BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 1
Lab 2: Initial set up Thurs. February 28, Completion Thurs. March 7, 2013
PCR Amplification and RFLP (Restriction Fragment Length Polymorphism) analysis of
the Alcohol dehydrogenase locus: a molecular test for clinal variation and epistasis in natural
populations of Drosophila melanogaster.
Genetic variation at the nucleotide level is the "ultimate" resolution in population genetics
and evolution since there is no finer or "lower" level that is relevant to the raw material for
evolution: heritable genetic variation. While the protein electrophoresis that we performed in
Lab 1 is still widely used and highly informative, there can be a considerable amount of "hidden"
genetic variation that is not uncovered by allozyme electrophoresis. For example, "silent"
nucleotide variation (e.g., many third positions in the genetic code) does not always alter the
encoded amino acid and hence cannot be assayed by allozyme analysis. Moreover, many
amino acid changes may not alter the charge or mobility of the protein sufficiently that an
allozyme gel can actually detect a difference (e.g. Valine, Leucine and Isoleucine differ by a CH
or a CH2 group in branched, hydrophobic side chains terminating with methyl groups CH3).
Hence, allozyme variants, which are usually called "alleles", are more accurately referred to as
"electromorphs" since there may be more than one genetic allele (DNA sequence) to one
electrophoretic mobility variant.
The most complete means of determining genetic variation is to sequence the region of
DNA directly. However, sometimes it is more informative to examine only a few specific
nucleotide sites in many different individuals than to examine all nucleotide sites in a few
individuals. The combined use of the Polymerase Chain Reaction (PCR) and Restriction
Enzyme digestion allows one to examine specific DNA sites in many individuals relatively
rapidly. This lab will demonstrate these methods using the fly strains we studied in Lab 1.
The Adh locus in Drosophila melanogaster is a classic example of a locus under
selection and has been the focus of extensive study in population genetics. Several widely
used neutrality tests were motivated by the combined patterns of allozyme, RFLP and DNA
sequence variation at this locus. In this lab we will examine two important polymorphisms, the
Fast/Slow amino acid polymorphism in exon 4, and the delta-1 insertion deletion polymorphism
in the 5’ non-coding region of the locus (See Figure below). Both of these sites show clinal
variation in frequency from Maine to Florida, and in Australia (Berry and Kreitman, 1993).
Importantly, population genetic analyses have shown that the two polymorphisms are in linkage
disequilibrium in nature. For an example of this linkage, see Table 2 in Kreitman and Hudson
(1991), and compare the positions in Intron 1 (TC∆G∆) and Exon 4 (GTCT – the A->C change is
the Thr/Lys amino acid change). Note that these positions are distantly spaced across the
locus, but represent a common haplotype that spans the entire locus. The delta-1 insertiondeletion we will study is further to the left in the 5’ region, but still shows linkage disequilibrium.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 2
The Fast allele has Threonine, which has no net charge and the Slow allele has Lysine,
which is positively charged. The Slow allele will thus run relatively slowly toward to the positive
(red) electrode compared to the neutral and thus more negatively charged Fast allele. In some
gel running buffers the Slow allele runs ‘backwards’ towards the black (-) electrode, but it is still
further from the red (+) electrode than the Fast allele.
This linkage disequilibrium between F/S and delta-1 poses an important question: does
selection act directly on the Fast/Slow site?, or does selection act on the functional properties of
the entire “haplotype” of Fast/Slow plus Insertion/Deletion variation? We will re-examine this
question by documenting the frequency of the two polymorphisms in the sample of fly strains
from Maine and Florida.
PCR allows for the rapid amplification of millions of copies of a DNA segment that lies
between two regions of known DNA sequence (see figure). This is achieved by adding two
short, single-stranded pieces of DNA (oligonucleotide primers) to a tube containing the DNA
sample of interest. One of these primers is complementary to the sequence at one end of one
strand of the DNA region of interest; the other primer is complementary to the sequence of DNA
at the other end of the other strand. By adding nucleotides, a thermal-stable DNA polymerase
(Taq polymerase isolated from the bacterium Thermus aquaticus which functions happily at very
high temperatures) and the appropriate reaction buffer, the polymerase chain reaction is
conducted by exposing the sample of DNA and primers to multiple cycles of different
temperatures. A typical cycle involves: a Denature step at 95˚C for 30 seconds, an Annealing
step at 50-60˚C for 30 seconds, followed by a polymerization (or Extension) step at 72˚C for 12 minutes. These three steps are repeated for 30 cycles, with each cycle resulting in a doubling
of the number of copies of DNA. After 30 cycles, the reaction will have produced 230 ≈ 109
copies of the double-stranded DNA fragment lying between the two primers. Any DNA
sequence differences between individuals that lie within this region can be determined by DNA
sequencing or restriction enzyme digestion and gel electrophoresis. We will identify two
polymorphisms using diagnostic restriction enzymes to determine the genotype of each fly,
and determine these genotypes using agarose gel electrophoresis.
Restriction enzymes are proteins encoded by bacteria that are analogous to a bacterial
"immune" system: they chop up foreign DNA into fragments, rendering it less "virulent" (in a
sense, restricting the abilities of the foreign DNA to transform the host cell). These proteins can
be extracted from a diverse array of bacterial species and purified for commercial production. In
this lab, the two polymorphisms are identified as follows:
∆1 Insertion-Deletion (InDel) polymorphism primers:
TCAAGCTGTCACAAGTAGTGCG
Adh 230F
TCTACCGTTACGCGATCTCGG
Adh ~630R
Restriction enzyme PsiI cuts one version of the indel at ~230bp into PCR fragment, but not the
other version. PsiI cuts at TTA/TAA
Adh Fast-Slow polymorphism primers:
AAACCAACAACTAACGGAGCC
Adh 705F
GCATCGAATCAGCCTTATTGCC Adh 1780R
Restriction enzyme HpyCH4IV cuts at ~100bp into the PCR fragment for both F and S, at
~690bp for the F allele. The 690 restriction site is the F/S polymorphism.
HpyCH4IV cuts at A/CGT
Agarose gel electrophoresis of DNA involves the separation of DNA fragments based
on the length. DNA is negatively charged, so it will run toward the red electrode (the +, or
cathode). Small fragments can weasel their way through the matrix of the agarose faster than
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 3
can long DNA fragments. We will add a “marker” DNA sample with fragments of DNA with
known sizes so we can estimate the size of our digested DNA fragments.
With this technical background we can now ask a simple population genetic question
about our populations of fruitflies. The Adh gels from last week identified an amino acid charge
variant. One enzyme cuts DNA at precisely the same nucleotide that causes the F/S amino
acid variation, and should correspond with allozyme genotype exactly. The InDel polymorphism
cuts at a different location, but we want to see if we can detect a statistical linkage association
between these markers.
The purpose of the lab is 1) to give you experience performing PCR amplifications and
restriction digestions; and 2) to provide a test of linkage disequilibrium between polymorphisms.
Since you will determine the two DNA polymorphisms for each allozyme genotype, the
combined-genotype data can provide more information than if the two types of analyses were
done on separate samples.
The process involves:
1) preparing DNA template in a specific buffer
2) the addition of PCR reagents to a sample of the DNA template
3) amplification of the target DNA fragments in a Thermal Cycler (this takes a couple of hours
and will be done between labs 2 and 3)
4) digestion of the amplified DNA with a specific enzyme that cuts the DNA at informative
positions in the DNA that are variable among individuals in the population (Lab 3)
5) electrophoresis of the digested DNA on an agarose gel to separate the fragments according
to size (Lab 3)
6) Staining the gel to visualize the DNA fragments so that i) the sizes of the fragments can be
determined and ii) the frequency of the two mtDNA variants can be determined (Lab 3).
Data analysis The frequencies of the haplotypes will be determined for each of the Maine and
Florida populations. As with the allozyme lab, we will tabulate the entire class data, and the
combined write up of the allozymes and RFLP will be added to a problem set.
Here's what to do:
Preparing DNA template from fly homogenate
1. Identify the population of flies you will be running and write down the names below: North
America A or B, or Australia A or B flies, and the # of each fly (e.g., NAA1, NAB8,
AUA3, AUB5, means the following: NA and AU refer to continent, A or B refers to
replicate population within that continent, the # refers to individual fly you squish
in each tube). You must keep track of which population you have, and which fly goes in
which tube.
Lane: Population ID
1:
2:
3:
4:
5:
6:
7:
8:
2. Using an indelible marker, label 8 tubes with the strain number for each strain you will study.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 4
3. Using a P200 pipettor, add 40µl of "Active Squishing Buffer" to each of your 8 tubes
containing fly homogenate. Active Squishing Buffer has Proteinase K, which degrades
proteins, an important step for PCR amplification of DNA.
4. Add a single fly to each tube, and make sure you put the correct strain in each tube.
5. Using a blue pestle, gently homogenize each fly with several circular strokes. Make sure
there are no chunks of flies left and the homogenate is a light pink color.
6. Close the cap tightly and incubate your homogenates in the 37 C incubator for 30 minutes
(incubator is in the central MDL hallway or the room beyond). Go to step 9 while you wait.
7. After the 30 minute incubation at 37˚C, place each tube in the heating block at 95˚C for 5
minutes. This will deactivate the Proteinase K so that it will not destroy the DNA
polymerase enzyme when you add it to do the PCR amplification of DNA.
8. Place your tubes on your lab bench to cool.
PCR Set-up
9. Label TWO clean strips of PCR microfuge tubes with the name of each of your fly
homogenate. One strip is for the InDel PCR and one for the Fast/Slow PCR.
Write down a CODE so that Tube 1 = fly X Tube 2 = Fly Y, etc
1
2 Name + InDel (or F/S)
7
8
Label TWO separate strips
here (F/S and Indel)
Code to identify fly genotype in PCR tube ____ ____ ____ ____ ____ ____ ____ ____
10. You will be provided with a PCR "Cocktail" containing the common reagents for each PCR
reaction. Each student will amplify 8 samples, but we will make a cocktail for 10, so we have
enough for a negative control and a little extra for pipetting error. Negative controls will have
NO DNA, and should not amplify. This is a control for contamination.
Amount for 1 reaction
sterile H20
10X PCR Buffer
dNTPs Mix
Primer Forward
Primer Reverse
Taq Polymerase
17.2 µl
2.5 µl
2.0 µl
0.6 µl
0.6 µl
0.15 µl
Amount for cocktail for
F/S
or Indel
Check when added Check when added
172 µl
172 µl
25.0 µl
25.0 µl
20.0 µl
20.0 µl
6.0 µl
6.0 µl
6.0 µl
6.0 µl
1.5 µl
1.5 µl
11. Add 21 µl of PCR Cocktail to each of your newly labeled PCR tubes, on ice.
12. Using a clean pipette tip for each sample, add 2.0 µl of fly homogenate (DNA template) to
each tube containing the PCR cocktail.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 5
13. Add any remaining PCR cocktail to the blank control strip assigned to your lab bench.
This will have no DNA and will serve as a negative control.
14. Apply a strip of caps to your PCR tubes and gently close them by pushing straight down
while the tube-strip is in a plastic holding rack. Leave sample on ice until they can be added to
the Thermal Cycler.
WE WILL RETURN HERE NEXT WEEK, to digest the DNA and run the gel.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 6
Part 2
Amplification of your own DNA: Just How mutant are you?
The mitochondrial DNA (mtDNA) “D-loop” is a non coding
regulatory region of the mitochondrial genome (is has a
displacement strand waiting to replicate that causes a loop in
the DNA, hence the ‘D’). It has a high mutation rate and thus
shows lots of genetic variation among organisms. Two regions
of the D-loop, HV1 and HV2, for ‘hyper variable’ (see figure:
http://www.nfstc.org/pdi/Subject09/pdi_s09_m02_01_a.htm)
have been used extensively in human population genetics to
trace our African origins and discover population variation and
divergence following dispersal out of Africa. We will sequence
our own D-loop regions and can ask two questions with the
data: 1) Are there any mutations between different tissues in
our body?, and 2) Where do I fall on the human mtDNA tree of
evolution?
We will prepare DNA from our cheek cells and from plucked hair (scalp cells). These cells
come from different tissue layers and have been separated from one another since about 8
weeks after you were conceived at fertilization. Moreover, these cells are continue to divide, so
many cell generations separate these two cell types. Using mtDNA primers for the D-loop, we
will amplify each locus from each of our two cell types and determine if you have the same
genotype in these two samples. You are often told that all the cells in your body are genetically
identical since we all develop from a single egg. However, somatic mutation rates are not zero,
so there is some possibility that there are genetic differences between these two cells.
Moreover, mtDNA exists as a population of molecules within a cell. The dogma is that all ~1000
or so copies of mtDNA within each cell are identical. However, “heteroplasmy” – the presence
of more than one mtDNA type within a cell – must exist at some point if two individuals have
different mtDNA genotypes. Hence, there is an “intracellular population genetics” with respect
to mtDNA (see Rand, DM. 2001. The units of selection on mitochondrial DNA. Annual Review of
Ecology and Systematics).
If we fail to show that anyone exhibits somatic variation, we will at very least show that we are a
genetically variable species (the mtDNA data will show different genotypes).
The process is really no more complex than making DNA and setting up a PCR reaction:
First you do a Squish Prep on yourself:
1) Label two clean blue homogenization tubes with your initials and a letter for hair or cheek
(e.g. Charles Robert Darwin: CRD-H, CRD-C).
2) Add 30 µl of active squish buffer to each tube.
3) Pluck three hairs from your head, and examine them to be certain that there is a good chunk
of your scalp attached to each root. Using fine scissors, sterilized with alcohol, cut about
0.5 cm of the root of each hair so that they drop into your "hair" homogenization tube.
4) Homogenize the hair root using the sterile blue pestle that fits in the blue microfuge tube.
Dab off excess buffer in the pestle inside the tube.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 7
5) using a sterile wooden stick, firmly scrape the inside of your cheek so you scratch off a nice
wad of cheek tissue. Don't scrape too hard or you will hurt yourself. Examine the stick
so that you can see the mass of cells, and then dip the pipette tip into the "cheek"
homogenization tube. Swirl the pipette tip around a bit, and then attach it to a P200
pipettor and pipette up and down a bit.
6) Put your tubes at 37˚C for 30 mins.
7) Put your tubes at 95˚C for 5 minutes to denature the Proteinase K. Then place on ice.
To ensure consistent results Prof Rand and Chester Q. TeeAy TA will set up the PCR
reactions.
It will be done like this
Primer 1 - 5'CACCATTAGCACCCAAAGCT3'
Primer 2 - 5'CTGTTAAAAGTGCATACCGCC3'
[8) Obtain a tube of PCR "Cocktail" containing the common reagents for the PCR reaction. You
and your lab partner will get one tube with enough cocktail for eight amplifications (2
people, each with a hair and a cheek sample, for both mtDNA regions, HV1 and HV2).
Amount for one 25µl reaction
Cocktail of
samples (entire class)
sterile H20
15.3 µl
µl
10X PCR Buffer
2.5 µl
µl
MgCl2
2.5 µl
µl
Nucleotide Mix
2.0 µl
µl
Forward Primer
0.3 µl
µl
Reverse Primer
0.3 µl
µl
Taq Polymerase
0.1 µl
µl
9) Add 23.0 µl of PCR Cocktail to each of your newly labeled PCR tubes, on ice.
10) Using a clean pipette tip for each sample, add 2.0 µl of your hair or cheek homogenate
(DNA template) to each tube containing the PCR cocktail. Be sure to keep the mtDNA
and VNTR amplification separate.
11) Close the cap of the microfuge tube tightly; leave sample on ice until they can be added to
the Thermal Cycler.]
We will amplify your DNAs, and send the out for DNA sequencing, and provide the data
file for analysis in a couple of weeks.
End of Lab 2
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 8
Lab Set up - Each student needs:
Ice bucket full of ice for each student
Indelible marker for labeling tubes
1.5 mL eppendorf tubes, matching Pestles
Strips of 8 PCR tubes, and PCR caps – thin-walled for standard PCR
Set of Pipettors, tips (check pipettors for proper calibration – many are inaccurate)
Forceps
Scissors
Alcohol for sterilizing scissors
Sterile wood strips (small stirrers, tongue depressors, Starbucks coffee stirrers, autoclaved)
1.5 ml tube rack
PCR strip rack that holds the strips
95˚C heat block with water in each well to deactivate proteinase K in squish prep (heat block
can be one per bench, or pair of students).
Note: no power supplies or gel rigs are needed for Lab 2- only in Lab 3.
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Page 9
Equipment and Supplies for Lab 2
37˚C oven for DNA squish preps
Indelible Markers
P1000, P200 and P20 pipettors
Thermal Cycler
Forceps, Scissors
Tube racks
Expendable Supplies
0.5uL PCR strip tubes and caps for amplifications
Kontes Microfuge tubes and pestles (Vineland New Jersey 08360, Item #749520-0000)
Order in bags, no need to have individually wrapped
Pipette tips, in racks, for P1000, P200 and P20 pipettors
Drosophila Adh Primers
∆1 Insertion-Deletion (InDel) polymorphism primers:
Adh 230F
5’ TCAAGCTGTCACAAGTAGTGCG 3'
Adh ~630R 5’ TCTACCGTTACGCGATCTCGG 3’
Adh Fast-Slow polymorphism primers:
Adh 705F
5’ AAACCAACAACTAACGGAGCC 3’
Adh 1780R
5’ GCATCGAATCAGCCTTATTGCC 3’
D-loop primers:
L15996
5' CTCCACCATTAGCACCCAAAGC 3'
H16401
5' TGATTTCACGGAGGATGGTG 3'
L29
H408
5' GGTCTATCACCCTATTAACCAC 3'
5' CTGTTAAAAGTGCATACCGCCA 3'
Restriction enzymes (Needed in Lab 3, not Lab 2)
PsiI cuts one version of indel at ~230bp into PCR fragment, but not the other version
PsiI cuts at TTA/TAA
HpyCH4IV cuts at ~100bp of PCR fragment for both F and S, and at ~690bp for the F allele.
The 690 restriction site is the F/S polymorphism
HpyCH4IV cuts at A/CGT
Restriction Enzyme and Buffer
PsiI enzyme: Enough for 20 digests per student (about 120 µl of 10 U/µl enzyme)
Appropriate buffer from supplier
HpyCH4IV enzyme: Enough for 20 digests per student (check Units/mL vs. uL !)
PCR reagents for both Adh and D-loop PCRs
Active Squish buffer (1 tube of 1000 µl per pair of lab partners)
Taq polymerase (Invitrogen # 10966-018 from stockroom is enough for 100 reactions –
much cheaper options exist – check out Denville Scientific Taq)
10X PCR buffer ( included in Invitrogen Taq)
MgCl2 ( included in Invitrogen Taq)
10 mM Nucleotides (dATP, dCTP, dGTP and dTTP combined ; 2.5 mM each)
Make mix of all four so that each nucleotide is 2.5 mM)
BioMed 141
Evolutionary Genetics
Laboratory #2
Spring 2013
Ultrapure, sterile H20 (good milliQ water is OK, no need to purchase)
Page 10