Vol. 46 No. 6
SCIENCE IN CHINA (Series C)
December 2003
Cadmium resistance in transgenic tobacco plants enhanced
by expressing bean heavy metal-responsive gene PvSR2
CHAI Tuanyao ()1, CHEN Qiong ( )1, ZHANG Yuxiu ()2,
DONG Juan ( )1 & AN Chengcai ()3
1. Department of Biology, Graduate School of Chinese Academy of Sciences, Beijing 100039, China;
2. School of Chemical and Environmental Engineering, China University of Mining and Technology Beijing, Beijing
100083, China;
3. National Laboratory of Protein Engineering and Plant Genetic Engineering, Life Science College, Peking University,
Beijing 100871, China
Correspondence should be addressed to Chai Tuanyao (email: [email protected])
Received February 28, 2003
Abstract
PvSR2 (Phaseolus vulgaris stress-related gene) has been cloned from French bean
and shown to be expressed specifically upon heavy metal treatment. In order to investigate the
role of PvSR2 in plant, PvSR2 gene under the control of cauliflower mosaic virus 35S promoter
was introduced into tobacco mediated with Agrobacterium tumefaciens LBA4404. The regenerated
plantlets were selected on medium with 100 mg/L kanamycin. PCR and Southern blot analysis
showed PvSR2 gene was integrated in tobacco genome. Gus and Northern blot analysis indicated
PvSR2 gene was expressed in transgenic seedling. The heavy metal resistance assay showed
that the transgenic tobacco seedlings with the PvSR2 coding sequence exhibited higher tolerance
to Cd compared with wild-type (WT) under Cd exposure. The Cd content accumulated in root between transgenic and WT seedlings had no obvious difference at lower Cd external concentration
(0.05—0.075 mmol/L CdCl2), whereas transgenic plant showed a lower root Cd content than the
control at higher external Cd concentration (0.1 mmol/L CdCl2). These results suggested that the
expression of PvSR2 can enhance the Cd tolerance, and PvSR2 may be involved in Cd transportation and accumulation at the test concentration of 0.1 mmol/L Cd.
Keywords: PvSR2 gene, cadmium resistance, tobacco.
DOI: 10.1360/02yc0190
Heavy metal pollution such as Cd, Hg, Pb, As and Se is an increasing environment problem
worldwide. These metals and metalloids have toxic effect on both plants and animals, which are
strongly poisonous to metal-sensitive enzymes, resulting in growth inhibition and death of the
organism[1]. Contamination of soils with heavy metals, either by natural causes or due to pollution,
often has pronounced effects on the vegetation, resulting in the appearance of metallophytes, and
heavy-metal tolerant plants. A range of tolerance mechanisms have also been proposed, including
phytochelatin-based sequestration, compartmentalization processes, as well as additional defense
mechanisms, which are based on cell wall immobilization, plasma membrane exclusion, stress
proteins, stress ethylene, peroxidase and metallothioneins (MT)[1,2].
Phytochelatin (PC) and heavy-metal transporters play important roles in heavy metal accu-
624
SCIENCE IN CHINA (Series C)
Vol. 46
mulation, transport and detoxification in plant[1,3]. Several metal resistance-related genes, when
overexpressed in bacteria, yeasts and plants, can increase the metal tolerance of transformants[4 —6].
PvSR2 (Phaseolus vulgaris stressed-related) gene isolated from the bean cDNA library by differential screening is expressed especially under the heavy metal stress and encodes a new
heavy-metal stress responsive protein. The putative amino acid sequences of PvSR2 have no any
similarity with the metal transporter, PC and metallothionein registered in data base. The transformed bacteria of PvSR2 displayed obvious resistance to CdCl2[7]. In order to assess the function
of PvSR2 with regard to heavy metal tolerance in plant, tobacco was genetically engineered to
express PvSR2. Furthermore, the Cd tolerance of PvSR2 transgenic plant was assayed. Here we
report that transgenic plants constitutively expressing the PvSR2 gene exhibit an enhanced resistance to Cd, indicating that the PvSR2 protein may play important roles in the defense of plant
against heavy metal.
1
Materials and methods
1.1
Plasmid constructs
A DNA fragment containing CaMV 35S enhancer, 35S promoter, the multiple cloning sites
and 35S polyA was obtained from plasmid pFF19 with Hind III and EcoR I digestion, and inserted
in the binary expression vector pCAMBIA2301 by similar enzyme digestion (kindly provided by
Dr. Huayi Yuan). A 750 bp fragment of PvSR2 cDNA containing the full open reading frame and 3
-untranslated region was cut from pKS-PvSR2 vector with Kpn III and Pst I, and then ligated at
the multiple cloning sites between the 35S promoter and 35S polyA, resulting in a recombinant
plasmid pCPN-PvSR2. The pCAMBIA2301 vector contained the NPT II region and the GUS
(β-glucuronidase) reporter gene, which were used for selection and identification of the transgenic
tobacco plant respectively (fig. 1). The pCPN-PvSR2 was introduced into Agrobacterium tumefaciencs strain LBA4404 cells by heat shock method. The transformed agrobacteria cells LBA4404
were selected on medium containing 30 µg/mL rifampicin and 50 µg/mL kanamycin and confirmed by dot blotting with PvSR2 cDNA probe.
Fig. 1. T-DNA region of pCPN-PvSR2 binary vector in Agrobacterium used for tobacco. Expression of the PvSR2 gene is
regulated by the CaMV35S promoter and 35S polyA.
1.2 Transformation of tobacco
The A. tumefaciens strains LBA4404 harboring the binary pCPN-PvSR2 plasmid were used
for cocultivation with leaf disks of tobacco ( Nicotiana tabacum c.v. Hong Hua Da Jin Yuan)[8],
followed by Kan selection and plant regeneration. The selective medium was Murashige and
No. 6
CADMIUM RESISTANCE IN TRANSGENIC TOBACCO PLANTS
625
Skoog (MS) agar medium containing 0.5 mg/L IAA, 2 mg/L benzyladenin (BA), 500 mg/L
carbenicillin and 100 mg/L kanamycin. After 23 weeks with a 16 h light/8 h dark cycle at 28,
the transgenic shoots were removed to the MS medium containing 100 mg/L kanamycin to rooting.
The regenerated tobacco plantlets were removed from the chamber to a greenhouse.
1.3
Southern blot analysis
Total DNA of tobacco leaf was isolated by CTAB method. Southern-blot hybridization was
carried out as described by Sambrook et al. (2002)[9]. 20 µg total DNA was digested by EcoR I
and Pst I, or Hind III. The digested products were separated by electrophoresis and then transferred to the nylon membrane. The PvSR2 cDNA was labeled with 32p-[dCTP] by random priming
using a DNA labeling kit (Prime-a-Gene Labeling System, Promega Corporate). Hybridization
and detection were carried out the following standard protocols of Bio-Rad.
1.4
Northern blot analysis
Total RNA was extracted from 10-d-old seedlings shoots by Guanidine Isothiocyanate
method[9]. 20 µg RNA was separated by electrophoresis and then transferred to nylon membrane.
Hybridization and detection were carried out the following standard protocols of Bio-Rad.
1.5 Histochemical staining for GUS activity
GUS staining was carried out according to Jefferson et al. (1987)[10]. Leaves or seedling of
transgenic tobacco and WT submerged in Glux Extraction Buffer (X-Gluc 0.5 mg/mL PBS) for
staining. After the incubation in a 37 incubator overnight, the tissue was cleared of chlorophyll
by repeated 10 min washes in 70% (v/v) ethanol.
1.6 Heavy metal resistance assays
1.6.1 Seedling experiments.
In the experiment, T1 seeds from transgenic lines CPN2 and
WT tobacco were sterilized by rinsing in 95% ethanol for 30 s, then in 1% hypochlorite solution
for 30 min, and subsequently in a sterile deionized water five times for 10 min each time. About
fifty sterilized seeds were sown for germination in a rocking platform on MS medium containing
100 mg/L kanamycin and different concentration of CdCl2 (0, 0.15, 0.20, 0.25 mmol/L). The individual seedlings were harvested and washed, and the length of the roots was measured after 10 d
of exposure to Cd at 25 under continuous light.
1.6.2 Mature plant experiment.
The 15-days-old seedlings of CPN2 and WT tobacco were
transferred onto MS medium containing different concentration of CdCl2 (0.05, 0.075, and 0.10
mmol/L). These platforms were maintained in a greenhouse with controlled temperature (25)
and a long-day (16 h) photoperiod. Plants were harvested after 20 d of exposure to Cd, and thoroughly washed under running deionized water to remove any trace elements adhering to the tissue.
Total fresh weights of the plants were measured before and after treatment. Leaves and roots tissues were separated and dried at 70 for 3 d. The dried tissues were weighed and ready for Cd
626
SCIENCE IN CHINA (Series C)
Vol. 46
concentration analysis.
1.7 Cd concentration analysis
Cd concentration analysis was carried out after acid digestion of dried and ground tissue
samples as described by Zarcinas et al. (1987)[11]. The concentrations of Cd in the acid digest were
measured by AAS. Standards and blanks were run with all samples for quality control. Plants that
were not supplied with Cd were also analyzed for trace Cd concentration as a negative control.
2
Results
2.1 Characterization of transgenic PvSR2 plants
Five kanamycin-resistant tobacco lines were initially detected by GUS analysis (data not
shown) and were designated as CPN1, CPN2, CPN3, CPN4, and CPN5. A pair of primers (the
sense primer was GTCCAGGAATTCCATGCGTTGCGCCATCCTCTA, the antisense primer was
GATATCCTGCAGGTCGACGATCAATTTCCACTG) specific for PvSR2 coding region were
used for PCR with genomic DNA from both
transgenic tobacco and WT plant leaves. PCR
results showed the expected 520 bp amplification fragment for all five lines CPN15, while
no band was observed for the untransformed
control plant (fig. 2). This result indicated the
presence of PvSR2 gene in five kanamyFig. 2. Electrophoresis result of PCR product. Lane 1, cin-resistant tobacco lines. Five transgenic lines
pKS-PvSR2 as positive control; lanes 26, the amplified were phenotypically normal in the greenhouse
DNA from five transgenic tobacco lines (CPN1CPN5); and did not show any distinguishable difference
lane 7, the amplified DNA from WT as negative control. The
in visual appearance compared with the WT.
arrow indicated the PvSR2 fragment.
In order to confirm that the PvSR2 gene in
transgenic lines was intact, Southern blot was further performed. The total genomic DNAs isolated from CPN2 and CPN5 transformants and WT were digested by Hind III alone, or by both
EcoR І and Pst І, and hybridized with PvSR2 probe.
Southern blot analysis showed a single fragment from
transgenic plants, whereas no hybridization signal
could be detected in WT (fig. 3). A single hybridization band, which was about 0.8 kb and corresponded
in size to PvSR2 cDNA (750 bp), was observed when
the genomic DNA from both CPN2 and CPN5 transformants was digested by EcoR I and Pst І, because
there is an EcoR I site at both ends of PvSR2 cDNA
(fig. 1). This result revealed that PvSR2 gene had
been integrated into the tobacco genomes. When the
Fig. 3. Southern blot assay of the PvSR2 in transgenic tobacco plants. Lanes 1—3, The total genomic
DNA from WT, CPN2, and CPN5 transformants was
digested with EcoR І and Pst I; lanes 4 and 5, the total
genomic DNA of both CPN2 and CPN5 was digested
with Hind alone.
No. 6
CADMIUM RESISTANCE IN TRANSGENIC TOBACCO PLANTS
627
DNA from CPN2 and CPN5 transformants was digested by Hind III, a different size band appeared, indicating that PvSR2 gene had been integrated into different sites of chromosome.
2.2
Expression of PvSR2 in transgenic seedling
GUS histochemical assay was performed with the tobacco seedling from CPN2 and CPN5
transgenic plant and the WT. Both CPN2 and CPN5 exhibited significant GUS activity, while WT
did not (fig. 4). Moreover, the GUS activity of CPN5 was stronger than CPN2. This result showed
the expression level of PvSR2 was different in both CPN2 and CPN5 transgenic lines.
Fig. 5.
Expression of PvSR2 in transgenic tobacco plants.
Lane 1, WT; lane 2, CPN2; lane 3, CPN5. Total RNA (10 µg)
Fig. 4. GUS activity analysis of transgenic tobacco and WT was loaded in each lane. The 28S ribosomal RNA is shown as a
plant. 1, WT; 2, CPN2; 3, CPN5.
control at the bottom.
The total leaf RNA was isolated from the CPN2 and CPN5 transgenic plant, and control
plants, and then analyzed by Northern blot with specific PvSR2 probe (fig. 5). PvSR2 mRNA was
detected in two transgenic lines, while not in WT, suggesting that the PvSR2 gene was expressed
in transgenic lines.
2.3
The Cd tolerance of transgenic PvSR2 plants
Cd resistance in transgenic tobacco seedling and the control was assayed under Cd stresses.
Root length was considered to be a reliable parameter for assaying the heavy metal resistance in
plant[12]. The seeds of both transgenic tobacco plant and the control were used for germination
under Cd stress and the root length of seedling was measured. The seedlings of CPN2 transgenic
line and WT grew well on MS medium containing no CdCl2 and there was no significant difference in root length between them. However, when the seedling grew 10 days on MS medium containing a series of increased Cd concentrations (0.15, 0.20, or 0.25 mmol/L), the roots of CPN2
seedling were longer than WT (fig. 6). Particularly at 0.25 mmol/L Cd, the root length of CPN2
was more than 1.5-fold compared to those of WT. This result indicated the CPN transgenic seedlings were more tolerant to Cd than WT.
The Cd resistance experiments with mature plants were performed with plants of transgenic
lines CPN2 and WT. After growing 20 d on MS medium containing 0.05, 0.075, or 0.10 mmol/L
628
SCIENCE IN CHINA (Series C)
Fig. 6. Effect of Cd on root length in seedling. Tobacco
seedling germinated for 10 days on MS medium containing
0, 0.15, 0.20, and 0.25 mmol/L CdCl2. Values shown are
the average ±SE of 50 replicated plants. *, Significant
difference (P < 0.05) from the WT of the same treatment.
Vol. 46
Fig. 7. Effect of Cd on transgenic tobacco plant growth.
15-days-old tobacco seedlings were grown on MS medium
containing CdCl2 (0.05, 0.075, or 0.10 mmol/L) for 21 days.
Values shown are the average ± SE of 10 replicate plants. Relative growth was calculated as the harvest fresh weight (shoot
plus root) minus the fresh weight before treatment. *, Significant difference (P < 0.05) from the WT of the same treatment.
CdCl2, the growth of both CPN2 and WT was inhibited (figs. 7 and 8). However, the biomass of
the CPN2 plants was bigger than WT under three different Cd concentrations. The leaves of CPN2
were greener and bigger than the control at 0.1 mmol/L CdCl2, the plants of CPN2 were also
higher than that of control (fig. 8), whereas this concentration resulted in chlorosis and slower development in the control. These results indicated the enhanced Cd resistance of CPN2 is due to the
expression of PvSR2 gene.
Fig. 8. Cd-resistance assay of the tobacco transgenic line CPN2. Seedlings of CPN2 and WT tobacco were stressed for 21 days
with 0.05, 0.075, and 0.10 mmol/L CdCl2, separately.
2.4 Cd accumulation in transgenic seedling
The tobacco seedling exposed to Cd on MS medium containing 0.05, 0.075, or 0.10 mmol/L
CdCl2 accumulated substantial amounts of Cd in their roots and leaves (fig. 9). The Cd content
accumulated in root and leaf increased dramatically with the increased Cd concentration from 0.05
to 0.1 mmol/L in the control, while CPN2 showed a different pattern of Cd accumulation, the Cd
content of CPN2 increased slowly. There was no big difference in Cd concentration of roots be-
No. 6
CADMIUM RESISTANCE IN TRANSGENIC TOBACCO PLANTS
629
tween CPN2 and the control at 0.05 and 0.075 mmol/L CdCl2, however, the content of Cd in
CPN2 was obviously smaller than in the control at 0.1 mmol/L CdCl2 (fig. 9(a)). The same result
was obtained from leaves. The Cd concentration of shoots in CPN2 and the control had no difference at 0.075 mmol/L CdCl2, while Cd concentration of CPN2 was a little smaller than the control
(fig. 9(b)). These suggested that PvSR2 played an important role in reducing Cd accumulation in
root at higher Cd concentration (0.1 mmol/L CdCl2), whereas had no big effect on it at 0.05—0.75
mmol/L CdCl2.
Fig. 9. Cd accumulation in root (a) and leaf (b). Tobacco plants were exposed to various Cd concentrations for 21 d. Values
shown are the average of 10 replicate plants.
4
Discussion
PvSR2 gene under the control of the CaMV 35S promoter was introduced into tobacco
through Agrobacterium tumefaciens-mediated transformation. PCR and Southern blot analysis
showed PvSR2 gene was integrated in tobacco genome. Gus and Northern blot analysis indicated
PvSR2 gene was expressed in transgenic seedling. The expression of PvSR2 in bacteria DH5α
strain under the control of PRPL promoter leads to significant Cd resistance of transformed cells
compared with the control[7]. The Cd resistance assay showed that PvSR2 also increased Cd tolerance in tobacco seedling, as transgenic tobacco had longer root and bigger biomass compared
with the control under Cd stresses; in addition, the leaves of transgenic tobacco were also greener
and bigger. These results demonstrated overexpression of PvSR2 gene can contribute to the heavy
metal resistance and detoxification in tobacco and bacteria. One of the major defense mechanisms
in plant is to inactivate metal ions by complexing with heavy-metal-complexing compounds such
as PC and MT[1]. In addition, metal transporters involved in the processes of metal uptake, transport and accumulation can improve plant tolerance to metal[3]. The expression of zinc transporter
gene in Arabidopsis conferred enhanced Zn resistance and strongly increased Zn content in roots
under high Zn exposure[6]. PvSR2, having no sequence similarity with heavy metal-related protein,
was a new heavy metal-induced protein[7]. Therefore, PvSR2 may have no chelation for metal ions.
Further studies show the Cd content accumulated in roots between PvSR2 transgenic and WT
seedlings had no big difference at 0.05 and 0.75 mmol/L CdCl2, indicating that PvSR2 was not
630
SCIENCE IN CHINA (Series C)
Vol. 46
directly involved in metal uptake and transport at lower Cd concentration. However, at higher external Cd concentration (0.1 mmol/L CdCl2), the CPN2 showed a lower root Cd content than the
control, indicating that PvSR2 could reduce the process of Cd2+ uptake and transportation. Avoidance of uptake toxic metal ions is one of the most important heavy metal tolerance mechanisms in
plant, which can maintain the cell living at a low metal ion concentration and prevent plant from
metal ion poisoning[1]. The expression of PvSR2 can reduce the Cd content in root at 0.1 mmol/L
CdCl2 and enhance the Cd tolerance in tobacco, suggesting that PvSR2 may interact with transporter protein and be involved in metal uptake and accumulation process.
Acknowledgements
This work was supported by the National Natural Science Foundation of China (Grant No.
39970070), Young Scientist Group Program of the Chinese Academy of Sciences, and the National Foundation of Transgenic
Plants Program of China (J00A00803, JY03A1902).
References
1.
Zhang, Y. X., Chai, T. Y., Burlard, G., Heavy metal tolerance mechanisms in plants, Acta Bot. Sin. (in Chinese), 1999,
41(5): 453457.
2.
Mejáre, M., Bülow, L., Metal-binding proteins and peptides in bioremediation and phytoremediation of heavy metals,
3.
Guerinot, M. G., The ZIP family of metal transporters, Biochimica Biophysica Acta, 2000, 1456(1-2): 190198.
4.
Odaware, F., Kauraski, M., Suzuki-Kurasaki, M. et al., Expression of human metallothionein-2 in Escherichia coli: Cad-
Trends in Biotech., 2001, 19(2): 6773.
mium tolerance of transformed cells, J. Biochem. (Tokyo), 1995, 118(6): 11311137.
5.
Huang, L., Gitschier, J., A novel gene involved in zinc transport is deficient in the lethal milk mouse, Nat. Genet., 1997,
17(3): 292297.
6.
Van der Zaal, B., Neuteboom, L. W., Pinas, J. E. et al., Overexpression of novel Arabidopsis gene related to putative
zinc-transporter genes from animals can lead to enhanced zinc resistance and accumulation, Plant Physiol., 1999, 119(3):
7.
Zhang, Y. X., Chai, T. Y., Zhao, W. M. et al., Cloning and expression analysis of the heavy-metal responsive gene PvSR2
10471055.
from bean, Plant Science, 2001, 161(4): 783790.
8.
Horsch, R. B., Fry, J. E., Hoffman, N. L. et al., A simple and general method for transferring genes into plants, Science,
9.
Sambrook, J., Russell, D. W., Molecular Cloning, 3rd ed., Cold Spring Harbor, New York: Cold Spring Harbor Laboratory
Press, 2002.
10.
Jefferson, R. A., Kavanagh, T. A., Bevan, M., Gus-fusions: β-glucuronidase as a sensitive and versatile gene fusion marker
1985, 227(7): 12291231.
in higher plants, EMBO J., 1987, 6(13): 39013907.
11.
Zarcinas, B. A., Cartwright, B., Spouncer, L. R., Nitric acid digestion and multi-element analysis of plant material by in-
12.
Murphy, A., Taiz, L., A new vertical mesh transfer technique for metal-tolerance studies in Arabidopsis: Ecotypic variation
ductively coupled plasma spectrometry, Commun. Soil. Sci. Plant Anal., 1987, 18(3): 131146.
and copper-sensitive mutant, Plant Physiology, 1995, 108(1): 2938.