Plant Cell Physiol. 47(7): 926–934 (2006)
doi:10.1093/pcp/pcj065, available online at www.pcp.oxfordjournals.org
ß The Author 2006. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
All rights reserved. For permissions, please email: [email protected]
Cloning, Expression and Characterization of a Nudix Hydrolase that
Catalyzes the Hydrolytic Breakdown of ADP-glucose Linked to
Starch Biosynthesis in Arabidopsis thaliana
Francisco José Muñoz 1, *, Edurne Baroja-Fernández 1, Marı́a Teresa Morán-Zorzano, Nora Alonso-Casajús
and Javier Pozueta-Romero *
Instituto de Agrobiotecnologı´a, Universidad Pública de Navarra/Consejo Superior de Investigaciones Cientı´ficas/Gobierno de Navarra, Ctra.
Mutilva s/n, 31192 Mutilva Baja, Navarra, Spain
The nucleotide sequences of AtASPP and StASPP
encoding cDNAs have been submitted to EMBL database
under accession numbers AJ748742 and AM180509,
respectively.
‘Nudix’ hydrolases are widely distributed nucleotide
pyrophosphatases
that
possess
a
conserved
GX5EX7REUXEEXGU motif where U is usually isoleucine,
leucine or valine. Among them, Escherichia coli ADP-sugar
pyrophosphatase (ASPP) has been shown to catalyze the
hydrolytic breakdown of ADP-glucose linked to bacterial
glycogen biosynthesis. Comparisons of the 31 different
Nudix-encoding sequences of the Arabidopsis genome with
those coding for known bacterial and mammalian ASPPs
identified one sequence possessing important divergences in
the Nudix motif that, once expressed in E. coli, produced a
protein with ASPP activity. This protein, designated as
AtASPP, shares strong homology with hypothetical rice and
potato proteins, indicating that ASPPs are widely distributed
in both mono- and dicotyledonous plants. As a first step to
test the possible involvement of plant ASPPs in regulating
the intracellular levels of ADP-glucose linked to starch
biosynthesis, we produced and characterized AtASPPoverexpressing Arabidopsis plants. Source leaves from these
plants exhibited a large reduction in the levels of both ADPglucose and starch, indicating that plant ASPPs catalyze the
hydrolytic breakdown of a sizable pool of ADP-glucose linked
to starch biosynthesis. No pleiotropic changes in maximum
catalytic activities of enzymes closely linked to starch
metabolism could be detected in AtASPP-overexpressing
leaves. The overall information provides the first evidence for
the existence of plant Nudix hydrolases that have access
to an intracellular pool of ADP-glucose linked to starch
biosynthesis.
Introduction
The Nudix hydrolases constitute a family of metalrequiring phosphoanhydrases that catalyze the hydrolytic
breakdown of Nucleoside diphosphates linked to some
other moiety such as a phosphate, sugar or nucleoside
(Bessman et al. 1996). They are characterized by the
following conserved array of 23 amino acids,
GX5EX7REUXEEXGU, where U represents a bulky,
hydrophobic amino acid (usually isoleucine, leucine or
valine). Nudix hydrolases are widely distributed among
organisms ranging from viruses to mammals, and have been
suggested to act as ‘housekeeping’ enzymes that prevent
accumulation of reactive nucleoside diphosphate derivatives, cell signaling molecules or metabolic intermediates by
diverting them to metabolic pathways in response to
biochemical and physiological needs (Bessman et al. 1996,
Jambunhathan and Mahalingam 2005). Compared with
mammalian cells and bacteria, little is known about the
functions of Nudix hydrolases in plants.
During the course of our investigations on bacterial
glycogen metabolism we identified a bacterial Nudix
hydrolase, designated as adenosine diphosphate sugar
pyrophosphatase (ASPP), that cleaves ADP-sugars such
as ADP-ribose, ADP-mannose and the precursor molecule
for glycogen biosynthesis, ADP-glucose (Moreno-Bruna
et al. 2001). Changes in ASPP activity were accompanied by
changes in bacterial glycogen accumulation, strongly
indicating that ASPP controls intracellular levels of ADPglucose linked to the glycogen biosynthetic process in
Escherichia coli.
Keywordss: Arabidopsis thaliana — Carbohydrate metabolism — Nudix hydrolase — Solanum tuberosum —
Starch.
Abbreviations: ASPP, adenosine diphosphate sugar
pyrophosphatase; AtASPP, Arabidopsis thaliana ASPP; StASPP,
Solanum tuberosum ASPP; WT, wild type.
1
These authors contributed equally to this work.
* Corresponding authors: Javier Pozueta-Romero, E-mail, [email protected]; Fax, þ34-948232191; Francisco José Muñoz,
E-mail, [email protected]; Fax, þ34-948232191.
926
Plant ASPPs and starch biosynthesis
Rodrı́guez-López et al. (2000) reported the occurrence
in plants of a widely distributed ADP-glucose hydrolytic
activity whose pattern showed an inverse correlation with
respect to starch accumulation. This activity is catalyzed
by protein entities displaying different properties and
subcellular localizations (Baroja-Fernández et al. 2000,
Rodrı́guez-López et al. 2000). As a first step to test whether
a part of this activity is catalyzed by a Nudix hydrolase, we
have identified, cloned and expressed in E. coli sequences of
plant genomes that code for proteins sharing homology
with ASPPs occurring in both prokaryotic and mammalian
cells. In addition, we have produced and characterized
ASPP-overexpressing transgenic plants. We discuss the
possible involvement of plant ASPPs in controlling the
intracellular levels of ADP-glucose linked to starch biosynthesis and in connecting starch metabolism with other
metabolic pathways in response to biochemical needs.
Results and Discussion
Identification of a putative ASPP encoding Nudix genes from
Arabidopsis
Searches in the InterPro database (http://www.ebi.ac.
uk/interpro) revealed the existence of at least 31 different
sequences that code for Nudix hydrolases in the Arabidopsis
genome. As shown in Supplementary Table 1, most of these
sequences code for proteins of as yet unknown functions.
To identify which sequence(s) code for proteins with ASPP
activity, we compared them with ASPP-encoding Nudix
genes from bacterial and mammalian species (Dunn et al.
1999, Gasmi et al. 1999, Yang et al. 2000, Moreno-Bruna
et al. 2001). This analysis allowed us to identify
four sequences (At2g42070, At4g11980, At1g68760 and
At5g20070) sharing significant homology with the aforementioned ASPP-encoding genes (Supplementary Fig. 1).
At4g11980 codes for an ADP-glucose hydrolase
Complete At4g11980, At1g68760 and At5g20070
cDNAs available in the RIKEN Arabidopsis collection
were expressed in E. coli as described in Materials and
Methods. Purification and SDS–PAGE of the recombinant
proteins resulted in single bands that were not detectable in
extracts from control bacterial cells (not shown). The sizes
of the recombinant proteins purified from bacterial cells
transformed with pET-At4g11980, pET-At1g68760 and
pET-At5g20070 were approximately 38, 20 and 52 kDa,
respectively, which roughly correspond to the molecular
mass predicted from their amino acid sequences.
Recombinant proteins encoded by At4g11980,
At1g68760 and At5g20070 were tested for their hydrolytic
activity against ADP-glucose in the presence of 5 mM
Mg2þ. These analyses revealed that only the At4g11980
Table 1
927
Substrate specificity of AtASPP and StASPP
Substrate
Substrate specificity
(% activity relative to
ADP-glucose)
AtASPP
ADP-glucose
ADP-ribose
ADP-mannose
CDP-glucose
GDP-glucose
UDP-glucose
UDP-galactose
NADþ
NADPþ
AMP
NDP
NTP
Ap3A
Ap4A
CoA
Bis-p-nitrophenyl phosphate
p-nitrophenyl phosphate
100
256
29
51
51
1.7
51
51
51
51
51
51
51
51
51
51
51
StASPP
100
152
Not determined
51
51
7.1
51
51
51
51
51
51
51
51
51
51
51
The reaction mixture contained 50 mM HEPES, pH 7, 5 mM
MgCl2, 2 mM of the indicated compound and recombinant plant
ASPP. After 30 min of incubation at 378C, the reaction was
stopped by boiling in a dry bath for 2 min. The resulting products
were then measured as described by Moreno-Bruna et al. (2001)
and Rodrı́guez-López et al. (2000). Ap3A, adenosine(50 )triphospho
(50 )adenosine. Ap4A, adenosine(50 )tetraphospho(50 )adenosine.
product, also designated as AtNUDT14 (Ogawa et al.
2005), was capable of hydrolyzing ADP-glucose.
Substrate specificity of the recombinant protein encoded by
At4g11980
The substrate specificity of the purified At4g11980encoded recombinant protein was tested using a wide range
of compounds at a concentration of 2 mM. The protein,
designated as AtASPP, recognized ADP-sugars such as
ADP-glucose, ADP-mannose and ADP-ribose, and poorly
hydrolyzed other nucleotide-sugars such as UDP-glucose,
CDP-glucose, GDP-glucose and UDP-galactose (Table 1).
AtASPP does not recognize PPi, synthetic phosphodiester
bond-containing compounds such as bis-p-nitrophenyl
phosphate, diadenosine polyphosphates, CoA or phosphomonoester
bond-containing
compounds
such
as
p-nitrophenyl phosphate, sugar-phosphates and nucleotide
mono-, di- and triphosphates.
Properties of AtASPP
The catalytic properties of AtASPP were studied on
ADP-glucose, ADP-ribose and ADP-mannose. ADP-ribose
Plant ASPPs and starch biosynthesis
ASPPs are widely distributed in mono- and dicotyledonous
plants
Computer searches of databanks showed that
AtASPP shares high sequence similarity with Q9SNS9 and
POADP80, two ‘hypothetical’ proteins from rice and
potato, respectively (Supplementary Fig. 3). A POADP80
cDNA was isolated and expressed in E. coli to produce a
recombinant protein designated as StASPP. Analyses of
glycogen content in these cells revealed that StASPP
expression leads to a glycogen-less phenotype (Fig. 1),
thus providing the first indication that StASPP catalyzes the
hydrolytic breakdown of ADP-glucose. In agreement with
this presumption, substrate specificity analyses revealed that
StASPP cleaves ADP-glucose and displays both a substrate
recognition pattern and kinetic behavior with respect to
ADP-glucose similar to AtASPP (Table 1, Supplementary
Fig. 2). The overall information thus indicates that Nudix
hydrolases with ASPP activity are widely distributed in both
mono- and dicotyledonous species.
Structural divergences of the Nudix signature sequence of
plant ASPPs
Nudix hydrolases comprise a large family of proteins
that are defined by the GX5EX7REUXEEXGU motif,
where U is usually isoleucine, leucine or valine. Although
this highly conserved Nudix motif has been shown to be
essential for the metal binding and pyrophosphatase activity
(Gabelli et al. 2001), there are numerous examples of nonconsensus motifs among the Nudix hydrolases, including
extra amino acids and missing glutamate or glycine residues
(O’Handley et al. 1998, Yagi et al. 2003). As shown in
Fig. 2, AtASPP, StASPP and rice Q9SNS9 contain
A
ADP-glucose hydrolytic activity
(mU/mg protein)
and ADP-mannose concentration curves followed a typical
Michaelis–Menten pattern (not shown) whereas, similar to
other enzymes displaying atypical kinetic behavior (Yu
et al. 1988), ADP-glucose kinetics displayed a non-saturable
pattern (Supplementary Fig. 2). Km and Vmax values
for ADP-ribose were 42.8 mM and 0.71 U mg1 protein,
respectively, whereas Km and Vmax values for
ADP-mannose were 130 mM and 0.32 U mg1 protein,
respectively.
When subjected to gel filtration chromatography,
AtASPP appeared as a symmetrical peak in a region
expected for a protein of approximately 70–75 kDa. Taking
into account that AtASPP migrates as an approximately
38 kDa protein in SDS–PAGE, it is quite possible that the
native enzyme occurs as a homodimer. In this respect, we
must emphasize that a common feature of other ASPPs is
the formation of homodimers (Gasmi et al. 1999, Yang
et al. 2000, Moreno-Bruna et al. 2001) that are required for
substrate recognition and catalytic activity (Gabelli et al.
2001).
300
250
200
150
100
50
0
B
pET
pET-StASPP
pET
pET-StASPP
45
40
Glycogen
(µg glucose/mg protein)
928
35
30
25
20
15
10
5
0
Fig. 1 ADP-glucose hydrolytic activities and glycogen levels of
BL21(DE3) cells transformed with either pET or pET-StASPP. Results
are given as mean SEM.
Fig. 2 Structural divergences of the Nudix signature sequence of
plant ASPPs. Partial sequence alignment of the Nudix signature of
ASPP proteins. The conserved Nudix box is in bold.
important modifications in the Nudix motif, including an
extra amino acid, and the substitution of the conserved
glutamate at position 7 by lysine or glutamine. These
differences are not responsible for the specific recognition of
ADP-sugars, since they are not present in bacterial and
mammalian ASPPs, and strengthen the view that the
specificity for individual substrates lies outside the Nudix
motif (Gabelli et al. 2001).
2000
A
929
0.45
1800
0.40
1600
ADP-glucose (nmol/g FW)
ADP-glucose hydrolytic activity (mU/g FW)
Plant ASPPs and starch biosynthesis
1400
1200
1000
800
600
400
200
0
WT
8
5
3
0.25
0.20
0.15
0.10
0.00
35S-AtASPP-NOS lines
WT
8
5
3
7
35S-AtASPP-NOS lines
B
Starch (nmol glucose/g FW)
AtASPP overexpression leads to a large reduction of both
ADP-glucose and transitory starch levels in leaves
Arabidopsis plants were transformed with 35SAtASPP-NOS
via
Agrobacterium-mediated
gene
transfer. We then compared ADP-glucose hydrolytic
activities in leaves of AtASPP-overexpressing plants with
those of wild-type (WT) plants. As illustrated in Fig. 3,
ADP-glucose hydrolytic activities in each of the AtASPPoverexpressing lines were several fold higher than
those occurring in the control plants. At no stage during
development
could
we
detect
any
phenotypic
difference between the 35S-AtASPP-NOS and the control
plants (not shown). No significant differences were
observed in protein and chlorophyll contents, dry
weight, plant height, flowering time, and leaf number or
size between 35S-AtASPP-NOS and control plants
(not shown).
Leaves from control and AtASPP-overexpressing
plants were then characterized for their ADP-glucose and
starch contents after 7 h of illumination. As it is our
experience that biochemical analyses are subject to considerable variation, we analyzed 10 plants per line to obtain
reliable data. As illustrated in Fig. 4A, leaves from 35SAtASPP-NOS plants showed an approximately 50%
reduction of ADP-glucose content. Most significantly,
AtASPP overexpression leads to about 60–70% reduction
of the starch content (Fig. 4B). The overall data thus
indicate that AtASPP has access to an intracellular pool of
ADP-glucose linked to starch biosynthesis. The fact that
irrespective of the ADP-glucose hydrolytic activity ADPglucose content is nearly the same in every line tested is
consistent with a previoius report pointing to the occurrence
of different subcellular localizations of ADP-glucose
(Baroja-Fernández et al. 2004).
0.30
0.05
7
Fig. 3 ADP-glucose hydrolytic activity in source leaves of WT
and 35S-AtASPP-NOS plants. Results are given as mean SEM of
10 independent plants per line.
0.35
1600
1400
1200
1000
800
600
400
200
0
WT
8
5
3
7
35S-AtASPP-NOS lines
Fig. 4 Plant ASPPs have access to an intracellular pool of
ADP-glucose linked to starch biosynthesis in Arabidopsis leaves.
ADP-glucose and starch levels in source leaves from 6-week-old
WT and AtASPP-overexpressing Arabidopsis plants. Leaf samples
were taken and quenched in liquid nitrogen at 7 h after the
beginning of the light period. Results are given as mean SEM of
10 independent plants per line.
Measurement of key enzymes of sucrose and starch
metabolism
Starch-deficient Arabidopsis mutants exhibit large
changes in activities of enzymes involved in sucrose and
starch metabolism (Caspar et al. 1985, Lin et al. 1988),
probably reflecting a regulated response to the absence of
metabolic flux towards starch. To identify possible pleiotropic effects of AtASPP overexpression, we measured the
maximum catalytic activities of enzymes closely connected
to starch and sucrose metabolism in leaves from both
WT and 35S-AtASPP-NOS plants. As shown in Table 2,
these analyses revealed no significant changes in ADPglucose pyrophosphorylase, alkaline pyrophosphatase,
UDP-glucose pyrophosphorylase, sucrose synthase,
phosphoglucomutase, hexokinase, acid invertase or
total amylolytic activity. In contrast, some but not all
930
Table 2
Plant ASPPs and starch biosynthesis
Enzyme activities (given in mU g1 FW) in WT and 35S-AtASPP-NOS Arabidopsis leaves
Control
ADP-glucose pyrophosphorylase
UDP-glucose pyrophosphorylase
Acid invertase
Phosphoglucomutase
Hexokinase
Sucrose phosphate synthase
Alkaline pyrophosphatase
Amylolytic activity
Total starch synthase
35S-AtASPP-NOS
WT
3
5
7
8
150 21.1
124 12.4
634 43
455 45
34.2 5.6
178 37
3,870 444
42.0 3.5
98.8 7.9
139 9.1
131 7.8
644 21
450 10
35.5 3.9
180 38
3,420 540
42.1 4.9
14.4 2.6
157 4.8
164 17.7
563 38
532 30
35.6 3.6
192 61
3,760 660
41.8 3.8
43.3 7.9
150 7.2
137 9.4
589 45
350 55
29.2 3.6
180 10
3,440 220
41.6 5.8
21.8 3.9
138 6.9
116 7.8
559 98
448 36
28.8 6.6
192 39
3,380 615
38.2 5.2
84.6 7.9
The activities were determined in samples from source leaves of plants grown in chambers at ambient CO2 conditions, 208C and at an
irradiance of 300 mmol photons s1 m2. Leaf samples were taken and quenched in liquid nitrogen 7 h after the beginning of the light
period. The results are the mean SEM of extracts from 10 independent plants per line.
Table 3
Metabolite levels (given in nmol g1 FW) in control (WT) and 35S-AtASPP-NOS source leaves
Control
Glucose
Fructose
Sucrose
soluble sugars
Glucose-6-phosphate
Glucose-1-phosphate
35S-AtASPP-NOS
WT
3
5
7
8
234 31
2,843 243
1,175 27
4,252 431
299 15
63.9 5.1
183 21
4,812 367
602 28
5,597 798
253 10
87.3 2.1
231 23
3,501 217
855 36
4,633 453
251 21
98.5 7.5
296 25
3,727 310
450 38
3,473 399
217 8
93.4 9.1
295 26
3,717 258
876 25
3,888 435
207 13
107.6 5.5
Source leaf samples were taken from plants grown in chambers at ambient CO2 conditions, 208C and at an irradiance of 300 mmol photons
s1 m2. Leaves were taken and quenched in liquid nitrogen 7 h after the beginning of the light period. The results are the mean SEM of
extracts from 10 independent plants per line. Values that are significantly different from the control plants are marked in bold.
significant
towards an increase in the levels of glucose-1-phosphate
and a decrease in the levels of glucose-6-phosphate.
Levels of soluble sugars and sugar phosphates
One of the distinguishing characteristics of some
starch-deficient Arabidopsis mutants is that, because they
are unable to store net photosynthate in starch, they
accumulate relatively large quantities of sucrose and
hexose in leaves (Caspar et al. 1985, Jones et al. 1986, Lin
et al. 1988, Neuhaus and Stitt 1990). To determine whether
AtASPP overexpression leads to increasing levels of soluble
sugars, we measured the intracellular content of sucrose,
glucose and fructose. In addition, we measured the levels of
sugar-phosphates. As shown in Table 3, leaves from both
WT and 35S-AtASPP-NOS plants accumulated nearly
identical amounts of total soluble sugars. Significantly,
however, AtASPP overexpression leads to both a significant
decrease of sucrose and an increase of fructose, whereas
glucose remained unaltered. Measurements of glucose-1phosphate and glucose-6-phosphate revealed a trend
Additional remarks on possible functions of plant ASPPs
This is the first report describing the cloning, expression in plants and characterization of genes coding for plant
ADP-glucose-cleaving enzymes. Results presented in this
work showing that enhancement of plant ASPP activity
leads to a concomitant reduction of ADP-glucose and
starch levels (Fig. 4) provide evidence that plant ASPPs
have access to an intracellular pool of ADP-glucose that is
linked to starch biosynthesis. This is not exclusive for
Arabidopsis since plant ASPP-overexpressing potato leaves
accumulate low levels of both ADP-glucose and starch
when compared with WT leaves (Supplementary Fig. 4).
This and the fact that maximum ASPP catalytic activities
are similar to those of enzymes responsible for ADP-glucose
synthesis and utilization (Table 2) strongly suggest that,
essentially similar to the suggested role of bacterial ASPP
(Moreno-Bruna et al. 2001), plant ASPPs may play a role in
AtASPP-overexpressing lines displayed
reduction of total starch synthase.
a
Plant ASPPs and starch biosynthesis
Table 4
931
Subcellular localization of AtASPP in leaves of 35S-AtASPP-NOS potato plants
Enzyme
Centrifugation
Lysate activity
(mU g1 FW)
Supernatant
Mitochondrial preparation
Activity
(mU g
ASPP
Fumarase
Sucrose phosphate synthase
342 29
3558 462
742 23.3
1
Activity
1
FW) % of lysate (mU g
274 25
1988 439
624 10.5
80.2 5.3
45.9 10.8
84.2 2.6
Recovery (%)
FW) % of lysate
50.0 3.2
2386 423
58.6 2.9
14.6 1.5
67.1 4.6
7.9 0.2
94.9 7.3
113 14.7
92.1 6.5
Mitochondria were prepared as described by Leaver et al. (1983). Data are given as mean SEM of three independent experiments.
both regulating intracellular levels of ADP-glucose and in
connecting the starch biosynthetic process with other
metabolic pathways in response to biochemical and
physiological needs.
Whether plant ASPPs exert a strong control on the
starch biosynthetic process will require studies on regulation
of both gene expression and enzyme activity, metabolic flux
analyses in both ASPP-overexpressing and -deficient
mutants as well as subcellular localization studies of plant
ASPPs. In this last respect, using the TargetP prediction
program (http://www.cbs.tu.dk/services/TargetP), Ogawa
et al. (2005) have classified the At4g11980 product
(AtASPP) as a mitochondrial protein. In clear contrast,
however, ChloroP (http://www.cbs.dtu.dk) predicts that
both StASPP and AtASPP have a plastidial localization,
whereas both TargetP and Psort (http://psort.nibb.ac.jp)
predict that StASPP has a cytosolic localization.
Predictions of protein localization based on in silico
analyses are questionable and need experimental verification (Soltys and Gupta 1999, Koroleva et al. 2005, Villarejo
et al. 2005). As a first step to investigate whether AtASPP is
a mitochondrial protein, we have performed subcellular
fractionation studies. Employing the centrifugation method
of Leaver et al. (1983), mitochondrial preparations were
obtained from leaves of 35S-AtASPP-NOS plants. As
shown in Table 4, comparisons of enzyme activities in
fractions obtained at the end of the preparation with those
in the initial lysate as well as in the centrifugation step
guaranteed no loss of activity during the preparation for
any of the enzymes analyzed. Judging by the activities of
fumarase, a mitochondrial matrix space marker (Nishimura
et al. 1982, Pádua et al. 1996), approximately 70% of the
mitochondria originally present in the homogenates of 35SAtASPP-NOS were recovered in the final mitochondrial
preparations. In contrast, the activities of ASPP and the
contaminating cytosolic marker sucrose phosphate
synthase in the mitochondrial preparations were found to
be approximately 15 and 8, respectively, of those occurring
in the initial homogenates. The data thus strongly indicate
that in contrast to the predictions of Ogawa et al. (2005),
AtASPP is not a mitochondrial protein.
Plant ASPPs recognize both ADP-glucose and ADPribose (Table 1). To determine whether intracellular ADPribose levels can interfere with the ADP-glucose-cleaving
reaction catalyzed by ASPP in the cell, we analyzed the
ADP-ribose content in different plant organs. Despite the
fact this nucleotide-sugar can be artifactually formed from
both NAD and NADH during the process of nucleotide
extraction (Jacobson et al. 1997), we failed to detect ADPribose (Supplementary Fig. 5), indicating that the intracellular levels of this nucleotide-sugar must be very low in the
plant cell. Taking into account that ADP-glucose is one of
the most abundant nucleotide-sugars in starch-storing
organs (Feingold and Avigad 1980, Baroja-Fernández
et al. 2003), it is highly likely that ADP-ribose does not
significantly prevent the ADP-glucose-cleaving reaction
catalyzed by plant ASPPs in the cell.
Materials and Methods
Plants, bacterial strains and culture medium
The work was carried out using WT Arabidopsis (ecotype
Columbia) plants and plants transformed with 35S-AtASPP-NOS
(see below). Plants were grown in pots at ambient CO2 (350 p.p.m.)
in growth chambers under a 16 h light (300 mmol photons s1 m2,
208C)/8 h dark (228C) regime. For biochemical analyses, fully
expanded source leaves were harvested after 7 h of illumination,
immediately quenched in liquid nitrogen, and stored at 808C for
up to 2 months before use.
All plasmid constructs were electroporated and propagated in
E. coli XL1Blue. Escherichia coli BL21(DE3) cells transformed
with either pET-AtASPP or pET-StASPP (see below) were grown
in LB medium at 378C. Agrobacterium tumefaciens cells, strain
EHA105, transformed with pBIN35S-AtASPP-NOS were grown
in LB medium at 288C. In every case, the bacterial cells were grown
with rapid gyratory shaking.
Gene cloning and expression in E. coli cells
Complete cDNAs corresponding to three Nudix-encoding
Arabidopsis genes (At1g68760, At4g11980 and At5g20070) were
obtained from the RIKEN Arabidopsis cDNA collection
932
Plant ASPPs and starch biosynthesis
(Seki et al. 1998, Seki et al. 2002) and amplified by PCR using
specific primers. The amplified products were cloned in the
pGEMT-Easy vector (Promega, Madison, WI, USA). The NheI–
XhoI fragments were then extracted and cloned into the
corresponding restriction sites of the pET-28c(þ) expression
vector (Novagen, Madison, WI, USA). The resulting plasmids
were designated as pET-At1g68760, pET-At4g11980 and pETAt5g20070.
A StASPP-encoding cDNA was obtained from 1 mg of total
RNA which was isolated from potato leaves using a ULTRASPEC
RNA Isolation System (BIOTECX Company, Houston, TX,
USA). After DNase I treatment, poly(A)þ transcripts were
reversed-transcribed using the Expand Reverse Transcriptase
system (Roche Diagnostics, Mannheim, Germany) and (dT)18 as
a primer. The first cDNA strand was amplified by PCR using
the primers 50 - CAAGTGCGGCTAGCATGAGACTAACAGTG
TCGCGTTG-30 (forward) and 50 - CAACTGCTCGAGTCAAG
GCAACAGTCCATCTCTTTTAG-30 (reverse). The amplified
product was cloned in the pET-28c(þ) expression vector to
produce pET-StASPP.
BL21(DE3) cells transformed with either pET-At1g68760,
pET-At4g11980, pET-At5g20070 or pET-StASPP were grown at
378C in 100 ml of LB medium supplemented with 50 mg ml1
kanamycin to an attenuance at 600 nm of 0.6, and then 1 mM
isopropyl-b-D-thiogalactopyranoside was added to the culture
medium. After 5 h, 100 ml of cultured cells were centrifuged at
6,000 g for 10 min. The pelleted bacteria were resuspended in 6 ml
of His-bind binding buffer (Novagen, Madison, WI, USA),
sonicated and centrifuged at 10,000 g for 10 min. The supernatant
thus obtained was subjected to His-bind chromatography
(Novagen, Madison, WI, USA). The eluted hexahistidine-tagged
recombinant proteins were then rapidly desalted by ultrafiltration
on Centricon YM-10 (Amicon, Bedford, MA, USA).
Production of AtASPP-overexpressing transgenic plants of
Arabidopsis
For the production of 35S-AtASPP-NOS plants, the NcoI–
XhoI fragment of pET-At4g11980 was digested successively with
XhoI, T4 DNA polymerase and NcoI. The fragment thus
released was ligated into NcoI–SmaI restriction sites of p35SNOS (Baroja-Fernández et al. 2004) to produce p35S-AtASPPNOS (Supplementary Fig. 6). This construct was digested with
HindIII–EcoRI and the fragment thus released was cloned into the
pBIN20 plant expression vector (Hennegan and Danna 1998)
previously digested successively with the enzymes HindIII–EcoRI
to produce pBIN35S-AtASPP-NOS. Transfer of this construct into
A. tumefaciens was carried out by electroporation. Subsequent
transformation of Arabidopsis plants was conducted as described
by Clough and Bent (1998). Transgenic plants were selected on
kanamycin-containing medium.
Enzyme assays
All enzymatic reactions were carried out at 378C. Harvested
leaves were immediately freeze-clamped and ground to a fine
powder in liquid nitrogen with a pestle and mortar. To assay
enzyme activity, 1 g of the frozen powder was resuspended at 48C
in 5 ml of 100 mM HEPES (pH 7.5), 2 mM EDTA and 5 mM
dithiothreitol (DTT). The suspension was desalted and assayed for
enzymatic activities. We checked that this procedure did not result
in loss of enzymatic activity as evidenced by comparing the activity
in extracts prepared from the frozen powder and extracts prepared
by homogenizing fresh tissue in extraction medium. Measurements
of nucleotide hydrolytic activities were performed essentially as
described elsewhere (Moreno-Bruna et al. 2001, Baroja-Fernández
et al. 2004). ADP-glucose pyrophosphorylase, acid invertase,
phosphoglucomutase, hexokinase, UDP-glucose pyrophosphorylase, alkaline pyrophosphatase, total starch synthase, total
amylolytic activity, and sucrose phosphate synthase activities
were assayed as described by Baroja-Fernández et al. (2004).
Fumarase was measured essentially as described by Pádua et al.
(1996). We define 1 U of enzyme activity as the amount of enzyme
that catalyzes the production of 1 mmol of product per minute.
Kinetic parameters were evaluated by Lineweaver–Burk plots.
Determination of soluble sugars
Fully expanded leaves were harvested and immediately
ground to a fine powder in liquid nitrogen with a pestle and
mortar. A 0.5 g aliquot of the frozen powdered tissue was
resuspended in 0.4 ml of 1.4 M HClO4, left at 48C for 2 h and
centrifuged at 10,000 g for 5 min. The supernatant was neutralized
with K2CO3 and centrifuged at 10,000 g. ADP-glucose content in
the supernatant was determined as described by Muñoz et al.
(2005) by using either one of the following methods. Assay A: by
HPLC on a system obtained from P. E. Waters and Associates
fitted with a Partisil-10-SAX column. Assay B: by HPLC with
pulsed amperometric detection on a DX-500 system (Dionex) fitted
to a CarboPac PA10 column.
To confirm further that measurements of ADP-glucose were
correct, ADP-glucose eluted from either the Partisil-10-SAX or
CarboPac PA10 columns was enzymatically hydrolyzed with
purified E. coli ASPP and assayed for conversion into AMP and
glucose-1-phosphate.
Glucose, sucrose, fructose, glucose-1-phosphate and glucose6-phosphate were determined by HPLC with pulsed amperometric
detection on a DX-500 system as described by Baroja-Fernández
et al. (2003).
Isolation of mitochondria
Mitochondria were prepared essentially as described by
Leaver et al. (1983). The final pellet was resuspended in 50 mM
Tris, pH 7.5/5 mM MgCl2/1 mM EDTA/2 mM DTT/1% (v/v)
Triton X-100.
Analytical procedures
Bacterial growth was determined spectrophotometrically by
attenuance at 600 nm. Protein content was determined by the
Bradford method using Bio-Rad prepared reagent (Bio-Rad
Laboratories, Hercules, CA, USA). Starch in desalted plant
extracts obtained by precipitation with 70% ethanol was measured
by using an amyloglucosidase-based test kit (Sigma-Aldrich
Chemical Co., St Louis, MO). Chlorophyll was quantified
according to the method of Wintermans and De Mots (1965).
The native molecular mass of AtASPP was determined by gel
filtration on a Superdex 200 column (Pharmacia LKB) using a
Bio-Rad kit of protein standards.
Supplementary material
Supplementary material mentioned in the article is available
to online subscribers at the journal website www.pcp.
oupjournals.org.
Acknowledgments
This research was supported by the grant BIO2004-01922
from the Comisión Interministerial de Ciencia y Tecnologı́a and
Plant ASPPs and starch biosynthesis
Fondo Europeo de Desarrollo Regional (Spain) and by the
government of Navarra. M.T.M-Z. acknowledges the Spanish
Ministry of Culture and Education for a pre-doctoral fellowship.
We thank Beatriz Zugasti for expert technical support.
References
Baroja-Fernández, E., Muñoz, F.J., Saikusa, T., Rodrı́guezLópez, M., Akazawa, T. and Pozueta-Romero, J. (2003)
Sucrose synthase catalyzes the de novo production of
ADPglucose linked to starch biosynthesis in heterotrophic
tissues of plants. Plant Cell Physiol. 44: 500–509.
Baroja-Fernandez, E., Muñoz, F.J., Zandueta-Criado, A., MoranZorzano, M.T., Viale, A.M., Alonso-Casajus, N. and PozuetaRomero, J. (2004) Most of ADP-glucose linked to starch
biosynthesis occurs outside the chloroplast in source leaves.
Proc. Natl Acad. Sci. USA 101: 13080–13085.
Baroja-Fernández, E., Zandueta-Criado, A., Rodrı́guezLópez, M., Akazawa, T. and Pozueta-Romero, J. (2000)
Distinct isoforms of ADPglucose pyrophosphatase and
ADPglucose pyrophosphorylase occur in the suspension-cultured cells of sycamore (Acer pseudoplatanus L.). FEBS Lett.
480: 277–282.
Bessman, M.J., Frick, D.N. and O’Handley, S.F. (1996) The MutT
proteins or ‘Nudix’ hydrolases, a family of versatile, widely
distributed, ‘housecleaning’ enzymes. J. Biol. Chem. 271: 25059–
25062.
Caspar, T., Huber, S.C and Somerville, C. (1985) Alterations in
growth, photosynthesis, and respiration in a starchless mutant of
Arabidopsis thaliana (L.) deficient in chloroplast phosphoglucomutase activity. Plant Physiol. 79: 11–17.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method
for Agrobacterium-mediated transformation of Arabidopsis
thaliana. Plant J. 16: 735–743.
Dunn, C.A., O’Handley, S.F., Frick, D.N. and Bessman, M.J.
(1999) Studies on the ADP-ribose pyrophosphatase subfamily of
the nudix hydrolases and tentative identification of trgB, a gene
associated with tellurite resistance. J. Biol. Chem. 274: 32318–
32324.
Feingold, D.S. and Avigad, G. (1980) Sugar nucleotide transformations in plants. Biochem. Plant 3: 101–170.
Gabelli, S.B., Bianchet, M.A., Bessman, M.J. and Amzel, L.M.
(2001) The structure of ADP-ribose pyrophosphatase reveals the
structural basis for the versatility of the Nudix family. Nat.
Struct. Biol. 8: 467–472.
Gasmi, L., Cartwright, J.L. and McLennan, A.G. (1999) Cloning,
expression and characterization of YSA1H, a human adenosine
50 -diphosphosugar pyrophosphatase possessing a MutT motif.
Biochem. J. 344: 331–337.
Hennegan, K. and Danna, K.J. (1998) pBIN20: an improved
binary vector for Agrobacterium-mediated transformation.
Plant Mol. Biol. Rep. 16: 129–131.
Jacobson, E.L., Cervantes-Laurean, D. and Jacobson, M.K. (1997)
ADP-ribose in glycation and glycoxidation reactions. Adv. Exp.
Med. Biol. 419: 371–379.
Jambunhathan, N. and Mahalingam, R. (2006) Analysis of
Arabidopsis growth factor gene 1 (GGF1) encoding a nudix
hydrolase during oxidative signaling. Planta 224: 1–11.
Jones, T.W.A., Gottlieb, L.D. and Pichersky, E. (1986) Reduced
enzyme activity and starch level in an induced mutant
of chloroplast phosphoglucose isomerase. Plant Physiol. 81:
367–371.
933
Koroleva, O.A., Tomlinson, M.L., Leader, D., Shaw, P. and
Doonan, J.H. (2005) High-throughput protein localization in
Arabidopsis using Agrobacterium-mediated transient expression
of GFP–ORF fusions. Plant J. 41: 162–174.
Leaver, C.J., Hack, E. and Forde, B.G. (1983) Protein synthesis by
isolated plant mitochondria. Methods Enzymol. 97: 476–481.
Lin, T-P., Caspar, T., Somerville, C. and Preiss, J. (1988) Isolation
and characterization of a starchless mutant of Arabidopsis
thaliana (L.) Heynh lacking ADPglucose pyrophosphorylase
activity. Plant Physiol. 86: 1131–1135.
Moreno-Bruna, B., Baroja-Fernández, E., Muñoz, F.J.,
Bastarrica-Berasategui, A., Zandueta-Criado, A., Rodrı́guezLópez, M., Lasa, I., Akazawa, T. and Pozueta-Romero, J. (2001)
Adenosine diphosphate sugar pyrophosphatase prevents glycogen biosynthesis in Escherichia coli. Proc. Natl Acad. Sci. USA
98: 8128–8132.
Muñoz, F.J., Baroja-Fernández, E., Morán-Zorzano, M.T.,
Viale, A.M., Etxeberria, E., Alonso-Casajús, N. and PozuetaRomero, J. (2005) Sucrose synthase controls the intracellular
levels of ADPglucose linked to transitory starch biosynthesis in
source leaves. Plant Cell Physiol. 46: 1366–1376.
Neuhaus, H.E. and Stitt, M. (1990) Control analysis of photosynthate partitioning. Planta 182: 445–454.
Nishimura, M., Douce, R. and Akazawa, T. (1982) Isolation and
characterization of metabolically competent mitochondria from
spinach leaf protoplasts. Plant Physiol. 69: 916–920.
Ogawa, T., Ueda, Y., Yoshimura, K. and Shigeoka, S. (2005)
Comprehensive analysis of cytosolic nudix hydrolases in
Arabidopsis thaliana. J. Biol. Chem. 280: 25277–25283.
O’Handley, S.F., Frick, D.N., Dunn, C.A. and Bessman, M.J.
(1998) Orf186 represents a new member of the Nudix hydrolases,
active on adenosine(50 )triphospho(50 )adenosine, ADP-ribose,
and NADH. J. Biol. Chem. 273: 3192–3197.
Pádua, M., Aubert, S., Casimiro, A. and Bligny, R. (1996) Arrest
of mitochondrial biogenesis in copper-treated sycamore cells.
FEBS Lett. 398: 248–252.
Rodriguez-Lopez, M., Baroja-Fernandez, E., Zandueta-Criado, A.
and Pozueta-Romero, J. (2000) Adenosine diphosphate
glucose pyrophosphatase: a plastidial phosphodiesterase that
prevents starch biosynthesis. Proc. Natl Acad. Sci. USA 97:
8705–8710.
Seki, M., Carninci, P., Nishiyama, Y., Hayashizaki, Y. and
Shinozaki, K. (1998) High-efficiency cloning of Arabidopsis
full-length cDNA by biotinylated CAP trapper. Plant J. 15:
707–720.
Seki, M., Narusaka, M., Kamiya, A., Ishida, J., Satou, M., et al.
(2002) Functional annotation of a full-length Arabidopsis cDNA
collection. Science 296: 141–145.
Soltys, B.J. and Gupta, R.S. (1999) Mitochondrial-matrix proteins
at unexpected locations: are they exporeted?. Trends Biochem.
Sci. 24: 174–177.
Villarejo, A., Burén, S., Larsson, S., Déjardin, A., Monné, M.,
et al. (2005) Evidence for a protein transported through the
secretory pathway en route to the higher plant chloroplast.
Nat. Cell Biol. 7: 1224–1231.
Wintermans, J.F.G.M. and de Mots, A. (1965) Spectrophotometric
characteristics of chlorophylls a and b and their pheophytins in
ethanol. Biochim. Biophys. Acta 109: 448–453.
Yagi, T., Baroja-Fernandez, E., Yamamoto, R., Muñoz, F.J.,
Akazawa, T., Hong, K.S. and Pozueta-Romero, J. (2003)
Cloning, expression and characterization of a mammalian
Nudix hydrolase-like enzyme that cleaves the pyrophosphate
bond of UDP-glucose. Biochem. J. 370: 409–415.
934
Plant ASPPs and starch biosynthesis
Yang, H., Slupska, M.M., Wei, Y.-F., Tai, J.H., Luther, W.M.,
et al. (2000) Cloning and characterization of a new member of
the Nudix hydrolases from human and mouse. J. Biol. Chem.
275: 8844–8853.
Yu, F., Jen, Y., Takeuchi, E., Inouye, M., Nakayama, H.,
Tagawa, M. and Fukui, T. (1988) a-Glucan phosphorylase
from Escherichia coli. J. Biol. Chem. 263: 13706–13711.
(Received April 6, 2006; Accepted May 19, 2006)