This information is current as
of July 31, 2017.
Efficient Internalization of IL-2 Depends on
the Distal Portion of the Cytoplasmic Tail of
the IL-2R Common γ-Chain and a Lymphoid
Cell Environment
Aixin Yu, Ferenc Olosz, Chris Y. Choi and Thomas R.
Malek
J Immunol 2000; 165:2556-2562; ;
doi: 10.4049/jimmunol.165.5.2556
http://www.jimmunol.org/content/165/5/2556
Subscription
Permissions
Email Alerts
This article cites 31 articles, 19 of which you can access for free at:
http://www.jimmunol.org/content/165/5/2556.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
References
Efficient Internalization of IL-2 Depends on the Distal Portion
of the Cytoplasmic Tail of the IL-2R Common ␥-Chain and a
Lymphoid Cell Environment1
Aixin Yu, Ferenc Olosz, Chris Y. Choi, and Thomas R. Malek2
T
he IL-2R is a critical molecule on lymphoid lineage cells,
particularly activated T lymphocytes and NK cells, as it
regulates their growth, apoptosis, and differentiation into
effector lymphocytes. The mouse IL-2R consists of three subunits,
the unique ␣-chain (p55); the ␤-chain (p90), which is also a subunit of the IL-15R; and the common ␥-chain (␥c;3 p75), which is
also a subunit of the IL-4R, IL-7R, IL-9R, and IL-15R (reviewed
in Ref. 1). These three subunits are expressed on the cell surface
largely independently of each other in the absence of IL-2. The
␣-chain binds IL-2 at a relatively low affinity (Kd of 10⫺8 M) with
fast on/off-rates (⬃30 s). The ␣- and ␤-chains cooperate to increase IL-2-binding affinity by 100-fold, but this partial receptor
still exhibits fast on/off-rates. The functional high affinity (Kd of
10⫺11 M) IL-2R, consisting of ␣, ␤, and ␥c subunits, exhibits fast
IL-2 on-rates characteristic of the ␣-chain, but slow off-rates,
which, in practical terms, represent essentially irreversible IL-2
binding. The sole role of the ␣-chain is in ligand binding, whereas
the ␤-chain and ␥c contribute to ligand binding and signal
transduction.
Signal transduction ensues by IL-2-induced trimerization of the
␣, ␤, and ␥c subunits, which brings the cytoplasmic tails of the ␤
and ␥c subunits in close proximity for an extended period of time,
Department of Microbiology and Immunology, University of Miami School of Medicine, Miami, FL 33136
Received for publication November 18, 1999. Accepted for publication June
15, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grant AI40114.
2
Address correspondence and reprint requests to Dr. Thomas Malek, Department of
Microbiology and Immunology, University of Miami School of Medicine, 1600 N.W.
10th Avenue, Miami, FL 33136. E-mail address: [email protected]
3
Abbreviations used in this paper: ␥c, common ␥-chain; I, intracellular;
I-labeled IL-2; S, surface; WT, wild type.
125
Copyright © 2000 by The American Association of Immunologists
125
I-IL-2,
allowing receptor phosphorylation by associated tyrosine kinases
(2, 3). The Janus kinase Jak3, the only known tyrosine kinase
associated with ␥c, importantly contributes to the initial phosphorylation of the ␤-chain (4). This initiates the recruitment of a number of signal-transducing molecules to the cytoplasmic tail of the
␤-chain, including Jak1, STAT5, and STAT3, the Shc-adaptor protein, Syk, and p56lck (reviewed in Ref. 5). Thus, at a minimum,
IL-2 signaling results in the activation of the Jak/STAT, phosphatidylinositol 3-kinase, and the ras/raf/mitogen-activated protein kinase pathways.
Besides signal transduction, another early consequence of the
IL-2/IL-2R interaction is receptor-mediated endocytosis of the receptor-ligand complex. This process is often utilized to remove the
receptor-ligand complex from the cell surface. For the IL-2/IL-2R
complex, receptor-mediated endocytosis functions to limit IL-2
signal transduction, and hence, the biological response to this cytokine. In T lymphocytes, IL-2 is rapidly internalized (t1/2 of
10 –20 min), ultimately leading to lysosomal degradation of IL-2
(6 – 8). After internalization, the ␤- and ␥c-chains are sorted to late
endosomal compartment, presumably for degradation (9). The
␣-chain, on the other hand, was detected only in early endosomes,
colocalizing with the transferrin receptor, suggesting that this subunit may recycle back to the plasma membrane (9). The route of
entry of IL-2/IL-2R complex into the cell has not been established,
but may be independent of clathrin-coated pit endocytosis (10, 11).
For most hormone receptors, ligand-induced receptor-mediated
endocytosis is dependent upon the cytoplasmic tail of the receptor,
often through a tyrosine-based or di-leucine-based motif (12). The
structural basis for IL-2/IL-2R internalization has not been extensively investigated. Transfection of wild-type (WT) (3) and mutant
IL-2R subunits points to an important role for the ␥c subunit for
internalization of IL-2 (13). In fact, rapid IL-2 internalization has
been noted for T cells expressing cytoplasmic tailless IL-2R␣ or
IL-2R␤ (14, 15), suggesting no essential role for these subunits in
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
The common ␥-chain (␥c), a subunit of the IL-2R, is essential for high affinity ligand binding and signal transduction due to Jak3
association to ␥c. Another consequence of IL-2/IL-2R interaction is rapid receptor-mediated endocytosis of the receptor-ligand
complex. In the present study, we establish that this rapid endocytosis of IL-2 in a T cell tumor line is dependent upon the
cytoplasmic tail of ␥c. Deletion mutants of the cytoplasmic tail mapped this activity to 9 aa of ␥c, 45–54 aa distal to the transmembrane region. In contrast, ligand-independent constitutive endocytosis of ␥c occurred more slowly and was dependent upon
a PEST sequence in a more membrane-proximal region of the cytoplasmic tail of ␥c. Thus, this receptor subunit may use distinct
sorting signals for its constitutive regulation and ligand-induced endocytosis. Rapid endocytosis of IL-2 was inhibited by the
tyrosine kinase inhibitor genistein, implicating a role for a signal transduction pathway in IL-2 internalization. However, one T
cell line bearing a mutant ␥c exhibited impaired endocytosis of IL-2, despite normal IL-2-induced Jak/STAT activation. Furthermore, inefficient endocytosis of IL-2 was noted after transfection of the COS7 epithelial cell line with the IL-2R, and further
reconstitution of these cells with Jak/STAT proteins did not enhance this internalization. Collectively, these latter findings indicate
that rapid endocytosis of IL-2 is dependent upon cellular signaling in lymphoid cell environment that is not solely a consequence
of the presence of the Jak/STAT pathway. The Journal of Immunology, 2000, 165: 2556 –2562.
The Journal of Immunology
this process other than ligand binding. The present study, therefore, was undertaken to more precisely define the contribution of
the cytoplasmic tail of the ␥c subunit in internalization of IL-2. We
establish that efficient internalization of IL-2 depends on 9 aa
within the cytoplasmic tail of ␥c and at least one other IL-2Rindependent lymphocyte-specific component.
Materials and Methods
Cell lines and culture conditions
CX␤ is a variant of the mouse EL4 thymoma that expresses mouse IL-2R␣,
␤, and ␥c subunits, the former two after transfection with the respective
cDNA (14). 1F1 is a mutant variant of CX␤ that lacks cell surface mouse
␥c (16). These cells were cultured in RPMI 1640 medium supplemented
with 5% FCS, L-glutamine (300 ␮g/ml), penicillin (100 U/ml), streptomycin (100 ␮g/ml), and 2-ME (5 ⫻ 10⫺5 M) (complete medium). To maintain
expression of the transfected cDNAs, the cells were periodically (every
10 –14 days) passed in complete medium supplemented with mycophenolic
acid (2 ␮g/ml), xanthine (25 ␮g/ml), hypoxanthine (15 ␮g/ml), and G418
(1 mg/ml; Life Technologies, Grand Island, NY).
Mouse IL-2R constructs
Transfection
1F1 cells (8 ⫻ 106) were stably cotransfected with either pSI-␥c284, pSI␥c295, or pSI-␥c328 (38.5 ␮g/ml) and BMG-His (18) (kindly provided by
E. Podack, University of Miami) (12.5 ␮g/ml) in 0.4 ml of RPMI 1640 by
electroporation using a BRL cell porator (Life Technologies) set at 1180
␮F and 200 V. The electroporated cells were placed on ice for 10 min;
resuspended in complete medium containing mycophenolic acid, xanthine,
hypoxanthine, and G418; and cultured (4 ⫻ 104/well) in 96-well flat-bottom culture plates at 37°C in a 7% CO2 incubator. Twenty-four hours later,
histidinol (0.5 mM) was added to the cultures. 1F1 was similarly transfected with the ␥cWT, ␥c337, or ␥cPEST cDNA, but using only the pSI␥cWT vector (50 ␮g/ml) containing the CMV ZeoCassette (Invitrogen,
Carlsbad, CA). Cells were selected by addition of Zeocin (150 ␮g/ml;
Invitrogen) 24 h after transfection.
COS7 cells were harvested by treatment with trypsin-EDTA and
washed, and 5–20 ⫻ 106 cells were transiently transfected, as described
above, at 330 ␮F and 215 V. These cells were transfected with either
pSI-IL-2R␣␤ (15 ␮g/ml), pSI-␥cWT (1–5 ␮g/ml), and pME18S-mJak3
(15 ␮g/ml) (19) (kindly provided by J. O’Shea, National Institutes of
Health), as indicated, or pSI-IL-2R␣␤, pSI-␥cWT, pME18S-Jak3, pcDNAmSTAT5a (20) (kindly provided by W. Leonard, National Institutes of
Health), and Prk5-mJak1 (21) (kindly provided by J. Ihle, St. Jude Children’s Research Hospital, Memphis, TN) at 5 ␮g/ml for each vector, as
indicated. In these latter transfections, empty pSI vector was added, as
required, to maintain a constant final concentration of DNA (30 ␮g/ml).
We noted similar expression of high affinity IL-2R after both types of
transfection conditions. After transfection, cells were cultured in complete
medium at 1 ⫻ 106 cells/100 mm2 tissue culture plates for 3 days. Cells
were then harvested for experimental assays by first washing the plates
with PBS and then harvesting the adherent cells by incubation with prewarmed (37°C) PBS containing 5 mM EDTA for 5 min.
Abs and other reagents
mAbs to mouse IL-2R␣ (3C7) (22), IL-2R␤ (5H4) (16), and ␥c (4G3 and
3E12) (17) were previously described. PE-conjugated anti-␥c (4G3) and
FITC-conjugated goat anti-rat Ig were obtained from PharMingen (San
Diego, CA). Rabbit antisera to mouse ␥c, Jak1, Jak3, and STAT5 were
obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and to phospho-STAT5 from Upstate Biotechnology (Lake Placid, NY). HRP-conjugated donkey anti-rabbit Ig was obtained from Amersham Pharmacia Biotech (Piscataway, NJ). Emetine was obtained from Sigma (St. Louis, MO),
and genistein from Calbiochem (San Diego, CA).
FACS analysis
FACS analysis was performed as previously described (23) using a Becton
Dickinson FACScan and CellQuest software. Typically, 10,000 cells/sample were analyzed. Dead cells were excluded from analysis by forward vs
side scatter gating. Depending upon the primary Ab, control stained cells
were incubated with either PE-streptavidin or FITC goat anti-rat Ig.
Internalization assays
CX␤ and the 1F1 transfectants (10 ⫻ 106/ml) or the transiently transfected
COS7 cells (4 ⫻ 106/ml) were incubated at 4°C for 30 min with 50,000
cpm/ml human 125I-labeled IL-2 (125I-IL-2). The IL-2 was radiolabeled
with Na125I using IODO-GEN-precoated tubes (Pierce, Rockford, IL), according to the manufacturer’s instruction, to a sp. act. of approximately
20 – 40 ␮Ci/␮g. The cells were washed three times with cold HBSS and
resuspended in complete medium at 4 ⫻ 106/ml (CX␤ and 1F1 transfectants) or 2 ⫻ 106/ml (COS7) and shifted to 37°C. At the indicated times,
1 ml was removed from culture and cells were pelleted by centrifugation in
a microfuge at 14,000 ⫻ g for 15 s in 1.5-ml tubes. Protein released in the
supernatant was precipitated by addition of 1/4 vol of 50% TCA. The
TCA-soluble counts represented internalized IL-2 that was degraded. The
cell pellets were then resuspended in 0.5 ml of 0.01 M sodium citrate, 0.14
M NaCl, pH 2 buffer for 2 min at room temperature and then centrifuged
for 15 s at 14,000 ⫻ g in a microfuge. The radioactivity that remained
associated with the cells after this low pH buffer wash represented the
internalized (I) IL-2, while the portion of radioactivity in the pH 2 buffer
supernatant represented cell surface-associated (S) IL-2. Before shifting the
cells to 37°C, usually 80 – 85% of the cpm was cell surface associated. The
I:S ratio was calculated at the indicated time points. The pH 2-resistant
material at t0 was considered nonspecific material and was subtracted
from I.
Internalization of transferrin was similarly evaluated, except that initially CX␤ and the 1F1 transfectants (40 ⫻ 106/ml) or the transiently transfected COS7 cells (12 ⫻ 106/ml) were incubated at 4°C for 30 min with
250,000 cpm/ml of 125I-labeled transferrin (1 ␮Ci/␮g; NEN, Boston, MA).
Western blot analysis
Cells were extracted in buffer containing 0.5% Nonidet P-40, as previously
described (24). The indicated Ab was first bound to protein G-Sepharose
(Amersham Pharmacia Biotech) by incubation for 30 min at 25°C, washed
three times with extraction buffer, and then used for immunoprecipitations
by incubation of the Ab-coated beads with the Nonidet P-40 extracts at 4°C
overnight. The immunoprecipitates were washed three times with extraction buffer containing 0.5% Nonidet P-40, and the bound material was
eluted with sample buffer containing 2% SDS. Samples were resolved by
10% SDS-PAGE under reducing conditions, transferred to nitrocellulose,
and blocked by incubation with 5% nonfat dried milk in PBS (5% milk) for
1 h. The nitrocellulose was subsequently incubated with the indicated antisera in 5% milk for 90 min, washed three times with PBS containing 0.1%
Nonidet P-40, and then incubated with HRP-conjugated donkey anti-rabbit
Ig for 60 min, followed by washing twice with PBS containing 0.1% Nonidet P-40 and once with PBS. Bands were visualized by chemiluminescence using ECL Western blotting detection reagents (Amersham Pharmacia Biotech), according to the manufacturer’s instructions.
Results
Internalization of IL-2 is dependent upon the cytoplasmic tail of ␥c
The CX␤ cell line is a transfected mutant variant (14) of the mouse
EL4 thymoma that constitutively expresses IL-2R␣, ␤, and ␥c
(Fig. 1A). CX␤ was further mutagenized to yield another variant,
designated 1F1, containing a deletion encompassing the transmembrane region of ␥c, which essentially lacks cells surface ␥c, as
assessed by FACS (Fig. 1B) and biochemical analysis (16).
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
Preparation of the cytoplasmic tailless ␥c284 mutant (␥c284Arg3stop
codon; in which 1 represents the initial methionine residue of the leader
peptide), which contains only 1 aa of the predicted cytoplasmic tail, was
previously described (17) and cloned into the pSI expression vector (Promega, Madison, WI). The cytoplasmic truncations ␥c295 (␥c295Glu3stop
codon) and ␥c328 (␥328Cys3stop) were prepared by site-directed mutagenesis using the Chameleon site-directed mutagenesis kit (Stratagene,
La Jolla, CA), according to the manufacturer’s instructions, using the fulllength mouse ␥c cDNA in the pSI vector as the target DNA. The mutagenic
oligonucleotides were 5⬘-CCCCCCATCAAGAATCTATAGGATCTGGT
TACTGAATACC for ␥c295 and 5⬘-CTACAGTGAACGGTTCTGACA
CGTCAGCGAGATTCCCCCC for ␥c328. The ␥c337 (␥c337Lys3stop)
and the ␥cPEST (␥c317Glu3 Val; ␥c318Ser3 Gly; ␥c321Pro3 Leu;
␥c322Asp3 Ala) were prepared using the Quick Change site-directed mutagenesis kit (Stratagene), according to the manufacturer’s instructions.
The forward mutagenic primers were 5⬘-GCGAGATTCCCCCTTAAG
GAGGGGCCCTAGG for ␥c337 and 5⬘-CTAAAGGGCTGACTGTGGG
TCTGCAGCTAGCCTACAGTGAACGG for ␥cPEST. Mutations were
confirmed by DNA sequence analysis. The mouse IL-2R␣ and IL-2R␤
cDNAs were cloned into the pSI expression vector. To prepare pSI-IL2R␣␤, the expression cassette from pSI-IL-2R␤ was excised and subcloned
adjacent to the expression cassette in pSI-IL-2R␣.
2557
2558
IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2
To quantify the rate by which these two cell lines differed in
IL-2 internalization, the data from six experiments were used to
plot the ratio of intracellular (I):surface (S) IL-2 during the first 30
min of culture at 37°C. An I:S ratio of 1 indicates that 50% of the
cell-associated IL-2 is on the surface, while the remaining 50% is
intracellular. Linear regression analysis of these data indicates that
the initial internalization of IL-2 by both cell lines is linear (Fig.
2D). Under these conditions, the time at which the I:S is 1 represents the t1/2 for internalization and is directly related to the rate of
internalization (25, 26). The t1/2 for CX␤ is 15 min, while the t1/2
for 1F1␥284 is 36 min. Therefore, in the absence of cytoplasmic
tail of ␥c, the IL-2R internalized 125I-IL-2 approximately 2-fold
more slowly. This trend held in all our subsequent analysis, although sometimes the absolute level and the time to reach plateau
levels of intracellular IL-2 varied.
Mapping the cytoplasmic tail of ␥c for internalization signals
Other studies have suggested an important role for ␥c in internalization of IL-2 (13). To test whether the cytoplasmic tail of ␥c
was essential, 1F1 was transfected with ␥c cDNA that contained
the entire extracellular and transmembrane regions of ␥c, but only
1 aa of the predicted cytoplasmic tail. The resulting 1F1␥c284 cell
line expressed high levels of ␥c as well as IL-2R ␣- and ␤-chains
(Fig. 1C). Internalization of IL-2 by these cells was compared with
the parental CX␤ cell line by first pretreating the cells with radiolabeled IL-2 in the cold and then shifting the cells to 37°C to assess
the fate of the cell-bound IL-2. It is evident that the rate at which
IL-2 is internalized (Fig. 2A), is lost from the cell surface (Fig. 2B),
and is metabolized (Fig. 2C) occurred more slowly for 1F1␥284
than CX␤.
Mapping the cytoplasmic tail of ␥c for constitutive turnover
FIGURE 2. Kinetics of internalization and degradation of IL-2. CX␤
(F) or 1F1␥c284 (E) were treated with 125I-IL-2 at 4°C, and then t0 were
cultured at 37°C. A, Rate of internalization of IL-2. B, Rate of loss of cell
surface IL-2. C, Rate of degradation of IL-2. Data in A–C are taken from
one experiment representative of six. D, Ratio of intracellular (I) to surface
(S) IL-2. Linear regression of data from six experiments (mean ⫾ SD). r 2
was 0.99 for CX␤ and 0.86 for 1F1␥c284. The dashed line represents the
95% confidence interval for the regression line.
The proximal 44 aa of the cytoplasmic tail of ␥c have been implicated in ligand-independent endocytosis (27) and contain a
PEST sequence that may function to regulate ␥c surface levels
(28). To assess whether this region of ␥c similarly functioned in
our EL4-transfected variants, the constitutive turnover of ␥c by
CX␤ and the 1F1␥c transfectants was compared. These cells were
treated with emetine, a protein synthesis inhibitor, and the loss of
cell surface ␥c was assessed by cell surface FACS analysis using
an anti-␥c mAb (Fig. 5). This same approach has been previously
used to study the turnover of human ␥c in the YT cell line, and the
decrease in surface ␥c as measured by FACS was essentially identical to the decrease in total ␥c protein as measured by Western
blot analysis (27). Cells that expressed a severely truncated ␥c
cytoplasmic tail, i.e., 1F1␥284 (not shown) and 1F1␥c295, exhibited a relatively slow and linear decrease in their ␥c molecules with
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
FIGURE 1. IL-2R expression by transfected variants of the EL4 thymoma. The indicated cells were stained with subunit-specific mAb (right
histogram) or control stained (left histogram).
The cytoplasmic tails of many cell surface receptors have been
shown to express specific, relatively short, amino acid sequences
that function for rapid ligand-induced receptor-mediated endocytosis (12). To determine whether ␥c contained a membrane-proximal internalization motif, several additional mutant ␥c cDNAs
were expressed in 1F1 that contained progressively longer cytoplasmic tails. 1F1␥c295, 1F1␥c328, and 1F1␥c337 expressed ␥c
molecules containing 12, 45, and 54 aa, respectively, of an 85-aalong cytoplasmic tail (Fig. 3A). 1F1 was also transfected with the
WT ␥c cDNA to ensure that the slow internalization of 1F1␥c284
was not due to a secondary defect in 1F1 cell line. Biochemical
analysis confirmed that the transfected cells expressed the appropriate ␥c molecules of increasing Mr (Fig. 3B). The material detected in band 1 (B1) represented the heavily glycosylated mature
cell surface ␥c, while that in band 2 (B2) represented an endo-Hsensitive intracellular ␥c intermediate (16) (data not shown).
FACS analysis with anti-␥c mAb to the extracytoplasmic region
revealed relatively high expression of these ␥c molecules on the
surface of all four transfectants, with the highest expression on
1F1␥c295 (Fig. 3C).
Internalization of IL-2 by these four cell lines was determined
after a 15-min incubation at 37°C (Fig. 4). This analysis indicates
that the internalization of IL-2 by 1F1␥c284 (not shown),
1F1␥c295, and 1F1␥c328 are all similarly impaired when compared with CX␤ (not shown) and 1F1␥cWT. These data directly
demonstrate that the 1F1 cell line is competent to support normal
internalization of IL-2, provided that these cells express WT ␥c.
These data also indicate that rapid internalization of IL-2 required
the proximal 54 aa of the cytoplasmic tail of ␥c and maps to a 9-aa
region between residues 328 and 337.
The Journal of Immunology
2559
a t1/2 of approximately 290 min. By contrast, the ␥c molecules of
CX␤ (not shown), 1F1␥cWT, and 1F1␥c328 each exhibited a similar more rapid and biphasic decrease, with a t1/2 of approximately
150 min, which is two times faster than seen for 1F1␥284 and
1F1␥c295. The turnover (t1/2) of human WT ␥c in YT cells has
been reported to be 120 min (27), similar to what we have observed for the decrease of mouse WT ␥c by this FACS analysis.
Collectively, our results indicate that the constitutive turnover of
␥c is dependent upon 33 aa between positions 295 and 328 of the
cytoplasmic tail. Furthermore, this finding demonstrates that the
region of the cytoplasmic tail responsible for the constitutive endocytosis of ␥c is distinct from that required for IL-2-induced receptor-mediated endocytosis.
The cytoplasmic tail of mouse ␥c contains a species-conserved
calpain-sensitive PEST sequence (GLTESLQPDYSE) (28) that
may function to regulate the level of this protein. To determine
whether the PEST sequence in mouse ␥c contributed to ligandindependent endocytosis, 3 aa between residues 317 and 321 were
mutated (GLTVGLQLAYSE) (Fig. 3A), as previously done for
human ␥c (28). The transfected 1F1␥cPEST cells expressed ␥c, as
FIGURE 4. Internalization of IL-2 by stable transfectants expressing
mutant ␥c. The I:S ratio (mean ⫾ SEM) was determined for the indicated
cells that were treated with 125I-IL-2 at 4°C and cultured at 37°C for 15
min. The number within each bar represents the number of independent
derived transfected cell lines that were analyzed.
assessed by biochemical (Fig. 3B) and FACS (Fig. 3C) analysis.
The somewhat lower levels of the mature form of ␥c from
1F1␥cPEST (B1, Fig. 3B) most likely reflected some variability
that we have detected in the overall expression of ␥c transfected in
1F1 cells, when analyzed at different times. Importantly, the rate of
internalization of ␥c in 1F1␥cPEST was comparable with that seen
for 1F1␥c295 (Fig. 5). Thus, the integrity of the PEST sequence is
required for normal ligand-independent endocytosis of ␥c.
Tissue specificity for IL-2-induced endocytosis
We developed a transient assay with the aim to rapidly characterize internalization of variants of the IL-2R. The approach was to
cotransfect COS7 cells with IL-2R␣, ␤, and ␥c cDNAs and assess
FIGURE 5. Constitutive ligand-independent cell surface turnover of
WT and mutant ␥c. The indicated cell lines (1 ⫻ 106/ml in complete RPMI
1640 medium) were treated with emetine (3 ␮g/ml) for the indicated time
in hours. Cell surface levels of ␥c were determined by FACS analysis by
staining with anti-␥c mAb (4G3). The mean fluorescence intensity of this
staining was determined at each time point and compared with untreated
cells to calculate the percentage of cell surface expression of ␥c. Data
shown are the mean ⫾ SD of three to four experiments.
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
FIGURE 3. Expression of ␥c by 1F1 cells stably transfected with WT and mutant ␥c. A, Representation of mutant ␥c molecules. The first diagram
represents WT ␥c, which shows the amino acid positions for the start of the leader peptide (L), extracytoplasmic domain (EX), transmembrane region (T),
and cytoplasmic tail (CYT). The number of amino acids in the cytoplasmic tail of each mutant and their designation are shown to the right. B, Western
blot analysis. Detergent extracts were prepared from the indicated cells and immunoprecipitated with the 4G3 mAb to ␥c, and the blot was probed with
antiserum to the extracytoplasmic region of ␥c. Molecular weight markers are shown to the left. C, FACS analysis. The indicated cells were stained with
the 4G3 mAb to ␥c (shaded histogram) or control stained (open histogram).
2560
IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2
FIGURE 7. The effect of a tyrosine kinase inhibitor on IL-2 internalization. The indicated cells were untreated (open bars) or treated with 250
␮M genistein (stippled bars) during IL-2 internalization. The I:S ratio was
determined after 45-min incubation at 37°C. The number in each open bar
represents the number of individual determinations.
IL-2 internalization 72 h later by binding IL-2 to the cell surface.
Surprisingly, when compared with CX␤, the transfected COS7
cells inefficiently internalized 125I-IL-2 (Fig. 6A). By contrast, the
internalization of transferrin, as assessed by the release of apotransferrin into the culture media, was identical for CX␤-,
1F1␥c284-, and IL-2R-transfected COS7 (Fig. 6B). Untransfected
COS7 cells failed to bind and internalize IL-2 (not shown), demonstrating specificity for the transfected cells. The t1/2 for internalization of IL-2 by IL-2R␣␤␥c-transfected COS7 cells was 39
min, more than 2-fold slower than detected for CX␤ and slightly
slower than observed for 1F1␥284. These data suggest that a lymphoid-specific component independent of the IL-2R is also required for rapid endocytosis of IL-2.
Role of tyrosine kinase activity in IL-2 internalization
One potential lymphoid-specific component that associates with
the cytoplasmic tail of ␥c is the tyrosine kinase Jak3. Initially, the
effect of the tyrosine kinase inhibitor genistein was tested on IL-2
internalization. When internalization was allowed to proceed for
45 min, genistein substantially inhibited IL-2 internalization by
CX␤ and 1F1␥c284 (Fig. 7). Interestingly, in the presence of
genistein, the proportion of internalized IL-2 by CX␤ was still
Role of the Jak/STAT pathway in IL-2 internalization
Jak3 is a lymphoid-specific tyrosine kinase that associates with ␥c.
Therefore, we tested whether functional Jak3 activity might be
required for IL-2-induced receptor-mediated endocytosis. For
these experiments, we compared the ability of IL-2 to induce
STAT5 phosphorylation in 1F1 cells transfected with WT or truncated mutant ␥c (Fig. 8). As expected, three independently derived
transfected 1F1␥c295 cell lines failed to phosphorylate STAT5,
demonstrating the dependence on the cytoplasmic tail of ␥c for this
phosphorylation. By contrast, STAT5 was phosphorylated in all
the 1F1␥c328 and 1F1␥c337 cells, albeit at somewhat different
levels. This activation of STAT5 was strictly dependent upon the
addition of IL-2 to each type of transfectant (not shown). Importantly, STAT5 was phosphorylated in 1F1␥c328, which, like
1F1␥c295, inefficiently internalized IL-2 (see Fig. 4). This finding
demonstrates that ␥c-dependent Jak3 functional activity is not the
sole ␥c signal required for rapid ligand-dependent receptor-mediated endocytosis.
To directly test the potential contribution of Jak3 and the Jak/
STAT signal transduction pathway to internalization of IL-2, the
IL-2R␣␤␥c-transfected COS7 cells were also cotransfected with
Jak3 or Jak1, Jak3, and STAT5. The expression of these multiple
genes in COS7 for the cytokine receptor subunits was confirmed
by irreversible binding of IL-2 and FACS analysis with anti-IL-2R
subunit-specific mAbs (not shown) and for Jak/STAT molecules
FIGURE 8. IL-2-induced ␥c-dependent tyrosine phosphorylation of STAT5 by WT and mutant ␥c. Independently derived transfected cells expressing
mutant or WT ␥c, as indicated, were treated with IL-2 for 30 min at 37°C. Nonidet P-40 extracts were prepared, and 10 ⫻ 106 cell equivalents were
precipitated with anti-STAT5 associated to protein G-Sepharose. The precipitated material was subjected to Western blot analysis after 10% SDS-PAGE
using antiserum to phospho-STAT5. The blots were stripped and reprobed with antiserum to STAT5 to verify the presence of STAT5 protein.
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
FIGURE 6. Ligand internalization by nonlymphoid cells. A, Internalization of IL-2. CX␤ (F) or COS7 cells transfected with IL-2R␣, ␤, and ␥c
(E) were treated with 125I-IL-2 at 4°C and then cultured at 37°C. The I:S
ratio was determined. B, Internalization of transferrin. CX␤ (F)-,
1F1␥c284 (E)-, or IL-2R-transfected COS7 cells (f) were treated with
125
I-labeled ferric-transferrin and then cultured at 37°C. The release of
transferrin into the culture supernatant was determined. The ferric-transferrin/transferrin receptor complex is rapidly internalized in early endosomes, and the receptor recycles back to the cell surface and undegraded
apo-transferrin is released by the cell.
greater than detected for 1F1␥c284. This result suggests that internalization may depend upon two components, the cytoplasmic
tail of ␥c and a tyrosine kinase activity that at least in part is
independent of the cytoplasmic tail of ␥c. At 45 min, the IL-2R␤transfected COS7 cells showed even greater impairment in internalization than 1F1␥c284, and this internalization was minimally
sensitive to the effects of genistein. This finding suggests that the
tyrosine kinase-dependent component for IL-2 internalization may
be lymphoid specific.
The Journal of Immunology
by Western blot analysis of untransfected and transfected COS7
cells (Fig. 9A). Essentially, no Jak3 and minimal STAT5a were
present in the untransfected cells, while these proteins were readily
detected after transfection. As reported by others (20), we detected
a low amount of Jak1 in the untransfected COS7, which was also
substantially increased after cotransfection of this cDNA.
The internalization of IL-2 by IL-2R␣␤␥c-transfected COS7
cells in the absence or presence of Jak3 or Jak1, Jak3, and STAT5a
was largely comparable and substantially lower than seen for CX␤
T cells when examined at both 15 min and 30 min after placing the
125
I-IL-2-treated cells at 37°C (Fig. 9B). These data indicate that
reconstitution of Jak3 and STAT5a in COS7 is not sufficient to
increase IL-2 internalization by this nonlymphoid cell.
Discussion
Structure/function studies of ␥c in lymphoid cells in general and T
lymphocytes in particular have been hampered because virtually
all lymphoid cells constitutively express ␥c, making such cell lines
unsuitable as recipients for transfected mutant ␥c constructs. Several laboratories have overcome this problem by expressing chimeric receptors in T lymphocytes in which the WT or mutant
cytoplasmic tail of ␥c is linked to extracytoplasmic domain of a
distinct protein (3, 27). The function of ␥c is then inferred by
stimulating the T cells through the extracytoplasmic region of the
chimeric molecule. This approach by the nature of its design is not
suitable for direct analysis of IL-2-induced receptor-mediated endocytosis. In the present study, a mutant variant of the mouse EL4
thymoma, designated 1F1 (16), which constitutively expresses
IL-2R ␣- and ␤-chains, but not cell surface ␥c, was exploited to
begin to study the structural basis by which ␥c controls IL-2Rmediated endocytosis of IL-2. Two major new observations
emerge from this study. First, there are distinct cytoplasmic regions of ␥c that function during endocytosis, one for ligand-inde-
pendent constitutive endocytosis of ␥c and another for ␥c-dependent IL-2-induced endocytosis. Second, efficient internalization of
IL-2 is dependent upon a lymphoid cell environment.
Internalization of IL-2 by T lymphocytes after binding to the
high affinity IL-2R has been reported to occur at a t1/2 of 10 –20
min (6 – 8). The t1/2 for CX␤ and 1F1␥cWT was approximately
10 –15 min, a value typically expected for IL-2 internalization by
a T cell. 1F1 cells transfected with cytoplasmic tailless ␥c
(1F1␥c284) internalized IL-2 at a rate approximately twice as slow
as the cells expressing WT ␥c, indicating that IL-2 internalization
is dependent upon ␥c (13) and its cytoplasmic tail. Expression of
WT IL-2R␣, ␤, and ␥c in COS7 monkey kidney epithelial cells
resulted in endocytosis of IL-2 at a rate slightly slower than detected for 1F1␥c284, demonstrating that the cytoplasmic tail of ␥c
is necessary, but not sufficient, for IL-2 internalization. This finding suggests that efficient internalization of IL-2 is dependent not
only on ␥c, but also upon one or more IL-2R-independent lymphoid-specific factors.
The cytoplasmic tail of ␥c contains a calpain-sensitive PEST
sequence that has been implicated in T cell function (28). This
sequence is found in the proximal region of the 85-aa cytoplasmic
tail of ␥c, between aa 35 and 43. Deletion mutants of the cytoplasmic tail of ␥c in the context of an IL-2R␣/␥c chimeric molecule have mapped the region between residues 35 and 40 in the
cytoplasmic tail of ␥c as being critical for the constitutive endocytosis of this molecule (27). Our ␥c328 mutant, which contains
the first 45 aa of the cytoplasmic tail, exhibited rapid constitutive
endocytosis of ␥c when transfected into the 1F1 cell line that was
comparable with WT ␥c. The constitutive turnover of the ␥c284
and ␥c295 mutants, containing 1 and 12 aa of the cytoplasmic tail,
was approximately two times slower. Importantly, site-directed
mutagenesis of this PEST site in the context of full-length ␥c resulted in ␥c turnover essentially identical to that seen for cytoplasmic tailless ␥c. Thus, these results are consistent with the above
findings (27, 28) and directly demonstrate a role for this sequence
in regulation of the constitutive endocytosis.
Rapid ␥c-dependent endocytosis of IL-2 clearly requires more
than these first 45 aa, including the PEST sequence, of the cytoplasmic tail. The rate of internalization by IL-2R in the context of
the ␥c284, ␥c295, and ␥c328 mutants, the latter of which includes
the PEST sequence, was approximately 2-fold slower than IL-2R
containing ␥cWT and ␥c337. This analysis maps IL-2-induced endocytosis to 9 aa between residues 45 and 54 of the cytoplasmic
tail. We have not defined which of these nine residues function as
an endocytic signal. This region lacks a di-leucine motif and does
not obviously contain a tyrosine motif similar to those reported to
target receptor-ligand complexes to clathrin-coated pits during the
initial phase of internalization. The importance of coated-pit structures in IL-2/IL-2R internalization has not been established unequivocally. If fact, substantial internalization of IL-2 was noted
even after effectively blocking clathrin-coated pit internalization of
transferrin (10, 11). Thus, the IL-2/IL-2R may utilize a novel pathway to deliver the ligand-receptor complex to the endosome that is
dependent upon ␥c cytoplasmic signals that do not show obvious
similarity to other cell surface receptors.
Nelson and colleagues (29) mapped the box 2 region of ␥c to aa
40 –52 of the cytoplasmic tail, which, along with the upstream box
1 region, are required for Jak3 binding to ␥c. As ␥c-dependent
STAT5 phosphorylation readily occurred in 1F1␥c328, our study
refines the region required for Jak3 binding to ␥c to the first 45 aa
of the cytoplasmic tail. Furthermore, since 1F1␥c328 showed impaired internalization of IL-2, this mutant clearly illustrates that
Jak/STAT activation is not sufficient for rapid endocytosis of IL-2
in T cells, although this does not rule out a possible contribution to
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
FIGURE 9. Internalization of IL-2 by nonlymphoid cells containing
Jak/STAT proteins. A, Western blot analysis. Detergent extracts were prepared from untransfected COS7 (⫺) or COS7 cells transfected with IL2R␣, ␤, ␥c, Jak1, Jak3, and STAT5a (⫹); immunoprecipitated with antisera to STAT5, Jak1, or Jak3, as indicated; and probed with the same
antisera. Molecular weight markers are shown to the left. B, Internalization
of IL-2. IL-2 internalization was performed for the cells, and the I:S ratio
was determined after incubation at 37°C for 15 min (open bars) or 30 min
(stippled bars). COS7␣␤␥ are cells transfected with IL-2R␣, ␤, and ␥c.
COS7␣␤␥J are cells transfected with IL-2R␣, ␤, ␥c, and Jak3.
COS7␣␤␥JS are cells transfected with IL-2R␣, ␤, ␥c, Jak1, Jak3, and
STAT5a. The number in each open bar represents the number of individual
determinations.
2561
2562
References
1. He, Y.-W., and T. R. Malek. 1998. The structure and function of ␥c-dependent
cytokines and receptors: regulation of T lymphocyte development and homeostasis. Crit. Rev. Immunol. 18:503.
2. Nakamura, Y., S. M. Russell, S. A. Mess, M. Friedmann, M. Erdos, C. Francois,
Y. Jacques, S. Adelstein, and W. J. Leonard. 1994. Heterodimerization of the
IL-2 receptor ␤- and ␥-chain cytoplasmic domains is required for signaling. Nature 369:330.
3. Nelson, B. H., J. D. Lord, and P. D. Greenberg. 1994. Cytoplasmic domains of
the interleukin-2 receptor ␤ and ␥ chains mediate the signal for T-cell proliferation. Nature 369:333.
4. Miyazaki, T., A. Kawahara, H. Fujii, Y. Nakagawa, Y. Minami, Z.-J. Liu,
I. Oishi, O. Silvennoinen, B. A. Witthuhn, J. N. Ihle, and T. Taniguchi. 1994.
Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor
subunits. Science 266:1045.
5. Nelson, B. H., and D. M. Willerford. 1998. Biology of the interleukin-2 receptor.
Adv. Immunol. 70:1.
6. Duprez, V., M. Ferrer, and A. Dautry-Varsat. 1992. High-affinity interleukin 2
receptor ␣ and ␤ chains are internalized and remain associated inside the cells
after interleukin 2 endocytosis. J. Biol. Chem. 267:18639.
7. Lowenthal, J. W., H. R. MacDonald, and B. J. Iacopetta. 1986. Intracellular
pathway of interleukin 2 following receptor-mediated endocytosis. Eur. J. Immunol. 16:1461.
8. Weissman, A., J. Harford, P. Svetlik, W. Leonard, J. Depper, T. Waldmann,
W. Greene, and R. Klausner. 1986. Only high-affinity receptors for interleukin 2
mediate internalization of ligand. Proc. Natl. Acad. Sci. USA 83:1463.
9. Hemar, A., A. Subtil, M. Lieb, E. Morelon, and R. Hellio. 1995. Endocytosis of
interleukin 2 receptors in human T lymphocytes: distinct intracellular localization
and fate of the receptor ␣, ␤, and ␥ chains. J. Cell Biol. 129:55.
10. Subtil, A., A. Hemar, and A. Dautry-Varsat. 1994. Rapid endocytosis of interleukin 2 receptors when clathrin-coated pit endocytosis is inhibited. J. Cell Sci.
107:3461.
11. Subtil, A., and A. Dautry-Varsat. 1997. Microtubule depolymerization inhibits
clathrin coated-pit internalization in non-adherent cell lines while interleukin 2
endocytosis is not affected. J. Cell Sci. 110:2441.
12. Mellman, I. 1996. Endocytosis and molecular sorting. Annu. Rev. Cell. Dev. Biol.
12:576.
13. Takeshita, T., H. Asao, K. Ohtani, N. Ishii, S. Kumaki, N. Tanaka, H. Munakata,
M. Nakamura, and K. Sugamura. 1992. Cloning of the ␥ chain of the human IL-2
receptor. Science 257:379.
14. Furse, R., and T. Malek. 1993. Selection of internalization-deficient cells by
interleukin-2-Pseudomonas exotoxin chimeric protein: the cytoplasmic domain
of the interleukin-2 receptor ␤ chain does not contribute to internalization of
interleukin-2. Eur. J. Immunol. 23:3181.
15. Kondo, S., M. Kinoshita, A. Shimizu, Y. Saito, M. Konishi, H. Sabe, and
T. Honjo. 1987. Expression and functional characterization of artifical mutants of
interleukin-2 receptor. Nature 327:64.
16. Malek, T. R., R. K. Furse, M. L. Fleming, A. J. Fadell, and Y.-W. He. 1995.
Biochemical identity and characterization of the mouse interleukin-2 receptor ␤
and ␥c subunits. J. Interferon Cytokine Res. 15:447.
17. He, Y.-W., B. Adkins, R. K. Furse, and T. R. Malek. 1995. Expression and
function of the ␥c subunit of the IL-2, IL-4, and IL-7 receptors: distinct interaction of ␥c in the IL-4 receptor. J. Immunol. 154:1596.
18. Nishio, M., and E. Podack. 1996. Rapid induction of tumor necrosis factor cytotoxicity in naive splenic T cells by simultaneous CD80 (B7.1) and CD54
(ICAM-1) co-stimulation. Eur. J. Immunol. 26:2160.
19. Zhou, Y.-J., E. Hanson, Y.-Q. Chen, K. Magnuson, M. Chen, P. Swann,
R. Wange, P. Changelian, and J. O’Shea. 1997. Distinct tryosine phosphorylation
sites in JAK3 kinase domain positively and negatively regulate its enzyme activity. Proc. Natl. Acad. Sci. USA 94:13850.
20. Lin, J.-X., J. Mietz, W. Modi, S. John, and W. Leonard. 1996. Cloning of human
Stat5B. J. Biol. Chem. 271:10738.
21. Muller, M., J. Briscoe, C. Laxton, D. Gushin, A. Ziemiecki, O. Silverennoinen,
A. Harper, G. Barbieri, B. Witthuhn, C. Schindler, et al. 1993. The protein tryosine kinase JAK1 complements defects in interferon-␣/␤ and -␥ signal transduction. Nature 366:129.
22. Ortega, R., G., R. Robb, E. Shevach, and T. Malek. 1984. The murine IL-2
receptor. I. Monoclonal antibodies that define distinct functional epitopes on activated T cells and react with activated B cells. J. Immunol. 133:1970.
23. Malek, T. R., R. J. Robb, and E. M. Shevach. 1983. Identification and initial
characterization of a rat monoclonal antibody reactive with the murine interleukin
2 receptor-ligand complex. Proc. Natl. Acad. Sci. USA 80:5694.
24. Saragovi, H., and T. Malek. 1987. The murine interleukin 2 receptor: irreversible
cross-linking of radiolabeled interleukin 2 to high affinity interleukin 2 receptors
reveals a noncovalently associated subunit. J. Immunol. 139:1918.
25. Wiley, H., and D. Cunningham. 1982. The endocytic rate constant: a cellular
parameter for quantitating receptor-mediated endocytosis. J. Biol. Chem.
257:4222.
26. Draznin, B., M. Trowbridge, and L. Ferguson. 1984. Quantitative studies of the
rate of insulin internalization in isolated rat hepatocytes. Biochem. J. 218:307.
27. Morelon, E., and A. Dautry-Varsat. 1998. Endocytosis of the common cytokine
receptor ␥c chain. J. Biol. Chem. 273:22044.
28. Noguchi, M., A. Sarin, M. J. Aman, H. Nakajima, E. W. Shores, P. A. Henkart,
and W. J. Leonard. 1997. Functional cleavage of the common cytokine receptor
␥ chain (␥c) by calpain. Proc. Natl. Acad. Sci. USA 94:11534.
29. Nelson, B. H., J. D. Lord, and P. D. Greenberg. 1996. A membrane-proximal
region of the interleukin-2 receptor ␥c chain sufficient for Jak kinase activation
and induction of proliferation in T cells. Mol. Cell. Biol. 16:309.
30. Hataketama, M., T. Kono, N. Kobayashi, A. Kawahara, S. Levin, R. Perlmutter,
and T. Taniguchi. 1991. Interaction of the IL-2 receptor with the src-family
kinase p56lck: identification of novel intermolecular association. Science 252:
1523.
31. Minami, Y., Y. Nakagawa, A. Kawahara, T. Miyazaki, K. Sada, H. Yamamura,
and T. Taniguchi. 1995. Protein tyrosine kinase Syk is associated with and activated by the IL-2 receptor: possible link with the c-myc induction pathway.
Immunity 2:89.
Downloaded from http://www.jimmunol.org/ by guest on July 31, 2017
endocytosis by these molecules. We also found that expression of
Jak3, either alone or with Jak1 and STAT5a, in IL-2R-bearing
COS7 did not increase the impaired IL-2 endocytosis by these
nonlymphoid cells. These findings further emphasize that Jak3 and
the Jak/STAT pathway are insufficient by themselves to target IL2/IL-2R for rapid endocytosis and indicate that Jak3 is not the key
lymphoid-specific component required for normal endocytosis of
IL-2. The requirement for tyrosine kinase activity for IL-2 endocytosis might be the result of an effect on intracellular signaling
independent of ␥c or Jak3, perhaps on some downstream signaling
molecule. Beside Jak1, the tyrosine kinases p56lck and Syk also
associate with the cytoplasmic tail of the IL-2R ␤-chain (30, 31).
It is highly unlikely that either of these tyrosine kinases are the
targets for genistein because we have previously shown that another variant of the EL4 thymoma normally internalizes IL-2 even
though their IL-2R consists of WT IL-2R␣ and ␥c, but a cytoplasmic tailless ␤-chain (14). Further studies are necessary to define
the signaling requirements for endocytosis of IL-2, including the
possible relationship to lymphocyte-specific components that control endocytosis of this cytokine.
IL-2R ␥c SUBUNIT IN ENDOCYTOSIS OF IL-2