PRESENCE OF SEASONAL COLIFORMS IN A THERMAL EFFLUENT
ON THE SUSQUEHANNA RIVER:
Heather Griffiths
Department of Biological Sciences,
York College of Pennsylvania
INTRODUCTION:
•
•
•
•
•
DISCUSSION:
RESULTS:
Coliforms are found naturally in aquatic environments due
to the feces of animals and runoff into watersheds.
Coliforms are Gram-negative rod-shaped bacteria normally
found in the digestive tract of animals (Bauman 2011).
In flooding events, increased stormwater runoff may
contain sewage and other contaminants. Pollution has
been a concern in this particular watershed since the Clean
Water Act was passed in 1972 (Onda 2012).
Harrisburg has recently faced EPA violations due to an
overwhelmed combined sewer system. Flooding and/or
sudden downpours cause an overflow of wastewater into
the Susquehanna River. Capital Region Water cited 82 of
these overflow events in 2013 (Vendel 2014).
The PPL Brunner Island coal-fired power plant provides
coal-fired electricity by steam conversion. River water is
used to cool the steam and recycled back into the river,
creating a thermal effluent. The effluent creates an
environment warm enough to sustain fish populations yearround (PPL 2007).
Increased water temperatures from a thermal effluent
have the potential to impact wildlife. Increased temperature
creates a stress on aquatic organisms by exacerbating
toxicity of chemicals such as ammonia, pesticides, and
heavy metals. High temperature also decreases oxygen
solubility and inhibits biological processes such as
respiration (Madden 2013).
Temperature. Monthly ambient temperature followed a
seasonal pattern during spring, summer, and fall months.
Ambient temperature in the winter was unseasonably warm-December 2013 proved to be a significant outlier, at 15 °C.
Monthly water temperature of the thermal effluent site was
consistently higher than other sites. The most obvious
differences in water temperature occurred in the fall and winter
months, when the upstream site froze, the water at the thermal
effluent remained at 28 °C. The thermal effluent site reached its
highest temperature in August at 32 °C (Figure 2).
Coliforms. Mean coliform counts upstream were significantly
different from both thermal effluent and downstream sites in the
months of June, July, and August. In September 2013, mean
coliform counts at all sites were statistically significant from
each other. In April 2014, mean monthly coliform counts
upstream versus effluent were statistically significant, but the
downstream site did not differ significantly from the other two.
In May 2014. Monthly coliform counts upstream decreased to
440/mL while downstream increased to 990/mL. The mean
coliform count at the thermal effluent site was the lowest, at
237/mL, and significantly different from the downstream site.
Downstream versus effluent were only statistically different from
each other in May. Mean coliform counts from all three sites
were significantly different from each other only in September
(Figure 3).
Statistics. Amount of daily precipitation was compared to mean
monthly coliform count using a frequency distribution but was
not significant (p=0.45). Monthly mean coliform counts across
each site were analyzed using a two-way ANOVA with a
Tukey’s post-hoc multiple comparison test. Analysis of
variance showed that month accounted for 32.4% of the total
variation (F=34.08, df =12, p < 0.001). Location accounted for
13.22% of the total variation (F = 49.47, df = 2, p = 0.0015).
The interaction between month and location accounts for
46.92% of the total variation (F= 19.06, df =24, p < 0.0001).
Google maps
Upstream
Thermal
Effluent
TGGE. Similar diversity of bacteria were found in water
samples from each site, as evidenced by similar banding
separated by charge and degradation temperature (Figure 4.)
PPL
Downstream
Google maps
Figure 1. Water sample collection locations in York Haven, PA: 20 miles SE of Harrisburg, PA
OBJECTIVES:
•
•
•
Compare monthly water temperature at sites
upstream, downstream and at the thermal effluent.
Investigate the relationship between growth of
coliforms in the thermal effluent site, compared to
sites upstream and downstream.
Determine if the relationship between site location and
month provides consistent
• Upstream water temperature gradually decreased from
summer to winter while sites downstream varied
monthly, indicating the power plant’s steam conversion
and cycling cooling tower dictate the temperature of
the effluent.
• Climate change could be playing a part in changes in
ambient temperature and could effect the river
temperature.
• In summer months, coliform counts were higher
upstream.
• Coliform counts at the thermal effluent and
downstream sites were typically lower, related to
higher temperatures.
• The differences between months in each site were
statistically significant.
• The differences in temperature did not appear to affect
bacterial diversity
• There appear to be outside factors influencing
coliform counts in the thermal effluent.
FURTHER STUDIES:
• Investigate sources of runoff related to test sites.
• Explore the relationship between climate change and the
thermal effluent.
• Perform next-generation sequencing of bacterial samples
on-site.
LITERATURE CITED:
Bauman, R. Microbiology with Diseases by Taxonomy. 2007. 4th ed. Pearson. Boston.
Climate Data. National Climatic Data Center. National Oceanic and Atmospheric Administration.
Heuer, H., Krsek, M., Baker, P., Smalla, K., and Wellington, E. 1997. Analysis of Actinomycete communities by
specific amplification of genes encoding 16S rRNA and Gel-Electrophoretic separation in denaturing
gradients. Applied and Environmental Microbiology. 63(8): 3233-3235.
Madden, N., Lewis, A., Davis, M. 2013. Thermal effluent from the power sector: an analysis of once-through
cooling system impacts on surface water temperature. Environmental Research Letters. 8(2013): 1-7.
Onda, K., LoBuglio, J, Bartram, J. 2012. Global access to safe water: accounting for water quality and the
resulting impact on MDG progress. International Journal of Environmental Research and Public Health.
9(3): 880-894.
PPL Brunner Island Power Plant. 2007. Available from http://www.pplweb.com/ppl-generation/ppl-brunnerisland.aspx. Accessed 2013 May 6.
Vendel, Christine. Capital Region Water faces millions in upgrades under consent decree to address clean water
violations. 25 November 2014. PennLive.com. Available from
http://www.pennlive.com/midstate/index.ssf/2014/11/capital_region_consent_decree.html. Accessed
2015 January 8.
Month
Location
Table 1. Universal PCR primers against prokaryotic 16S rDNA
(Heuer et. al 1997).
Primer
F984GC
R1378
16S rDNA target
Bacteria (968-984)
Bacteria (1378-1401)
ACKNOWLEDGEMENTS:
Sequence (5’ to 3’)
[
[
[
[
[
[
gc.-AACGCGAAGAACCTTAC
CGGTGTGTACAAGGCCCGGGAACG
Figure 4. Presence of bacterial diversity as evidenced by various banding (indicated with brackets) on 8%
polyacrylamide gel from locations upstream (1), thermal effluent (2) and downstream (3).
I would like to thank Dr. David Singleton, Dr. Bridgette Hagerty, and Joan Carpenter for
their guidance and support. I would also like to thank and applaud the wonderful people
who served time as my fieldwork buddies: Michael Griffiths, Dale Hatrock, and Abbie
Werner., and Rob Harvey because he is awesome.
METHODS:
Quantification of
bacteria:
• Measure temperature and pH at
each site.
• Collect 500-mL water sample
from each site.
• Triplicate plate 100 μL of
water sample from each site
on three types of media:
NA: Nutrient Agar provides
nutrients for a wide variety of
bacteria.
EMB: Eosin Methylene Blue
selects for Enterobacteriaceae
and E. coli colonies have a
metallic green appearance.
Molecular Analysis:
MAC: MacConkey’s Agar selects
for Gram-negative and lactosefermenting coliforms using a pH
sensitive indicator as well as bile
salts and crystal violet to inhibit
Gram-positive growth.
•
•
•
•
Isolated colonies from nutrient agar in order to identify presence of bacteria.
DNA released by three cycles of freeze/boil (-80°C, 99°C).
PCR using 16S primers (Table 1) and NEB Q5 Master Mix, at standard cycles.
Presence of 450bp PCR fragments were identified using 1.5% agarose gel
electrophoresis.
• Presence of bacterial diversity was confirmed using an 8% polyacrylamide gel
(Figure 4).