochem. 263 (1999) 709–716.
[38] A.M. James, M.S. Sharpley, A.R. Manas, F.E. Frerman, J. Hirst, R.A. Smith, M.P.
Murphy, Interaction of the mitochondria-targeted antioxidant MitoQ with
phospholipid bilayers and ubiquinone oxidoreductases, J. Biol. Chem. 282
(2007) 14708–14718.
[39] P.H. Reddy, Mitochondrial oxidative damage in aging and Alzheimer's disease:
implications for mitochondrially targeted antioxidant therapeutics, J. Biomed.
Biotechnol. 2006 (2006) 31372.
[40] P.H. Reddy, R. Tripathi, Q. Troung, K. Tirumala, T.P. Reddy, V. Anekonda, U.P.
Shirendeb, M.J. Calkins, A.P. Reddy, P. Mao, M. Manczak, Abnormal mitochondrial
dynamics and synaptic degeneration as early events in Alzheimer's disease: implications to mitochondria-targeted antioxidant therapeutics, Biochim. Biophys. Acta 1822
(2012) 639–649.
2331
[41] M.E. Solesio, T.A. Prime, A. Logan, M.P. Murphy, M. Del Mar Arroyo-Jimenez, J.
Jordán, M.F. Galindo, The mitochondria-targeted anti-oxidant MitoQ reduces aspects of mitochondrial fission in the 6-OHDA cell model of Parkinson's disease,
Biochim. Biophys. Acta 1832 (2013) 174–182.
[42] T. Ma, C.A. Hoeffer, H. Wong, C.A. Massaad, P. Zhou, I.C. Adecola, M.P. Murphy, R.G.
Pautler, E. Klann, Amyloid β-induced impairments in hippocampal synaptic plasticity are rescued by decreasing mitochondrial superoxide, J. Neurosci. 31 (2011)
5589–5595.
[43] M.J. McManus, M.P. Murphy, J.L. Franklin, The mitochondria-targeted antioxidant
MitoQ prevents loss of spatial memory retention and early neuropathology in a transgenic mouse model of Alzheimer's disease, J. Neurosci. 31 (2011) 15703–15715.
[44] V.J. Adlam, J.C. Harrison, C.M. Porteous, A.M. James, R.A. Smith, M.P. Murphy, I.A.
Sammut, Targeting an antioxidant to mitochondria decreases cardiac ischemiareperfusion injury, FASEB J. 19 (2005) 1088–1095.
[45] W.Y. Wani, S. Gudup, A. Sunkaria, A. Bal, P.P. Singh, R.J. Kandimalla, D.R. Sharma, K.D.
Gill, Protective efficacy of mitochondrial targeted antioxidant MitoQ against dichlorvos induced oxidative stress and cell death in rat brain, Neuropharmacology 61
(2011) 1193–1201.
[46] H. Neumann, I.M. Medana, J. Bauer, H. Lassmann, Cytotoxic T lymphocytes in autoimmune and degenerative CNS diseases, Trends Neurosci. 25 (2002) 313–319.
[47] L. Steinman, Multiple sclerosis: a two-stage disease, Nat. Immunol. 2 (2001)
762–764.
[48] A. van der Goes, J. Brouwer, K. Hoekstra, D. Roos, T.K. van den Berg, C.D. Dijkstra,
Reactive oxygen species are required for the phagocytosis of myelin by macrophages,
J. Neuroimmunol. 92 (1998) 67–75.
[49] Y. Liu, W. Hao, M. Letiembre, S. Walter, M. Kulanga, H. Neumann, K. Fassbender,
Suppression of microglial inflammatory activity by myelin phagocytosis: role of
p47-PHOX-mediated generation of reactive oxygen species, J. Neurosci. 26 (2006)
12904–12913.
[50] P.K. Stys, General mechanisms of axonal damage and its prevention, J. Neurol. Sci.
233 (2005) 3–13.
[51] S.G. Waxman, Sodium channel blockers and axonal protection in neuroinflammatory
disease, Brain 128 (2005) 5–6.
[52] R. Dutta, J. McDonough, X. Yin, J. Peterson, A. Chang, T. Torres, T. Gudz, W.B. Macklin,
D.A. Lewis, R.J. Fox, R. Rudick, K. Mirnics, B.D. Trapp, Mitochondrial dysfunction as a
cause of axonal degeneration in multiple sclerosis patients, Ann. Neurol. 59 (2006)
478–489.
[53] D.J. Mahad, I. Ziabreva, G. Campbell, N. Lax, K. White, P.S. Hanson, H. Lassmann, D.M.
Turnbull, Mitochondrial changes within axons in multiple sclerosis, Brain 132 (2009)
1161–1174.
[54] J.L. Zambonin, C. Zhao, N. Ohno, G.R. Campbell, S. Engeham, I. Ziabreva, N. Schwarz,
S.E. Lee, J.M. Frischer, D.M. Turnbull, B.D. Trapp, H. Lassmann, R.J. Franklin, D.J.
Mahad, Increased mitochondrial content in remyelinated axons: Implications for
multiple sclerosis, Brain 134 (2011) 1901–1913.
[55] D.A. Lowes, N.R. Webster, M.P. Murphy, H.F. Galley, Antioxidants that protect mitochondria reduce interleukin-6 and oxidative stress, improve mitochondrial function,
and reduce biochemical markers of organ dysfunction in a rat model of acute sepsis,
Br. J. Anaesth. 110 (2013) 472–480.
[56] R. George, J.W. Griffin, The proximo-distal spread of axonal degeneration in the
dorsal columns of the rat, J. Neurocytol. 23 (1994) 657–667.
[57] R.K. Chaturvedi, M.F. Beal, Mitochondrial approaches for neuroprotection, Ann. N. Y.
Acad. Sci. 1147 (2008) 395–412.