This information is current as of July 31, 2017. Efficient Internalization of IL-2 Depends on the Distal Portion of the Cytoplasmic Tail of the IL-2R Common γ-Chain and a Lymphoid Cell Environment Aixin Yu, Ferenc Olosz, Chris Y. Choi and Thomas R. Malek J Immunol 2000; 165:2556-2562; ; doi: 10.4049/jimmunol.165.5.2556 http://www.jimmunol.org/content/165/5/2556 Subscription Permissions Email Alerts This article cites 31 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/165/5/2556.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 References Efficient Internalization of IL-2 Depends on the Distal Portion of the Cytoplasmic Tail of the IL-2R Common ␥-Chain and a Lymphoid Cell Environment1 Aixin Yu, Ferenc Olosz, Chris Y. Choi, and Thomas R. Malek2 T he IL-2R is a critical molecule on lymphoid lineage cells, particularly activated T lymphocytes and NK cells, as it regulates their growth, apoptosis, and differentiation into effector lymphocytes. The mouse IL-2R consists of three subunits, the unique ␣-chain (p55); the -chain (p90), which is also a subunit of the IL-15R; and the common ␥-chain (␥c;3 p75), which is also a subunit of the IL-4R, IL-7R, IL-9R, and IL-15R (reviewed in Ref. 1). These three subunits are expressed on the cell surface largely independently of each other in the absence of IL-2. The ␣-chain binds IL-2 at a relatively low affinity (Kd of 10⫺8 M) with fast on/off-rates (⬃30 s). The ␣- and -chains cooperate to increase IL-2-binding affinity by 100-fold, but this partial receptor still exhibits fast on/off-rates. The functional high affinity (Kd of 10⫺11 M) IL-2R, consisting of ␣, , and ␥c subunits, exhibits fast IL-2 on-rates characteristic of the ␣-chain, but slow off-rates, which, in practical terms, represent essentially irreversible IL-2 binding. The sole role of the ␣-chain is in ligand binding, whereas the -chain and ␥c contribute to ligand binding and signal transduction. Signal transduction ensues by IL-2-induced trimerization of the ␣, , and ␥c subunits, which brings the cytoplasmic tails of the  and ␥c subunits in close proximity for an extended period of time, Department of Microbiology and Immunology, University of Miami School of Medicine, Miami, FL 33136 Received for publication November 18, 1999. Accepted for publication June 15, 2000. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by National Institutes of Health Grant AI40114. 2 Address correspondence and reprint requests to Dr. Thomas Malek, Department of Microbiology and Immunology, University of Miami School of Medicine, 1600 N.W. 10th Avenue, Miami, FL 33136. E-mail address: [email protected] 3 Abbreviations used in this paper: ␥c, common ␥-chain; I, intracellular; I-labeled IL-2; S, surface; WT, wild type. 125 Copyright © 2000 by The American Association of Immunologists 125 I-IL-2, allowing receptor phosphorylation by associated tyrosine kinases (2, 3). The Janus kinase Jak3, the only known tyrosine kinase associated with ␥c, importantly contributes to the initial phosphorylation of the -chain (4). This initiates the recruitment of a number of signal-transducing molecules to the cytoplasmic tail of the -chain, including Jak1, STAT5, and STAT3, the Shc-adaptor protein, Syk, and p56lck (reviewed in Ref. 5). Thus, at a minimum, IL-2 signaling results in the activation of the Jak/STAT, phosphatidylinositol 3-kinase, and the ras/raf/mitogen-activated protein kinase pathways. Besides signal transduction, another early consequence of the IL-2/IL-2R interaction is receptor-mediated endocytosis of the receptor-ligand complex. This process is often utilized to remove the receptor-ligand complex from the cell surface. For the IL-2/IL-2R complex, receptor-mediated endocytosis functions to limit IL-2 signal transduction, and hence, the biological response to this cytokine. In T lymphocytes, IL-2 is rapidly internalized (t1/2 of 10 –20 min), ultimately leading to lysosomal degradation of IL-2 (6 – 8). After internalization, the - and ␥c-chains are sorted to late endosomal compartment, presumably for degradation (9). The ␣-chain, on the other hand, was detected only in early endosomes, colocalizing with the transferrin receptor, suggesting that this subunit may recycle back to the plasma membrane (9). The route of entry of IL-2/IL-2R complex into the cell has not been established, but may be independent of clathrin-coated pit endocytosis (10, 11). For most hormone receptors, ligand-induced receptor-mediated endocytosis is dependent upon the cytoplasmic tail of the receptor, often through a tyrosine-based or di-leucine-based motif (12). The structural basis for IL-2/IL-2R internalization has not been extensively investigated. Transfection of wild-type (WT) (3) and mutant IL-2R subunits points to an important role for the ␥c subunit for internalization of IL-2 (13). In fact, rapid IL-2 internalization has been noted for T cells expressing cytoplasmic tailless IL-2R␣ or IL-2R (14, 15), suggesting no essential role for these subunits in 0022-1767/00/$02.00 Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 The common ␥-chain (␥c), a subunit of the IL-2R, is essential for high affinity ligand binding and signal transduction due to Jak3 association to ␥c. Another consequence of IL-2/IL-2R interaction is rapid receptor-mediated endocytosis of the receptor-ligand complex. In the present study, we establish that this rapid endocytosis of IL-2 in a T cell tumor line is dependent upon the cytoplasmic tail of ␥c. Deletion mutants of the cytoplasmic tail mapped this activity to 9 aa of ␥c, 45–54 aa distal to the transmembrane region. In contrast, ligand-independent constitutive endocytosis of ␥c occurred more slowly and was dependent upon a PEST sequence in a more membrane-proximal region of the cytoplasmic tail of ␥c. Thus, this receptor subunit may use distinct sorting signals for its constitutive regulation and ligand-induced endocytosis. Rapid endocytosis of IL-2 was inhibited by the tyrosine kinase inhibitor genistein, implicating a role for a signal transduction pathway in IL-2 internalization. However, one T cell line bearing a mutant ␥c exhibited impaired endocytosis of IL-2, despite normal IL-2-induced Jak/STAT activation. Furthermore, inefficient endocytosis of IL-2 was noted after transfection of the COS7 epithelial cell line with the IL-2R, and further reconstitution of these cells with Jak/STAT proteins did not enhance this internalization. Collectively, these latter findings indicate that rapid endocytosis of IL-2 is dependent upon cellular signaling in lymphoid cell environment that is not solely a consequence of the presence of the Jak/STAT pathway. The Journal of Immunology, 2000, 165: 2556 –2562. The Journal of Immunology this process other than ligand binding. The present study, therefore, was undertaken to more precisely define the contribution of the cytoplasmic tail of the ␥c subunit in internalization of IL-2. We establish that efficient internalization of IL-2 depends on 9 aa within the cytoplasmic tail of ␥c and at least one other IL-2Rindependent lymphocyte-specific component. Materials and Methods Cell lines and culture conditions CX is a variant of the mouse EL4 thymoma that expresses mouse IL-2R␣, , and ␥c subunits, the former two after transfection with the respective cDNA (14). 1F1 is a mutant variant of CX that lacks cell surface mouse ␥c (16). These cells were cultured in RPMI 1640 medium supplemented with 5% FCS, L-glutamine (300 g/ml), penicillin (100 U/ml), streptomycin (100 g/ml), and 2-ME (5 ⫻ 10⫺5 M) (complete medium). To maintain expression of the transfected cDNAs, the cells were periodically (every 10 –14 days) passed in complete medium supplemented with mycophenolic acid (2 g/ml), xanthine (25 g/ml), hypoxanthine (15 g/ml), and G418 (1 mg/ml; Life Technologies, Grand Island, NY). Mouse IL-2R constructs Transfection 1F1 cells (8 ⫻ 106) were stably cotransfected with either pSI-␥c284, pSI␥c295, or pSI-␥c328 (38.5 g/ml) and BMG-His (18) (kindly provided by E. Podack, University of Miami) (12.5 g/ml) in 0.4 ml of RPMI 1640 by electroporation using a BRL cell porator (Life Technologies) set at 1180 F and 200 V. The electroporated cells were placed on ice for 10 min; resuspended in complete medium containing mycophenolic acid, xanthine, hypoxanthine, and G418; and cultured (4 ⫻ 104/well) in 96-well flat-bottom culture plates at 37°C in a 7% CO2 incubator. Twenty-four hours later, histidinol (0.5 mM) was added to the cultures. 1F1 was similarly transfected with the ␥cWT, ␥c337, or ␥cPEST cDNA, but using only the pSI␥cWT vector (50 g/ml) containing the CMV ZeoCassette (Invitrogen, Carlsbad, CA). Cells were selected by addition of Zeocin (150 g/ml; Invitrogen) 24 h after transfection. COS7 cells were harvested by treatment with trypsin-EDTA and washed, and 5–20 ⫻ 106 cells were transiently transfected, as described above, at 330 F and 215 V. These cells were transfected with either pSI-IL-2R␣ (15 g/ml), pSI-␥cWT (1–5 g/ml), and pME18S-mJak3 (15 g/ml) (19) (kindly provided by J. O’Shea, National Institutes of Health), as indicated, or pSI-IL-2R␣, pSI-␥cWT, pME18S-Jak3, pcDNAmSTAT5a (20) (kindly provided by W. Leonard, National Institutes of Health), and Prk5-mJak1 (21) (kindly provided by J. Ihle, St. Jude Children’s Research Hospital, Memphis, TN) at 5 g/ml for each vector, as indicated. In these latter transfections, empty pSI vector was added, as required, to maintain a constant final concentration of DNA (30 g/ml). We noted similar expression of high affinity IL-2R after both types of transfection conditions. After transfection, cells were cultured in complete medium at 1 ⫻ 106 cells/100 mm2 tissue culture plates for 3 days. Cells were then harvested for experimental assays by first washing the plates with PBS and then harvesting the adherent cells by incubation with prewarmed (37°C) PBS containing 5 mM EDTA for 5 min. Abs and other reagents mAbs to mouse IL-2R␣ (3C7) (22), IL-2R (5H4) (16), and ␥c (4G3 and 3E12) (17) were previously described. PE-conjugated anti-␥c (4G3) and FITC-conjugated goat anti-rat Ig were obtained from PharMingen (San Diego, CA). Rabbit antisera to mouse ␥c, Jak1, Jak3, and STAT5 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and to phospho-STAT5 from Upstate Biotechnology (Lake Placid, NY). HRP-conjugated donkey anti-rabbit Ig was obtained from Amersham Pharmacia Biotech (Piscataway, NJ). Emetine was obtained from Sigma (St. Louis, MO), and genistein from Calbiochem (San Diego, CA). FACS analysis FACS analysis was performed as previously described (23) using a Becton Dickinson FACScan and CellQuest software. Typically, 10,000 cells/sample were analyzed. Dead cells were excluded from analysis by forward vs side scatter gating. Depending upon the primary Ab, control stained cells were incubated with either PE-streptavidin or FITC goat anti-rat Ig. Internalization assays CX and the 1F1 transfectants (10 ⫻ 106/ml) or the transiently transfected COS7 cells (4 ⫻ 106/ml) were incubated at 4°C for 30 min with 50,000 cpm/ml human 125I-labeled IL-2 (125I-IL-2). The IL-2 was radiolabeled with Na125I using IODO-GEN-precoated tubes (Pierce, Rockford, IL), according to the manufacturer’s instruction, to a sp. act. of approximately 20 – 40 Ci/g. The cells were washed three times with cold HBSS and resuspended in complete medium at 4 ⫻ 106/ml (CX and 1F1 transfectants) or 2 ⫻ 106/ml (COS7) and shifted to 37°C. At the indicated times, 1 ml was removed from culture and cells were pelleted by centrifugation in a microfuge at 14,000 ⫻ g for 15 s in 1.5-ml tubes. Protein released in the supernatant was precipitated by addition of 1/4 vol of 50% TCA. The TCA-soluble counts represented internalized IL-2 that was degraded. The cell pellets were then resuspended in 0.5 ml of 0.01 M sodium citrate, 0.14 M NaCl, pH 2 buffer for 2 min at room temperature and then centrifuged for 15 s at 14,000 ⫻ g in a microfuge. The radioactivity that remained associated with the cells after this low pH buffer wash represented the internalized (I) IL-2, while the portion of radioactivity in the pH 2 buffer supernatant represented cell surface-associated (S) IL-2. Before shifting the cells to 37°C, usually 80 – 85% of the cpm was cell surface associated. The I:S ratio was calculated at the indicated time points. The pH 2-resistant material at t0 was considered nonspecific material and was subtracted from I. Internalization of transferrin was similarly evaluated, except that initially CX and the 1F1 transfectants (40 ⫻ 106/ml) or the transiently transfected COS7 cells (12 ⫻ 106/ml) were incubated at 4°C for 30 min with 250,000 cpm/ml of 125I-labeled transferrin (1 Ci/g; NEN, Boston, MA). Western blot analysis Cells were extracted in buffer containing 0.5% Nonidet P-40, as previously described (24). The indicated Ab was first bound to protein G-Sepharose (Amersham Pharmacia Biotech) by incubation for 30 min at 25°C, washed three times with extraction buffer, and then used for immunoprecipitations by incubation of the Ab-coated beads with the Nonidet P-40 extracts at 4°C overnight. The immunoprecipitates were washed three times with extraction buffer containing 0.5% Nonidet P-40, and the bound material was eluted with sample buffer containing 2% SDS. Samples were resolved by 10% SDS-PAGE under reducing conditions, transferred to nitrocellulose, and blocked by incubation with 5% nonfat dried milk in PBS (5% milk) for 1 h. The nitrocellulose was subsequently incubated with the indicated antisera in 5% milk for 90 min, washed three times with PBS containing 0.1% Nonidet P-40, and then incubated with HRP-conjugated donkey anti-rabbit Ig for 60 min, followed by washing twice with PBS containing 0.1% Nonidet P-40 and once with PBS. Bands were visualized by chemiluminescence using ECL Western blotting detection reagents (Amersham Pharmacia Biotech), according to the manufacturer’s instructions. Results Internalization of IL-2 is dependent upon the cytoplasmic tail of ␥c The CX cell line is a transfected mutant variant (14) of the mouse EL4 thymoma that constitutively expresses IL-2R␣, , and ␥c (Fig. 1A). CX was further mutagenized to yield another variant, designated 1F1, containing a deletion encompassing the transmembrane region of ␥c, which essentially lacks cells surface ␥c, as assessed by FACS (Fig. 1B) and biochemical analysis (16). Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 Preparation of the cytoplasmic tailless ␥c284 mutant (␥c284Arg3stop codon; in which 1 represents the initial methionine residue of the leader peptide), which contains only 1 aa of the predicted cytoplasmic tail, was previously described (17) and cloned into the pSI expression vector (Promega, Madison, WI). The cytoplasmic truncations ␥c295 (␥c295Glu3stop codon) and ␥c328 (␥328Cys3stop) were prepared by site-directed mutagenesis using the Chameleon site-directed mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer’s instructions, using the fulllength mouse ␥c cDNA in the pSI vector as the target DNA. The mutagenic oligonucleotides were 5⬘-CCCCCCATCAAGAATCTATAGGATCTGGT TACTGAATACC for ␥c295 and 5⬘-CTACAGTGAACGGTTCTGACA CGTCAGCGAGATTCCCCCC for ␥c328. The ␥c337 (␥c337Lys3stop) and the ␥cPEST (␥c317Glu3 Val; ␥c318Ser3 Gly; ␥c321Pro3 Leu; ␥c322Asp3 Ala) were prepared using the Quick Change site-directed mutagenesis kit (Stratagene), according to the manufacturer’s instructions. The forward mutagenic primers were 5⬘-GCGAGATTCCCCCTTAAG GAGGGGCCCTAGG for ␥c337 and 5⬘-CTAAAGGGCTGACTGTGGG TCTGCAGCTAGCCTACAGTGAACGG for ␥cPEST. Mutations were confirmed by DNA sequence analysis. The mouse IL-2R␣ and IL-2R cDNAs were cloned into the pSI expression vector. To prepare pSI-IL2R␣, the expression cassette from pSI-IL-2R was excised and subcloned adjacent to the expression cassette in pSI-IL-2R␣. 2557 2558 IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2 To quantify the rate by which these two cell lines differed in IL-2 internalization, the data from six experiments were used to plot the ratio of intracellular (I):surface (S) IL-2 during the first 30 min of culture at 37°C. An I:S ratio of 1 indicates that 50% of the cell-associated IL-2 is on the surface, while the remaining 50% is intracellular. Linear regression analysis of these data indicates that the initial internalization of IL-2 by both cell lines is linear (Fig. 2D). Under these conditions, the time at which the I:S is 1 represents the t1/2 for internalization and is directly related to the rate of internalization (25, 26). The t1/2 for CX is 15 min, while the t1/2 for 1F1␥284 is 36 min. Therefore, in the absence of cytoplasmic tail of ␥c, the IL-2R internalized 125I-IL-2 approximately 2-fold more slowly. This trend held in all our subsequent analysis, although sometimes the absolute level and the time to reach plateau levels of intracellular IL-2 varied. Mapping the cytoplasmic tail of ␥c for internalization signals Other studies have suggested an important role for ␥c in internalization of IL-2 (13). To test whether the cytoplasmic tail of ␥c was essential, 1F1 was transfected with ␥c cDNA that contained the entire extracellular and transmembrane regions of ␥c, but only 1 aa of the predicted cytoplasmic tail. The resulting 1F1␥c284 cell line expressed high levels of ␥c as well as IL-2R ␣- and -chains (Fig. 1C). Internalization of IL-2 by these cells was compared with the parental CX cell line by first pretreating the cells with radiolabeled IL-2 in the cold and then shifting the cells to 37°C to assess the fate of the cell-bound IL-2. It is evident that the rate at which IL-2 is internalized (Fig. 2A), is lost from the cell surface (Fig. 2B), and is metabolized (Fig. 2C) occurred more slowly for 1F1␥284 than CX. Mapping the cytoplasmic tail of ␥c for constitutive turnover FIGURE 2. Kinetics of internalization and degradation of IL-2. CX (F) or 1F1␥c284 (E) were treated with 125I-IL-2 at 4°C, and then t0 were cultured at 37°C. A, Rate of internalization of IL-2. B, Rate of loss of cell surface IL-2. C, Rate of degradation of IL-2. Data in A–C are taken from one experiment representative of six. D, Ratio of intracellular (I) to surface (S) IL-2. Linear regression of data from six experiments (mean ⫾ SD). r 2 was 0.99 for CX and 0.86 for 1F1␥c284. The dashed line represents the 95% confidence interval for the regression line. The proximal 44 aa of the cytoplasmic tail of ␥c have been implicated in ligand-independent endocytosis (27) and contain a PEST sequence that may function to regulate ␥c surface levels (28). To assess whether this region of ␥c similarly functioned in our EL4-transfected variants, the constitutive turnover of ␥c by CX and the 1F1␥c transfectants was compared. These cells were treated with emetine, a protein synthesis inhibitor, and the loss of cell surface ␥c was assessed by cell surface FACS analysis using an anti-␥c mAb (Fig. 5). This same approach has been previously used to study the turnover of human ␥c in the YT cell line, and the decrease in surface ␥c as measured by FACS was essentially identical to the decrease in total ␥c protein as measured by Western blot analysis (27). Cells that expressed a severely truncated ␥c cytoplasmic tail, i.e., 1F1␥284 (not shown) and 1F1␥c295, exhibited a relatively slow and linear decrease in their ␥c molecules with Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 FIGURE 1. IL-2R expression by transfected variants of the EL4 thymoma. The indicated cells were stained with subunit-specific mAb (right histogram) or control stained (left histogram). The cytoplasmic tails of many cell surface receptors have been shown to express specific, relatively short, amino acid sequences that function for rapid ligand-induced receptor-mediated endocytosis (12). To determine whether ␥c contained a membrane-proximal internalization motif, several additional mutant ␥c cDNAs were expressed in 1F1 that contained progressively longer cytoplasmic tails. 1F1␥c295, 1F1␥c328, and 1F1␥c337 expressed ␥c molecules containing 12, 45, and 54 aa, respectively, of an 85-aalong cytoplasmic tail (Fig. 3A). 1F1 was also transfected with the WT ␥c cDNA to ensure that the slow internalization of 1F1␥c284 was not due to a secondary defect in 1F1 cell line. Biochemical analysis confirmed that the transfected cells expressed the appropriate ␥c molecules of increasing Mr (Fig. 3B). The material detected in band 1 (B1) represented the heavily glycosylated mature cell surface ␥c, while that in band 2 (B2) represented an endo-Hsensitive intracellular ␥c intermediate (16) (data not shown). FACS analysis with anti-␥c mAb to the extracytoplasmic region revealed relatively high expression of these ␥c molecules on the surface of all four transfectants, with the highest expression on 1F1␥c295 (Fig. 3C). Internalization of IL-2 by these four cell lines was determined after a 15-min incubation at 37°C (Fig. 4). This analysis indicates that the internalization of IL-2 by 1F1␥c284 (not shown), 1F1␥c295, and 1F1␥c328 are all similarly impaired when compared with CX (not shown) and 1F1␥cWT. These data directly demonstrate that the 1F1 cell line is competent to support normal internalization of IL-2, provided that these cells express WT ␥c. These data also indicate that rapid internalization of IL-2 required the proximal 54 aa of the cytoplasmic tail of ␥c and maps to a 9-aa region between residues 328 and 337. The Journal of Immunology 2559 a t1/2 of approximately 290 min. By contrast, the ␥c molecules of CX (not shown), 1F1␥cWT, and 1F1␥c328 each exhibited a similar more rapid and biphasic decrease, with a t1/2 of approximately 150 min, which is two times faster than seen for 1F1␥284 and 1F1␥c295. The turnover (t1/2) of human WT ␥c in YT cells has been reported to be 120 min (27), similar to what we have observed for the decrease of mouse WT ␥c by this FACS analysis. Collectively, our results indicate that the constitutive turnover of ␥c is dependent upon 33 aa between positions 295 and 328 of the cytoplasmic tail. Furthermore, this finding demonstrates that the region of the cytoplasmic tail responsible for the constitutive endocytosis of ␥c is distinct from that required for IL-2-induced receptor-mediated endocytosis. The cytoplasmic tail of mouse ␥c contains a species-conserved calpain-sensitive PEST sequence (GLTESLQPDYSE) (28) that may function to regulate the level of this protein. To determine whether the PEST sequence in mouse ␥c contributed to ligandindependent endocytosis, 3 aa between residues 317 and 321 were mutated (GLTVGLQLAYSE) (Fig. 3A), as previously done for human ␥c (28). The transfected 1F1␥cPEST cells expressed ␥c, as FIGURE 4. Internalization of IL-2 by stable transfectants expressing mutant ␥c. The I:S ratio (mean ⫾ SEM) was determined for the indicated cells that were treated with 125I-IL-2 at 4°C and cultured at 37°C for 15 min. The number within each bar represents the number of independent derived transfected cell lines that were analyzed. assessed by biochemical (Fig. 3B) and FACS (Fig. 3C) analysis. The somewhat lower levels of the mature form of ␥c from 1F1␥cPEST (B1, Fig. 3B) most likely reflected some variability that we have detected in the overall expression of ␥c transfected in 1F1 cells, when analyzed at different times. Importantly, the rate of internalization of ␥c in 1F1␥cPEST was comparable with that seen for 1F1␥c295 (Fig. 5). Thus, the integrity of the PEST sequence is required for normal ligand-independent endocytosis of ␥c. Tissue specificity for IL-2-induced endocytosis We developed a transient assay with the aim to rapidly characterize internalization of variants of the IL-2R. The approach was to cotransfect COS7 cells with IL-2R␣, , and ␥c cDNAs and assess FIGURE 5. Constitutive ligand-independent cell surface turnover of WT and mutant ␥c. The indicated cell lines (1 ⫻ 106/ml in complete RPMI 1640 medium) were treated with emetine (3 g/ml) for the indicated time in hours. Cell surface levels of ␥c were determined by FACS analysis by staining with anti-␥c mAb (4G3). The mean fluorescence intensity of this staining was determined at each time point and compared with untreated cells to calculate the percentage of cell surface expression of ␥c. Data shown are the mean ⫾ SD of three to four experiments. Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 FIGURE 3. Expression of ␥c by 1F1 cells stably transfected with WT and mutant ␥c. A, Representation of mutant ␥c molecules. The first diagram represents WT ␥c, which shows the amino acid positions for the start of the leader peptide (L), extracytoplasmic domain (EX), transmembrane region (T), and cytoplasmic tail (CYT). The number of amino acids in the cytoplasmic tail of each mutant and their designation are shown to the right. B, Western blot analysis. Detergent extracts were prepared from the indicated cells and immunoprecipitated with the 4G3 mAb to ␥c, and the blot was probed with antiserum to the extracytoplasmic region of ␥c. Molecular weight markers are shown to the left. C, FACS analysis. The indicated cells were stained with the 4G3 mAb to ␥c (shaded histogram) or control stained (open histogram). 2560 IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2 FIGURE 7. The effect of a tyrosine kinase inhibitor on IL-2 internalization. The indicated cells were untreated (open bars) or treated with 250 M genistein (stippled bars) during IL-2 internalization. The I:S ratio was determined after 45-min incubation at 37°C. The number in each open bar represents the number of individual determinations. IL-2 internalization 72 h later by binding IL-2 to the cell surface. Surprisingly, when compared with CX, the transfected COS7 cells inefficiently internalized 125I-IL-2 (Fig. 6A). By contrast, the internalization of transferrin, as assessed by the release of apotransferrin into the culture media, was identical for CX-, 1F1␥c284-, and IL-2R-transfected COS7 (Fig. 6B). Untransfected COS7 cells failed to bind and internalize IL-2 (not shown), demonstrating specificity for the transfected cells. The t1/2 for internalization of IL-2 by IL-2R␣␥c-transfected COS7 cells was 39 min, more than 2-fold slower than detected for CX and slightly slower than observed for 1F1␥284. These data suggest that a lymphoid-specific component independent of the IL-2R is also required for rapid endocytosis of IL-2. Role of tyrosine kinase activity in IL-2 internalization One potential lymphoid-specific component that associates with the cytoplasmic tail of ␥c is the tyrosine kinase Jak3. Initially, the effect of the tyrosine kinase inhibitor genistein was tested on IL-2 internalization. When internalization was allowed to proceed for 45 min, genistein substantially inhibited IL-2 internalization by CX and 1F1␥c284 (Fig. 7). Interestingly, in the presence of genistein, the proportion of internalized IL-2 by CX was still Role of the Jak/STAT pathway in IL-2 internalization Jak3 is a lymphoid-specific tyrosine kinase that associates with ␥c. Therefore, we tested whether functional Jak3 activity might be required for IL-2-induced receptor-mediated endocytosis. For these experiments, we compared the ability of IL-2 to induce STAT5 phosphorylation in 1F1 cells transfected with WT or truncated mutant ␥c (Fig. 8). As expected, three independently derived transfected 1F1␥c295 cell lines failed to phosphorylate STAT5, demonstrating the dependence on the cytoplasmic tail of ␥c for this phosphorylation. By contrast, STAT5 was phosphorylated in all the 1F1␥c328 and 1F1␥c337 cells, albeit at somewhat different levels. This activation of STAT5 was strictly dependent upon the addition of IL-2 to each type of transfectant (not shown). Importantly, STAT5 was phosphorylated in 1F1␥c328, which, like 1F1␥c295, inefficiently internalized IL-2 (see Fig. 4). This finding demonstrates that ␥c-dependent Jak3 functional activity is not the sole ␥c signal required for rapid ligand-dependent receptor-mediated endocytosis. To directly test the potential contribution of Jak3 and the Jak/ STAT signal transduction pathway to internalization of IL-2, the IL-2R␣␥c-transfected COS7 cells were also cotransfected with Jak3 or Jak1, Jak3, and STAT5. The expression of these multiple genes in COS7 for the cytokine receptor subunits was confirmed by irreversible binding of IL-2 and FACS analysis with anti-IL-2R subunit-specific mAbs (not shown) and for Jak/STAT molecules FIGURE 8. IL-2-induced ␥c-dependent tyrosine phosphorylation of STAT5 by WT and mutant ␥c. Independently derived transfected cells expressing mutant or WT ␥c, as indicated, were treated with IL-2 for 30 min at 37°C. Nonidet P-40 extracts were prepared, and 10 ⫻ 106 cell equivalents were precipitated with anti-STAT5 associated to protein G-Sepharose. The precipitated material was subjected to Western blot analysis after 10% SDS-PAGE using antiserum to phospho-STAT5. The blots were stripped and reprobed with antiserum to STAT5 to verify the presence of STAT5 protein. Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 FIGURE 6. Ligand internalization by nonlymphoid cells. A, Internalization of IL-2. CX (F) or COS7 cells transfected with IL-2R␣, , and ␥c (E) were treated with 125I-IL-2 at 4°C and then cultured at 37°C. The I:S ratio was determined. B, Internalization of transferrin. CX (F)-, 1F1␥c284 (E)-, or IL-2R-transfected COS7 cells (f) were treated with 125 I-labeled ferric-transferrin and then cultured at 37°C. The release of transferrin into the culture supernatant was determined. The ferric-transferrin/transferrin receptor complex is rapidly internalized in early endosomes, and the receptor recycles back to the cell surface and undegraded apo-transferrin is released by the cell. greater than detected for 1F1␥c284. This result suggests that internalization may depend upon two components, the cytoplasmic tail of ␥c and a tyrosine kinase activity that at least in part is independent of the cytoplasmic tail of ␥c. At 45 min, the IL-2Rtransfected COS7 cells showed even greater impairment in internalization than 1F1␥c284, and this internalization was minimally sensitive to the effects of genistein. This finding suggests that the tyrosine kinase-dependent component for IL-2 internalization may be lymphoid specific. The Journal of Immunology by Western blot analysis of untransfected and transfected COS7 cells (Fig. 9A). Essentially, no Jak3 and minimal STAT5a were present in the untransfected cells, while these proteins were readily detected after transfection. As reported by others (20), we detected a low amount of Jak1 in the untransfected COS7, which was also substantially increased after cotransfection of this cDNA. The internalization of IL-2 by IL-2R␣␥c-transfected COS7 cells in the absence or presence of Jak3 or Jak1, Jak3, and STAT5a was largely comparable and substantially lower than seen for CX T cells when examined at both 15 min and 30 min after placing the 125 I-IL-2-treated cells at 37°C (Fig. 9B). These data indicate that reconstitution of Jak3 and STAT5a in COS7 is not sufficient to increase IL-2 internalization by this nonlymphoid cell. Discussion Structure/function studies of ␥c in lymphoid cells in general and T lymphocytes in particular have been hampered because virtually all lymphoid cells constitutively express ␥c, making such cell lines unsuitable as recipients for transfected mutant ␥c constructs. Several laboratories have overcome this problem by expressing chimeric receptors in T lymphocytes in which the WT or mutant cytoplasmic tail of ␥c is linked to extracytoplasmic domain of a distinct protein (3, 27). The function of ␥c is then inferred by stimulating the T cells through the extracytoplasmic region of the chimeric molecule. This approach by the nature of its design is not suitable for direct analysis of IL-2-induced receptor-mediated endocytosis. In the present study, a mutant variant of the mouse EL4 thymoma, designated 1F1 (16), which constitutively expresses IL-2R ␣- and -chains, but not cell surface ␥c, was exploited to begin to study the structural basis by which ␥c controls IL-2Rmediated endocytosis of IL-2. Two major new observations emerge from this study. First, there are distinct cytoplasmic regions of ␥c that function during endocytosis, one for ligand-inde- pendent constitutive endocytosis of ␥c and another for ␥c-dependent IL-2-induced endocytosis. Second, efficient internalization of IL-2 is dependent upon a lymphoid cell environment. Internalization of IL-2 by T lymphocytes after binding to the high affinity IL-2R has been reported to occur at a t1/2 of 10 –20 min (6 – 8). The t1/2 for CX and 1F1␥cWT was approximately 10 –15 min, a value typically expected for IL-2 internalization by a T cell. 1F1 cells transfected with cytoplasmic tailless ␥c (1F1␥c284) internalized IL-2 at a rate approximately twice as slow as the cells expressing WT ␥c, indicating that IL-2 internalization is dependent upon ␥c (13) and its cytoplasmic tail. Expression of WT IL-2R␣, , and ␥c in COS7 monkey kidney epithelial cells resulted in endocytosis of IL-2 at a rate slightly slower than detected for 1F1␥c284, demonstrating that the cytoplasmic tail of ␥c is necessary, but not sufficient, for IL-2 internalization. This finding suggests that efficient internalization of IL-2 is dependent not only on ␥c, but also upon one or more IL-2R-independent lymphoid-specific factors. The cytoplasmic tail of ␥c contains a calpain-sensitive PEST sequence that has been implicated in T cell function (28). This sequence is found in the proximal region of the 85-aa cytoplasmic tail of ␥c, between aa 35 and 43. Deletion mutants of the cytoplasmic tail of ␥c in the context of an IL-2R␣/␥c chimeric molecule have mapped the region between residues 35 and 40 in the cytoplasmic tail of ␥c as being critical for the constitutive endocytosis of this molecule (27). Our ␥c328 mutant, which contains the first 45 aa of the cytoplasmic tail, exhibited rapid constitutive endocytosis of ␥c when transfected into the 1F1 cell line that was comparable with WT ␥c. The constitutive turnover of the ␥c284 and ␥c295 mutants, containing 1 and 12 aa of the cytoplasmic tail, was approximately two times slower. Importantly, site-directed mutagenesis of this PEST site in the context of full-length ␥c resulted in ␥c turnover essentially identical to that seen for cytoplasmic tailless ␥c. Thus, these results are consistent with the above findings (27, 28) and directly demonstrate a role for this sequence in regulation of the constitutive endocytosis. Rapid ␥c-dependent endocytosis of IL-2 clearly requires more than these first 45 aa, including the PEST sequence, of the cytoplasmic tail. The rate of internalization by IL-2R in the context of the ␥c284, ␥c295, and ␥c328 mutants, the latter of which includes the PEST sequence, was approximately 2-fold slower than IL-2R containing ␥cWT and ␥c337. This analysis maps IL-2-induced endocytosis to 9 aa between residues 45 and 54 of the cytoplasmic tail. We have not defined which of these nine residues function as an endocytic signal. This region lacks a di-leucine motif and does not obviously contain a tyrosine motif similar to those reported to target receptor-ligand complexes to clathrin-coated pits during the initial phase of internalization. The importance of coated-pit structures in IL-2/IL-2R internalization has not been established unequivocally. If fact, substantial internalization of IL-2 was noted even after effectively blocking clathrin-coated pit internalization of transferrin (10, 11). Thus, the IL-2/IL-2R may utilize a novel pathway to deliver the ligand-receptor complex to the endosome that is dependent upon ␥c cytoplasmic signals that do not show obvious similarity to other cell surface receptors. Nelson and colleagues (29) mapped the box 2 region of ␥c to aa 40 –52 of the cytoplasmic tail, which, along with the upstream box 1 region, are required for Jak3 binding to ␥c. As ␥c-dependent STAT5 phosphorylation readily occurred in 1F1␥c328, our study refines the region required for Jak3 binding to ␥c to the first 45 aa of the cytoplasmic tail. Furthermore, since 1F1␥c328 showed impaired internalization of IL-2, this mutant clearly illustrates that Jak/STAT activation is not sufficient for rapid endocytosis of IL-2 in T cells, although this does not rule out a possible contribution to Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 FIGURE 9. Internalization of IL-2 by nonlymphoid cells containing Jak/STAT proteins. A, Western blot analysis. Detergent extracts were prepared from untransfected COS7 (⫺) or COS7 cells transfected with IL2R␣, , ␥c, Jak1, Jak3, and STAT5a (⫹); immunoprecipitated with antisera to STAT5, Jak1, or Jak3, as indicated; and probed with the same antisera. Molecular weight markers are shown to the left. B, Internalization of IL-2. IL-2 internalization was performed for the cells, and the I:S ratio was determined after incubation at 37°C for 15 min (open bars) or 30 min (stippled bars). COS7␣␥ are cells transfected with IL-2R␣, , and ␥c. COS7␣␥J are cells transfected with IL-2R␣, , ␥c, and Jak3. COS7␣␥JS are cells transfected with IL-2R␣, , ␥c, Jak1, Jak3, and STAT5a. The number in each open bar represents the number of individual determinations. 2561 2562 References 1. He, Y.-W., and T. R. Malek. 1998. The structure and function of ␥c-dependent cytokines and receptors: regulation of T lymphocyte development and homeostasis. Crit. Rev. Immunol. 18:503. 2. Nakamura, Y., S. M. Russell, S. A. Mess, M. Friedmann, M. Erdos, C. Francois, Y. Jacques, S. Adelstein, and W. J. Leonard. 1994. Heterodimerization of the IL-2 receptor - and ␥-chain cytoplasmic domains is required for signaling. Nature 369:330. 3. Nelson, B. H., J. D. Lord, and P. D. Greenberg. 1994. Cytoplasmic domains of the interleukin-2 receptor  and ␥ chains mediate the signal for T-cell proliferation. Nature 369:333. 4. Miyazaki, T., A. Kawahara, H. Fujii, Y. Nakagawa, Y. Minami, Z.-J. Liu, I. Oishi, O. Silvennoinen, B. A. Witthuhn, J. N. Ihle, and T. Taniguchi. 1994. Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science 266:1045. 5. Nelson, B. H., and D. M. Willerford. 1998. Biology of the interleukin-2 receptor. Adv. Immunol. 70:1. 6. Duprez, V., M. Ferrer, and A. Dautry-Varsat. 1992. High-affinity interleukin 2 receptor ␣ and  chains are internalized and remain associated inside the cells after interleukin 2 endocytosis. J. Biol. Chem. 267:18639. 7. Lowenthal, J. W., H. R. MacDonald, and B. J. Iacopetta. 1986. Intracellular pathway of interleukin 2 following receptor-mediated endocytosis. Eur. J. Immunol. 16:1461. 8. Weissman, A., J. Harford, P. Svetlik, W. Leonard, J. Depper, T. Waldmann, W. Greene, and R. Klausner. 1986. Only high-affinity receptors for interleukin 2 mediate internalization of ligand. Proc. Natl. Acad. Sci. USA 83:1463. 9. Hemar, A., A. Subtil, M. Lieb, E. Morelon, and R. Hellio. 1995. Endocytosis of interleukin 2 receptors in human T lymphocytes: distinct intracellular localization and fate of the receptor ␣, , and ␥ chains. J. Cell Biol. 129:55. 10. Subtil, A., A. Hemar, and A. Dautry-Varsat. 1994. Rapid endocytosis of interleukin 2 receptors when clathrin-coated pit endocytosis is inhibited. J. Cell Sci. 107:3461. 11. Subtil, A., and A. Dautry-Varsat. 1997. Microtubule depolymerization inhibits clathrin coated-pit internalization in non-adherent cell lines while interleukin 2 endocytosis is not affected. J. Cell Sci. 110:2441. 12. Mellman, I. 1996. Endocytosis and molecular sorting. Annu. Rev. Cell. Dev. Biol. 12:576. 13. Takeshita, T., H. Asao, K. Ohtani, N. Ishii, S. Kumaki, N. Tanaka, H. Munakata, M. Nakamura, and K. Sugamura. 1992. Cloning of the ␥ chain of the human IL-2 receptor. Science 257:379. 14. Furse, R., and T. Malek. 1993. Selection of internalization-deficient cells by interleukin-2-Pseudomonas exotoxin chimeric protein: the cytoplasmic domain of the interleukin-2 receptor  chain does not contribute to internalization of interleukin-2. Eur. J. Immunol. 23:3181. 15. Kondo, S., M. Kinoshita, A. Shimizu, Y. Saito, M. Konishi, H. Sabe, and T. Honjo. 1987. Expression and functional characterization of artifical mutants of interleukin-2 receptor. Nature 327:64. 16. Malek, T. R., R. K. Furse, M. L. Fleming, A. J. Fadell, and Y.-W. He. 1995. Biochemical identity and characterization of the mouse interleukin-2 receptor  and ␥c subunits. J. Interferon Cytokine Res. 15:447. 17. He, Y.-W., B. Adkins, R. K. Furse, and T. R. Malek. 1995. Expression and function of the ␥c subunit of the IL-2, IL-4, and IL-7 receptors: distinct interaction of ␥c in the IL-4 receptor. J. Immunol. 154:1596. 18. Nishio, M., and E. Podack. 1996. Rapid induction of tumor necrosis factor cytotoxicity in naive splenic T cells by simultaneous CD80 (B7.1) and CD54 (ICAM-1) co-stimulation. Eur. J. Immunol. 26:2160. 19. Zhou, Y.-J., E. Hanson, Y.-Q. Chen, K. Magnuson, M. Chen, P. Swann, R. Wange, P. Changelian, and J. O’Shea. 1997. Distinct tryosine phosphorylation sites in JAK3 kinase domain positively and negatively regulate its enzyme activity. Proc. Natl. Acad. Sci. USA 94:13850. 20. Lin, J.-X., J. Mietz, W. Modi, S. John, and W. Leonard. 1996. Cloning of human Stat5B. J. Biol. Chem. 271:10738. 21. Muller, M., J. Briscoe, C. Laxton, D. Gushin, A. Ziemiecki, O. Silverennoinen, A. Harper, G. Barbieri, B. Witthuhn, C. Schindler, et al. 1993. The protein tryosine kinase JAK1 complements defects in interferon-␣/ and -␥ signal transduction. Nature 366:129. 22. Ortega, R., G., R. Robb, E. Shevach, and T. Malek. 1984. The murine IL-2 receptor. I. Monoclonal antibodies that define distinct functional epitopes on activated T cells and react with activated B cells. J. Immunol. 133:1970. 23. Malek, T. R., R. J. Robb, and E. M. Shevach. 1983. Identification and initial characterization of a rat monoclonal antibody reactive with the murine interleukin 2 receptor-ligand complex. Proc. Natl. Acad. Sci. USA 80:5694. 24. Saragovi, H., and T. Malek. 1987. The murine interleukin 2 receptor: irreversible cross-linking of radiolabeled interleukin 2 to high affinity interleukin 2 receptors reveals a noncovalently associated subunit. J. Immunol. 139:1918. 25. Wiley, H., and D. Cunningham. 1982. The endocytic rate constant: a cellular parameter for quantitating receptor-mediated endocytosis. J. Biol. Chem. 257:4222. 26. Draznin, B., M. Trowbridge, and L. Ferguson. 1984. Quantitative studies of the rate of insulin internalization in isolated rat hepatocytes. Biochem. J. 218:307. 27. Morelon, E., and A. Dautry-Varsat. 1998. Endocytosis of the common cytokine receptor ␥c chain. J. Biol. Chem. 273:22044. 28. Noguchi, M., A. Sarin, M. J. Aman, H. Nakajima, E. W. Shores, P. A. Henkart, and W. J. Leonard. 1997. Functional cleavage of the common cytokine receptor ␥ chain (␥c) by calpain. Proc. Natl. Acad. Sci. USA 94:11534. 29. Nelson, B. H., J. D. Lord, and P. D. Greenberg. 1996. A membrane-proximal region of the interleukin-2 receptor ␥c chain sufficient for Jak kinase activation and induction of proliferation in T cells. Mol. Cell. Biol. 16:309. 30. Hataketama, M., T. Kono, N. Kobayashi, A. Kawahara, S. Levin, R. Perlmutter, and T. Taniguchi. 1991. Interaction of the IL-2 receptor with the src-family kinase p56lck: identification of novel intermolecular association. Science 252: 1523. 31. Minami, Y., Y. Nakagawa, A. Kawahara, T. Miyazaki, K. Sada, H. Yamamura, and T. Taniguchi. 1995. Protein tyrosine kinase Syk is associated with and activated by the IL-2 receptor: possible link with the c-myc induction pathway. Immunity 2:89. Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017 endocytosis by these molecules. We also found that expression of Jak3, either alone or with Jak1 and STAT5a, in IL-2R-bearing COS7 did not increase the impaired IL-2 endocytosis by these nonlymphoid cells. These findings further emphasize that Jak3 and the Jak/STAT pathway are insufficient by themselves to target IL2/IL-2R for rapid endocytosis and indicate that Jak3 is not the key lymphoid-specific component required for normal endocytosis of IL-2. The requirement for tyrosine kinase activity for IL-2 endocytosis might be the result of an effect on intracellular signaling independent of ␥c or Jak3, perhaps on some downstream signaling molecule. Beside Jak1, the tyrosine kinases p56lck and Syk also associate with the cytoplasmic tail of the IL-2R -chain (30, 31). It is highly unlikely that either of these tyrosine kinases are the targets for genistein because we have previously shown that another variant of the EL4 thymoma normally internalizes IL-2 even though their IL-2R consists of WT IL-2R␣ and ␥c, but a cytoplasmic tailless -chain (14). Further studies are necessary to define the signaling requirements for endocytosis of IL-2, including the possible relationship to lymphocyte-specific components that control endocytosis of this cytokine. IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2
© Copyright 2026 Paperzz