The University of Toledo
The University of Toledo Digital Repository
Theses and Dissertations
2012
The role of menin in regulation of hepatic glucose
production through FoxO1
Leah M. Wuescher
The University of Toledo
Follow this and additional works at: http://utdr.utoledo.edu/theses-dissertations
Recommended Citation
Wuescher, Leah M., "The role of menin in regulation of hepatic glucose production through FoxO1" (2012). Theses and Dissertations.
478.
http://utdr.utoledo.edu/theses-dissertations/478
This Dissertation is brought to you for free and open access by The University of Toledo Digital Repository. It has been accepted for inclusion in Theses
and Dissertations by an authorized administrator of The University of Toledo Digital Repository. For more information, please see the repository's
About page.
A Dissertation
entitled
The Role of Menin in Regulation of Hepatic Glucose Production Through FoxO1
by
Leah M. Wuescher
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Sciences
_________________________________________________
Dr. Edith Mensah-Osman, Major Advisor
_________________________________________________
Dr. Marcia McInerney, Committee Member
_________________________________________________
Dr. Thomas McLoughlin, Committee Member
_________________________________________________
Dr. Sonia Najjar, Committee Member
_________________________________________________
Dr. Edwin Sanchez, Committee Member
_________________________________________________
Dr. Stanislaw Stepkowski, Committee Member
_________________________________________________
Dr. Guillermo Vazquez, Committee Member
_________________________________________________
Dr. Patricia Komuniecki, Dean,
College of Graduate Studies
The University of Toledo
December 2012
Copyright 2012, Leah M. Wuescher
This document is copyrighted material. Under copyright law, no parts of this document
may be reproduced without the expressed permission of the author.
ii
An Abstract of
The Role of Menin in Regulation of Hepatic Glucose Production through FoxO1
by
Leah M. Wuescher
Submitted to the Graduate Faculty in partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Sciences
The University of Toledo
December 2012
The menin protein is ubiquitously expressed, but mutations causing loss of menin
function lead to a neuro-endocrine specific tumor phenotype called MEN1 Syndrome.
Importantly, the MEN1 Syndrome has metabolic manifestations such as glucose
intolerance and increased prevalence of type 2 diabetes not associated with the endocrine
tumors. Knockout of menin in the liver, a main regulator of glucose homeostasis, yielded
no neoplastic phenotype, but no metabolic studies were undertaken. In this collection of
studies, our lab shows insulin as a novel regulator of menin expression and localization.
Also, insulin facilitates the interaction of menin with FoxO1, the main regulator of
gluconeogenesis. To further investigate the purpose of this interaction, mice were created
with deletion of one allele of the Men1 gene (HET). On normal chow, mice showed
increased markers of FoxO1 activation and when challenged with high fat diet mice
showed an exacerbated metabolic phenotype. This evidence supports the hypothesis that
menin is a metabolically relevant in the liver with its loss causing an exacerbated
metabolic syndrome phenotype.
iii
This work is dedicated to my wonderful husband Christian. You have been my rock
throughout this entire process always ready with encouraging words and hugs. Also, to
my parents and brother; Charles, Dawn, and Charlie Palladino: Thank you for all of your
love and support over the years that got me where I am today.
iv
Acknowledgements
I would like to thank my major advisor Dr. Edith Mensah-Osman for allowing me to
work in her laboratory and to work on such an exciting project. I would also like to thank
my committee members for their constant support and advice during my graduate studies.
Lastly, I would like to thank my lab mate Kristine Angevine for all of your support
throughout the years, it was truly a pleasure working in the lab with you every day. Your
constant laughter and friendship kept me optimistic even when things were difficult. You
are a major part of this dissertation and I truly appreciate all that you have done to help
me complete this project.
v
Contents
Abstract
iii
Acknowledgments
v
Contents
vi
List of Figures
ix
1. Literature Review
1
1.1 Liver Physiology………………………………………………………………1
1.1.1 The Liver in the Fasted State………………………………...….…..1
1.1.2 The Liver in the Fed State……….…………………………………..3
1.1.3 FoxO1 as a Regulator of Fasting and Feeding………………………4
1.2 Metabolic Syndrome and T2DM…………………………………………...…5
1.2.1 Increased FoxO1 Activity Promotes MetS and T2DM Phenotype…6
1.2.2 Increased FoxO1 Activity Promotes Lipogenesis and
Hypertriglyceridemia……………………………………………………...8
1.3 Multiple Endocrine Neoplasia Type 1………………………………………...9
1.3.1 The Menin Gene and Protein………………………………………..9
1.3.2 Menin Interacting Proteins (MIPs)………………………………...12
1.3.3 Hepatic Menin……………………………………………………...13
1.3.4 Summary and Hypothesis…………………………………………14
vi
2. Insulin Regulates Menin Expression, Cytoplasmic Localization, and Interaction
with FoxO1
16
2.1 Abstract………………………………………………………………………17
2.2 Introduction…………………………………………………………………..18
2.3 Materials and Methods……………………………………………………….20
2.4 Results………………………………………………………………………..24
2.5 Discussion……………………………………………………………………30
2.6 References……………………………………………………………………33
2.7 Figure Legends……………………………………………………………….36
2.8 Figures………………………………………………………………………..41
3. Menin Liver-Specific Hemizygous Mice Challenged with High Fat Diet Show
Increased Weight Gain and Markers of Metabolic Impairment
49
3.1 Abstract………………………………………………………………………50
3.2 Introduction…………………………………………………………………..51
3.3 Materials and Methods……………………………………………………….52
3.4 Results………………………………………………………………………..55
3.5 Discussion……………………………………………………………………59
3.6 References……………………………………………………………………62
3.7 Figure Legends……………………………………………………………….71
3.8 Figures………………………………………………………………………..73
4. Discussion
79
4.1 Discussion……………………………………………………………………79
4.2 Summary and Future Directions……………………………………………..85
vii
References
88
viii
List of Figures
4-1 Effects of Loss of Menin on Fasted and Re-fed mice. Mice underwent an overnight
fast followed by 4 hours of re-feeding, were euthanized, and whole liver protein was
analyzed using Western Blotting analysis. A) Phosphorylated Akt (pAkt) normalized to
total Akt (tAkt) B) Acetylated FoxO1 (AcFoxO1) normalized to total FoxO1 (tFoxO1) C)
Glucokinase (GLK) normalized to Actin…………………..…………………………….86
ix
Chapter 1
Literature Review
1.1 Liver Physiology
The liver is a vital organ with many functions in maintaining whole body homeostasis.
The liver metabolizes administered drugs, creates bile for digestion, and regulates whole
body glucose homeostasis with its important role in insulin clearance in feeding, and
glucose production in fasting.
1.1.1
The Liver in the Fasted State
The liver is a main relay organ involved in maintaining whole body energy homeostasis
(Sommerfeld, Krones-Herzig et al. ; Dey and Chandrasekaran 2009). It responds to
signals given from the pancreas in the form of secreted hormones to control the
peripheral glucose concentration. In times of fasting, circulating levels of glucose are
decreased. This decrease triggers pancreatic secretion of glucagon, a peptide hormone,
with its receptor being expressed in the liver, kidney, brain, heart, and adipose tissue
(Authier and Desbuquois 2008). When glucagon binds its cognate G-protein coupled
receptor (GPCR), downstream signaling occurs through cyclic AMP and activation of
protein kinase A (PKA). PKA has already been implicated as a negative regulator of
1
menin protein expression via somatostatin signaling (Mensah-Osman, Zavros et al.
2008). PKA signaling via the glucagon receptor also increases glycogenolysis through
phosphorylation of glycogen synthase kinase (GSK) which subsequently activates
glycogen phosphorylase leading to increased breakdown of glycogen to glucose (Jiang
and Zhang 2003; Ali and Drucker 2009). Glucagon also increases gluconeogenesis after
prolonged fasting through regulation of various histone acetyltransferases and histone
deacetylase complexes which subsequently affect gene expression (Authier and
Desbuquois 2008). Glucagon signaling impedes glucose breakdown (glycolysis) through
the inhibition of pyruvate dehydrogenase, thereby stopping the conversion of pyruvate to
acetyl CoA allowing it to be used as a substrate for gluconeogenesis (Authier and
Desbuquois 2008).
Gluconeogenesis is regulated by several signaling molecules, with
the most studied being forkhead box transcription factor O1 (FoxO1). FoxO1 has been
vastly studied since its discovery in 1995 (Davis, Bennicelli et al. 1995; Fredericks, Galili
et al. 1995), with an established role in regulation of gluconeogenesis (Nakae, Kitamura
et al. 2001; Puigserver, Rhee et al. 2003). In the fasted state, FoxO1 is predominantly
nuclear leading to increased transcription of target genes. FoxO1 directly regulates
transcription of Glucose-6-Phosphatase (G6Pase), the rate limiting enzyme and final step
of hepatic glucose production. It has also been implicated in increased transcription of
phosphoenolpyruvate carboxykinase (PEPCK), another rate limiting step in the pathway
of glucose production. Regulation of both of these enzymes is necessary for maintaining
normal glucose balance in times of prolonged fasting. Another important consequence of
glucagon signaling is the induction of lipolysis in white adipose tissue (Ali and Drucker
2009; Heppner, Habegger et al. 2010) . When lipolysis occurs, free fatty acids travel
2
through the blood to organs such as the muscle and liver to be used for energy through
beta oxidation and the TCA cycle leading to ATP production (Sommerfeld, KronesHerzig et al.).
1.1.2
The Liver in the Fed State
During feeding, the pancreas secretes insulin, a peptide hormone, which influences the
adipose tissue, muscle and liver to undergo glucose uptake for storage as glycogen or
fatty acids for later use (Gross, van den Heuvel et al. 2008). Circulating insulin during
feeding is cleared by the liver primarily, and to a lesser extent, the kidney (Duckworth,
Bennett et al. 1998). When insulin binds its receptor in the liver, the receptor undergoes
endocytosis and is dissociated from insulin, which then undergoes degradation
(Duckworth, Bennett et al. 1998; Poy, Yang et al. 2002). Also, when insulin binds its
receptor, the receptor becomes autophosphorylated and can subsequently induce a
signaling cascade via phosphotidylinositol 3’ kinase (PI3K) with activation of Akt/PKB
(Sommerfeld, Krones-Herzig et al. ; Kido, Nakae et al. 2001). Phosphorylation of Akt
downstream of the insulin receptor causes multiple effects such as phosphorylation of
glycogen synthase kinase 3 (GSK3) causing its inactivation leading to the activation of
pathways involving glycogen synthesis, protein synthesis, and fatty acid synthesis
(Rayasam, Tulasi et al. 2009). Akt also increases phosphorylation of forkhead box
family of transcription factors, notably FoxO1 (Kido, Nakae et al. 2001; Ramnanan,
Edgerton et al. 2010). Phosphorylation of FoxO1 leads to its cytoplasmic translocation
and inactivation, however, p300 mediated acetylation has also been recently implicated in
FoxO1 subcellular localization, (Perrot and Rechler 2005; van der Heide and Smidt 2005;
Qiang, Banks et al. 2010). Increased acetylation is associated with cytoplasmic
3
localization in combination with phosphorylation, while decreased acetylation allows for
nuclear localization and increases in FoxO1 transcriptional targets (Qiang, Banks et al.
2010; Banks, Kim-Muller et al. 2011). Inactivation of FoxO1 via translocation from the
nucleus to the cytoplasm leads to the suppression of gluconeogenic genes and the
expression of genes involved in glycogen synthesis and storage (Kido, Nakae et al. 2001;
Zhang, Patil et al. 2006). . Another pathway activated by insulin secretion in the liver is
glycolysis. Glycolysis is the breakdown of glucose by the liver into pyruvate which also
can be converted to lactate or acetyl CoA which subsequently enters the TCA cycle to
produce large amounts of ATP (Zhang, Patil et al. 2006). This process is regulated, in
part, by glucokinase (GK), the enzyme responsible for the conversion of glucose to
glucose 6 phosphate. Glucose 6 phosphate can then undergo further processing through
the pathway until it reaches the result of pyruvate. FoxO1 has also been shown to exert
effects on the glucokinase promoter in concert with hepatocyte nuclear factor 4 alpha
(HNF4) to regulate its expression in the fasted and fed states (Hirota, Sakamaki et al.
2008).
1.1.3
FoxO1 as a Regulator of Fasting and Feeding
FoxO1 is a member of the forkhead box family of transcription factors characterized by
conserved DNA binding domain and an N-terminal region containing an Akt
phosphorylation site (Cheng and White 2010). FoxO1 has an established role in
maintaining the balance between the gluconeogenesis and glycolysis pathways in times
of fasting and feeding (Liu, Dentin et al. 2008; Haeusler, Kaestner et al. 2010). FoxO1
localization is controlled by PKB/Akt signaling downstream of the insulin receptor
4
(Gross, Wan et al. 2009). In times of feeding, insulin signaling is high, along with
activation of Akt, which causes phosphorylation of FoxO1 and its chaperone, 14-3-3
(Nakae, Oki et al. 2008; Gross, Wan et al. 2009). This phosphorylation causes FoxO1 to
be sequestered to the cytoplasm, down-regulating its transcriptional effects (Zhang, Patil
et al. 2006; Gross, van den Heuvel et al. 2008; Nakae, Oki et al. 2008; Gross, Wan et al.
2009; Cheng and White 2010). In times of reduced Akt signaling (i.e. fasting) FoxO1 is
nuclear and exerting effects on various target genes such as the transcriptional regulator
peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1, and
enzymes that catalyze rate limiting steps in gluconeogenesis glucose 6 phosphatase
(G6Pase) and phosphoenolpyruvate carboxykinase (PEPCK) (Puigserver, Rhee et al.
2003; Samuel, Choi et al. 2006; Cheng and White 2010; Oiso, Furukawa et al. 2010;
Park, Kim et al. 2010; Ramnanan, Edgerton et al. 2010). FoxO1 binds insulin response
elements (IREs) on various genes exerting opposing effects from insulin signaling
(Cheng and White 2010). An interesting finding is that FoxO1 binds the insulin receptor
promoter and increases transcription and expression of the insulin receptor, thought to
prepare cells for the next cycle of insulin secretion/feeding (Puig and Tjian 2005). The
effects of FoxO1 that have been studied have been observed in mice exhibiting insulin
resistance or have some exogenous modification (i.e. siRNA, overexpression) (Samuel,
Choi et al. 2006; Zhang, Patil et al. 2006; Gross, Wan et al. 2009; Cheng and White
2010). The physiological contribution of FoxO1 in regulation of hepatic metabolism is
still not entirely clear (Zhang, Patil et al. 2006; Gross, van den Heuvel et al. 2008; Gross,
Wan et al. 2009; Cheng and White 2010).
1.2 Metabolic Syndrome and T2DM
5
Metabolic syndrome (MetS) has been defined as involving 5 characteristics:
dyslipidemia, abdominal obesity, hypertension, hyperglycemia, and insulin resistance
(Grundy, Brewer et al. 2004). MetS is occurring more and more frequently recent years
attributing to overnutrition and sedentary lifestyle (Ford, Kohl et al. 2005; Ford, Li et al.
2010). This is a serious issue due to the significant increase in risk of development of
cardiovascular disease (CVD) and type 2 diabetes mellitus (T2DM) (Grundy, Brewer et
al. 2004). T2DM is characterized by impaired glucose tolerance and hyperinsulinemia.
This disease is multi-faceted involving many organ systems and overall changes in
glucose homeostasis. There is an increased importance for prevention of disease onset
and finding possible treatments since T2DM accounts for 90% of all diabetes worldwide
and the incidence will double by 2025 (Doria, Patti et al. 2008).
1.2.1
Increased FoxO1 Activity promotes MetS and T2DM
Phenotype
The inability of organs to respond to insulin signaling is crucial for development of
T2DM. The lack of insulin signaling in the liver leads to lack of insulin clearance,
thereby increasing peripheral insulin concentrations (Poy, Yang et al. 2002). Higher
peripheral insulin concentrations cause other insulin responsive organs, such as the
muscle and adipose, to also become resistant. The muscle is responsible for the
approximately 80% of glucose uptake induced by insulin signaling (de Lange, Moreno et
al. 2007). This uptake occurs through insulin induction of GLUT4 translocation from the
cytoplasm stored in vesicles to the cell membrane. Loss of glucose uptake leads to
increased serum glucose, owing to hyperglycemia. Insulin resistance in adipose is
characterized by decreased uptake of triglycerides from the serum, partially attributing to
6
the increased dyslipidemia (Gallagher, LeRoith et al. 2010). Also, insulin resistance in
the adipose causes more release of free fatty acids (FFA) which can be used by other
organs such as the liver for increasing glucose production (Gallagher, LeRoith et al.
2010). In insulin resistance, many major signaling cascades are not functioning properly,
leading to the defects seen in T2DM. FoxO1 has been mostly studied under the influence
of insulin resistant states. Loss of function of hepatic FoxO1 has shown maintenance of
normoglycemia in db/db mice that were insulin resistant (Qu, Altomonte et al. 2006).
This lead to the discovery of the FoxO1 targets PEPCK and G6Pase, both rate-limiting in
hepatic glucose production. Similarly, gain-of-function studies involving
phosphorylation defective mutants of FoxO1 implicate it in exacerbation of the metabolic
syndrome phenotype (Gross, Wan et al. 2009; Cheng and White 2010) . FoxO1 has also
been shown to be regulated via acetylation along with phosphorylation (Perrot and
Rechler 2005; van der Heide and Smidt 2005), with acetylation actually seeming to
regulate FoxO1 subcellular localization more than phosphorylation (Qiang, Banks et al.
2010). As previously stated, insulin resistant states are usually accompanied by
hyperglycemia. Acetylation of FoxO1 is regulated both by CBP/p300 and the
deacetylase Sirtuin1 (SIRT1) leading to deacetylation of FoxO1 and nuclear localization
(Hirota, Sakamaki et al. 2008; Houtkooper, Pirinen et al. 2012) . Most recently published
has been the differences in expression of FoxO1 targets depending on if it is a
phosphorylation defective mutant versus an acetylation defective mutant (Banks, KimMuller et al. 2011). This increases the importance of finding FoxO1 binding partners and
seeing how they can affect FoxO1 post translational modifications and function.
7
1.2.2
Increased FoxO1 Activity Promotes Lipogenesis and
Hypertriglyceridemia
Hypertriglyceridemia and nonalcoholic fatty liver disease (NAFLD) are common
pathologic manifestations of obesity and insulin resistance as seen in type 2 diabetes
(Chavez-Tapia, Uribe et al. 2009; Subramanian and Chait 2012). However, the pathways
controlling these manifestations are still not completely known. Insulin resistance in the
liver is characterized by inability for the liver to suppress gluconeogensis and promote
glycogen synthesis. Conversely, in insulin resistance hepatic lipogenesis increases,
which is typically a sign of insulin sensitivity (Brown and Goldstein 2008). This is the
conflict that lead to the hypothesis of “selective insulin resistance” (Brown and Goldstein
2008). Researchers have been trying to identify the regulatory element involved in this
phenomenon and recent studies have implicated FoxO1 in regulation of this phenotype.
In humans with NAFLD, FoxO1 was reported to be more active with increased fat
deposition in the liver (Valenti, Rametta et al. 2008). In mice with constitutively active
FoxO1 it was shown that there was increased expression of lipogenic genes such as
SREBP1c, ACC, and FAS (Matsumoto, Han et al. 2006; Zhang, Patil et al. 2006).
FoxO1 has also been shown to regulate hepatic lipid metabolism and contribute to
hypertriglyceridemia through its regulation of rate limiting enzymes involved in
triglyceride synthesis (Sparks and Dong 2009). FoxO1 directly binds the promoter of
microsomal transfer protein (MTP) which is responsible for transporting lipids to apoB, a
rate limiting step in triglyceride synthesis (Sparks and Sparks 2008). FoxO1 also
increases apolipoprotein CIII which acts as an inhibitor of lipoprotein lipase (LpL),
protecting newly formed triglyceride from hydrolysis (Kim, Zhang et al. 2011).
Increased activity of FoxO1 contributes both to the defects in regulation of hepatic
8
glucose production and regulation of de novo lipogenesis, this research points to the
importance of FoxO1 and its potential for therapeutic intervention in metabolic syndrome
and type 2 diabetes.
1.3 Multiple Endocrine Neoplasia Type 1
Multiple Endocrine Neoplasia Type 1 (MEN1) Syndrome is an autosomal dominant
disorder involving the development of neuro-endocrine tumors by the 5th decade with
near 100% penetrance (Chandrasekharappa, Guru et al. 1997; Shen and Libutti 2010).
The protein product of the MEN1 gene, menin, has been characterized as a tumor
suppressor because the syndrome follows Knudson’s classic 2-hit hypothesis consisting
of one germline mutation followed by tumor development after a somatic mutation.
Tumors mainly occur in the anterior pituitary, endocrine pancreas and parathyroid which
exert a wide variety of hormonal symptoms (Lemos and Thakker 2008; Tsukada,
Nagamura et al. 2008). A striking feature of the MEN1 syndrome is the increased
incidence of glucose intolerance and type 2 diabetes (Wagner, Martin-Campos et al.
2005; McCallum, Parameswaran et al. 2006; van Wijk, Dreijerink et al. 2011). Studies of
the MEN1 gene and menin protein have not helped to elucidate a genotype-phenotype
correlation for MEN1 mutations, the selectivity of the tumor development, or apparent
metabolic symptoms (Lemos and Thakker 2008; Tsukada, Nagamura et al. 2008).
1.3.1
The Menin Gene and Protein
The MEN1 gene is located on chromosome 11q13 in humans consisting of 10 exons with
the coding region found on exons 2-10 (Chandrasekharappa, Guru et al. 1997; Guru,
9
Crabtree et al. 1999; Balogh, Patócs et al. 2010). Homologues have been found in
mouse, rat, zebrafish, and Drosophila melanogaster (Shen and Libutti 2010). Menin total
body heterozygotes developed a tumor profile similar to MEN1 after 9 months of age
(Bertolino, Tong et al. 2003). Since homozygous deletion of whole body menin is
embryonic lethal, menin conditional knockdowns and knockouts using the Cre/loxp
system of deletion have been studied in mice (Bertolino, Radovanovic et al. 2003;
Scacheri, Crabtree et al. 2004; Chen, Yan et al. 2006; Shen, He et al. 2009; Cheng, Yang
et al. 2011; Wuescher, Angevine et al. 2011; Wuescher, Angevine et al. 2012).
Knockouts in the endocrine pancreas did indeed cause tumor formation, but at 10-15
months of age (Bertolino, Tong et al. 2003; Crabtree, Scacheri et al. 2003; Shen, He et al.
2009). Since menin is expressed ubiquitously and at high levels in the liver, a targeted
homozygous deletion of Men1 was developed specifically in the liver (Scacheri, Crabtree
et al. 2004). Although there was no hepatoma formation, and no differences in life-span,
no metabolic parameters were measured, still leaving the question of increased incidence
of type 2 diabetes in these patients. This supports our hypothesis that menin is playing a
metabolic regulatory role in the liver. The mRNA product of the MEN1 gene is 2.8
kilobases in length, with 6 alternative transcripts only differing in the 5’-UTR (Bassett,
Rashbass et al. 1999; Fromaget, Vercherat et al. 2003). Little is known about the
transcriptional regulation of MEN1, but the protein product menin can influence the
transcription of the MEN1 gene as a compensatory effect when function of one allele is
lost, and we have previously shown that insulin regulates menin at the transcriptional
level; most recently, chronically high glucose was shown to decrease menin in the
pancreatic  cell (Fromaget, Vercherat et al. 2003; Zablewska, Bylund et al. 2003;
10
Wuescher, Angevine et al. 2011; Zhang, Li et al. 2012). Also, transcriptional regulation
depends on cell type (Fromaget, Vercherat et al. 2003; Zablewska, Bylund et al. 2003).
The protein product of MEN1 is a 67 kilodalton protein termed menin which was first
cloned in 1997 and shares 97% identity with both the mouse and rat menin
(Chandrasekharappa, Guru et al. 1997; Shen and Libutti 2010). Total knockout of menin
is embryonic lethal between days 11-13 while the hemizygous deletion yields a
phenotype similar to that of the human MEN1 syndrome with development of full neuroendocrine tumors at 16 months of age with all tumors showing loss of murine Men1
(Crabtree, Scacheri et al. 2001; Crabtree, Scacheri et al. 2003). The menin protein is
unique because it shares no homology with any other known protein (Balogh, Rácz et al.
2006; Balogh, Patócs et al. 2010; Huang, Gurung et al. 2012). The protein consists of 5
GTPase sites which only show GTP binding activity in the presence of nm23, a
suppressor of tumor metastasis (Yaguchi, Ohkura et al. 2002). Menin also contains 3
nuclear localization signals (NLSs) and multiple phosphorylation sites in the C-terminus
of the protein (MacConaill, Hughes et al. 2006; Shen and Libutti 2010; Francis, Lin et al.
2011). Mutations of all 3 of the NLSs do not prevent menin localization to the nucleus,
but affect its ability to elicit transcriptional effects on target genes in vitro (La, Desmond
et al. 2006). A study of pancreatic tumors in humans revealed that most of the MEN1
mutations were truncation mutations causing loss of the C-terminal region that includes
the NLSs and caused cytoplasmic localization (Corbo, Dalai et al. 2010). Mutations of
both of the phosphorylation sites on menin did not affect its ability to associate with the
mixed lineage leukemia (MLL) histone methyltransferase complex, but no other possible
consequences were studied (MacConaill, Hughes et al. 2006). More recently, consistent
11
with menin’s tumor suppressor function, it has been shown to be phosphorylated in
response to DNA damage (Francis, Lin et al. 2011). This phosphorylation was shown to
be required for menin dependent transcription of DNA damage response genes. To
further elucidate the function of the menin protein, the crystal structure was recently
discovered (Huang, Gurung et al. 2012). The structure revealed a binding pocket
containing 3 tetratricopeptide motifs which are responsible for protein-protein
interactions. It was shown that menin, which binds both JunD and MLL in the same
pocket, can regulate them differently. Menin suppressed JunD function while enhancing
MLL activity. Even with the discoveries of these functional motifs, there is still no
definitive physiological function for menin.
1.3.2
Menin Interacting Proteins (MIPs)
Although the physiological function of menin has not yet been elucidated, there have
been many proteins identified that do interact with menin indicating functions related to
cell cycle regulation, apoptosis, transcriptional regulation, and most recently, metabolism.
A major protein involved in regulation of growth and metabolism is PKB/Akt found
solely in the cytoplasmic compartment (Wang, Ozawa et al. 2010). Recently 2 papers
have been published showing menin’s regulation of the Akt pathway looking solely at the
proliferative consequences and showing menin as a negative regulator of Akt signaling
(Gao, Feng et al. 2010; Wang, Ozawa et al. 2010). Both the MAPK and Akt pathways
are activated down-stream of insulin receptor activation indicating that insulin receptor
signaling could require menin for a feedback mechanism. The most studied MIP is JunD
and the mechanism that menin can suppress its activation (Manickam, Vogel et al. 2000;
12
Kim, Lee et al. 2003; Huang, Gurung et al. 2012). Importantly, beside the fact that menin
does bind JunD, menin also can recruit a histone deacetylase complex and act a corepressor through association with mSin3A (Kim, Lee et al. 2003). Conversely, menin
has also been shown to associate with mixed lineage leukemia (MLL) in the trithorax
family of proteins with histone methyltransferase (HMT) activity (MacConaill, Hughes et
al. 2006; Caslini, Yang et al. 2007; Huang, Gurung et al. 2012). With both acetylation
and methylation being key epigenetic regulators of transcription, menin plays a major
role in the transcription of various genes. Menin also directly interacts with several
proteins such as Smad3 (TGF pathway) and NFB (Zindy, L'Helgoualc'h et al. 2006)
affecting target gene transcription (Heppner, Bilimoria et al. 2001; Kaji, Canaff et al.
2001; Theillaumas, Blanc et al. 2008). Menin has also been shown to regulate
transcription factors downstream of MAPK signaling (Gallo, Cuozzo et al. 2002). While
menin has been classified as a nuclear protein, it does interact with cytoplasmic proteins
involved in cell cycle regulation such as vimentin and glial fibrillary acidic protein
(GFAP) (Balogh, Rácz et al. 2006; Balogh, Patócs et al. 2010).
1.3.3
Hepatic Menin
Menin plays a role in the liver starting during development. Men1 null pups are
embryonic lethal at day E11-13.5. During this timeframe, the liver undergoes its highest
phase of growth as it develops into the main hematopoietic organ of the fetus (Zorn
2008). Although Men1 null pups have cranio-facial defects, they also show massive
hemorrhage in the abdominal cavity with abnormal liver development (Bertolino,
Radovanovic et al. 2003; Lemos, Harding et al. 2009). Tissue specific knockout of
menin in the liver was analyzed in the context of tumor suppression, showing loss of
13
menin was well tolerated (Scacheri, Crabtree et al. 2004). However, no metabolic
parameters were measured. Recently, there has been increasing interest in hepatic menin
due to its involvement in regulation of fibrogenesis in hepatocellular carcinoma via
regulation of the collagen type 1 promoter (Zindy, L'Helgoualc'h et al. 2006). Menin has
now been implicated in regulation of PPAR mediated control of beta oxidation to
prevent hepatic lipid accumulation (Cheng, Yang et al. 2011). Importantly, our
contribution to the growing field of research is the involvement of menin with FoxO1, a
main regulator of the switch between fasting and feeding metabolism (Wuescher,
Angevine et al. 2011). Additionally, after high fat challenge with tissue specific
knockdown of menin, we saw an exacerbation of metabolic syndrome phenotype
indicating not just a role for menin in regulation of beta oxidation, but whole body
glucose metabolism (Wuescher, Angevine et al. 2012).
1.3.4
Summary and Hypothesis
As previously discussed, the menin protein is ubiquitously expressed but poorly
understood. An abundance of research has been dedicated to finding the key to the
neuroendocrine tissue specificity of the MEN1 Syndrome phenotype, but little has been
designated to the metabolic aspects of the disease. `Although a liver specific knockout
has been achieved, again, there were no studies on any sort of metabolic phenotype. As
FoxO1 is a main regulator of gluconeogenesis in the liver and aberrant FoxO1 activation
is associated with metabolic syndrome phenotype, it was used as an initial target of the
menin protein. Based on evidence that the MEN1 Syndrome is accompanied by a
metabolic phenotype, and that the liver is a main regulator of glucose homeostasis via
14
FoxO1, we hypothesize: Hepatic menin is a metabolically relevant protein due to
mediating effects on gluconeogenesis through regulation of FoxO1.
15
Chapter 2
Insulin regulates Menin expression, cytoplasmic localization and interaction with
FOXO1.
(Published in: Am J Physiol Endocrinol Metab. 2011 Sep;301(3):E474-83)
Leah Wuescher, Kristine Angevine, Terry Hinds, Sadeesh Ramakrishnan, Sonia Najjar,
and Edith Mensah-Osman†.
Center for Diabetes and Endocrine Research (CeDER), Department of Pharmacology &
Physiology, University of Toledo College of Medicine, Toledo, OH.
†Address correspondence to:
Edith Mensah-Osman, M.D., Ph.D.
College of Medicine
University of Toledo
Health Science Campus
3000 Arlington Avenue, Mail stop 1008
Toledo, Ohio, 43614
Tel: (419) 383-4183
Fax: (419) 383-2871
e-mail: [email protected]
Running Title: Menin, a novel target of insulin signaling.
16
Keywords: Menin, insulin, FOXO1, AKT
Acknowledgement: The work has been supported by institutional funds to E MensahOsman and by grants from the National Institutes of Health (DK054254 and DK083850)
and the United States Department of Agriculture (USDA 38903-02315) to SM Najjar.
Abstract:
Menin is the ubiquitously expressed nuclear protein product of the MEN1 gene, which
interacts with PKB/AKT in the cytoplasm to inhibit its activity. This study describes a
novel insulin-dependent mechanism of menin regulation and interaction with other
metabolic proteins. We show that insulin down-regulated menin in a time-dependent
manner via the human insulin receptor. Inhibition analysis indicated a critical role for the
protein kinase AKT in regulation of menin expression and localization. Insulin mediated
decrease in menin expression was abrogated by the PI3K/AKT inhibitor, LY294002 at
early time points, from 2 hours until 7 hours. Furthermore, exposure to insulin resulted in
the cytoplasmic localization of menin and increased interaction with FOXO1. Fasting
followed by refeeding modulates serum insulin levels, which corresponded to an increase
in menin interaction with FOXO1 in the liver. Liver specific hemizygous deletion of
menin resulted in increased expression of FOXO1 target genes, namely IGFBP1, PGC1,
insulin receptor, AKT and G6Pase. This study provides evidence that menin expression
and localization is regulated by insulin signaling, and that this regulation triggers an
17
increase in its interaction with FOXO1 via AKT with metabolic consequences.
Introduction:
Menin is the protein product of the multiple endocrine neoplasia type 1 (MEN1)
gene with its loss causing a syndrome characterized by development of neuroendocrine
tumors. Menin has been shown to interact with key transcriptional elements such as NFkB, Smad 3 and JunD, to regulate expression of their target genes (1) (11) (12). Menin is
ubiquitously expressed in all tissues, both endocrine and neuro-endocrine,(23) and has
been described as a tumor suppressor gene in all organs except the liver (21). Previous
reports have described a high prevalence of impaired fasting glucose and diabetes
mellitus in families with MEN1 inheritance (15). Karnik et al implicated menin in the
development of gestation-induced diabetes and associated the loss of menin in beta cells
of pancreatic islets to increased proliferation (13).
Menin regulates transcription factors downstream of mitogen activated protein
kinase (MAPK) signaling (9) and interacts with cytoplasmic proteins involved in cell
cycle regulation (6). A major protein involved in regulation of growth and metabolism is
protein kinase B (PKB/AKT). This important serine kinase, found in the cytoplasmic
compartment, is inactivated by menin via direct interaction (24). Both the MAPK and
AKT pathways are activated down-stream of insulin receptor signaling indicating menin
could be involved in the regulation of this signaling cascade.
Although the physiological role of menin has not yet been elucidated, there have
been many proteins identified that interact with menin alluding to functions related to cell
cycle regulation, apoptosis and transcriptional regulation.
18
The transcription factor FOXO1 plays a central role in the hepatic regulation of key
metabolic genes involved in glucose and fatty acid metabolism, as well as cellular growth
and differentiation (10, 22). The transcriptional activity of FOXO1 is regulated by insulin
via AKT. In the presence of insulin, FOXO1 is inactivated by AKT through
phosphorylation resulting in the translocation of FOXO1 into cytoplasm (14).
Deregulated expression and activity of FOXO1 protein results in secondary insulin
resistance (8). Fasting and re-feeding acutely modulate insulin levels to activate genes
involved in glucose production and fatty acid metabolism. In times of feeding and high
AKT activity, FOXO1 is exported from the nucleus into the cytoplasm (20). In the liver,
FOXO 1 mediates the switch from glycolysis and carbohydrate metabolism to
gluconeogenesis with Glucose-6-Phosphatase (G6Pase) enzyme playing a rate-limiting
role (4).
In this study we demonstrate that insulin is a direct regulator of menin expression
via the AKT pathway and modulates interaction of menin with FOXO1 in primary
hepatocytes and HepG2 cells. We identified that fasting and refeeding regulate the
expression of menin in the liver and is also associated with increased interaction of menin
with FOXO1 in vivo. We further implicate hepatic menin in glucose metabolism since the
hemizygous deletion in the liver induces overproduction of G6Pase, IGFBP1, PGC1,
which are FOXO1 target genes, involved in hepatic glucose production. Furthermore,
liver specific menin hemizygous mice display reduced glucose levels during glucose
tolerance tests while insulin tolerance testing showed no change. These results provide
evidence that menin has a metabolic role in the liver whose interaction with FOXO1
increases during refeeding and is regulated by insulin.
19
Experimental procedures
Animal Maintenance: Animals were kept in a 12-hour dark/light cycle and fed standard
chow ad libitum. All procedures were approved by Institutional Animal Care and
Utilization Committeeat the University of Toledo. Liver specific menin hemizygous
mice on a mix of FVB/129S mice expressing loxP sequences on exons 3-10 of the Men1
gene and C57/Blk6 mice expressing Albumin-Cre were crossed together and genotyping
performed with tail lysates. Wild-type (WT) and Flox (loxP) sequences with Cre
expression were considered hemizygous for menin in the liver (HETs). Genotyping:
Primers A+G give the WT allele, primers F+G give the floxed allele. The primer
sequences are as follows:
A-Men 1: 5’ – TCC AGT CCC TCT TCA GCT TC – 3’
F-Men1: 5’ – GCC ATT TCA TTA CCT CTT TCT CCG – 3’
G-Men1: 5’ – TAC CAC TGC AAA GGC CAC GC – 3’
Cre Forward: 5’ – TGA GGT TCG CAA GAA CCT GAT GGA – 3’
Cre Reverse: 5’ – GCC GCA TAA CCA GTG AAA CAG CAT – 3’
Tail snips were collected from mice at 21 days after birth digested in a mixture of direct
PCR, tail lysis buffer (Thermo Fisher Scientific, Pittsburgh PA) plus Proteinase K
(Roche, Indianapolis, IN) overnight, rotating at 55˚C. Lysates were collected incubated
at 85˚C for 45 minutes. The lysates then underwent PCR with the following conditions:
20
The PCR running conditions for the Men-1 gene: An initial step of 95˚C for 15 min
followed by 35 cycles of denaturing at 94˚C for 30s, annealing at 62˚C for 30s, and
extension at 72˚C for 1m30s with a final step of 1 cycle of 72˚C for 10min and hold at
4˚C.
The PCR running conditions of the Cre gene: An initial step 95˚C for 15 min followed by
35 cycles of denaturing at 94˚C for 30s, annealing at 66.6˚C for 30s, and extension at
72˚C for 1m30s with a final step of 1 cycle of 72˚C for 10min and hold at 4˚C.
PCR products were run on a 1% agarose gel in TAE for 30min at 120V.
Mice were euthanized at 25 weeks of age.
Cell culture. Primary hepatocytes were isolated from livers of WT mice according to the
protocol (19) and HepG2 cells were maintained at 37°C and 5% CO2 in DMEM medium
containing 10% FBS and penicillin and streptomycin. All experiments were performed on
80% confluent cells.
Transfections. Stable transfection of NIH 3T3 cells with the human insulin receptor have
previously been described (7).
Western blot. The concentration of proteins in tissue and serum lysates was quantitated
by BCA protein assay (Pierce, Rockford IL), prior to analysis by 10% or 4-12% gradient
SDS-PAGE (Invitrogen, Carlsbard CA), respectively, and immunoprobing with specific
antibodies. These include polyclonal antibodies against Menin (AbCam, Cambridge MA
and Santa Cruz Biotechnology Inc, Santa Cruz CA), FOXO1, (Santa Cruz Biotechnology
Inc, Santa Cruz CA), pERK and ERK (Cell Signaling, Beverly, MA), in addition to
21
monoclonal antibodies against GAPDH and Lamin B (Sigma-Aldrich, St. Louis MO).
Proteins were detected by Odyssey INFRA-Red imaging system using corresponding
secondary antibodies conjugated to near infrared dyes.
Cellular Fractionation. Cells were fractionated using the NE-PER nuclear protein
extraction kit (Thermo Scientific, Rockford, IL) according to manufacturer’s protocol.
Briefly, cells were harvested via trypsin-EDTA (Invitrogen, Carlsbad CA) and pelleted at
500xg for 5 minutes (all centrifuge steps at 4˚C). Supernatant was removed, 200ml of ice
cold CERI (cytoplasmic extraction reagent 1) added to pellet (supplemented with
protease and phosphatase inhibitors) and vortexed vigorously for 15s. Mixture was
incubated for 10min prior to adding 11l of CERII (cytoplasmic extraction reagent 2),
vortexed for 5s. Mixture was Incubated on ice for 1min, vortexed again and centrifuged
for 5min at max speed. Supernatant (cytoplasmic fraction) was extracted and stored on
ice. Pellet was resuspended in 100l of NER (nuclear extraction reagent, supplemented
with protease and phosphatase inhibitors), vortexed for 15s and steps repeated every 10
min for a total of 40min. Mixture was centrifuged at full speed for 10min and extracts
subjected to immunoprecipitation and immunoblotting.
Immunoprecipitation. Primary hepatocytes and HepG2 cells were lysed and proteins
(1mg) were subjected to immunoprecipitation with an anti-menin or anti FOXO1
polyclonal antibody analyzed on SDS-PAGE, followed by immunoprobing with FOXO1
and Menin.
Quantitative Real Time PCR. RNA was extracted using the TRIZOL method according
to the manufacturer’s protocol. Following DNAse digestion (DNAfree, Ambion), 100ng
22
RNA was transcribed into cDNA in a 20µl reaction using a High Capacity cDNA kit
(Applied Biosystems, Carlsbard CA), analysed and amplified (ABI 7900 HT system).
PCR was performed in a 10µl reaction, containing 5µl cDNA (1/5 diluted), 1xSYBR
Green PCR Master Mix (Applied Biosystems, Carlsbard CA) and 300nM of each primer.
Menin forward primer: TCATTGCTGCCCTCTATGCC
Menin reverse primer: TCCAGTTTGGTGCCTGTGATG
GAPDH forward primer: CCACCAGCCCCAGCAAGAGC
GAPDH reverse primer: GGCAGGGACTCCCCAGCAGT
18s forward primer: TTGACGGAAGGGCACCACCAG
18s reverse primer: GCACCACCACCCACGGAATCG
Ct values (cycle threshold) were used to calculate the amount of amplified PCR product
relative to GAPDH or 18s. The relative amount of mRNA was calculated as 2–
.
Results were expressed as fold change as means ± SEM.
Immunocytochemistry. Cells were fixed in 4% paraformaldehyde/PBS on and blocked
with 20% normal donkey serum/PBS and 0.1% Triton X-100 for 30 min. The slides were
incubated for 1 h with a 1:50 dilution of rabbit anti-menin (Bethyl labs, Montgomery
TX), insulin receptor or FOXO1 antibody. A 1:200 dilution of FITC-conjugated antirabbit was used as the secondary antibody.
Insulin Radioimmunoassay. Whole blood was collected via retro-orbital bleeding in
anticoagulant treated capillary tubes at the appropriate time-points after an 18h fast and
23
post re-feeding. Serum was collected after whole blood was spun down at 4 degrees
Celsius and the supernatant was aliquoted to new tubes and stored at -20 degrees Celsius
until use. RIA was conducted using Millipore (Billerica MA) kit #SRI-13K. Briefly,
overnight at 4 degrees Celsius. The next day,
125
I-insulin was added to samples and
samples were incubated for 24 hours at 4 degrees Celsius. Precipitating reagent was
added to tubes followed by vortexing and centrifugation. All tubes were counted with a
gamma counter and serum insulin was calculated from those values.
Glucose and Insulin Tolerance Tests. Mice were fasted for 18h (glucose) and 6h
(insulin) respectively. Mice were then injected intraperitoneally with either 0.5U/kg
insulin or 1.5g/kg glucose and glucose measurements were taken up to 3h post injection
using Accu-Chek glucometers (Roche, Indianapolis IN).
Statistical analysis. Data were analyzed with SPSS software using one-factor ANOVA
analysis or Student’s t-test. P<0.05 were statistically significant.
Results:
Insulin Regulates Menin expression via the Insulin Receptor - Western analysis
reveals that insulin (100nM) caused a progressive decrease in menin protein levels in
mouse primary hepatocytes with a pronounced effect after 24 hours (Fig. 1A).
To elucidate the mechanism by which insulin regulated menin expression, we treated
stably transfected NIH-3T3 cells with human insulin receptor (3T3-hIR) and
untransfected cells (3T3) (7) with 100nM insulin for 24 hours prior to evaluating menin
24
levels by western analysis. As shown in (Fig 1B), insulin (Ins) failed to modulate menin
protein content in the native 3T3 cells. In 3T3-hIR cells, baseline menin protein level was
higher than in untransfected cells, but was significantly downregulated by insulin. This
observation was specific for insulin since glucagon (GLU) did not change menin
expression in either cell group. The data indicate that insulin exerts a down-regulatory
effect on menin expression level in a manner depending on its receptor.
Effect of multiple time points of insulin exposure on menin mRNA
We investigated the direct effect of insulin on menin in primary hepatocytes isolated
from mouse liver. We determined that 100nM of insulin caused a time-dependent
biphasic effect on menin expression, increasing menin mRNA at 1 hr of exposure and
gradually decreasing to below baseline levels by 24hrs. The transcription initiation
inhibitor, amanitin, inhibited insulin’s ability to induce menin mRNA, at 1hr to 4 hrs,
however not at the 24 hour time point, indicating that insulin is an acute transcriptional
activator of menin (Fig. 1C). Interestingly, while insulin had no effect on menin mRNA
at 24hr hrs, the decrease in menin protein suggests a post-translational effect on
expression.
Effect of LY294002 and UO126 on menin expression- Since insulin activates the
PI3K/AKT signaling pathway, we investigated the effect of LY294002 on menin
expression with and without insulin. LY294002 is an inhibitor of PI3K/AKT signaling
that regulates cell metabolism and survival (5, 13). In Figure 2B we show that LY294002
(LY) abrogated the acute effect of insulin on menin expression between 2 and 7hrs but
25
not at 24hrs. Furthermore, the analysis showed that at 24 hrs both insulin and LY294002
decreased menin protein levels but together had no effect. It is interesting to note that at
24hrs AKT phosphorlyation was absent with insulin treatment (Fig 2A). Figure 2B is a
quantification of the near infrared signal from the conjugated secondary antibodies
showing the relative protein expression of menin to GAPDH graphed from three separate
experiments.
Since insulin activates the MAPK pathway we performed similar experiments with
the MAPK inhibitor, UO126 and determined the effect on menin expression and ERK
phosphorylation. In Figure 2C, we show that UO126 did not reverse the effect of insulin
on menin expression at 2, 4 or 7h of exposure. Contrary to LY294002, UO126 effectively
abrogated insulin effect on menin levels at 24hrs. Interestingly, the highest level of ERK
phosphorylation is observed with insulin at 24hrs (Fig 2C), the time at which pAKT was
undectectable (Fig 2A). Figure 2D is a quantification of the near infrared signal from the
conjugated secondary antibodies showing the relative protein expression of menin to
GAPDH graphed from three separate experiments.
Insulin mediates Cellular Localization of menin protein - Since AKT is known to
mediate the action of insulin to sequester a number of target proteins from the nucleus to
the cytoplasm (5), we hypothesized that insulin causes translocation of menin from the
nucleus into the cytoplasm. Insulin treatment of primary hepatocytes caused traslocation
of menin from the nucleus into the cytoplasm, as demonstrated by increased
immunostaining of menin in the cytoplasmic compartment (Fig. 3A, green, middle
panel). In the presence of LY294002 (LY) the effect of insulin was prevented and menin
remained in the nucleus (Fig. 3A, right panel). These observations were further supported
26
by western analysis, which revealed a predominant menin expression in the nuclear (N)
fractions in the absence of insulin (i). Insulin treatment, however, caused a reduction in
menin nuclear content with a concomitant appearance in the cytoplasmic fractions (C)
(ii). LY294002 prevented the negative effect of insulin on nuclear distribution of menin
(iii), consistent with a role for the AKT pathway in mediating cellular localization of the
menin protein. (Fig. 3B) shows the decrease in menin expression in nuclear extracts
relative to Lamin B after treatment with insulin and which was abrogated with LY294002
(LY) exposure.
Insulin enhances the interaction of menin with FOXO1 - AKT-mediated
phosphorylation of FOXO 1 induces its cytoplasmic localization in response to insulin
(26), thus we hypothesized that insulin induces FOXO1 and menin interaction. Coimmunoprecipitation assays detected FOXO1 in the menin immunopellet (IP) from
mouse primary hepatocyte lysates treated with insulin (100nM) for 2hrs, but not 15
minutes (Fig. 4A). The level of interaction is increased by approximately 4-fold as
demonstrated by the graph insert depicting FOXO1/menin expression.
Co-
immunoprecipitation experiments using HepG2 cells further revealed that the complex
formation between menin and FOXO1 also involves 14-3-3, which mediates the
translocation of FOXO1 from the nucleus into the cytoplasm (Fig. 4B). The insulinmediated menin/14-3-3/FOXO1 complex was specific since the association of menin
with other proteins implicated in insulin metabolism such as CEACAM1 (16, 17),
occurred independently of insulin treatment (data not shown). We further determined the
cellular localization using multiple time points at which insulin enhanced the menin
FOXO1 interaction. In Figure 4C we show that insulin enhanced the cytoplasmic
27
interaction of menin with FOXO1 at 2hrs, after which interactions returned back to
baseline by 24hrs. Furthermore, the highest reduction of menin and FOXO1 interaction in
the nucleus with insulin exposure occurred at 2hrs.
Figure 4D shows the relative
expression of FOXO1 to total menin. Note how the interaction trends towards an increase
in the cytoplasm while decreasing in the nuclei with early time points.
Since AKT is implicated in insulin regulation of FOXO1 cellular distribution, we
investigated the effect of AKT inhibitor LY294002 on the insulin-mediated meninFOXO1 interaction. As expected, insulin treatment for 2hrs, but not 15 min elevated the
interaction of menin with FOXO1 by approximately 3-fold in primary hepatocytes (Fig.
5A). Interestingly, the baseline interaction of menin with FOXO1 was elevated with
LY294002 in the absence of insulin, but remained unchanged with insulin treatment at 15
min and 2 hrs (Fig 5A). Interestingly, the MAPK inhibitor UO126 (UO) inhibited the
interaction of menin and FOXO1 independent of insulin.
We also performed immunocytochemical analysis to demonstrate the induced
translocation of menin to the cytoplasm by insulin (Fig. 5B, panel 8). Consistent with Fig.
5A, the effect of insulin was blocked by LY294002 (LY) (Fig. 5B, panel 10). Insulin
caused a similar effect on FOXO1 distribution (Fig. 5B, panel 4 versus 2). Merging
menin (green) and FOXO1 (red) labeling indicated a diffuse interaction between FOXO1
and menin in the presence of insulin in both the nucleus and cytoplasm (Fig. 5B, panel
14), and this interaction was localized predominately to the nucleus with LY pretreatment
(Fig. 5B panel 16). Consistent with the IP data shown in Figure 5A, UO126 inhibited the
interaction of menin and FOXO1 independent of insulin (panels 17 &18). Taken together,
the data show that insulin sequesters menin to the cytoplasm and increases its interaction
28
with FOXO1 primarily via activating the AKT signaling pathway,
In order to establish a functional role for our observation in in vitro we first
determined the physiological stimuli that will cause the interaction of menin with
FOXO1. Because hepatic FOXO1 levels and activity are modulated metabolically in the
liver, we subjected C57/BLK6 male mice to a fasting-refeeding paradigm prior to
examining menin-FOXO1 interaction in liver lysates. Consistent with the cell data, coimmunoprecipitation analysis detected minimum FOXO1 and menin interaction in the
immunopellet derived from fasted animals. However refeeding by 7 hr significantly
enhanced the FOXO1 and menin interaction (Fig. 6A), in correlation with highest plasma
insulin levels (Fig. 6B). Furthermore, the menin/FOXO1 interaction in the liver is present
at baseline when animals are subjected to ad libitum feeding (Fig. 6A).
Partial loss of menin in the liver increases AKT signaling and induces FOXO1
target genes. To determine if menin had a role to play in the metabolic processes of the
liver we developed a hemizygous deletion of menin specifically in hepatocytes using
FVB/129S mice expressing loxP sequences on exons 3-10 of the Men1 gene crossed to
C57/Blk6 mice expressing Albumin-Cre. At 6 months of age, we analyzed genes that are
direct targets of FOXO1 involved in glucose synthesis. In (Fig. 7A) we show a significant
decrease in menin RNA expression in mice with liver specific hemizygous deletion of
menin (HET). Interestingly, while the expression of FOXO 1 remained unchanged
(Fig.7D), its target genes, insulin receptor (insR) (Fig. 7B), AKT (Fig 7C) as well as
IGFBP1 (Fig 7E), G6Pase (Fig 7F) and PGC1 (Fig 7G) were all significantly
upregulated consistent with enhanced FOXO1 activity. In contrast, the FOXO1
independent metabolic gene glucokinase (GK) was unchanged, and interestingly, the
29
gluconeogenic marker PEPCK also remained unchanged. Furthermore, the menin
hemizygote mice displayed reduced glucose excursions during glucose tolerance test
(GTT) compared with control mice while the insulin tolerance test (ITT) showed no
change (Fig.8).
The implications for these findings are under investigation in our lab, however,
we hypothesize that the interactions between menin and FOXO1 play a role in induction
of FOXO1 specific target genes described in Fig 7 and may partially explain the observed
phenotype of reduced glucose excursion in mice with partial deletion of the MEN1 gene
in the liver after IPGTT but not IPITT, shown in Fig 8.
Discussion:
Hepatic glucose production (HGP) plays an important role in maintaining glucose
homeostasis and is mediated by FOXO1, activated by fasting to induce gluconeogenic
and glycogenolytic genes involved in HGP. Menin is a tumor suppressor protein that
interacts and negatively regulates the activities of several transcription factors (2).
Although loss of the MEN1 gene is associated with insulinomas and increased serum
insulin, the reciprocal relationship between menin and insulin has not been well
delineated. We show for the first time that insulin is a direct regulator of menin
expression at both the transcriptional and translational levels. Furthermore insulin effect
is biphasic with an initial early response mediated by AKT (Fig 2A) and by 24hrs
predominately by MAPK signaling (Fig 2B).
Menin has never been previously described to be involved in FOXO1 mediated
HGP, and no glucose metabolism defects have been described in liver specific menin
30
deficient mice.
The most intriguing interpretation of our data is in support of the
hypothesis that menin plays an important role in metabolism in the liver. FOXO1 has an
established role in maintaining the balance between the gluconeogenesis and glycolysis
pathways in times of fasting and feeding.
FOXO1 localization is controlled by
PKB/AKT signaling downstream of the insulin receptor. In times of feeding, insulin
signaling is high, along with activation of AKT, which causes phosphorylation of
FOXO1 and its chaperone, 14-3-3.
This phosphorylation causes FOXO1 to be
sequestered to the cytoplasm, down-regulating its transcriptional effects. In times of
reduced AKT signaling (i.e. fasting), FOXO1 is nuclear and exerts its effects on various
target genes such as glucose 6 phosphatase (G6Pase), which catalyzes the rate limiting
step in gluconeogenesis. Our data shows that insulin enhances the interaction of menin
with FOXO1 within the cytoplasm (Figs 4C & 5B panel 14) and loss of menin is
associated with up-regulation of FOXO1 target genes (Fig 7). These observations suggest
that menin may repress FOXO1 transcriptional activity by recruiting the FOXO1/14-3-3
complex into the cytoplasm. We propose that insulin binding to its receptor activates the
AKT signaling pathway and down-regulates menin levels at early time points (acute
phase), while MAPK regulation of menin sets in at later time points (chronic phase).
Interestingly, the reduction in menin expression occurs at a latter time point (about 24hrs)
really suggesting a MAPK mediated effect, while interaction with FOXO1 is an early
time event mediated by AKT. Since menin is a rate-limiting protein required to inhibit
AKT activation, its interaction directly with FOXO1 may be required to repress FOXO1
transcriptional activity by causing its translocation into the cytoplasm.
We further observed that partial deletion of menin does not affect the expression of
31
FOXO1 but induces the expression of FOXO1 specific genes, in support of the
hypothesis that menin negatively regulates FOXO1 activity at the post-transcriptional
level via direct interaction.
Indeed the finding that insulin increases the interaction
between menin and FOXO1 via an AKT-dependent pathway is entirely novel, and
implicates menin in FOXO1 mediated effects of insulin on glucose homeostasis and
production (5, 18). FOXO1 is expressed in tissues involved in energy metabolism such as
the liver (25), pancreas and gut (3) and inhibition of its function by insulin (5) may
require menin.
Thus our current studies suggest that while menin may be mediating the
mitogenic functions of insulin, an important effect may be to modulate the insulin
mediated FOXO1 regulated metabolic pathways in the liver. Furthermore, since menin is
an inhibitor of AKT activation, its expression may be the rate-limiting step in maintaining
the metabolic homeostasis within the liver regulated by insulin.
In summary, insulin regulates menin expression, subcellular localization and
interaction with FOXO1 via nuclear-cytoplasmic shuttling. Loss of menin leads to
enhanced FOXO1 activity as evidenced by specific increase in FOXO1 target genes.
Although the physiological significance of insulin’s regulation on the menin/FOXO1
interaction in the liver needs to be further elucidated, this current study indicates that
insulin regulation of menin expression and interaction with FOXO1 may be essential for
the regulation of hepatic glucose production in the liver. We propose that menin is
required for the optimal repression of FOXO1 transcriptional activity, a protein that plays
crucial roles in positive and negative regulation of cell proliferation, gluconeogenesis and
glycolysis.
32
References:
1.
Agarwal SK, Guru SC, Heppner C, Erdos MR, Collins RM, Park SY, Saggar
S, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ, and Burns AL. Menin
interacts with the AP1 transcription factor JunD and represses JunD-activated
transcription. Cell 96: 143-152, 1999.
2.
Agarwal SK, Kennedy PA, Scacheri PC, Novotny EA, Hickman AB, Cerrato
A, Rice TS, Moore JB, Rao S, Ji Y, Mateo C, Libutti SK, Oliver B,
Chandrasekharappa SC, Burns AL, Collins FS, Spiegel AM, and Marx SJ. Menin
molecular interactions: insights into normal functions and tumorigenesis. Horm Metab
Res 37: 369-374, 2005.
3.
Altomonte J, Cong L, Harbaran S, Richter A, Xu J, Meseck M, and Dong
HH. Foxo1 mediates insulin action on apoC-III and triglyceride metabolism. J Clin
Invest 114: 1493-1503, 2004.
4.
Altomonte J, Richter A, Harbaran S, Suriawinata J, Nakae J, Thung SN,
Meseck M, Accili D, and Dong H. Inhibition of Foxo1 function is associated with
improved fasting glycemia in diabetic mice. Am J Physiol Endocrinol Metab 285: E718728, 2003.
5.
Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ,
Arden KC, Blenis J, and Greenberg ME. Akt promotes cell survival by
phosphorylating and inhibiting a Forkhead transcription factor. Cell 96: 857-868, 1999.
6.
Cao Y, Liu R, Jiang X, Lu J, Jiang J, Zhang C, Li X, and Ning G. Nuclearcytoplasmic shuttling of menin regulates nuclear translocation of {beta}-catenin. Mol
Cell Biol 29: 5477-5487, 2009.
7.
Choice CV, Howard MJ, Poy MN, Hankin MH, and Najjar SM. Insulin
stimulates pp120 endocytosis in cells co-expressing insulin receptors. J Biol Chem 273:
22194-22200, 1998.
8.
Dong XC, Copps KD, Guo S, Li Y, Kollipara R, DePinho RA, and White MF.
Inactivation of hepatic Foxo1 by insulin signaling is required for adaptive nutrient
homeostasis and endocrine growth regulation. Cell Metab 8: 65-76, 2008.
9.
Gallo A, Cuozzo C, Esposito I, Maggiolini M, Bonofiglio D, Vivacqua A,
Garramone M, Weiss C, Bohmann D, and Musti AM. Menin uncouples Elk-1, JunD
and c-Jun phosphorylation from MAP kinase activation. Oncogene 21: 6434-6445, 2002.
33
10.
Hall RK, Yamasaki T, Kucera T, Waltner-Law M, O'Brien R, and Granner
DK. Regulation of phosphoenolpyruvate carboxykinase and insulin-like growth factorbinding protein-1 gene expression by insulin. The role of winged helix/forkhead proteins.
J Biol Chem 275: 30169-30175, 2000.
11.
Heppner C, Bilimoria KY, Agarwal SK, Kester M, Whitty LJ, Guru SC,
Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ, and Burns AL. The
tumor suppressor protein menin interacts with NF-kappaB proteins and inhibits NFkappaB-mediated transactivation. Oncogene 20: 4917-4925, 2001.
12.
Kaji H, Canaff L, Lebrun JJ, Goltzman D, and Hendy GN. Inactivation of
menin, a Smad3-interacting protein, blocks transforming growth factor type beta
signaling. Proc Natl Acad Sci U S A 98: 3837-3842, 2001.
13.
Karnik SK, Chen H, McLean GW, Heit JJ, Gu X, Zhang AY, Fontaine M,
Yen MH, and Kim SK. Menin controls growth of pancreatic beta-cells in pregnant mice
and promotes gestational diabetes mellitus. Science 318: 806-809, 2007.
14.
Matsuzaki H, Daitoku H, Hatta M, Tanaka K, and Fukamizu A. Insulininduced phosphorylation of FKHR (Foxo1) targets to proteasomal degradation. Proc Natl
Acad Sci U S A 100: 11285-11290, 2003.
15.
McCallum RW, Parameswaran V, and Burgess JR. Multiple endocrine
neoplasia type 1 (MEN 1) is associated with an increased prevalence of diabetes mellitus
and impaired fasting glucose. Clin Endocrinol (Oxf) 65: 163-168, 2006.
16.
Najjar SM. Regulation of insulin action by CEACAM1. Trends Endocrinol
Metab 13: 240-245, 2002.
17.
Najjar SM, Yang Y, Fernstrom MA, Lee SJ, Deangelis AM, Rjaily GA, AlShare QY, Dai T, Miller TA, Ratnam S, Ruch RJ, Smith S, Lin SH, Beauchemin N,
and Oyarce AM. Insulin acutely decreases hepatic fatty acid synthase activity. Cell
Metab 2: 43-53, 2005.
18.
Nakae J, Kitamura T, Silver DL, and Accili D. The forkhead transcription
factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. J
Clin Invest 108: 1359-1367, 2001.
19.
Powers AC, Efrat S, Mojsov S, Spector D, Habener JF, and Hanahan D.
Proglucagon processing similar to normal islets in pancreatic alpha-like cell line derived
from transgenic mouse tumor. Diabetes 39: 406-414, 1990.
34
20.
Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura
Y, Altomonte J, Dong H, Accili D, and Spiegelman BM. Insulin-regulated hepatic
gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 423: 550-555, 2003.
21.
Scacheri PC, Crabtree JS, Kennedy AL, Swain GP, Ward JM, Marx SJ,
Spiegel AM, and Collins FS. Homozygous loss of menin is well tolerated in liver, a
tissue not affected in MEN1. Mamm Genome 15: 872-877, 2004.
22.
Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther
R, and Unterman TG. Regulation of glucose-6-phosphatase gene expression by protein
kinase Balpha and the forkhead transcription factor FKHR. Evidence for insulin response
unit-dependent and -independent effects of insulin on promoter activity. J Biol Chem
275: 36324-36333, 2000.
23.
Trump D, Farren B, Wooding C, Pang JT, Besser GM, Buchanan KD,
Edwards CR, Heath DA, Jackson CE, Jansen S, Lips K, Monson JP, O'Halloran D,
Sampson J, Shalet SM, Wheeler MH, Zink A, and Thakker RV. Clinical studies of
multiple endocrine neoplasia type 1 (MEN1). QJM 89: 653-669, 1996.
24.
Wang Y, Ozawa A, Zaman S, Prasad NB, Chandrasekharappa SC, Agarwal
SK, and Marx SJ. The Tumor Suppressor Protein Menin Inhibits AKT Activation by
Regulating Its Cellular Localization. Cancer Res.
25.
Zhang W, Patil S, Chauhan B, Guo S, Powell DR, Le J, Klotsas A, Matika R,
Xiao X, Franks R, Heidenreich KA, Sajan MP, Farese RV, Stolz DB, Tso P, Koo
SH, Montminy M, and Unterman TG. FoxO1 regulates multiple metabolic pathways in
the liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression. J Biol
Chem 281: 10105-10117, 2006.
26.
Zhao X, Gan L, Pan H, Kan D, Majeski M, Adam SA, and Unterman TG.
Multiple elements regulate nuclear/cytoplasmic shuttling of FOXO1: characterization of
phosphorylation- and 14-3-3-dependent and -independent mechanisms. Biochem J 378:
839-849, 2004.
35
Figure Legends:
Figure 1
Insulin regulates menin expression via the human insulin receptor (InsR).
A) Immunoblot analysis of primary hepatocytes exposed to 100nM insulin for 16 and 24
hrs show a time-dependent decrease in menin protein levels.
B) NIH 3T3 cells stably transfected with human insulin receptors-A (3T3-hIR) were
treated with 100nM insulin and 50nM glucagon for 24 hrs prior to immunoblot analysis.
C) mRNA analysis by RT-PCR of primary hepatocytes extracted from C57BLK/6 mice
treated with 100nM insulin, or 1g/mL of -amanitin (sigma) prior to insulin treatment
show peak expression at 1hr and 2 hrs, inhibited by amanitin at all time points. N>3
independent experiments in triplicates pooled from livers of >9 C57BLK/6 mice. Values
are mean±S.E.
Figure 2
Insulin regulates menin expression acutely via the AKT pathway followed by
MAPK.
A) Protein expression of menin, pAkt, Akt, and GAPDH in HepG2 lysates after overnight
serum starvation was determined under the conditions of either 1h pre-treatment of
LY294002 (10M), insulin treatment (100nM), or a combination of both as indicated by
the + and – signs at the allotted time-points. (LY treatment alone was collected 1h post
LY administration).
36
B) Quantification of Western Blots from (A) by densitometry showing menin relative to
GAPDH
C) Protein expression of menin, pERK, ERK, and GAPDH in HepG2 lysates after
overnight serum starvation was determined under the conditions of either 1h pretreatment of UO126 (10M), insulin treatment (100nM), or a combination of both as
indicated by + or – signs at the allotted time-points (UO treatment alone was collected 1h
post UO administration).
D) Quantification of Western Blots from (C) by densitometry showing menin relative to
GAPDH.
Figure 3
Insulin shuttles menin from the nucleus into the cytoplasm via AKT signaling.
A) Flourescent images of menin in HepG2 cells after 24hr exposure to 100nM insulin
(INS-24hr) show cytoplasmic localization inhibited by LY294002 (INS+LY294002).
(i;ii;iii) represent menin expression in cytoplasmic (C) and nuclear (N) fractionation from
untreated HepG2 cells (i), HepG2 cells treated 2with 100nM insulin (ii) and HepG2
pretreated with LY294002 for 1 hr prior to insulin treatment (iii).
B) Western blotting with 30g nuclear lysates from HepG2 cells exposed to 100nM
insulin (Ins) or 10M LY296004 1hr prior to insulin (LY+Ins). Lamin B used for control
of nuclear lysates. Graph shows densitometry of near infrared band intensity from 3
experiments. **P=0.0014
37
Figure 4
Insulin enhances menin interaction with FOXO1 and cellular localization via AKT.
A) Immunoprecipitation with menin antibody, immunoblotted for FOXO1 shows
enhanced interaction with 100nM insulin exposure at 2h and undetectable FOXO1 with
15min of insulin treatment. Graph shows immunoblot analysis quantified by near infrared
fluoresence and relative ratio of FOXO1 and menin. Values are mean±S.E. of >6
experiments, ***P<0.0005.
B) Immunoprecipitation with agarose-conjugated menin antibody was immnunoblotted
for FOXO1 antibody, phospho and total-14-3-3 antibodies. Graphs below show
Immunoblot analysis quantified by near infrared immunofluoresence and expressed as
relative ratio of phospho-14-3-3 and menin or phospho-14-3-3 and total 14-3-3. Values
are mean±S.E. of 3 experiments. NS=non significant.
C) Western blotting with cytoplasmic and nuclear fractionated lysates from HepG2 cells
exposed to 100nM insulin at designated time-points. IP represents immunoprecipitation
with menin antibody and probed for FOXO1. Input represent total FOXO1 expressed in
cytoplasmic and nuclear lysates prior to IP.
D) Graphs show densitometry of near infrared band intensity from 3 experiments of
relative FOXO1 to menin expression after immunoprecipitation assay (IP). **P=0.0019
Figure 5
38
Menin interaction with FOXO 1 is inhibited by LY294002.
A)
or 10M UO126 1 hr prior to insulin for 15min and 2h probed with FOXO1 specific
antibody and CEACAM 1 (CC1).
B) Images of HepG2 cells stained for menin (green) and FOXO1 (red) after exposure to
UO126, or UO126+insulin (UO+INS). Cells were counterstained with Dapi (blue) for
nuclei. Control is untreated cells (UNT).
Figure 6
Menin and FOXO 1 interaction invivo
A) C57/BLK6 mice subjected to 18h fast (F) followed by 4hr of feeding and 7hrs of
refeeding. Whole liver lysates from mice were subjected to immunoprecipitation with
menin antibody and immunoblotted for FOXO1 and menin by western blot analysis.
B) Plasma insulin levels of C57/BLK6 mice subjected to 18h fast (F) followed by 4hr of
feeding and 7hrs of refeeding was determined by radioimmunoassay as described in
materials and methods. Data analyzed using One way Anova ; Turkey post-hoc test.
***P<0.0001; **0.0017.
Figure 7
39
Effect of hepatic menin on FOXO1 target genes.
C57/BLK6/FVB(129S) mice hemizygous for MEN 1 in the liver were subjected to 18h
fast, livers extracted and analyzed. Genes that are direct targets of FOXO1 and directly
involved in hepatic glucose production shown to be differentially expressed in the liver
specific hemizygous mice (HETs) vs WT based on results from quantitative real-time
PCR. A) Menin mRNA is decreased in the HETs while *p<0.0145, B) insulin receptor
(InsR) *p<0.0172, C) total AKT *p<0.0249, D) total FOXO1, E) IGFBP1 **p<0.0026,
F) G6Pase *p<0.0030, G) PGC1 *p<0.0054, H) PEPCK, I) Glucokinase (GK).
Figure 8
Glucose metabolism in mice with liver specific hemizygote expression of menin.
A) Glucose tolerance tests (n=5/group) in liver specific hemizygote mice (MenLiv(+/-) ) and
control litter mates (WT). **p<0.01, *p<0.05. B) Area under the curve of glucose
tolerance test for liver specific hemizygote mice (HET) relative to same strain control
litter mates (WT), *p<0.05.
C) Insulin tolerance tests (n=5/group) in liver specific hemizygote mice (MenLiv(+/-) ) and
control litter mates (WT)
40
Figure 1
41
Figure 2
42
Figure 3
43
Figure 4
44
Figure 5
45
Figure 6
46
Figure 7
47
Figure 8
48
Chapter 3
Menin Liver-Specific Hemizygous Mice Challenged with High Fat Diet Show
Increased Weight Gain and Markers of Metabolic Impairment
(Published in: Nutr Diabetes. 2012 May; 2(5): e34)
Running Title: Menin regulated phenotype during high fat feeding
Leah Wuescher, Kristine Angevine, Payal R Patel, Edith Mensah-Osman†
Center for Diabetes and Endocrine Research, Department of Physiology and
Pharmacology, University of Toledo College of Medicine, Toledo, OH 43614
†Address correspondence to:
Edith Mensah-Osman, M.D., Ph.D., MBA
College of Medicine
University of Toledo
Health Science Campus
3000 Arlington Avenue, Mail stop 1008
Toledo, Ohio, 43614
Tel: (419) 383-4183
Fax: (419) 383-2871
e-mail: [email protected]
49
Abstract
Objective: The menin tumor suppressor protein is abundantly expressed in the liver,
although no function has been identified due to lack of tumor development in Men1 null
livers. We examine the phenotype of mice lacking one functional allele of Men1
(consistent with the phenotype in humans with MEN1 syndrome) challenged with high
fat diet to elucidate a metabolic function for hepatic menin.
Methods: In this study, we challenged mice with a liver specific hemizygous deletion of
Men1 (HETs) on a high fat diet for 3 months, and monitored the severity of metabolic
changes compared to wild type (WT) counterparts fed a high fat diet. We demonstrate
that the HET mice challenged with high fat diet for 3 months show increased weight gain
with decreased glucose tolerance compared to WT counterparts. Along with these
changes, there was a more severe serum hormone profile involving increased serum
insulin, glucose, and glucagon, all hallmarks of the type 2 diabetic phenotype. In concert
with increased serum hormones, we found that these mice have significantly increased
liver triglycerides coupled with increased liver steatosis and inflammatory markers.
Quantitative real time polymerase chain reaction (qRT-PCR) and Western Blotting
studies show increases in enzymes involved with lipogenesis and hepatic glucose
production.
Conclusions: We conclude that hepatic menin is required for regulation of diet induced
metabolism, and our studies indicate a protective role for the Men1 gene in the liver when
challenged with high fat diet.
Keywords: menin, metabolic syndrome, fatty liver, type 2 diabetes
50
Introduction
Menin is the product of the Men1 gene, classified as a tumor suppressor following
the classical “2-Hit Hypothesis”, which involves one genetic mutation followed by a
somatic mutation causing tumor formation. Loss of menin causes the multiple endocrine
neoplasia type 1 (MEN1) syndrome in humans which is an autosomal dominant disorder
characterized by development of neuroendocrine tumors, glucose intolerance, and type 2
diabetes 1-3. The metabolic consequences of the MEN1 syndrome have been largely
ignored, and elucidating a role for menin in metabolism can be useful in identifying novel
drug targets for metabolic disorders.
Recently we have shown metabolic abnormalities in mice hemizygous for menin
specifically in the liver noting differences in insulin sensitivity and markers of hepatic
glucose production compared to wild type (WT) littermates on normal chow 4. In the
current study, we challenge menin liver-specific hemizygous mice and their wild type
littermates with high fat diet for 3 months and characterized their phenotype based on
metabolic parameters. Mice with hemizygous deletion of menin on a high fat diet show
increasing weight gain, increases in serum hormones such as insulin and glucagon, and
increases in liver triglycerides and steatosis compared to WT. The menin mice (HETs)
also exhibit increases in metabolically relevant genes such as uncoupling protein 2
(UCP2), Peroxisome Proliferator-Activated receptor gamma coactivator 1-alpha (PGC1alpha) and glucokinase (GK), all of which are associated with the up-regulation of
hepatic glucose production and lipogenesis 5-8. These results demonstrate that hepatic
menin plays a protective role during high fat feeding and when lost contributes to dietinduced obesity.
51
Materials and Methods
Animal Maintenance
Animals were kept on a 12:12-h dark-light cycle and fed Research Diets D12451
consisting of 45% calories from saturated fat, ad libitum, for 3 months starting at 3
months of age. All procedures were approved by Institutional Animal Care and Use
Committee at the University of Toledo. Liver-specific menin hemizygous mice on a mix
of FVB/129S mice expressing loxP sequences on exons 3–10 of the Men1 gene (Jackson
Labs #005109) and C57bl/6 mice expressing Albumin-Cre (Jackson Labs #003574) were
crossed, and genotyping was performed with tail lysates. Wild type (WT) and Flox (loxP)
sequences with Cre expression were considered hemizygous for menin in the liver
(HETs)4. All experiments were conducted with WT HFD N=7 and HET HFD N=5
unless otherwise noted.
Serum Hormone Assays and Glucose Tolerance Test
Fasting glucose was obtained using a glucometer (Accu-Chek, Roche) after mice had
undergone an 18h fast. Mice were then injected intraperitoneally with 2mg/kg glucose
and monitored up to 180 minutes post injection. The upper limit of detection is 600
mg/dL and glucose above that level was recorded as such.
Whole venous blood was
collected via the retro orbital sinus. Radioimmunoassay was then conducted to measure
serum insulin (Millipore, Billerica, MA #SRI-13K), glucagon (Millipore, Billerica, MA
#GL-32K), and C-peptide (Millipore, Billerica, MA #RCP-21K). The C:I ratio was
calculated from the serum C-peptide and insulin values.
Triglyceride and Free Fatty Acid Measurements
52
Liver-specific triglyceride concentrations were determined by digesting tissue samples in
chloroform-methanol (2:1 (v/v)). Briefly, the lipid layer was separated using H2SO4, and
concentrations were determined using triglyceride assay kit (Pointe Scientific Inc,
tissue. Serum triglycerides were also analyzed using Pointe Scientific Inc. triglyceride
reagents. Serum free fatty acids (FFA) were calculated using NEFA C kit (Wako
Chemicals, Richmond, VA).
Liver Histology
Livers were fixed in formalin and paraffin embedded. These liver sections were then
stained with hemotoxylin-eosin (H&E) and assessed for the degree of steatosis and
lobular inflammation according to the NASH scoring system proposed by the NIDDKNASH Clinical Research Network 9.
Quantitative Real-Time PCR
RNA was extracted using the 5PRIME PerfectPure RNA Tissue Kit (5 Prime,
Gaithersburg, MD). RNA was transcribed into cDNA as described previously 4. qRTPCR was performed on the Applied Biosystems StepOnePlus system using Fast SYBR
green Master Mix (Applied Biosystems, Carlsbad, CA). Probe sequences are as follows:
Menin Forward: TCATTGCTGCCCTCTATGCC
Menin Reverse: TCCAGTTTGGTGCCTGTGATG
TNF Forward: CATCTTCTCAAAATTCGAGTGACAA
53
TNF Reverse: TGGGAGTAGACAAGGTACAACCC
18S Forward: ATACATGCCGACGGGCGCTG
18S Reverse: GGGAGGGAGCTCACCGGGTT
PGC1 Forward: ATGTGTCGCCTTCTTGCTCT
PGC1 Reverse: CACGACCTGTGTCGAGAAAA
UCP2 Forward: GCGTTCTGGGTACCATCC
UCP2 Reverse: GCGACCACGCCATTGTAGA
GK Forward: ACTTTCCAGGCCACAAACA
GK Reverse: TCCCAGAACTGTAAGCCACTC
HNF4 Forward: ATCTTCTTTGATCCAGATGCCA
HNF4 Reverse: GTTGATGTAATCCTCCAGGC
Immunoblotting Analysis
Livers were harvested and lysed in T-PER (Life Technologies, Grand Island, NY) with
Complete Protease Inhibitor Mini (Roche, Indianapolis, IN) and HALT Phosphatase
Inhbitor (Thermo Fisher, Waltham, MA). Protein concentration was assayed using the
BCA protein assay (Pierce, Rockford, IL) and 50g of protein was loaded per well.
Samples were run on a 10% Tris Glycine gel at 125V for 2h. Blots were probed using
antibodies against menin (Santa Cruz Biotechonology, Santa Cruz, CA), HNF4 (Santa
Cruz Biotechnology, Santa Cruz, CA), and PGC1 (Santa Cruz Biotechnology, Santa
54
Cruz, CA). Analysis was done using the Odyssey Infrared Imager with secondary
antibodies conjugated to near infrared dyes (Li-Cor, Lincoln, NE).
Statistical Analysis
Values are reported as mean + SEM. Student’s t test and two-way ANOVA with
Bonferroni’s post test were performed using GraphPad Prism version 5.02 for Windows,
GraphPad Software, San Diego California USA, www.graphpad.com.
P values <0.05 were considered statistically significant.
Results
Menin hemizygous mice show increased weight gain and higher glucose intolerance than
wild type counterparts. Menin hemizygous mice (HETs) and their wildtype (WT)
counterparts were fed high fat diet (HFD) ad libitum for a period of 3 months. As shown
in Figure 1A&B, the HET mice show a “scruffy” phenotype compared to WT animals
which could indicate illness or a more cytotoxic effect as a result of the high fat diet on
mice deficient in menin 10, 11 . During the three month period, mice were weighed
initially 2 weeks post feeding, then each month after that for the duration of the
experiment. As shown in Figure 1C, the HET mice showed increased weight gain
compared to WT throughout the experiment, and reached statistical significance at 14
days and 60 days of high fat feeding. We performed glucose tolerance testing (IPGTT)
(Figure 1D) on these mice and found that HET mice had significantly increased area
under the curve (AUC) (Figure 1E), indicating increased glucose intolerance.
55
Menin HETs have increased serum hormones compared to WT counterparts. To further
investigate the metabolic phenotype of the HET mice, serum was harvested from the
mice after 3 months of high fat feeding for analysis. The HET mice showed increased
levels of serum glucose, insulin, and glucagon, all consistent with a type 2 diabetic
phenotype (Figure 2A-C) 12, 13. To check if the increased serum insulin levels were due
to increased insulin secretion from beta-cells, serum C-peptide was measured. This is a
reliable indication of secretion because it is released from the beta-cell at a 1:1 ratio with
insulin 14. A significant increase was observed in C-peptide indicating increased insulin
secretion in these animals compared to WT (Figure 2D). Using the C-peptide and serum
insulin measurements, the C:I ratio was calculated, which is,a measure of insulin
clearance predominantly in the liver 15. There were no significant increases in the C:I
ratio in these animals (Figure 2E) indicating no problems in insulin clearance, and
enforcing that the increase in serum insulin is attributed to increased insulin secretion
related to insulin resistance in these animals 16.
Menin HETs show increased liver triglycerides. High fat diet is known to cause
alterations of the lipid profile in mice in association with metabolic syndrome 17, 18. Since
serum hormones are elevated, serum triglycerides and free fatty acid (FFA) levels were
examined. There was no evidence of increased serum FFA or triglycerides between the
WT and HETs on high fat diet (Figure 3A&B). However, a significant increase in the
level of liver tissue triglycerides was observed with no change in liver weight between
the groups (Figure 3C&D). These findings indicate that loss of menin does play a
protective role in the liver in the regulation of diet-induced triglyceride accumulation,
consistent with a recent report using the acute hepatic knockdown of menin 19.
56
Increased hepatic steatosis in HET mice compared to WT counterparts. Since the HETs
exhibited increase in liver triglycerides and knowing that high fat diet contributes
significantly to the development of Non-Alcoholic Fatty Liver Disease (NAFLD) which
can progress to Non-Alcoholic Steatohepatitis (NASH) 20, 21, livers were harvested and
histologically analyzed. HET mice on high fat diet have increased liver fat droplets
characterized by large size vacuoles compared to WT (Figure 4A). Using a previously
described method of NASH scoring9, it was determined that the total NASH score of the
HET mice on high fat diet was significantly higher than WT counterparts on high fat diet
(Figure 4B). Since NASH is associated with hepatic inflammation, the mRNA of
TNFalpha in the liver of the WT and HETs on high fat diet was measured. Higher
TNFalpha levels in the HET mice on HFD compared to WT were observed, signifying a
significant increase in inflammation in the livers of the HET mice (Figure 4C).
HET mice show increased markers of stress, hepatic glucose production, and lipogenesis
in the liver. In Figures 5A and 6A&B there are significant decreases in the mRNA and
protein expression of menin in the liver of HET mice. To further investigate what
contribution decrease in hepatic menin has on markers implicated in metabolic syndrome
under the metabolic stress of 3 months on HFD, factors were analyzed that are involved
in oxidative stress and regulation of hepatic glucose production, which have both been
shown to be increased in HFD conditions 17, 22 . Glucokinase (GK) is a key regulatory
enzyme responsible for converting glucose to glucose-6-phosphate which subsequently
undergoes glycolysis and lipogenesis in the liver 7, 8. GK is significantly increased in
HET mice (Figure 5B), consistent with observations in diabetic patients and patients with
fatty liver 8. Hepatic Nuclear Factor 4 alpha (HNF4alpha), an orphan nuclear receptor,
57
shows increased expression at both the mRNA and protein levels in HET mice compared
to WT (Figure 5C, 6C&D). This could account for the increased expression of GK since
HNF4alpha is a known positive regulator of GK expression 23-26. UCP2, an inner
mitochondrial membrane protein, has been shown to be increased in pathology such as
NASH and type 2 diabetes 27-29. A significant increase is observed in UCP2 in HET mice
on high fat diet compared to WT HFD fed counterparts (Figure 5D). Since Peroxisome
Proliferator-Activated receptor gamma coactivator 1-alpha (PGC1alpha) has been shown
to be a regulator of UCP2 expression 30, the mRNA and protein expression of PGC1alpha
was investigated and found it to be significantly increased at the mRNA level and
trending towards an increase at the protein level in HET mice compared to WT (Figure
5E, 6E&F). PGC1alpha has other well-known functions in metabolism such as
regulation of factors involved in gluconeogenesis in concert with HNF4alpha 26, 31 .
58
Discussion
The menin liver specific complete knockout has previously been shown to be void
of tumors, however, no studies were undertaken on the metabolic phenotype of these
mice 32. We have shown previously that menin hemizygous (HET) mice on normal
chow do have metabolic perturbations compared to WT counterparts 4. When challenged
with high fat diet HET mice exhibited increased weight gain compared to WT indicating
that hepatic menin does have a systemic effect on the response of these mice to high fat
challenge. We have also shown that these mice exhibit insulin resistance with increased
glucose intolerance during glucose tolerance testing (Figure 1D). This decreased glucose
tolerance is indicative of a more severe metabolic phenotype 33, and with the liver being a
main regulator of insulin clearance 34, this finding therefore implicates hepatic menin as
playing a role in regulating whole body glucose homeostasis. It has been previously
shown that menin levels fluctuate with high fat challenge and the mice show increased
hepatic steatosis19. As the results confirm that finding in this study, we have expanded on
this fact through a total metabolic profile showing a systemic effect of menin loss in the
liver. Also, the results show a chronic effect of menin loss as opposed to acute loss,
implicating menin both as an acute and chronic regulator of the metabolic state in the
liver.
To further our understanding of the phenotype of these mice, we examined levels
of serum hormones commonly deregulated in metabolic syndrome. Mice with prolonged
exposure to HFD commonly exhibit hyperglycemia 35 however, this consequence is
exacerbated and significantly higher in the HET mice (Figure 2A). This and the increase
in other serum markers indicate that HET mice are showing a decreased ability to clear
59
glucose from the system compared to WT mice fed high fat diet, enforcing that loss of
hepatic menin affects systemic glucose homeostasis. Furthermore, the HET mice show
significant increases in serum insulin concentration and increased C-peptide (Figure 2B
& D) both of which are indicative of insulin resistance and increased insulin secretion
due to hyperglycemia 7, 16.
Glucagon secreted from the pancreas regulates hepatic glucose production (HGP)
in the fasted state causing increased gluconeogenesis and glycogenolysis in the liver, and
increased lipolysis in adipose tissue 22, 36, 37. Hyperglucagonemia has been implicated in
hyperglycemia in models of metabolic syndrome due to its regulatory role in HGP. HET
mice exhibit significantly increased levels of serum glucagon consistent with the changes
observed in mice with high HGP. Previously, our lab has shown that loss of hepatic
menin in mice fed normal chow have increased markers of HGP and downstream targets
of FoxO1, a main regulator of the switch between fasting and feeding 4, 5, 38, 39.
Hypertriglyceridemia is also a consequence of high fat diet that contributes to the
pathogenesis of type 2 diabetes and metabolic syndrome through increased de novo
production of triglycerides in the liver 8, 40. Although we do not see high serum
triglycerides or FFA, we do see a significant increase of triglycerides in the liver (Figure
3C) between the two groups.
Liver histology clearly shows differences in the phenotypes of HET mice
compared to WT mice. WT mice fed HFD for 3 months show microsteatosis and
inflammatory infiltrate, but this is to a much greater degree in HET mice on HFD (Figure
4A). The macrosteatosis and increased inflammation we see in the HET mice (Figure
4A-C) implicates menin as a protective protein for high fat diet challenge. Indeed, the
60
gene expression profile in HET mice challenged on HFD shows increased markers of
hepatic metabolism such as glucokinase (GK), the enzyme responsible for converting
glucose to glucose-6-phosphate, which is also a regulator of hepatic lipogenesis,
glycolysis, and glycogen synthesis 8. Hepatic GK gene expression has been associated
with increased hepatic lipid content, which is consistent with what we observe in our
HET mice. GK gene expression is dependent on insulin signaling along with glucose
concentration, but it is also regulated by factors such as HNF4alpha 23. As we show in
this study, HNF4alpha expression is increased in HET mice on HFD (Figure 5C &
6C&D). This factor has been implicated in regulation of many genes involved in
lipogenesis and HGP 31, 41. It has also been cited as a co-factor working with PGC1alpha
to regulate gluconeogenic genes42. PGC1alpha is a master regulator of mitochondrial
biogenesis, and when up-regulated its expression is associated with increased expression
of protective genes such as UCP2 30, 43. PGC1alpha is also a direct transcriptional
regulator of UCP2, which is a mitochondrial protein responsible for inhibiting increases
in membrane potential under the conditions of low adenosine diphosphate (ADP) which,
in turn, decreases reactive oxygen species (ROS) production 29. UCP2 has been
implicated in the pathogenesis of non-alcoholic steatohepatitis and non-alcoholic fatty
liver disease 20, 21, 28, 29. The phenotype of our Men1 HET mice on a high fat diet suggest
that menin plays a role in mediating the expression of these important metabolically
related proteins and factors described above. In conclusion, menin in the liver is a
metabolic protein that functions to regulate genes involved in hepatic glucose production,
lipogenesis, and steatosis in response to high fat diet.
61
Acknowledgements
We would like to acknowledge the University of Toledo for their institutional funding
responsible for this research.
We would also like to acknowledge Dr. M.K. Kaw for her technical assistance with liver
histology.
Conflict of Interest
The authors declare no conflict of interest.
References
1.
Balogh K, Patócs A, Hunyady L, Rácz K. Menin dynamics and functional insight:
Take your partners. Molecular and Cellular Endocrinology 2010; 326(1-2): 8084.
2.
van Wijk JPH, Dreijerink KMA, Pieterman CRC, Lips CJM, Zelissen PMJ, Valk
GD. Increased prevalence of impaired fasting glucose in MEN1 gene mutation
carriers. Clinical Endocrinology 2012; 76(1): 67-71.
3.
McCallum RW, Parameswaran V, Burgess JR. Multiple endocrine neoplasia type
1 (MEN 1) is associated with an increased prevalence of diabetes mellitus and
impaired fasting glucose. Clin Endocrinol (Oxf) 2006; 65(2): 163-8.
62
4.
Wuescher L, Angevine K, Hinds T, Ramakrishnan S, Najjar SM, Mensah-Osman
EJ. Insulin regulates menin expression, cytoplasmic localization, and interaction
with FOXO1. American journal of physiology. Endocrinology and metabolism
2011; 301(3): E474-83.
5.
Liu Y, Dentin R, Chen D, Hedrick S, Ravnskjaer K, Schenk S et al. A fasting
inducible switch modulates gluconeogenesis via activator/coactivator exchange.
Nature 2008; 456(7219): 269-73.
6.
Estall JL, Kahn M, Cooper MP, Fisher FM, Wu MK, Laznik D et al. Sensitivity
of lipid metabolism and insulin signaling to genetic alterations in hepatic
peroxisome proliferator-activated receptor-gamma coactivator-1alpha expression.
Diabetes 2009; 58(7): 1499-508.
7.
Agius L. New hepatic targets for glycaemic control in diabetes. Best Practice &
Research Clinical Endocrinology & Metabolism 2007; 21(4): 587-605.
8.
Peter A, Stefan N, Cegan A, Walenta M, Wagner S, Königsrainer A et al. Hepatic
Glucokinase Expression Is Associated with Lipogenesis and Fatty Liver in
Humans. Journal of Clinical Endocrinology & Metabolism 2011; 96(7): E1126E1130.
63
9.
Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW et
al. Design and validation of a histological scoring system for nonalcoholic fatty
liver disease. Hepatology 2005; 41(6): 1313-1321.
10.
Hart BL. Biological basis of the behavior of sick animals. Neurosci Biobehav Rev
1988; 12(2): 123-37.
11.
Dos Santos N, Waterhouse D, Masin D, Tardi PG, Karlsson G, Edwards K et al.
Substantial increases in idarubicin plasma concentration by liposome
encapsulation mediates improved antitumor activity. Journal of Controlled
Release 2005; 105(1-2): 89-105.
12.
Kahn SE, Hull RL, Utzschneider KM. Mechanisms linking obesity to insulin
resistance and type 2 diabetes. Nature 2006; 444(7121): 840-6.
13.
Stumvoll M, Goldstein BJ, van Haeften TW. Type 2 diabetes: principles of
pathogenesis and therapy. Lancet 2005; 365(9467): 1333-46.
14.
Tura A, Ludvik B, Nolan JJ, Pacini G, Thomaseth K. Insulin and C-peptide
secretion and kinetics in humans: direct and model-based measurements during
OGTT. American Journal of Physiology - Endocrinology And Metabolism 2001;
281(5): E966-E974.
64
15.
Meier JJ, Holst JJ, Schmidt WE, Nauck MA. Reduction of hepatic insulin
clearance after oral glucose ingestion is not mediated by glucagon-like peptide 1
or gastric inhibitory polypeptide in humans. American Journal of Physiology Endocrinology And Metabolism 2007; 293(3): E849-E856.
16.
Shanik MH, Xu Y, Škrha J, Dankner R, Zick Y, Roth J. Insulin Resistance and
Hyperinsulinemia. Diabetes Care 2008; 31(Supplement 2): S262-S268.
17.
Dey A, Chandrasekaran K. Hyperglycemia induced changes in liver: in vivo and
in vitro studies. Curr Diabetes Rev 2009; 5(2): 67-78.
18.
Rossmeisl M, Rim JS, Koza RA, Kozak LP. Variation in type 2 diabetes--related
traits in mouse strains susceptible to diet-induced obesity. Diabetes 2003; 52(8):
1958-66.
19.
Cheng P, Yang SS, Hu XG, Zhou XY, Zhang YJ, Jin G et al. Menin prevents
liver steatosis through co-activation of peroxisome proliferator-activated receptor
alpha. FEBS Lett 2011; 585(21): 3403-8.
20.
Yeh MM, Brunt EM. Pathology of nonalcoholic fatty liver disease. Am J Clin
Pathol 2007; 128(5): 837-47.
65
21.
Farrell GC, Larter CZ. Nonalcoholic fatty liver disease: from steatosis to
cirrhosis. Hepatology 2006; 43(2 Suppl 1): S99-S112.
22.
Ali S, Drucker DJ. Benefits and limitations of reducing glucagon action for the
treatment of type 2 diabetes. Am J Physiol Endocrinol Metab 2009; 296(3): E41521.
23.
Hirota K, Sakamaki J, Ishida J, Shimamoto Y, Nishihara S, Kodama N et al. A
combination of HNF-4 and Foxo1 is required for reciprocal transcriptional
regulation of glucokinase and glucose-6-phosphatase genes in response to fasting
and feeding. J Biol Chem 2008; 283(47): 32432-41.
24.
Ganjam GK, Dimova EY, Unterman TG, Kietzmann T. FoxO1 and HNF-4 Are
Involved in Regulation of Hepatic Glucokinase Gene Expression by Resveratrol.
Journal of Biological Chemistry 2009; 284(45): 30783-30797.
25.
Roth U, Jungermann K, Kietzmann T. Activation of glucokinase gene expression
by hepatic nuclear factor 4alpha in primary hepatocytes. Biochem. J. 2002;
365(1): 223-228.
66
26.
Schmidt SF, Mandrup S. Gene program-specific regulation of PGC-1α activity.
Genes & Development 2011; 25(14): 1453-1458.
27.
Ruiz-Ramírez A, Chávez-Salgado M, Peñeda-Flores JA, Zapata E, Masso F, ElHafidi M. High-sucrose diet increases ROS generation, FFA accumulation, UCP2
level, and proton leak in liver mitochondria. American Journal of Physiology Endocrinology And Metabolism 2011; 301(6): E1198-E1207.
28.
Jiang Y, Zhang H, Dong L-y, Wang D, An W. Increased hepatic UCP2 expression
in rats with nonalcoholic steatohepatitis is associated with upregulation of Sp1
binding to its motif within the proximal promoter region. Journal of Cellular
Biochemistry 2008; 105(1): 277-289.
29.
Serviddio G, Bellanti F, Tamborra R, Rollo T, Capitanio N, Romano AD et al.
Uncoupling protein-2 (UCP2) induces mitochondrial proton leak and increases
susceptibility of non-alcoholic steatohepatitis (NASH) liver to ischaemia–
reperfusion injury. Gut 2008; 57(7): 957-965.
30.
Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V et al.
Mechanisms controlling mitochondrial biogenesis and respiration through the
thermogenic coactivator PGC-1. Cell 1999; 98(1): 115-24.
67
31.
Rhee J, Ge H, Yang W, Fan M, Handschin C, Cooper M et al. Partnership of
PGC-1α and HNF4α in the Regulation of Lipoprotein Metabolism. Journal of
Biological Chemistry 2006; 281(21): 14683-14690.
32.
Scacheri PC, Crabtree JS, Kennedy AL, Swain GP, Ward JM, Marx SJ et al.
Homozygous loss of menin is well tolerated in liver, a tissue not affected in
MEN1. Mamm Genome 2004; 15(11): 872-7.
33.
Simeon I T. Deconstructing Type 2 Diabetes. Cell 1999; 97(1): 9-12.
34.
Duckworth WC, Bennett RG, Hamel FG. Insulin Degradation: Progress and
Potential. Endocr Rev 1998; 19(5): 608-624.
35.
Winzell MS, Ahren B. The high-fat diet-fed mouse: a model for studying
mechanisms and treatment of impaired glucose tolerance and type 2 diabetes.
Diabetes 2004; 53 Suppl 3: S215-9.
36.
Heppner KM, Habegger KM, Day J, Pfluger PT, Perez-Tilve D, Ward B et al.
Glucagon regulation of energy metabolism. Physiol Behav 2010; 100(5): 545-8.
68
37.
Jiang G, Zhang BB. Glucagon and regulation of glucose metabolism. Am J
Physiol Endocrinol Metab 2003; 284(4): E671-8.
38.
Gross DN, Wan M, Birnbaum MJ. The role of FOXO in the regulation of
metabolism. Curr Diab Rep 2009; 9(3): 208-14.
39.
Haeusler RA, Kaestner KH, Accili D. FoxOs function synergistically to promote
glucose production. J Biol Chem 2010; 285(46): 35245-8.
40.
Leavens KF, Easton RM, Shulman GI, Previs SF, Birnbaum MJ. Akt2 is required
for hepatic lipid accumulation in models of insulin resistance. Cell Metab 2009;
10(5): 405-18.
41.
Oiso H, Furukawa N, Suefuji M, Shimoda S, Ito A, Furumai R et al. The role of
class I histone deacetylase (HDAC) on gluconeogenesis in liver. Biochemical and
Biophysical Research Communications 2011; 404(1): 166-72.
42.
Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J et al. Control of
hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature
2001; 413(6852): 131-138.
69
43.
Oberkofler H, Klein K, Felder TK, Krempler F, Patsch W. Role of peroxisome
proliferator-activated receptor-gamma coactivator-1alpha in the transcriptional
regulation of the human uncoupling protein 2 gene in INS-1E cells.
Endocrinology 2006; 147(2): 966-76.
70
Figure Legends
Figure 1: High Fat Diet (HFD) challenged HET mice show increased weight gain and
glucose intolerance. A) Representative photos of WT HFD fed mice versus B) HET
HFD fed mice. C) Percent change in body weight at 0, 14, 30, 60, and 90 days of high fat
feeding; *p<0.05 D) Glucose tolerance test E) IPGTT AUC *p<0.0387, N=5 for both
groups.
Figure 2: Fasting serum hormone concentrations. A) Glucose; *p<0.01 B) Insulin;
**p<0.0028 C) Glucagon; *p<0.0350 D) C-Peptide; *p<0.05 E) C:I ratio
Figure 3: Measurement of free fatty acids (FFA) and triglycerides (TG) in HET versus
WT mice on HFD. A) Serum FFA B) Serum TG C) Liver TG as ng/g of tissue
significantly increased in HET mice vs. WT; *p<0.0427 D) Liver weight as a percentage
of body weight in HET vs. WT mice
Figure 4: Liver steatosis and increased inflammation in HET mice. Ai) Representative
liver histology at 20x magnification Aii) Representative liver histology at 40x
magnification B) Total NASH score; *p<0.0220 C) qRT-PCR analysis of
TNF*p<0.0447
Figure 5: qRT-PCR analysis of hepatic tissue from HET and WT mice. A) Menin
mRNA expression; *p<0.0484 B) Glucokinase mRNA expression; *p<0.0384 C) HNF4
mRNA expression; *p<0.0331 D) UCP2 mRNA expression; ***p<0.0001 E) PGC1
mRNA expression; *p<0.0154
71
Figure 6: Western Blotting Analysis of hepatic tissue from HET and WT mice. A)
Menin protein B) Quantification of menin protein vs. Actin; *p<0.0205 C) HNF4
protein D) Quantification of HNF4vs. Actin E) PGC1 protein F) Quantification of
PGC1 vs. Actin
72
Figure 1
73
Figure 2
74
Figure 3
75
Figure 4
76
Figure 5
77
Figure 6
78
Chapter 4
Discussion
4.1 Discussion
Hepatic Glucose Production (HGP) is crucial for the maintenance of normoglycemia in
times of fasting. The process, gluconeogenesis, is regulated mainly by the transcription
factor FoxO1. In insulin resistant and diabetic states, gluconeogensis can continue
unchecked through aberrant activation of FoxO1 leading to hyperglycemia. This
demonstrates the importance of finding FoxO1 cofactors to regulate its function. Loss of
the Men1 gene leads to Multiple Endocrine Neoplasia Type 1 with a phenotype of
neuroendocrine tumor formation coupled with glucose intolerance and type 2 diabetes
(van Wijk, Dreijerink et al. 2012). The protein product of the Men1 gene, menin, is a
tumor suppressor protein that regulates many different transcription factors both
positively and negatively (Balogh, Patócs et al. 2010). However, a relationship has never
been shown between menin expression and the apparent metabolic manifestations of
MEN1 Syndrome, we hypothesize that hepatic menin is metabolically important.
As previously mentioned, before these studies there has been no evidence linking menin
and metabolic phenotypes. Menin has undergone organ specific deletions in various
79
mouse models to help delineate its function as a tumor suppressor (Bertolino, Tong et al.
2003; Crabtree, Scacheri et al. 2003; Chen, Yan et al. 2006), but the liver-specific
knockout of menin yielded no discernible neoplastic phenotype (Scacheri, Crabtree et al.
2004). For the first time, our studies implicate insulin as a direct transcriptional and
translational regulator of menin expression. Insulin mediates this effect through both
major pathways downstream of the insulin receptor, with PI3K/Akt being an acute
regulator of menin expression, and MAPK mediating prolonged insulin signaling effects
on menin (Wuescher, Angevine et al. 2011). Not only is total protein affected after
prolonged exposure to insulin, the menin protein also undergoes translocation from the
nucleus to the cytoplasm. This change in subcellular localization of menin is halted by
treatment with the PI3K inhibitor LY294002, showing that downstream of the insulin
receptor, the PI3K/Akt pathway is mediating this effect. This change in menin
localization through insulin signaling proves that menin can be regulated by important
metabolic factors, but this does not exclude menin from responding to the mitogenic
effects of insulin as it is a tumor suppressor protein that antagonizes growth. This led us
to investigate other proteins regulated by insulin in the same manner, such as forkhead
box O1 (FoxO1). As previously discussed, FoxO1 has a well studied role in the
regulation of fasting and re-feeding hepatic metabolism and its localization and
expression are regulated by insulin receptor signaling. Phosphorylation of FoxO1 by Akt
leads to its nuclear exclusion by its chaperone protein 14-3-3 and sequestration to the
cytoplasm which inhibits FoxO1 transcriptional effects (i.e. induction of gluconeogenic
genes). Data shown here associates loss of menin with increases in FoxO1 target genes
implicating menin as a regulator of FoxO1 function. Importantly, the gene insulin
80
growth factor binding protein 1 (IGFBP1), a canonical FoxO1 target indicating increased
activity was upregulated, along with glucose 6 phosphatase (G6Pase), the rate limiting
enzyme in gluconeogenesis (Hirota, Sakamaki et al. 2008; Haeusler, Kaestner et al.
2010). Increases in G6Pase mRNA expression in the context of FoxO1 hyperactivity has
been shown to contribute to hyperglycemia in metabolic syndrome (Samuel, Choi et al.
2006; Valenti, Rametta et al. 2008). We have also shown that menin does indeed
complex with FoxO1 and 14-3-3 in response to insulin signaling and believe that menin
is required for continued sequestration in the cytoplasm. This effect is mediated by the
PI3K/Akt pathway as co-immunoprecipitation studies show a decreased association of
menin with FoxO1 at the 2 hour time-point with LY294002 treatment.
Partial loss of menin does not affect FoxO1 at the transcriptional level, showing no
differences in the mRNA of FoxO1 between WT and HET animals. This observation
furthers the hypothesis that menin regulates FoxO1 at the post-transcriptional level and
that menin is required for insulin mediated effects on FoxO1. This data furthers our
hypothesis that menin is an important metabolic protein due to its interaction with FoxO1
and mediating its transcriptional effects. The whole body effects of loss of hepatic menin
are exposed through the intraperitoneal (I.P.) glucose tolerance test showing a
significantly increased clearance of glucose from the periphery compared to WT
counterparts. These results are further complicated by no change in the I.P. insulin
tolerance test. These results indicate a whole body phenotype not necessarily dependent
on whole body insulin sensitivity, leaving this effect still open to more interpretation
whether it is due to increased energy expenditure or another mechanism of glucose
clearance.
81
As we have shown an abnormal metabolic phenotype in normal chow fed mice with 50%
loss of hepatic menin, we have furthered the study with high fat challenge (HFD). It has
been recently shown that hepatic menin levels decrease in diabetic mouse models and
diet induced obese (DIO) mice (Cheng, Yang et al. 2011). This supports our hypothesis
that menin is integral in the sequestration of FoxO1 to the nucleus because it is known in
genetic diabetic mouse models and DIO mouse models that FoxO1 is predominantly
nuclear and exerting its effects on its target gluconeogenic genes (Gross, Wan et al. 2009;
Cheng and White 2010). On HFD, HET mice show increased weight gain compared to
WT counterparts again indicating a systemic effect of hepatic menin loss. Along with
increased weight gain, the menin mice show an increased area under the curve (AUC)
indicate decreased glucose excursion during glucose tolerance testing showing a more
severe whole body metabolic phenotype than WT mice on HFD (Wuescher, Angevine et
al. 2012).
To further elucidate the metabolic phenotype of these mice, we examined serum
hormones commonly known to be increased in metabolic syndrome. Notably, HET mice
show a significant increase in hyperglycemia compared to WT counterparts which could
be exacerbated due to the mechanism described contributing to increased FoxO1 activity,
which leads to increased hepatic glucose output. Serum insulin and C-Peptide are
significantly increased in HET mice which indicate increased secretion secondary to
hyperglycemia. The mice also show increased serum glucagon which is common in type
2 diabetes and also can exacerbate hyperglycemia (Ali and Drucker 2009). Glucagon
increases hepatic glucose production (HGP) through induction of both glycogenolysis
and gluconeogenesis, and can also affect adipose tissue by stimulating lipolysis (Authier
82
and Desbuquois 2008; Ali and Drucker 2009; Heppner, Habegger et al. 2010). HET mice
have significantly increased glucagon compared to WT counterparts which is in
agreement with observations in mice with high HGP.
Hypertriglyceridemia, also a well characterized manifestation of metabolic syndrome, is
caused by aberrant production of triglycerides in the liver (Leavens, Easton et al. 2009;
Peter, Stefan et al. 2011). Although there were no significant differences between the
groups in serum triglycerides, there was indeed an increase in liver triglycerides. This
was shown both through analysis of liver triglycerides and liver histology. The histology
showed microsteatosis in WT mice fed HFD which was greatly exacerbated to
macrosteatosis accompanied by inflammatory infiltrate in the HET mice on HFD. The
non-alcoholic steatohepatitis (NASH) score of the HET mice was significantly higher
than WT counterparts indicating a more severe hepatic phenotype in response to HFD.
This data shows the importance of menin as protective concerning lipid accumulation in
the liver due to high fat challenge. This was confirmed by another group showing loss of
menin increases hepatic steatosis, however, they only conducted an acute study without
further analysis of the whole body phenotype (Cheng, Yang et al. 2011). Their findings
still provide insight as to the acute effects of menin loss, but importantly, our lab
elaborates on a chronic whole body phenotype which is more physiologically relevant to
metabolic syndrome.
Our lab had observed increases in markers of HGP in mice fed normal chow which were
downstream targets of FoxO1 (Wuescher, Angevine et al. 2011) which seem to be
exacerbated with HFD (Wuescher, Angevine et al. 2012). To elucidate signaling
involved in the metabolic phenotypes exacerbated by high fat diet, we looked at genes
83
known to be deregulated in metabolic syndrome. Glucokinase (GK), the rate limiting
enzyme responsible for converting glucose to glucose-6-phosphate, is associated with
increased hepatic lipid content (Peter, Stefan et al. 2011) and was significantly increased
in HET mice. We further examined factors also associated with increased GK expression
and found both at the protein and mRNA level hepatocyte nuclear factor 4 alpha
(HNF4) was increased. HNF4 directly regulates GK expression at the transcriptional
level and regulates a number of genes in concert with FoxO1. HNF4 also has been
shown to be abnormally activated in hyperglycemia (Rhee, Ge et al. 2006; Oiso,
Furukawa et al. 2011). Along with FoxO1, HNF4 also interacts with peroxisome
proliferator-activated receptor gamma coactivator 1-alpha (PGC1) to control hepatic
gluconeogenesis and lipogenesis (Yoon, Puigserver et al. 2001; Rhee, Ge et al. 2006;
Estall, Kahn et al. 2009). PGC1 mRNA was increased in both normal chow fed and
high fat fed HET mice compared to WT counterparts, consistent with increased FoxO1
activity and increased glucose 6 phosphatase (G6Pase) expression (Schmidt and Mandrup
2011). Along with regulation of gluconeogenic gene expression, PGC1 regulates
mitochondrial biogenesis and genes responsive to oxidative stress such as uncoupling
protein 2 (UCP2) (Wu, Puigserver et al. 1999). UCP2 inhibits increases in mitochondrial
membrane potential during times of oxidative stress to reduce reactive oxygen species
(ROS) production (Serviddio, Bellanti et al. 2008). Increases in UCP2 have been
associated with non-alcoholic steatohepatitis (NASH) and non-alcoholic fatty liver
disease (NAFLD) (Farrell and Larter 2006; Yeh and Brunt 2007; Serviddio, Bellanti et al.
2008). Mice deficient in hepatic Men1 show a metabolic syndrome phenotype which
increases in severity with high fat challenge. Menin is a protective hepatic protein with
84
influence on whole body glucose homeostasis through regulation of FoxO1 and FoxO1
cofactors. Loss of menin does have metabolic consequences making it a candidate for
drug intervention in relation to metabolic disorders.
4.2 Summary and Future Directions
The studies done here show convincing evidence of menin’s role in regulation of glucose
homeostasis, but the exact mechanism has yet to be elucidated. As we have shown
FoxO1 and menin do interact directly in response to insulin, it still needs to be elucidated
which post-translational modifications of FoxO1 are affected. It is possible since menin
seems to be integral in maintaining FoxO1 nuclear exclusion, that either phosphorylation
or acetylation could be affected. During fasting and re-feeding studies, acute changes are
seen in levels of insulin, glucose, and other important hormones. We started to
investigate what effect acute changes will have in menin deficient livers. As shown
below (Figure 4-1) we see a significant basal increase in phosphorylated Akt (pAkt)
which remains unchanged with re-feeding. This indicates an abnormal response to
insulin signaling and does support that menin is a negative regulator of Akt. Although
not significant, we also observe an increase in acetylation of FoxO1 which could be
compensatory for increased FoxO1 activity (Banks, Kim-Muller et al. 2011).
Glucokinase is differentially regulated by both hepatocyte nuclear factor 4 alpha
(HNF4) and FoxO1. HNF4increases glucokinase (GK) expression during re-feeding
while FoxO1 represses it in fasting (Hirota, Sakamaki et al. 2008), however, there is a
reciprocal expression in the menin knockout livers with an increase of GK at fasting and
a repression during feeding.
85
Figure 4-1: Fasting and 4 hour re-feeding studies on WT, HET, KO mice. A)
pAkt levels in fasted and re-fed mice ***p<0.001, *p<0.05 versus WT. B)
Acetylated FoxO1 normalized to total FoxO1 C) Glucokinase normalized to
Actin, N=3
This decreased expression of GK in the liver at feeding, when it should be induced,
could cause decreases in the downstream pathways that it effects such as glycolysis,
lipogenesis, and the pentose phosphate shunt which are all crucial to post-prandial
hepatic metabolism (Hagiwara, Cornu et al. 2012). This preliminary data shows that loss
of menin in the liver even can have effects on acute regulation of genes involved in the
86
fasting/feeding responses, along with effecting post-translational modification of FoxO1.
Further investigation of the metabolic phenotype of the mice is warranted as even effects
are seen on normal chow fed mice. Eventual elucidation of this regulatory pathway will
lead to new treatments with small molecule intervention for metabolic diseases.
87
References
Ali, S. and D. J. Drucker (2009). "Benefits and limitations of reducing glucagon action
for the treatment of type 2 diabetes." Am J Physiol Endocrinol Metab 296(3):
E415-421.
Authier, F. and B. Desbuquois (2008). "Glucagon receptors." Cell Mol Life Sci 65(12):
1880-1899.
Balogh, K., A. Patócs, et al. (2010). "Menin dynamics and functional insight: Take your
partners." Molecular and Cellular Endocrinology 326(1-2): 80-84.
Balogh, K., K. Rácz, et al. (2006). "Menin and its interacting proteins: elucidation of
menin function." Trends in Endocrinology & Metabolism 17(9): 357-364.
Banks, A. S., J. Y. Kim-Muller, et al. (2011). "Dissociation of the glucose and lipid
regulatory functions of FoxO1 by targeted knockin of acetylation-defective alleles
in mice." Cell metabolism 14(5): 587-597.
Banks, Alexander S., Ja Y. Kim-Muller, et al. (2011). "Dissociation of the Glucose and
Lipid Regulatory Functions of FoxO1 by Targeted Knockin of AcetylationDefective Alleles in Mice." Cell metabolism 14(5): 587-597.
Bassett, J. H., P. Rashbass, et al. (1999). "Studies of the murine homolog of the multiple
endocrine neoplasia type 1 (MEN1) gene, men1." J Bone Miner Res 14(1): 3-10.
Bertolino, P., I. Radovanovic, et al. (2003). "Genetic ablation of the tumor suppressor
menin causes lethality at mid-gestation with defects in multiple organs." Mech
Dev 120(5): 549-560.
88
Bertolino, P., W. M. Tong, et al. (2003). "Heterozygous Men1 mutant mice develop a
range of endocrine tumors mimicking multiple endocrine neoplasia type 1." Mol
Endocrinol 17(9): 1880-1892.
Bertolino, P., W. M. Tong, et al. (2003). "Pancreatic beta-cell-specific ablation of the
multiple endocrine neoplasia type 1 (MEN1) gene causes full penetrance of
insulinoma development in mice." Cancer Res 63(16): 4836-4841.
Brown, M. S. and J. L. Goldstein (2008). "Selective versus total insulin resistance: a
pathogenic paradox." Cell metabolism 7(2): 95-96.
Caslini, C., Z. Yang, et al. (2007). "Interaction of MLL amino terminal sequences with
menin is required for transformation." Cancer Res 67(15): 7275-7283.
Chandrasekharappa, S. C., S. C. Guru, et al. (1997). "Positional Cloning of the Gene for
Multiple Endocrine Neoplasia-Type 1." Science 276(5311): 404-407.
Chavez-Tapia, N. N., M. Uribe, et al. (2009). "New insights into the pathophysiology of
nonalcoholic fatty liver disease." Annals of hepatology 8 Suppl 1: S9-17.
Chen, Y. X., J. Yan, et al. (2006). "The tumor suppressor menin regulates hematopoiesis
and myeloid transformation by influencing Hox gene expression." Proc Natl Acad
Sci U S A 103(4): 1018-1023.
Cheng, P., S. S. Yang, et al. (2011). "Menin prevents liver steatosis through co-activation
of peroxisome proliferator-activated receptor alpha." FEBS Lett 585(21): 34033408.
Cheng, Z. and M. F. White (2010). "Targeting Forkhead Box O1 from the Concept to
Metabolic Diseases: Lessons from Mouse Models." Antioxid Redox Signal.
89
Corbo, V., I. Dalai, et al. (2010). "MEN1 in pancreatic endocrine tumors: analysis of
gene and protein status in 169 sporadic neoplasms reveals alterations in the vast
majority of cases." Endocr Relat Cancer 17(3): 771-783.
Crabtree, J. S., P. C. Scacheri, et al. (2001). "A mouse model of multiple endocrine
neoplasia, type 1, develops multiple endocrine tumors." Proc Natl Acad Sci U S A
98(3): 1118-1123.
Crabtree, J. S., P. C. Scacheri, et al. (2003). "Of mice and MEN1: Insulinomas in a
conditional mouse knockout." Mol Cell Biol 23(17): 6075-6085.
Davis, R. J., J. L. Bennicelli, et al. (1995). "Structural characterization of the FKHR gene
and its rearrangement in alveolar rhabdomyosarcoma." Human Molecular
Genetics 4(12): 2355-2362.
de Lange, P., M. Moreno, et al. (2007). "Fuel economy in food-deprived skeletal muscle:
signaling pathways and regulatory mechanisms." FASEB journal : official
publication of the Federation of American Societies for Experimental Biology
21(13): 3431-3441.
Dey, A. and K. Chandrasekaran (2009). "Hyperglycemia induced changes in liver: in
vivo and in vitro studies." Curr Diabetes Rev 5(2): 67-78.
Doria, A., M.-E. Patti, et al. (2008). "The Emerging Genetic Architecture of Type 2
Diabetes." Cell metabolism 8(3): 186-200.
Duckworth, W. C., R. G. Bennett, et al. (1998). "Insulin Degradation: Progress and
Potential." Endocr Rev 19(5): 608-624.
90
Estall, J. L., M. Kahn, et al. (2009). "Sensitivity of lipid metabolism and insulin signaling
to genetic alterations in hepatic peroxisome proliferator-activated receptor-gamma
coactivator-1alpha expression." Diabetes 58(7): 1499-1508.
Farrell, G. C. and C. Z. Larter (2006). "Nonalcoholic fatty liver disease: from steatosis to
cirrhosis." Hepatology 43(2 Suppl 1): S99-S112.
Ford, E. S., H. W. Kohl, 3rd, et al. (2005). "Sedentary behavior, physical activity, and the
metabolic syndrome among U.S. adults." Obes Res 13(3): 608-614.
Ford, E. S., C. Li, et al. (2010). "Prevalence and correlates of metabolic syndrome based
on a harmonious definition among adults in the US." J Diabetes 2(3): 180-193.
Francis, J., W. Lin, et al. (2011). "The menin tumor suppressor protein is phosphorylated
in response to DNA damage." PLoS One 6(1): e16119.
Fredericks, W. J., N. Galili, et al. (1995). "The PAX3-FKHR fusion protein created by
the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent
transcriptional activator than PAX3." Molecular and Cellular Biology 15(3):
1522-1535.
Fromaget, M., C. Vercherat, et al. (2003). "Functional characterization of a promoter
region in the human MEN1 tumor suppressor gene." J Mol Biol 333(1): 87-102.
Gallagher, E. J., D. LeRoith, et al. (2010). "Insulin Resistance in Obesity as the
Underlying Cause for the Metabolic Syndrome." Mount Sinai Journal of
Medicine: A Journal of Translational and Personalized Medicine 77(5): 511-523.
Gallo, A., C. Cuozzo, et al. (2002). "Menin uncouples Elk-1, JunD and c-Jun
phosphorylation from MAP kinase activation." Oncogene 21(42): 6434-6445.
91
Gao, S. B., Z. J. Feng, et al. (2010). "Menin represses malignant phenotypes of melanoma
through regulating multiple pathways." J Cell Mol Med.
Gross, D. N., A. P. van den Heuvel, et al. (2008). "The role of FoxO in the regulation of
metabolism." Oncogene 27(16): 2320-2336.
Gross, D. N., M. Wan, et al. (2009). "The role of FOXO in the regulation of metabolism."
Curr Diab Rep 9(3): 208-214.
Grundy, S. M., H. B. Brewer, et al. (2004). "Definition of Metabolic Syndrome."
Circulation 109(3): 433-438.
Guru, S. C., J. S. Crabtree, et al. (1999). "Isolation, genomic organization, and expression
analysis of Men1, the murine homolog of the MEN1 gene." Mamm Genome
10(6): 592-596.
Haeusler, R. A., K. H. Kaestner, et al. (2010). "FoxOs Function Synergistically to
Promote Glucose Production." Journal of Biological Chemistry 285(46): 3524535248.
Hagiwara, A., M. Cornu, et al. (2012). "Hepatic mTORC2 Activates Glycolysis and
Lipogenesis through Akt, Glucokinase, and SREBP1c." Cell metabolism 15(5):
725-738.
Heppner, C., K. Y. Bilimoria, et al. (2001). "The tumor suppressor protein menin
interacts with NF-kappaB proteins and inhibits NF-kappaB-mediated
transactivation." Oncogene 20(36): 4917-4925.
Heppner, K. M., K. M. Habegger, et al. (2010). "Glucagon regulation of energy
metabolism." Physiol Behav 100(5): 545-548.
92
Hirota, K., J. Sakamaki, et al. (2008). "A combination of HNF-4 and Foxo1 is required
for reciprocal transcriptional regulation of glucokinase and glucose-6-phosphatase
genes in response to fasting and feeding." J Biol Chem 283(47): 32432-32441.
Houtkooper, R. H., E. Pirinen, et al. (2012). "Sirtuins as regulators of metabolism and
healthspan." Nat Rev Mol Cell Biol 13(4): 225-238.
Huang, J., B. Gurung, et al. (2012). "The same pocket in menin binds both MLL and
JUND but has opposite effects on transcription." Nature 482(7386): 542-546.
Jiang, G. and B. B. Zhang (2003). "Glucagon and regulation of glucose metabolism." Am
J Physiol Endocrinol Metab 284(4): E671-678.
Kaji, H., L. Canaff, et al. (2001). "Inactivation of menin, a Smad3-interacting protein,
blocks transforming growth factor type beta signaling." Proc Natl Acad Sci U S A
98(7): 3837-3842.
Kido, Y., J. Nakae, et al. (2001). "Clinical review 125: The insulin receptor and its
cellular targets." J Clin Endocrinol Metab 86(3): 972-979.
Kim, D. H., T. Zhang, et al. (2011). "Targeting FoxO1 for hypertriglyceridemia." Current
drug targets 12(9): 1245-1255.
Kim, H., J. E. Lee, et al. (2003). "Menin, a tumor suppressor, represses JunD-mediated
transcriptional activity by association with an mSin3A-histone deacetylase
complex." Cancer Res 63(19): 6135-6139.
La, P., A. Desmond, et al. (2006). "Tumor suppressor menin: the essential role of nuclear
localization signal domains in coordinating gene expression." Oncogene 25(25):
3537-3546.
93
Leavens, K. F., R. M. Easton, et al. (2009). "Akt2 is required for hepatic lipid
accumulation in models of insulin resistance." Cell Metab 10(5): 405-418.
Lemos, M. C., B. Harding, et al. (2009). "Genetic background influences embryonic
lethality and the occurrence of neural tube defects in Men1 null mice: relevance to
genetic modifiers." J Endocrinol 203(1): 133-142.
Lemos, M. C. and R. V. Thakker (2008). "Multiple endocrine neoplasia type 1 (MEN1):
analysis of 1336 mutations reported in the first decade following identification of
the gene." Hum Mutat 29(1): 22-32.
Liu, Y., R. Dentin, et al. (2008). "A fasting inducible switch modulates gluconeogenesis
via activator/coactivator exchange." Nature 456(7219): 269-273.
MacConaill, L. E., C. M. Hughes, et al. (2006). "Phosphorylation of the menin tumor
suppressor protein on serine 543 and serine 583." Mol Cancer Res 4(10): 793801.
Manickam, P., A. M. Vogel, et al. (2000). "Isolation, characterization, expression and
functional analysis of the zebrafish ortholog of MEN1." Mamm Genome 11(6):
448-454.
Matsumoto, M., S. Han, et al. (2006). "Dual role of transcription factor FoxO1 in
controlling hepatic insulin sensitivity and lipid metabolism." The Journal of
Clinical Investigation 116(9): 2464-2472.
McCallum, R. W., V. Parameswaran, et al. (2006). "Multiple endocrine neoplasia type 1
(MEN 1) is associated with an increased prevalence of diabetes mellitus and
impaired fasting glucose." Clin Endocrinol (Oxf) 65(2): 163-168.
94
Mensah-Osman, E., Y. Zavros, et al. (2008). "Somatostatin stimulates menin gene
expression by inhibiting protein kinase A." Am J Physiol Gastrointest Liver
Physiol 295(4): G843-854.
Nakae, J., T. Kitamura, et al. (2001). "The forkhead transcription factor Foxo1 (Fkhr)
confers insulin sensitivity onto glucose-6-phosphatase expression." The Journal of
Clinical Investigation 108(9): 1359-1367.
Nakae, J., M. Oki, et al. (2008). "The FoxO transcription factors and metabolic
regulation." FEBS Lett 582(1): 54-67.
Oiso, H., N. Furukawa, et al. (2010). "The role of class I histone deacetylase (HDAC) on
gluconeogenesis in liver." Biochem Biophys Res Commun.
Oiso, H., N. Furukawa, et al. (2011). "The role of class I histone deacetylase (HDAC) on
gluconeogenesis in liver." Biochemical and Biophysical Research
Communications 404(1): 166-172.
Park, J.-M., T.-H. Kim, et al. (2010). "Role of resveratrol in FOXO1-mediated
gluconeogenic gene expression in the liver." Biochemical and Biophysical
Research Communications In Press, Corrected Proof.
Perrot, V. and M. M. Rechler (2005). "The Coactivator p300 Directly Acetylates the
Forkhead Transcription Factor Foxo1 and Stimulates Foxo1-Induced
Transcription." Molecular Endocrinology 19(9): 2283-2298.
Peter, A., N. Stefan, et al. (2011). "Hepatic Glucokinase Expression Is Associated with
Lipogenesis and Fatty Liver in Humans." Journal of Clinical Endocrinology &
Metabolism 96(7): E1126-E1130.
95
Poy, M. N., Y. Yang, et al. (2002). "CEACAM1 regulates insulin clearance in liver." Nat
Genet 30(3): 270-276.
Puig, O. and R. Tjian (2005). "Transcriptional feedback control of insulin receptor by
dFOXO/FOXO1." Genes Dev 19(20): 2435-2446.
Puigserver, P., J. Rhee, et al. (2003). "Insulin-regulated hepatic gluconeogenesis through
FOXO1-PGC-1alpha interaction." Nature 423(6939): 550-555.
Qiang, L., A. S. Banks, et al. (2010). "Uncoupling of Acetylation from Phosphorylation
Regulates FoxO1 Function Independent of Its Subcellular Localization." Journal
of Biological Chemistry 285(35): 27396-27401.
Qu, S., J. Altomonte, et al. (2006). "Aberrant Forkhead Box O1 Function Is Associated
with Impaired Hepatic Metabolism." Endocrinology 147(12): 5641-5652.
Ramnanan, C. J., D. S. Edgerton, et al. (2010). "Molecular characterization of insulinmediated suppression of hepatic glucose production in vivo." Diabetes 59(6):
1302-1311.
Rayasam, G. V., V. K. Tulasi, et al. (2009). "Glycogen synthase kinase 3: more than a
namesake." Br J Pharmacol 156(6): 885-898.
Rhee, J., H. Ge, et al. (2006). "Partnership of PGC-1α and HNF4α in the Regulation of
Lipoprotein Metabolism." Journal of Biological Chemistry 281(21): 1468314690.
Samuel, V. T., C. S. Choi, et al. (2006). "Targeting foxo1 in mice using antisense
oligonucleotide improves hepatic and peripheral insulin action." Diabetes 55(7):
2042-2050.
96
Scacheri, P. C., J. S. Crabtree, et al. (2004). "Homozygous loss of menin is well tolerated
in liver, a tissue not affected in MEN1." Mamm Genome 15(11): 872-877.
Schmidt, S. F. and S. Mandrup (2011). "Gene program-specific regulation of PGC-1α
activity." Genes & Development 25(14): 1453-1458.
Serviddio, G., F. Bellanti, et al. (2008). "Uncoupling protein-2 (UCP2) induces
mitochondrial proton leak and increases susceptibility of non-alcoholic
steatohepatitis (NASH) liver to ischaemia–reperfusion injury." Gut 57(7): 957965.
Shen, H. C., M. He, et al. (2009). "Recapitulation of pancreatic neuroendocrine tumors in
human multiple endocrine neoplasia type I syndrome via Pdx1-directed
inactivation of Men1." Cancer Res 69(5): 1858-1866.
Shen, H. C. and S. K. Libutti (2010). "The menin gene." Cancer Treat Res 153: 273-286.
Sommerfeld, A., A. Krones-Herzig, et al. "Transcriptional co-factors and hepatic energy
metabolism." Molecular and Cellular Endocrinology In Press, Corrected Proof.
Sparks, J. D. and H. H. Dong (2009). "FoxO1 and hepatic lipid metabolism." Current
opinion in lipidology 20(3): 217-226.
Sparks, J. D. and C. E. Sparks (2008). "Overindulgence and metabolic syndrome: is
FoxO1 a missing link?" The Journal of Clinical Investigation 118(6): 2012-2015.
Subramanian, S. and A. Chait (2012). "Hypertriglyceridemia secondary to obesity and
diabetes." Biochimica et biophysica acta 1821(5): 819-825.
Theillaumas, A., M. Blanc, et al. (2008). "Relation between menin expression and NF[kappa]B activity in an intestinal cell line." Molecular and Cellular Endocrinology
291(1-2): 109-115.
97
Tsukada, T., Y. Nagamura, et al. (2008). "MEN1 gene and its mutations: Basic and
clinical implications." Cancer Sci.
Valenti, L., R. Rametta, et al. (2008). "Increased expression and activity of the
transcription factor FOXO1 in nonalcoholic steatohepatitis." Diabetes 57(5):
1355-1362.
van der Heide, L. P. and M. P. Smidt (2005). "Regulation of FoxO activity by CBP/p300mediated acetylation." Trends in biochemical sciences 30(2): 81-86.
van Wijk, J. P., K. M. Dreijerink, et al. (2011). "Increased prevalence of impaired fasting
glucose in MEN1 gene mutation carriers." Clin Endocrinol (Oxf).
van Wijk, J. P. H., K. M. A. Dreijerink, et al. (2012). "Increased prevalence of impaired
fasting glucose in MEN1 gene mutation carriers." Clinical Endocrinology 76(1):
67-71.
Wagner, A. M., J. M. Martin-Campos, et al. (2005). "Patients with MEN-1 are more
insulin-resistant than their non-affected relatives." Eur J Intern Med 16(7): 507509.
Wang, Y., A. Ozawa, et al. (2010). "The tumor suppressor protein menin inhibits AKT
activation by regulating its cellular localization." Cancer Res.
Wu, Z., P. Puigserver, et al. (1999). "Mechanisms controlling mitochondrial biogenesis
and respiration through the thermogenic coactivator PGC-1." Cell 98(1): 115-124.
Wuescher, L., K. Angevine, et al. (2011). "Insulin regulates menin expression,
cytoplasmic localization, and interaction with FOXO1." American journal of
physiology. Endocrinology and metabolism 301(3): E474-483.
98
Wuescher, L., K. Angevine, et al. (2012). "Menin liver-specific hemizygous mice
challenged with high fat diet show increased weight gain and markers of
metabolic impairment." Nutrition and Diabetes 2: e34.
Yaguchi, H., N. Ohkura, et al. (2002). "Menin, the multiple endocrine neoplasia type 1
gene product, exhibits GTP-hydrolyzing activity in the presence of the tumor
metastasis suppressor nm23." J Biol Chem 277(41): 38197-38204.
Yeh, M. M. and E. M. Brunt (2007). "Pathology of nonalcoholic fatty liver disease." Am
J Clin Pathol 128(5): 837-847.
Yoon, J. C., P. Puigserver, et al. (2001). "Control of hepatic gluconeogenesis through the
transcriptional coactivator PGC-1." Nature 413(6852): 131-138.
Zablewska, B., L. Bylund, et al. (2003). "Transcription regulation of the multiple
endocrine neoplasia type 1 gene in human and mouse." J Clin Endocrinol Metab
88(8): 3845-3851.
Zhang, H., W. Li, et al. (2012). "Glucose-Mediated Repression of Menin Promotes
Pancreatic β-Cell Proliferation." Endocrinology 153(2): 602-611.
Zhang, W., S. Patil, et al. (2006). "FoxO1 regulates multiple metabolic pathways in the
liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression." The
Journal of biological chemistry 281(15): 10105-10117.
Zhang, W., S. Patil, et al. (2006). "FoxO1 regulates multiple metabolic pathways in the
liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression." J Biol
Chem 281(15): 10105-10117.
99
Zindy, P. J., A. L'Helgoualc'h, et al. (2006). "Upregulation of the tumor suppressor gene
menin in hepatocellular carcinomas and its significance in fibrogenesis."
Hepatology 44(5): 1296-1307.
Zorn, A. M. (2008). Liver development. StemBook. Cambridge (MA).
100