Regenerative Neurogenesis After Ischemic Stroke Promoted
by Nicotinamide Phosphoribosyltransferase–Nicotinamide
Adenine Dinucleotide Cascade
Yan Zhao, MD, PhD*; Yun-Feng Guan, BSc*; Xiao-Ming Zhou, MD*; Guo-Qiang Li, MD;
Zhi-Yong Li, MD, PhD; Can-Can Zhou, BSc; Pei Wang, MD, PhD; Chao-Yu Miao, MD, PhD
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Background and Purpose—Nicotinamide adenine dinucleotide (NAD) is a ubiquitous fundamental metabolite. Nicotinamide
phosphoribosyltransferase (Nampt) is the rate-limiting enzyme for mammalian NAD salvage synthesis and has been
shown to protect against acute ischemic stroke. In this study, we investigated the role of Nampt–NAD cascade in brain
regeneration after ischemic stroke.
Methods—Nampt transgenic (Nampt-Tg) mice and H247A mutant enzymatic-dead Nampt transgenic (ΔNampt-Tg) mice
were subjected with experimental cerebral ischemia by middle cerebral artery occlusion. Activation of neural stem cells,
neurogenesis, and neurological function recovery were measured. Besides, nicotinamide mononucleotide and NAD, two
chemical enzymatic product of Nampt, were administrated in vivo and in vitro.
Results—Compared with wild-type mice, Nampt-Tg mice showed enhanced number of neural stem cells, improved neural
functional recovery, increased survival rate, and accelerated body weight gain after middle cerebral artery occlusion,
which were not observed in ΔNampt-Tg mice. A delayed nicotinamide mononucleotide administration for 7 days with
the first dose at 12 hours post middle cerebral artery occlusion did not protect acute brain infarction and neuronal deficit;
however, it still improved postischemic regenerative neurogenesis. Nicotinamide mononucleotide and NAD+ promoted
proliferation and differentiation of neural stem cells in vitro. Knockdown of NAD-dependent deacetylase sirtuin 1
(SIRT1) and SIRT2 inhibited the progrowth action of Nampt–NAD axis, whereas knockdown of SIRT1, SIRT2, and
SIRT6 compromised the prodifferentiation effect of Nampt–NAD axis.
Conclusions—Our data demonstrate that the Nampt–NAD cascade may act as a centralizing switch in postischemic
regeneration through controlling different sirtuins and therefore represent a promising therapeutic target for long-term
recovery of ischemic stroke. (Stroke. 2015;46:00-00. DOI: 10.1161/STROKEAHA.115.009216.)
Key Words: ischemic stroke ◼ NAD ◼ neurogenesis ◼ neural stem cells ◼ sirtuin
N
icotinamide adenine dinucleotide (NAD) is a coenzyme
found in all living cells, and nicotinamide phosphoribosyltransferase (Nampt) is the rate-limiting enzyme for
NAD biosynthesis in mammal.1 Nampt catalyzes the reaction
between nicotinamide and 5-phosphoribosyl-1-pyrophosphate
to yield nicotinamide mononucleotide (NMN), an intermediate in the biosynthesis of NAD.1 Classically, NAD acts as a
coenzyme and metabolite playing a fundamental role in electron transfer chain and energy generation (ATP production)
through oxidative phosphorylation.2 Recent work has revealed
an entirely different role of NAD as a critical signaling regulator.3,4 Moreover, with the identification of a group of NADconsuming proteins,3 such as the sirtuins, poly(ADP-ribose)
polymerases, and cyclic ADP-ribose synthases, Namptregulated NAD pool has drawn much attention as a substrate
and a regulator in cell signaling and cellular homeostasis,
such as metabolism,5,6 circadian rhythms,7 immunity,8 and cell
death.9
Nampt–NAD cascade plays critical roles in cerebral ischemic injury. Cerebral ischemia caused brain NAD depletion followed by brain cell death.10 Replenishment of NAD conferred
a marked neuroprotection against ischemic cell death.10 We
and other groups have shown that Nampt is mainly localized
on neurons rather than glial cells,11,12 and both intercellular and
extracellular Nampt display potent neuroprotection in ischemic
stroke models.11–13 We also showed that induction of autophagy
Received April 20, 2015; final revision received May 9, 2015; accepted May 14, 2015.
From the Department of Pharmacology, Second Military Medical University, Shanghai, China (Y.Z., Y.-F.G., G.-Q.L., Z.-Y.L., C.-C.Z., P.W., C.-Y.M.);
Department of Science and Education, Shandong Provincial Hospital affiliated to Shandong University, Jinan, China (X.-M.Z); and Center of Stroke,
Beijing Institute for Brain Disorders, Beijing, China (C.-Y.M.).
*Y. Zhao, Y.-F. Guan, and X.-M. Zhou contributed equally.
The online-only Data Supplement is available with this article at http://stroke.ahajournals.org/lookup/suppl/doi:10.1161/STROKEAHA.
115.009216/-/DC1.
Correspondence to Chao-Yu Miao, MD, PhD or Pei Wang, MD, PhD, Department of Pharmacology, Second Military Medical University, Shanghai,
China. E-mail [email protected] or [email protected]
© 2015 American Heart Association, Inc.
Stroke is available at http://stroke.ahajournals.org
DOI: 10.1161/STROKEAHA.115.009216
1
2 Stroke July 2015
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
at the early stage of ischemia contributes to the neuroprotection
of Nampt.14 Stein et al15 demonstrated that forebrain excitatory
neurons mainly use intracellular Nampt-mediated NAD biosynthesis to maintain their survival and function. These observations support the view that Nampt–NAD cascade may be a
critical therapeutic target in brain disorders. However, the role
of Nampt–NAD signaling in brain regeneration after cerebral
ischemia has not been examined. Given the crucial role of NAD
signaling in cellular functions and biological consequences,16
we applied genetic and pharmacological approaches to study the
effects of Nampt–NAD axis in postischemic brain regeneration.
We found that the number of neural stem cells (NSCs) in
Nampt transgenic (Nampt-Tg) mouse brain was higher than
that in H247A-enzymatic–dead Nampt (ΔNampt) transgenic
(ΔNampt-Tg) mouse brain after ischemic stroke. Neural functional recovery was also better improved in Nampt-Tg mice
than ΔNampt-Tg mice. A delayed administration of Nampt
enzymatic product (NMN) did not protect brain infarction but
successfully improved neurogenesis in vivo. NMN and NAD
treatment also enhanced proliferation and differentiation of
cultured NSCs in vitro. Knockdown of sirtuin deacetylases
(SIRT1, SIRT2, or SIRT6) significantly reduced the proneurogenesis effect of Nampt enzymatic product. Thus, we provide
first evidence that Nampt–NAD cascade is not only crucial
against acute brain ischemic injury but also important for
postischemic regeneration.
Methods
Mice
Ten-week-old male C57BL/6J mice were purchased from SinoBritish SIPPR/BK Lab Animal Ltd (Shanghai, China). Nampt-Tg
mice overexpressing normal mouse Nampt and ΔNampt-Tg mice
overexpressing H247A-ΔNampt17 were generated as described previously.18 All experiments were performed according to the National
Institutes of Health guidelines on the use of laboratory animal.
Generation of Transgenic Mice
Nampt-Tg mice and H247A mutant ΔNampt transgenic mice
(ΔNampt-Tg mice) were described in our previous report.18
Linearized pIRES2-EGFP vector encoding full-length mouse Nampt
or ΔNampt17 under control of the ubiquitin promoter was injected
into fertilized 1-cell eggs. Injected fertilized eggs were transplanted
into the oviducts of pseudopregnant F1 hybrids of C57BL/6J mice.
Founder mice were hybridized with wild-type (WT) C57BL/6J mice
to produce mice used in all the experiments.
Cerebral Ischemia Model
Cerebral ischemia/reperfusion model was induced by middle cerebral artery occlusion (MCAO) in mice as previously described.11,19
Figure 1. Nicotinamide phosphoribosyltransferase (Nampt) overexpression promotes neurogenesis after ischemic stroke. A, Scheme
showing the generation of Nampt transgenic (Nampt-Tg) and ΔNampt transgenic (ΔNampt-Tg) mice and the experiment design for BrdU
injection and immunostaining. Fragments containing His-tagged mouse normal-Nampt or ΔNampt cDNA were subcloned into pIRES2EGFP vector under control of the ubiquitin promoter. B, Representative images and quantitative analysis of neurogenesis (BrdU+/NeuN+)
in dentate gyrus. C, Representative images and quantitative analysis of migrated neural progenitor cells (BrdU+/DCX+) in dentate gyrus
and subventricular zone (SVZ). D, Representative images and quantitative analysis of proliferated neural stem cells (BrdU+/Nestin+, top)
and radical glial stem cells (GFAP+/Nestin+, bottom) on day 7 after MCAO. n=8; *P<0.01 vs wild-type (WT), #P<0.01 vs Nampt-Tg.
Zhao et al Nampt Promotes Postischemic Cerebral Neurogenesis 3
Briefly, adult male mice weighing from 20 to 25 g were anesthetized with an intraperitoneal injection of chloral hydrate (400 mg/
kg). Rectal temperature was monitored and maintained at 37°C
during the surgical procedure and recovery period until the animals
regained full consciousness. The right middle cerebral artery was
occluded by silicone rubber–coated nylon monofilament with round
tip and advanced 1.1 cm into the internal carotid artery to obstruct
the right middle cerebral artery.
Inclusion and Exclusion Criteria
Animals with an adequacy of MCAO as evidenced by >75% drop
in the cerebral blood flow determined by Laser-Doppler flowmetry
(VMSTM-LDF1; Moor Instruments, Axminster, United Kingdom)
were included in the study. Animals were excluded from analysis
when the following occurred: inadequacy of MCAO as evidenced by
incomplete occlusion (<75%), subarachnoid hemorrhage on postmortem analysis, death because of anesthesia or surgery, and death that
occurred within 24 hours post MCAO.
NMN Treatment in mice
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Intraperitoneal injection of NMN (500 mg/kg) was given at different
times (30 minutes and 12 hours) post MCAO to explore the potential
neuroprotective effect of NMN on acute ischemia cerebral injury. For
delayed NMN treatment, mice were administrated with intraperitoneal injection of NMN (500 mg/kg per d)6,11 for 7 days with the first
dose at 12 hours post MCAO. After NMN administration, the mice
were maintained for another week and examined with water maze test
for 3 days. Then, the mice were anesthetized and executed to obtain
brain tissue for immunohistochemistry.
Measurement of NAD in Brain Tissue
NAD concentration was determined using NAD quantification kit
(BioVision) as described previously.11,20 Brain tissue (2 g) was cut
and washed with cold PBS and homogenized with 400 μL of extraction buffer supplied by the kit in a microcentrifuge tube. Sample was
centrifuged at 12 000g for 5 minutes. The extracted supernatant was
transferred into a new tube. Then, the NAD levels were determined by
the kit according to the instructions of manufacturer.
Morris Water Maze Test
Morris water maze tests were performed as described previously.21
Experiments were performed on days 21, 23, 25, and 27 post MCAO
comprising 20 trials (5 trials per day for every mouse). The data
were collectively analyzed with the HVS Image 2020 Plus Tracking
System (US HVS Image, San Diego, CA). On day 28 post MCAO,
24 hours after the previous training, probe trials were started in which
the escape platform was removed and the mice were allowed to swim
freely for 2 minutes, and the times of crossing the platform (passing
times) were calculated.
Immunohistochemistry Staining
BrdU (Sigma-Aldrich, St. Louis, MO) was consecutively injected
(50 mg/kg per d IP, dissolved in saline) as indicated in Figure 1.
For immunostaining, the mice were anesthetized and then fixed by
transcardiac perfusion with 4% paraformaldehyde (pH 7.4). After
dissection, the brains were immersed in 4% paraformaldehyde at
4°C for 24 hours, cryoprotected in 15% to 30% (wt/vol) sucrose/
paraformaldehyde, and cut into slices (20 μmol/L). For BrdU immunostaining, the brain sections were incubated in 1 N HCl at 45°C
for 30 minutes and then neutralized in 0.1 mol/L sodium borate
buffer (pH 8.0). The sections or cells were sequentially incubated
with 10% goat serum for 2 hours and incubated in specific primary
antibodies as follows: anti-BrdU antibody (1:200; number ab1893,
Abcam), NeuN (1:500; number 427917, Chemicon), GFAP (1:500;
number 3670, Cell Signaling Technology), Nampt (1:400; number H-300, Stanta Cruz Biotechnology), Nestin (1:400; number
H-85, Stanta Cruz Biotechnology), CNP (1:400; number BA1754,
Boster China), and Tuj-1 (1:400; number 5568s, Cell Signaling
Technology). After being washed by 3× with PBS, the sections
and cells were incubated with corresponding secondary antibodies
(Alexa 488-conjugated and Cy3-conjugated). The fluorescence-labeled sections were examined with FLUOVIEW FV1000 Confocal
Figure 2. Nicotinamide phosphoribosyltransferase (Nampt) overexpression accelerates postischemic neurological function recovery. A,
Representative swimming tracks and quantitative analysis of escape latency, path length, and passing time in Morris water maze test
after middle cerebral artery occlusion (MCAO). n=15; *P<0.01 vs wild-type (WT). B–D, Percent survival curve (B), body weight curve (C),
and representative images (D) of mouse brain at 28 days after MCAO. n=8, 39, 42 and 45 in Sham, WT, Nampt-Tg, and ΔNampt-Tg
groups, respectively. *P<0.01 vs WT.
4 Stroke July 2015
laser scanning microscope (Olympus, Japan). Immunochemicalpositive cells were counted in the dentate gyrus and subventricular
zone in at least 10 sections per animal.
Neurosphere Culture, Differentiation, and
Proliferation
Culture of neurospheres was based on the previously published
methods with minor modifications.22 Dissected telencephalons of
embryonic day 13 mice were digested with Accutase solution (Life
Technologies, Gaithersburg, MD) for 5 minutes at 37°C. The single
and suspended cells were plated at a density of 1×104 cells per milliliter on 6-well plate. Growth medium was composed of DMEM-F-12
medium (Life Technologies), 20 ng/mL of epidermal growth factor
(Life Technologies), and 20 ng/mL basic fibroblast growth factor
(Life Technologies). At 7 days, the neurospheres were plated on polylysine- (Sigma) coated glass coverslips. Differentiation was induced
by withdrawal of epidermal growth factor and basic fibroblast growth
factor. At day 7, the differentiation was evaluated. Cell viability was
evaluated by a nonradioactive cell counting kit-8 (CCK-8) assay
(Dojindo, Kumamoto, Japan) as described previously.11
Nampt-Tg mice was higher than that in WT mice, which was
not observed in ΔNampt-Tg mice (Figure 1B). At day 9 post
MCAO, the number of BrdU+/DCX+ cells in dentate gyrus and
subventricular zone of Nampt-Tg mice, but not ΔNampt-Tg
mice, was higher than that in WT mice (Figure 1C). The
numbers of BrdU+/Nestin+ cells in dentate gyrus and GFAP+/
Nestin+ cells in subventricular zone were significantly higher
in Nampt-Tg mice (Figure 1D). These results indicate that
Nampt overexpression elevates brain NAD levels and promotes NSC activation and neurogenesis after ischemic stroke
via its enzymatic activity.
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
siRNA-Mediated Knockdown of SIRT1-7 by
Nucleofection
For plasmids encoding siRNAs of SIRT1-7, we used pRNAT-U6.2/
Lenti vector (Genescript, Piscataway, NJ) as described previously.23
Sequences of effective siRNAs targeting SIRT1-7 are listed in Table I in
the online-only Data Supplement. Nucleofection of embryonic mouse
NSCs were performed by electroporation as reported previously.24 We
used 5×105 neurosphere-derived NSCs per sample and resuspended
them in 20 μL of P3 primary cell solution containing 5 μg of plasmid DNA. Cells were transferred into the nucleofector cuvette (20 μL)
according to the manufacturer’s protocol (Lonza, Walkersville, MD).
After the pulse application, 180 μL of prewarmed neurosphere medium
was added to the electroporated NSCs in the cuvette. NSCs were gently
resuspended in the cuvette and transferred into a 1.5-mL sterile tube.
After centrifugation with 80g for 5 minutes at room temperature, the
supernatant was discarded and the cell pellet was resuspended in 500
μL of neurosphere medium containing epidermal growth factor (20 ng/
mL) and basic fibroblast growth factor (20 ng/mL).
Statistical Analysis
Data are presented as mean±SEM. ANOVA was used for comparisons. Neuroscore was analyzed by Mann–Whitney test. Survival
curve was analyzed by Log-rank test. Statistical significance was set
at P<0.05.
Results
Nampt-Mediated NAD Promotes NSC Activation
and Neurogenesis After Ischemic Stroke
In H247A mutant-Nampt (ΔNampt), the histidine at site
247 was mutated into alanine17 to inactivate its NADbiosynthetic activity (Figure IA and IB in the online-only Data
Supplement). We generated 2 strains of transgenic mice: normal Nampt-Tg mice and ΔNampt transgenic (ΔNampt-Tg)
mice (Figure 1A).18 DNA assay, immunoblotting, and immunochemistry confirmed the overexpression of normal-Nampt
and ΔNampt in mice (Figures IC, ID, and II in the online-only
Data Supplement). Transgene of normal-Nampt increased
the NAD concentration in brain tissue, whereas transgene
of ΔNampt decreased the NAD concentration in brain tissue
(Figure III in the online-only Data Supplement). MCAO was
performed in (WT), Nampt-Tg, and ΔNampt-Tg mice to study
the activation of NSCs (Figure 1B). At days 7, 14, and 28 post
MCAO, the number of BrdU+/NeuN+ cells in dentate gyrus of
Figure 3. Nicotinamide phosphoribosyltransferase enzymatic
product nicotinamide mononucleotide (NMN) improves survival
and neurogenesis after ischemic stroke. A, Comparison of infarct
size and neurological deficit score in early and delayed NMN
treatment in middle cerebral artery occlusion (MCAO) mice. NMN
(500 mg/kg IP) was given for 7 days with the first dose at 30 minutes (early) or 12 hours (delayed) after MCAO; n=12 per group.
B, Body weight curve and percent survival curve in mice treated
with saline (control) or a delayed administration of NMN; n=16
per group. C, Effects of delayed NMN administration (500 mg/kg
per d IP) on neuronal function recovery in MCAO mice; n=15 per
group. Morris water maze test was performed on day 15 to day
17 post MCAO. *P<0.05, **P<0.01 vs control (Ctrl). D, Representative images and quantitative analysis of neurogenesis (BrdU+/
NeuN+) in subventricular zone (SVZ; I) and dentate gyrus (J) at
day 18 post MCAO; n=12 per group. **P<0.01 vs control (Ctrl).
Scale bar, 100 μmol/L.
Zhao et al Nampt Promotes Postischemic Cerebral Neurogenesis 5
Transgene of Nampt Accelerates Postischemic
Neurological Function Recovery and Body Weight
Gain
We used Morris water maze to examine brain learning and
memory function after ischemic stroke. In visible platform tests, Nampt-Tg mice exhibited a decreased latency to
escape onto the visible platform and a shorter swimming distance before escaping onto the visible platform (Figure 2A).
Nampt-Tg mice also had more platform-passing times to
escape onto the hidden platform (Figure 2A). These improvements in Nampt-Tg mice were not found in ΔNampt-Tg
mice (Figure 2A). Accordingly, Nampt-Tg mice, but not
ΔNampt-Tg mice, displayed a higher survival rate (Figure 2B)
and a better recovery of body weight (Figure 2C) compared
with WT mice. Moreover, the cortical cavitation caused by
ischemic injury was attenuated in Nampt-Tg mice but not in
ΔNampt-Tg mice (Figure 2D).
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Delayed Administration of NMN Improves
Postischemic Regenerative Neurogenesis
Intraperitoneal injection of NMN, the enzymatic product
of Nampt (Figure IVA in the online-only Data Supplement)
increased cerebral NAD/nicotinamide adenine dinucleotide phosphate ratio (Figure IVB in the online-only Data
Supplement). Early NMN administration with the first dose
at 30 minutes post MCAO for 7 days decreased brain infarction and neurological deficit (Figure 3A), enhanced animal
survival, and accelerated body weight recovery (Figure V
in the online-only Data Supplement). However, because the
early NMN administration with the first dose at 30 minutes post MCAO is able to protect acute cerebral ischemic
injury, the possibility that the difference of neuronal damage is likely to lead to inconsistent levels of survived NSCs
and thereby affects post ischemic neurogenesis cannot be
ruled out.
To further tease out the specific effect of Nampt–NAD
axis on neurogenesis, we applied a delayed administration of
NMN for 7 days with the first dose at 12 hours post MCAO.
Delayed NMN administration was unable to decrease brain
infarction and neurological deficit (Figure 3A), suggesting
that delayed NMN administration does not have neuroprotection. Delayed NMN administration also did not affect the
body weight (Figure 3B). However, delayed NMN treatment
reduced MCAO-induced death (Figure 3C) during the first
weeks post MCAO. Furthermore, delayed NMN treatment
not only improved the neuronal recovery (Figure 3C) but also
increased neurogenesis (BrdU+/NeuN+ cells) in subventricular
zone and dentate gyrus of MCAO mice (Figure 3D). Taken
together, these results indicate that Nampt–NAD+ axis is able
to improve postischemic neurogenesis.
NMN and NAD Induce NSC Neurosphere
Proliferation and Differentiation
We further investigated the potential effect of Namptmediated NAD pathway (Figure 3A) on neurogenesis in cultured NSC neurospheres. Nampt was expressed abundantly
Figure 4. Nicotinamide mononucleotide (NMN) and nicotinamide adenine dinucleotide (NAD) promote proliferation and differentiation in
cultured neural stem cells (NSCs). A, Characterization of primary neurospheres formed by NSCs. Nicotinamide phosphoribosyltransferase
is expressed in neurospheres and secreted into culture medium. B, Representative images and quantitative analysis of proliferation of
NSCs (BrdU+/Nestin+, yellow) treated by NMN (300 μmol/L), NAD (300 μmol/L), and FK866 (20 nmol/L) for 7 days. C, Differentiation (Tuj-1
staining) of neurospheres treated by NMN (300 μmol/L), NAD (300 μmol/L), and FK866 (20 nmol/L) for 7 days. n=6; *P<0.05 vs control,
#P<0.05 vs NMN or NAD.
6 Stroke July 2015
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
in NSC neurospheres (Figure 4A), and NSCs were able to
secrete Nampt (Figure 4A). Flow cytometer assay showed
that the number of NSCs was increased by NMN (Figure
VI in the online-only Data Supplement). Double immunostaining (BrdU+/Nestin+, Figure VII in the online-only
Data Supplement) assay also showed that NMN and NAD
promoted NSC proliferation, whereas Nampt inhibitor FK866 (10 nmol/L, also known as daporinad) induced
converse effect (Figure 4B). NSCs cultured with differentiation medium exhibited phenotypes of neurons, astrocytes,
and oligodendrocytes (Figure VIII in the online-only Data
Supplement). NMN and NAD increased the Tuj-1/DAPI
ratio and GFAP/DAPI ratio, suggesting a prodifferentiation
effect of NMN and NAD (Figure 4C).
neuroprotection against acute cerebral ischemia,11 SIRT3/4
for protecting against cell death,9 and SIRT6 for synthesis of
tumor necrosis factor.8 SIRT1 to 7 were knocked down with
specific siRNA by nucleofection in NSCs (Figure IX in the
online-only Data Supplement). Knockdown of SIRT1 or
SIRT2 partly blocked the increase of cell viability induced
by either NMN or NAD (Figure 5A and 5B). BrdU+/Nestin+
immunostaining showed that knockdown of SIRT1 or SIRT2
blocked the increase of NSC proliferation by either NMN or
NAD (Figure 5C). Meanwhile, Tuj-1 immunostaining showed
that knockdown of SIRT1, SIRT2, or SIRT6 postponed the
prodifferentiation (Tuj-1/DAPI ratio) effect of either NMN or
NAD (Figure 6A and 6B).
Sirtuin Deacetylases Mediate the Proneurogenesis
Effect of Nampt–NAD Cascade
Here, we contribute new insights into the function of
Nampt–NAD axis in regeneration after ischemic stroke.
Previously, we and others demonstrate that Nampt–NAD
axis is a potent defense system in acute ischemic brain
injury. Nampt confers neuroprotection against ischemic
Sirtuins, a family of NAD-dependent deacetylases, regulate
neurogenesis.25 Most of biological functions of Nampt–NAD
cascade were mediated by sirtuins, including SIRT1 for
Discussion
Figure 5. Sirtuin 1 (SIRT1) and SIRT2 are required for the proliferative effect of nicotinamide mononucleotide (NMN) and nicotinamide
adenine dinucleotide (NAD). A and B, Effects of NAD (300 μmol/L, A) and NMN (300 μmol/L, B) on cell viability in siRNA1-7–transfected
neural stem cells (NSCs) for 7 days. C, Effects of NAD (300 μmol/L) and NMN (300 μmol/L) on BrdU+/Nestin+ cell number in siRNA17–transfected NSCs for 7 days. n=8; *P<0.05 vs siRNA-scramble.
Zhao et al Nampt Promotes Postischemic Cerebral Neurogenesis 7
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Figure 6. Sirtuin 1 (SIRT1), SIRT2, and SIRT6 are required for the prodifferentiation effect of nicotinamide mononucleotide (NMN) and
nicotinamide adenine dinucleotide (NAD). A, siRNA-transfected neural stem cells (NSCs) were treated with NMN (300 μmol/L) and NAD
(300 μmol/L) for 7 days, and then the Tuj-1 staining was performed to evaluate the differentiation of NSCs. B, Quantitative analysis on the
differentiation of NSCs treated by NMN and NAD. n=8; *P<0.05 vs siRNA-scramble.
death,11,12 potentiates autophagy salvage mechanism at early
stage of cerebral ischemia,14 and ultimately promotes neuronal survival. In this study, we focused on neurogenesis post
ischemic stroke. Nampt-Tg mice, but not H247A-ΔNampt
transgenic mice, displayed enhanced NSC activation and
improved neurological functional recovery after ischemic
stroke. Furthermore, delayed NMN treatment, which cannot
confer neuroprotection, still improved postischemic neurogenesis. Either NMN or NAD promoted NSC proliferation/
differentiation via a sirtuin deacetylase–dependent manner,
whereas Nampt chemical inhibitor FK866 induced converse
effect. In addition, Nampt has a proangiogenic capacity.26
All these results suggest that Nampt–NAD+ cascade may
have both neuroprotective and proneurogenesis effects
ensuring that adequate NAD content in the brain may have
advantages on facilitating both angiogenesis27 and neurogenesis after cerebral ischemia.
An interesting and unexpected phenomenon is that
the proneurogenesis effect of Nampt–NAD axis requires
several sirtuins rather than SIRT1 solely. We found that
SIRT1 and SIRT2 contribute to NSC proliferation, whereas
SIRT1, SIRT2, and SIRT6 contribute to NSC differentiation. Our study seemed to be the first work revealing the
effects of SIRT2 and SIRT6 in postischemia neurogenesis.
The transcription levels of sirtuin family in NSCs are selectively regulated by different histone acetylation in neural
development process.28 Most of studies devoting to reveal
the molecular mechanism underlying the biological functions of Nampt have highlighted the importance of SIRT1
for the roles of Nampt in neuron.11,14,29 Stein et al30 showed
that Nampt is critical for oligodendrocytic lineage fate decisions in NSCs through a mechanism mediated by SIRT1
and SIRT2. SIRT6 was reported to be involved in proliferation/differentiation of bone marrow mesenchymal stem
cells.31 We did not observe the influence of knockdown of
SIRT3, 4, 5, and 7 on NSC proliferation and differentiation.
This interesting and unexpected phenomenon may have to
do with the distribution of sirtuins family proteins. SIRT1,
SIRT6, and SIRT7 were mainly localized to nucleus; SIRT2
is a predominantly cytoplasmic deacetylase that colocalizes with microtubules; SIRT3, SIRT4, and SIRT5 were
predominantly present in mitochondria. There were still
no data on the effects of SIRT3, SIRT4, SIRT5, and SIRT7
in biological functions of NSCs. According to our data,
SIRT3, SIRT4, SIRT5, and SIRT7 might not be involved in
the regulatory roles of Namp-NAD+ axis in NSCs. Several
specified sirtuins, including SIRT1, SIRT2, and SIRT6, may
cooperate with each other to regulate NSC proliferation and
differentiation.
Our data indicate a potentially clinical importance of
Nampt–NAD axis. Obviously, modulation of Nampt genetically is far from clinical application. Supplementation of
NMN and activation of Nampt are 2 potential ways to provide adequate NAD pool. NMN is a small-molecule chemical
easy to be administrated to modulate intracellular NAD level.
Our previous data demonstrate that NMN can pass through
blood–brain barrier in the mouse.11 NMN has been reported to
treat diabetes mellitus and aging in animal models.6,30 Our data
provide evidence that brain NAD was increased by intraperitoneal injection of NMN, and a delayed supplementation of
8 Stroke July 2015
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
NMN may be of benefit for regeneration post ischemic stroke.
NMN may be safe used in stroke rehabilitation in long-term
treatment because it is an endogenous substrate. Activation
of Nampt may be another way to maintain intracellular NAD
pool. Prolonged administration of P7C3 chemicals, a class of
newly discovered small molecules screened from 1000 druglike compounds, impeded neuron death and preserved cognitive capacity in aged rodent.32 The mechanism by which P7C3
chemicals initiate the neuroprotection has been proposed in
a recent study; P7C3 chemicals may function via activating
Nampt.19 However, it is yet unknown for the efficacy of P7C3
chemicals in stroke model.
In conclusion, we demonstrate that Nampt promotes
regeneration after cerebral ischemia via its enzymatic activity. Our results provide new insights into the critical roles of
Nampt–NAD axis in cerebral ischemia and would add weight
to the notion that modulation of Nampt–NAD axis, such as
supplementation of NMN, may be a promising treatment for
ischemic stroke.
Acknowledgments
We thank Dr Cynthia Wolberger (Johns Hopkins University School of
Medicine) for providing H247A mutant Nampt plasmid. C.-Y. Miao
and P. Wang designed the study. Y. Zhao, Y.-F. Guan, and X.-M. Zhou
performed most of the experiments. G.-Q. Li performed nicotinamide
mononucleotide experiments in vivo. Z.-Y. Li screened effective siRNAs for SIRT1-7 knockdown. C.-C. Zhou performed some of animal
experiments. P. Wang, Y. Zhao, and C.-Y. Miao wrote the article. All
authors contributed to the analysis of experimental data.
Sources of Funding
This work was supported by grants from National Natural Science
Foundation of China (81373414, 81130061, 81473208, and 81422049),
National 863 Plan Young Scientist Program (2015AA020943),
National Basic Research Program of China (2009CB521902),
Shanghai Qimingxing project (14QA1404700), and Shandong
Province Natural Science Foundation (ZR2014HQ003).
Disclosures
C.-Y. Miao, P. Wang, and Y.-F. Guan are inventors of a Chinese patent (no. CN101601679A) named Application of nicotinamide mononucleotide, which is related to the content of this article.
References
1. Rongvaux A, Shea RJ, Mulks MH, Gigot D, Urbain J, Leo O, et al. Pre-B-cell
colony-enhancing factor, whose expression is up-regulated in activated lymphocytes, is a nicotinamide phosphoribosyltransferase, a cytosolic enzyme
involved in NAD biosynthesis. Eur J Immunol. 2002;32:3225–3234. doi:
10.1002/1521-4141(200211)32:11<3225::AID-IMMU3225>3.0.CO;2-L.
2.Rich PR. The molecular machinery of Keilin’s respiratory chain.
Biochem Soc Trans. 2003;31(Pt 6):1095–1105.
3. Houtkooper RH, Cantó C, Wanders RJ, Auwerx J. The secret life of
NAD+: an old metabolite controlling new metabolic signaling pathways.
Endocr Rev. 2010;31:194–223. doi: 10.1210/er.2009-0026.
4. Koch-Nolte F, Haag F, Guse AH, Lund F, Ziegler M. Emerging roles
of NAD+ and its metabolites in cell signaling. Sci Signal. 2009;2:mr1.
doi: 10.1126/scisignal.257mr1.
5. Revollo JR, Körner A, Mills KF, Satoh A, Wang T, Garten A, et al.
Nampt/PBEF/Visfatin regulates insulin secretion in beta cells as a
systemic NAD biosynthetic enzyme. Cell Metab. 2007;6:363–375.
doi: 10.1016/j.cmet.2007.09.003.
6. Yoshino J, Mills KF, Yoon MJ, Imai S. Nicotinamide mononucleotide, a
key NAD(+) intermediate, treats the pathophysiology of diet- and ageinduced diabetes in mice. Cell Metab. 2011;14:528–536. doi: 10.1016/j.
cmet.2011.08.014.
7. Nakahata Y, Sahar S, Astarita G, Kaluzova M, Sassone-Corsi P. Circadian
control of the NAD+ salvage pathway by CLOCK-SIRT1. Science.
2009;324:654–657. doi: 10.1126/science.1170803.
8. Van Gool F, Gallí M, Gueydan C, Kruys V, Prevot PP, Bedalov A,
et al. Intracellular NAD levels regulate tumor necrosis factor protein
synthesis in a sirtuin-dependent manner. Nat Med. 2009;15:206–210.
doi: 10.1038/nm.1906.
9.Yang H, Yang T, Baur JA, Perez E, Matsui T, Carmona JJ, et al.
Nutrient-sensitive mitochondrial NAD+ levels dictate cell survival. Cell.
2007;130:1095–1107. doi: 10.1016/j.cell.2007.07.035.
10. Wang S, Xing Z, Vosler PS, Yin H, Li W, Zhang F, et al. Cellular
NAD replenishment confers marked neuroprotection against ischemic
cell death: role of enhanced DNA repair. Stroke. 2008;39:2587–2595.
doi: 10.1161/STROKEAHA.107.509158.
11.Wang P, Xu TY, Guan YF, Tian WW, Viollet B, Rui YC, et al.
Nicotinamide phosphoribosyltransferase protects against ischemic
stroke through SIRT1-dependent adenosine monophosphate-activated kinase pathway. Ann Neurol. 2011;69:360–374. doi: 10.1002/
ana.22236.
12. Zhang W, Xie Y, Wang T, Bi J, Li H, Zhang LQ, et al. Neuronal protective
role of PBEF in a mouse model of cerebral ischemia. J Cereb Blood Flow
Metab. 2010;30:1962–1971. doi: 10.1038/jcbfm.2010.71.
13. Zhao Y, Liu XZ, Tian WW, Guan YF, Wang P, Miao CY. Extracellular
visfatin has nicotinamide phosphoribosyltransferase enzymatic activity and is neuroprotective against ischemic injury. CNS Neurosci Ther.
2014;20:539–547. doi: 10.1111/cns.12273.
14. Wang P, Guan YF, Du H, Zhai QW, Su DF, Miao CY. Induction of
autophagy contributes to the neuroprotection of nicotinamide phosphoribosyltransferase in cerebral ischemia. Autophagy. 2012;8:77–87.
doi: 10.4161/auto.8.1.18274.
15. Stein LR, Wozniak DF, Dearborn JT, Kubota S, Apte RS, Izumi Y, et
al. Expression of Nampt in hippocampal and cortical excitatory neurons is critical for cognitive function. J Neurosci. 2014;34:5800–5815.
doi: 10.1523/JNEUROSCI.4730-13.2014.
16. Ying W. NAD+/NADH and NADP+/NADPH in cellular functions and
cell death: regulation and biological consequences. Antioxid Redox
Signal. 2008;10:179–206. doi: 10.1089/ars.2007.1672.
17. Wang T, Zhang X, Bheda P, Revollo JR, Imai S, Wolberger C. Structure
of Nampt/PBEF/visfatin, a mammalian NAD+ biosynthetic enzyme. Nat
Struct Mol Biol. 2006;13:661–662. doi: 10.1038/nsmb1114.
18. Wang P, Du H, Zhou CC, Song J, Liu X, Cao X, et al. Intracellular
NAMPT-NAD+-SIRT1 cascade improves post-ischaemic vascular repair
by modulating Notch signalling in endothelial progenitors. Cardiovasc
Res. 2014;104:477–488. doi: 10.1093/cvr/cvu220.
19. Wang P, Xu TY, Wei K, Guan YF, Wang X, Xu H, et al. ARRB1/β-arrestin-1
mediates neuroprotection through coordination of BECN1-dependent
autophagy in cerebral ischemia. Autophagy. 2014;10:1535–1548.
doi: 10.4161/auto.29203.
20. Wang P, Zhang RY, Song J, Guan YF, Xu TY, Du H, et al. Loss of AMPactivated protein kinase-α2 impairs the insulin-sensitizing effect of
calorie restriction in skeletal muscle. Diabetes. 2012;61:1051–1061.
doi: 10.2337/db11-1180.
21. Ji S, Kronenberg G, Balkaya M, Färber K, Gertz K, Kettenmann H,
et al. Acute neuroprotection by pioglitazone after mild brain ischemia
without effect on long-term outcome. Exp Neurol. 2009;216:321–328.
doi: 10.1016/j.expneurol.2008.12.007.
22. Renault VM, Rafalski VA, Morgan AA, Salih DA, Brett JO, Webb AE,
et al. FoxO3 regulates neural stem cell homeostasis. Cell Stem Cell.
2009;5:527–539. doi: 10.1016/j.stem.2009.09.014.
23.Arnold J, Zimmerman B, Li M, Lairmore MD, Green PL. Human
T-cell leukemia virus type-1 antisense-encoded gene, Hbz, promotes
T-lymphocyte proliferation. Blood. 2008;112:3788–3797. doi: 10.1182/
blood-2008-04-154286.
24. Heldring N, Joseph B, Hermanson O, Kioussi C. Pitx2 expression promotes p21 expression and cell cycle exit in neural stem cells. CNS Neurol
Disord Drug Targets. 2012;11:884–892.
25. Tiberi L, van den Ameele J, Dimidschstein J, Piccirilli J, Gall D, Herpoel
A, et al. BCL6 controls neurogenesis through Sirt1-dependent epigenetic
repression of selective Notch targets. Nat Neurosci. 2012;15:1627–1635.
doi: 10.1038/nn.3264.
26. Adya R, Tan BK, Punn A, Chen J, Randeva HS. Visfatin induces human
endothelial VEGF and MMP-2/9 production via MAPK and PI3K/Akt
signalling pathways: novel insights into visfatin-induced angiogenesis.
Cardiovasc Res. 2008;78:356–365. doi: 10.1093/cvr/cvm111.
Zhao et al Nampt Promotes Postischemic Cerebral Neurogenesis 9
27.Wang P, Guan YF, Li WL, Lu GC, Liu JM, Miao CY.
Nicotinamide phosphoribosyltransferase facilitates post-stroke angiogenesis. CNS Neurosci Ther. 2015;21:475–477. doi: 10.1111/cns.12388.
28. Wang HF, Li Q, Feng RL, Wen TQ. Transcription levels of sirtuin family
in neural stem cells and brain tissues of adult mice. Cell Mol Biol (Noisyle-grand). 2012;58:OL1737–OL1743.
29. Chang HC, Guarente L. SIRT1 mediates central circadian control in
the SCN by a mechanism that decays with aging. Cell. 2013;153:1448–
1460. doi: 10.1016/j.cell.2013.05.027.
30. Stein LR, Imai S. Specific ablation of Nampt in adult neural stem
cells recapitulates their functional defects during aging. EMBO J.
2014;33:1321–1340. doi: 10.1002/embj.201386917.
31. Sun H, Wu Y, Fu D, Liu Y, Huang C. SIRT6 regulates osteogenic differentiation of rat bone marrow mesenchymal stem cells partially via
suppressing the nuclear factor-κB signaling pathway. Stem Cells.
2014;32:1943–1955. doi: 10.1002/stem.1671.
32. Pieper AA, Xie S, Capota E, Estill SJ, Zhong J, Long JM, et al. Discovery
of a proneurogenic, neuroprotective chemical. Cell. 2010;142:39–51.
doi: 10.1016/j.cell.2010.06.018.
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Regenerative Neurogenesis After Ischemic Stroke Promoted by Nicotinamide
Phosphoribosyltransferase−Nicotinamide Adenine Dinucleotide Cascade
Yan Zhao, Yun-Feng Guan, Xiao-Ming Zhou, Guo-Qiang Li, Zhi-Yong Li, Can-Can Zhou, Pei
Wang and Chao-Yu Miao
Downloaded from http://stroke.ahajournals.org/ by guest on July 31, 2017
Stroke. published online June 9, 2015;
Stroke is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2015 American Heart Association, Inc. All rights reserved.
Print ISSN: 0039-2499. Online ISSN: 1524-4628
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://stroke.ahajournals.org/content/early/2015/06/09/STROKEAHA.115.009216
Data Supplement (unedited) at:
http://stroke.ahajournals.org/content/suppl/2015/06/22/STROKEAHA.115.009216.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Stroke can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office.
Once the online version of the published article for which permission is being requested is located, click
Request Permissions in the middle column of the Web page under Services. Further information about this
process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Stroke is online at:
http://stroke.ahajournals.org//subscriptions/
SUPPLEMENTAL MATERIAL
Regenerative neurogenesis after ischemic stroke promoted by Nampt-NAD cascade
Zhao Y, et al.
Supplementary Table I. Sequences of siRNA.
TGAAGTGCCTCAGATATTA
GCCATGTTTGATATTGAGTAT
siRNA-SIRT2
GACTCCAAGAAGGCCTACA
GCCCAATGTCACTCACTACTT
siRNA-SIRT3 pool
GCGTTGTGAAACCCGACAT
TGGAGAGTTGCTGCCTTTAAT
siRNA-SIRT4 pool
TTGACTTTCAGGCCGACAAAG
siRNA-SIRT5
GCCGATTCATTTCCCAGTTGT
siRNA-SIRT6
GGTGCAGTGCATGTTTCGTAT
CCTCCCTCTTTCTACTCCTTA
siRNA-SIRT7 pool
TGCATCCCTAACAGAGAGTAT
siRNA-SIRT1 pool
Supplementary Figure I
Characterization of Nampt-transgenic mice (Tg mice) and H247A mutant Nampt-transgenic
mice (Tg mice). (a) The schematic illustration of Nampt protein. The histidine [H] at the site 247
was mutated to alanine [A]. (b) NAD biosynthesis activities of recombinant Nampt and Nampt
protein. (c) DNA assay for transgene of exogenous Nampt. (d) Confirmation of exogenous Nampt and
H247A mutant Nampt (Nampt) overexpression in mice by immunoblot targeting His-tag (vector)
and full-length Nampt. The antibody specific for full-length Nampt can not recognize the Nampt
protein.
1
Supplementary Figure II
Double immunofluorescent staining of Nampt (green) and His-tag (red) in dentate gyrus and lateral
ventricle of WT, Tg and Tg mice. DAPI was used to stain nuclei.
Supplementary Figure III
*
NAD concentration
(mmol/g tissue)
40
*
30
20
10
0
WT
Tg
Tg
NAD concentrations in brain tissues from WT, Tg and Tg mice. *P < 0.05 vs WT, n = 6 per group.
2
Supplementary Figure IV
(A) Scheme showing Nampt-NAD cascade. Nicotinamide is converted to nicotinamide
mononucleotide (NMN) by Nampt and then to NAD by nicotinamide mononucleotide
adenylyltransferase (Nmnat). (B) NAD/NADH ratio in brain tissue 2 hours after intraperitoneal
injection of NMN.
Supplementary Figure V
Percent survival curve (left panel) and body weight curve (right panel) in mice treated with saline
(control) or early NMN treatment (500 mg/kg/day, i.p., first dose at 30 minutes post MCAO) for 7
days post MCAO. n=26 and 17 in control and early NMN treatment groups, respectively.
3
Supplementary Figure VI
NSCs cultured in 6-wells were treated with different concentrations of NMN for 7 days. Then,
NSCs were digested and suspended for flow cytometry. (a) Representative flow cytometry images
for cell number determination of NSCs in single well which was added into with different
concentrations of NMN. (b) Quantitative analysis of cell number of NSCs. *P<0.05 vs without
NMN. n = 8.
Supplementary Figure VII
BrdU
Nestin
Merge
Double immunochemistry of BrdU (green) and nestin (red) in primary NSCs-formed neurospheres.
4
Supplementary Figure VIII
Under pro-differentiative condition, NSCs exhibited phenotypes of neurons (Tuj1), astrocytes
(GFAP), and oligodendrocytes (2',3'-cyclic-nucleotide 3'-phosphodiesterase, CNP).
Supplementary Figure IX
a
Transfection
Proliferation
Differentiation
Plasmid
NSC
b
attB1
GFP
c
5’ miR flanking
region
3’ miR flanking
region
siRNA
attB2
mRNA level (fold)
1.5
1.0
0.5
0.0
siRNA-SIRT1
siRNA-SIRT2
siRNA-SIRT3
siRNA-SIRT4
siRNA-SIRT5
siRNA-SIRT6
siRNA-SIRT7
*
-
+
-
*
*
*
+
-
+
-
+
-
* * *
+
-
+
-
+
Knockdown of SIRT1-7 with specific siRNA by nucleofection in NSCs. (a) NSCs in neurosphere
cultures were nucleotransfected with plasmids encoding GFP-tagged siRNA targeting SIRT1-SIRT7.
(b) Diagrammatic sketch of the plasmid structure. (c) Evaluation of the efficiency of
siRNA-mediated knockdown using real-time PCR. *P < 0.05 vs. control. n = 8.
5