Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 1. Chlorophyll content in shoots of auxin signaling mutants. Chlorophyll contents in shoots of 14-day-old wild-type Col and auxin signaling mutants, msg2-1, slr-1, and arf7 arf19, were determined as described in Methods. There were no significant differences between Col and these mutants. Values are the means ± SD (n > 3). 1 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 2. Chlorophyll accumulation in the stele of the primary root. (A) Fluorescence from GFP (green) and chlorophyll (red) was detected in the primary root of 14-day-old SCRpro:GFP seedlings at 1.0~6.0 cm from the root-hypocotyl junction by a confocal laser scanning microscope (LSM700; Carl Zeiss). The laser intensity and detection gain of microscopes was fixed during a series of the analyses to compare fluorescence intensity among different samples. (B) Images for both GFP and chlorophyll fluorescence in SCRpro:GFP roots were maximally enhanced by a software program (ZEN 2009; Carl Zeiss) and merged with differential interference contrast images (Merged image). Bars = 100 μm. 2 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 3. Promoter activities of IAA14, SHR, and SCR in the mature root. Promoter activities of IAA14, SHR, and SCR were observed in roots of 8-day-old and 14-day-old seedlings. Promoter activities of IAA14 and SHR were detected histochemically by GUS staining in transgenic lines carrying the IAA14pro:GUS (Fukaki et al., 2002) and SHRpro:GUS constructs (Helariutta et al., 2000), respectively, while those of SCR were detected in a GUS enhancer trap line (End199) in which GUS activity represents SCR expression (Di Laurenzio et al., 1996; Malamy and Benfey, 1997). An inset shows GUS staining in the mature primary root region of the 14-day-old IAA14pro:GUS seedling. Bars = 1.0 mm (0.1 mm for the inset). GUS staining was performed as described (Fukaki et al., 2002). 3 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 4. Chlorophyll autofluorescence in roots expressing the stabilized mutant IAA14 protein. Mutant IAA14 protein (mIAA14) was expressed in 21-day-old seedlings via the indicated promoter in the absence (–) or presence (+) of 1 μM dexamethasone (DEX). Intact roots at approximately 2.0 cm from the root-hypocotyl junction of each transgenic plant were examined using a confocal laser scanning microscope (LSM 510; Carl Zeiss). Merged images represent fluorescent micrographs merged with optical images. Bars = 200 μm. 4 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 5. Spatial images of maximum quantum yield (Fv/Fm) in roots. Twenty-one-day-old seedlings of wild-type Col, slr-1, ahk2 ahk3, and hy5-215 were used for the assay. Wild-type seedlings were grown for 7 days in the absence (Col) or presence (Col + BA) of 1 μM 6-benzyladenine before the assay. Detached roots on agar plates were placed in a fluorescence imaging system (FluorCam 800MF, Photon System Instruments) and exposed to actinic light for 5 s (Electronic shutter = 8, sensitivity = 25, and irradiance = 75) following dark adaptation for 5 min. The image of maximum quantum yield shown in (B) was obtained by monitoring Chl fluorescence using software (FluoWin 3.6, Photon System Instruments). The figure in (A) shows a merged image with the image of maximum quantum yield (B) and the photograph of the roots captured by a digital camera (C). 5 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Figure 6. Plastid distribution in the primary root of wild type and slr-1. (A) A cross-section of the primary root of 21-day-old wild-type Col at 4 cm from the root-hypocotyl junction was observed by transmission electron microscopy. Plastid development was undetectable in outer vacuolated cells. (B) Plastids with thylakoid membranes are indicated by arrowheads in the Col root shown in (A). (C) Plastid distribution in the primary root of 21-day-old slr-1 was observed at the same region as that in the Col root in (B). Bars =10 μm. 6 Supplemental Data. Kobayashi et al. (2012). Plant Cell 10.1105/tpc.111.092254 Supplemental Table 1. Oligonucleotide primers used in this study Gene Forward Primer (5'→3') Reverse Primer (5'→3') Use ACTIN8 ACTGTGCCTATCTACGAGGGTTTC CCCGTTCTGCTGTTGTGGT qRT-PCR HEMA1 TAAGATTAGCTTCCCCACAAACTC AGCTCGCTTATAGCTTCACAACAC qRT-PCR CHLH TGGTAGAGAGACAGAAGCTCGAAA CCAAAGAACCTGCCCAAGAG qRT-PCR CHL27 TCAAGACCGATTACAACCAGACA CGCTCAAGGAACTCAACGAAG qRT-PCR CHLP ACCAGAAACAGAGCTAAGGACAAGA GCATCACCTACAAGAGCCACAC qRT-PCR GLK1 AAGGGAAGAGAAAGGTGAAGGTG GTTGTGACGAGTGAGACAATGGA qRT-PCR GLK2 TAGCGGAAGAGATGAGGAACAAG TAAAACCACCGTCACCACCA qRT-PCR LHCA4 AACCCGCTTAACTTTGCTCCTAC CAAACCCTAAGAATGCCAACATC qRT-PCR LHCB4 CCACTCCACACCACCATCA CAAACAAGCAAAAGCCCAAAG qRT-PCR 7
© Copyright 2026 Paperzz