Indian Journal of Biotechnology Vol 8, January 2009, pp 53-60 Down-regulation of an abiotic stress related Nicotiana benthamiana WRKY transcription factor induces physiological abnormalities K Archana, N Rama, H M Mamrutha and Karaba N Nataraja* Department of Crop Physiology, University of Agricultural Sciences, GKVK, Bangalore, India Received 24 December 2007 revised 31 July 2008; accepted 3 October 2008 Transcription factors (TFs), the DNA binding proteins, play key role in biotic and abiotic stress responses in plants by regulating the expression of downstream target genes. Many different TFs have been cloned and characterized in model plants and a few of them have been shown to have direct role in abiotic stress tolerance. In the present report, we have cloned a partial cDNA of AtWRKY75 like gene (NbWRKY) from the model plant, Nicotiana benthamiana, and studied its expression under whole plant desiccation (drought) stress. To induce drought stress, soil water status (field capacity, FC) was maintained between 60-65% by controlled irrigation and replacing water transpired twice a day. The extent of drought stress was assessed by monitoring the leaf water status and quantifying photosynthetic pigments. The semi-quantitative RT-PCR revealed constitutive expression of NbWRKY and up-regulation under drought. Down-regulation of NbWRKY by virus induced gene silencing (VIGS) produced chlorosis and senescing phenotype in N. benthamiana. The silenced plants showed reduced photosynthesis, efficiency of open PSII reaction centre, and exhibited the symptoms of photoinhibition. The results indicated the indispensable role of NbWRKY in basic physiological processes. Keywords: VIGS, transcription factor, WRKY, abiotic stress, gene silencing Introduction Plants have various adaptive strategies to acclimate to the changing environment1. Acclimation to diverse abiotic factors such as water stress, temperature fluctuations, etc., results from adjustments in physiological and biochemical processes upon exposure2-4. Under stressful environments, a cascade of responsive events are activated, which begin with stress perception and end with the synthesis of target proteins and associated products5,6. It has been demonstrated that the abiotic stresses regulate gene expression mostly at the transcriptional level7,8. Studies on the stress signaling pathways have identified several regulatory proteins including transcription factors (TFs). A large number of abiotic stress related TFs have been identified such as DREBs, ERF, Zinc finger, WRKY, MYB, HLH, bZIP, HD-Zip and NAC9-11. Amongst these, TFs, most studied ones are DREBs, which regulate the expression of drought stress related functional genes. Constitutive expression of DREB 1A resulted in acquired tolerance to drought and freezing9. Similarly, overexpression of Arabidopsis TF HARDY improved _________ *Author for correspondence: Te: 91-80-23636713; Fax: 91-80-23636713 E-mail: [email protected] water use efficiency in rice12. Although the recent discoveries identified different TFs associated with environmental stresses, knowledge on their relevance in drought, an important abiotic stress response is limited11. We have made an attempt to study the significance of a member of WRKY family TF under drought in model plant Nicotiana benthamiana. The WKRY TFs are unique to plants, belonging to different groups13,14. The WRKY proteins have been implicated in cellular defense against a variety of biotic and abiotic stresses including drought and NaCl stress15-19. Some of these TFs are induced during ripening and thought to be associated with abiotic stress conditions during ripening20, while a few others are involved in carbohydrate anabolism21. More than 50% of the WRKY proteins reported in Arabidopsis have been shown to respond to both biotic and abiotic stresses, and a few members have been directly linked to abiotic stress response in different plants13. WRKY38 has been shown to play a regulatory role in abiotic stress response in barley and OsWRKY24, −51, −71, and −72 are reported to be induced by stress hormone abscisic acid (AA)22,23. In order to examine the relevance of WRKY TF in abiotic stress, a partial length WRKY-like cDNA, (hereafter referred to as NbWRKY) was cloned from N. benthamiana. The NbWRKY studied in this report was upregulated under 54 INDIAN J BIOTECHNOL, JANUARY 2009 drought in N. benthamiana, and its down-regulation by post-transcriptional gene silencing induces abnormal physiological functions. Materials and Methods Plant Material and Imposition of Drought Stress at Whole Plant Level Nicotiana benthamiana plants were raised in pots by following plant growth and protection methods in greenhouse. Four-wk-old healthy plants were subjected to drought stress by withholding irrigation. Soil moisture status was monitored by gravimetry12 and water status was maintained at 60-65% of field capacity (FC) for 10 d. At the end of the treatment, leaf samples were collected from well irrigated and moisture stressed plants for analysis. Estimation of Plant Water Status To assess the drought stress effects, relative water content (RWC) was quantified by taking leaf discs from well irrigated and drought stressed plants24. Fresh leaf discs (10 discs in three replicates) were floated in water for 6 h after recording the fresh weight (FW) and allowed to gain full turgidity. Turgid weight (TW) of the discs was recorded and dried in oven (at 80°C for 4 d) to a constant weight to record dry weight (DW). The RWC was estimated and expressed in per cent using the formula: RWC = {(FW – DW)/(TW−DW)}*100. Estimation of Leaf Pigments Leaf chlorophyll content was quantified in both stressed and well-irrigated plants to assess the stress effects. About 100 mg fresh leaf tissue was incubated in a mixture of DMSO and 80% acetone (1:1 ratio) overnight under dark to extract the pigments25. To assess total chlorophyll pigment content, absorbance was read at 645 (A645) and 663 nm (A663) using spectrophotometer (UV-VIS, Simadzu, Japan). Total chlorophyll (mg G FW−1) was estimated using the formula: Total chlorophyll = {20.2(A645) + 8.02(A663)}*(V/1000*W) Cloning of WRKY-like Gene from N. benthamiana A WRKY gene from N. benthamiana was cloned by PCR using the gene sequence information of TC7932 obtained from TIGR N. benthamiana database (http://www.tigr.org). The gene specific primers were designed (between 817-838 and 12281249 bp of N. benthamiana WRKY, TC7932) with the help of DNA STAR software (www.dnastar.com). The 452 bp of WRKY gene fragment was amplified using oligonucleotide primers, 5′gttccatggatgatttggccgt3′ (forward) and 5′gttcacgtctcttggtgggaca3′ (reverse) from cDNA pool. The cDNA pool was generated by reverse transcription of total RNA isolated from drought stressed leaf tissue using Tri reagent (Sigma, USA). For total RNA isolation about 100 mg of leaf tissue was macerated in a mortar and pestle in liquid nitrogen, homogenized in 1 mL of triazol reagent (Sigma, USA) and incubated for 5 min. To the extraction mix 200 µL of chloroform was added and incubated for 2-3 min. The contents were then centrifuged at 12,000 rpm and the colourless aqueous was transferred into a fresh Eppendorf tube for precipitating RNA. The RNA was precipitated by adding 500 µL of isopropyl alcohol, washed with ethanol (75% v/v), air dried before dissolving the RNA pellet in 30 µL DEPC water and stored at −70°C until further use. For cDNA sysnthesis, about 5 µg of total RNA was reverse transcribed using 200 U molony murine leukemia virus reverse transcriptase (MMLV-RT) at 42°C for one h. Twenty six RNA samples were treated with RNAse free DNAse prior to reverse transcription (RT) reaction. The RT-reaction was primed with 2.5 µM Oligo (dT) 15 primer in the presence of 10 mM dNTPs mix in a total volume of 20 µL. The PCR was carried out using the cDNA in 20 µL reaction mixture containing 2 mM dNTPs, 25 mM MgCl2, 5 pmol of forward and reverse primers and 1U of Taq DNA polymerase (Bangalore Genie, India) under standardized conditions using PCR machine (Master Cycler Gradient, Eppendorf AG, Germany). The PCR cycling conditions comprised an initial denaturation at 94°C for 5 min, followed by 25 cycles of 94°C for 1 min, 61°C for 45s, 72°C for 1 min and a final extension of 20 min at 72°C. The PCR product was purified and cloned into T/A cloning vector (pTZ57R/T vector, MBI Fermentas). The ligation reaction was set to a total volume of 10 µL comprising pTZ5R/T vector (150 ng), purified PCR product (in the ratio of 3:1 - insert to vector ratio), 10X ligation buffer (1 µL), 10X PEG4000 (1 µL), T4DNA ligase enzyme (2 Units). The reaction was carried on at 16°C overnight and the reaction mixture was used for bacterial transformation. The ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY recombinant colony with the gene of interest was identified by colony PCR under standardized conditions and purified plasmid isolated from the recombinant clone was sequenced and annotated. The DNA sequence was analyzed by BLASTp (NCBI database, http://www.ncbi.nlm.nih.gov) and subjected for ClustalW analysis (http://www.ebi.ac.uk/ clustalw). Expression Studies by Semi-Quantitative RT-PCR Analysis Total RNA was isolated from the leaves of drought stressed and well-irrigated plants as mentioned above. The isolated RNA was quantified using microspectrophotometry (NanoDrop Technologies, USA) and 5 µg of total RNA was reverse transcribed using 200U MMLV RT at 42°C for 1 h26. The reaction was primed with 2.5 µM OligodT primers in the presence of 10 mM dNTPs mix in a total volume of 20 µL. Semi quantitative RT-PCR was performed using cDNA of control and drought stressed material to examine the expression pattern of NbWRKY gene27. For internal control, β-actin (250 bp fragment) was amplified from cDNA of control and drought stressed RNA using the oligonucleotide primers, 5′TCCATAATGAAGTGTGATGT3′ (forward) and 5′GGACCTGACTCGTCATACTC3′ (reverse). The PCR reaction had cDNA as template (100 ng), actin forward and reverse primers (3 µM), dNTPs (200 µM), Taq DNA polymerase buffer (1X), Taq DNA polymersase (1 unit). The cycling conditions comprised an initial denaturation at 94°C for 5min, followed by 25 cycles of 94°C for 1 min, 50°C for 45 s, 72°C for 1 min and a final extension of 8 min at 72°C. The NbWRKY and β-actin were amplified from 2 µL of cDNA using the gene specific primers. The PCR product was resolved on agarose (1.0%) gel and stained with ethidium bromide28. Silencing of NbWRKY in N. benthamiana Construction of pTRV2 Derivative and Agro-infiltration A 452 bp fragment of NbWRKY gene fragment released from T/A cloning (pTZ57R/T) vector was cloned into VIGS vector, pTRV2 as XbaI and BamHI fragment. pTRV2:PDS (VIGS vector) containing a fragment of phytoene desaturase (PDS) gene from N. benthamiana used for silencing experiments27. Infiltration of Agrobacterium cells (strain GV3101) carrying pTRV1 vectors and constructs derived from pTRV2 were cultured as described earlier28. For Agro infiltration, the cells were grown at 28°C in LB 55 medium with appropriate antibiotics for 24 h, harvested and suspended in the infiltration buffer (10 mM MES buffer, 200 µM acetosyringone, 10 mM MgCl2, glucose 1%, sucrose 2%) to a final absorbance of 0.8-0.9 at 600 nm. The cells in infiltration medium were incubated for 2 h with shaking at room temperature. The Agrobacterium cultures harboring pTRV1 and pTRV2 or its derivatives (pTRV2: WRKY; pTRV2: PDS) were mixed in 1:1 ratio and infiltrated into lower leaves of 4-leaf stage N. benthamiana plants using 1 mL needle-less syringe27. The Agrobacterium carrying pTRV2:PDS was used to silence the endogenous PDS gene, and treated as positive control in all the silencing experiments. Twenty infected plants were maintained under controlled environmental conditions28 for effective viral infection and systemic silencing, and observations were made 15-25 d of post-infiltration (dpi). Evaluation of Silenced Plants by Physiological Studies Semi-quantitative RT-PCR was performed28 using the cDNA synthesized from Agro-infiltrated and control N. benthamiana plants to examine the extent of down-regulation of targeted genes. The WRKY gene silenced or down regulated plants were tested for variations in physiological processes along with the control. Photosynthetic gas exchange was recorded using the portable photosynthetic system (LICOR 6400, USA)12,29, 20-25 dpi on young fully expanded leaves (above the infiltrated leaves). The measurements were made at an ambient CO2 concentration of 360 µmol.mol−1 and PPFD of 500-600 µmol.m−2.s−1 using LICOR light source and chamber temperature of 28°C±0.5. For recording the maximum quantum yield of PSII (Fv/Fm), intact leaf was dark-adapted for 30 min before the measurements. The relative quantum yield of PSII was calculated as Fv′/Fm′= (Fm′–Fo′)/Fm′, where Fo′ is the minimal fluorescence of light adapted leaf and Fm′ is the maximal fluorescence during saturating light12,30. Results and Discussion The WRKY genes are reported only in plants with many sub-families; 72 and 100 proteins are reported in Arabidopsis and rice, respectively10,31. Most WRKY proteins studied thus far have been implicated in regulating biotic stress responses and several of them play a role in the regulation of abiotic stress 56 INDIAN J BIOTECHNOL, JANUARY 2009 responses including Pi starvation32,33. Environmental stresses such as high temperature, drought and freezing induces some of the WRKY genes, which have either one or two WRKY domains for binding to the DNA sequence to activate target gene expression. Many of these stresses induce the production of reactive oxygen species (ROS), including H2O2, leading to oxidative stress34. Oxidative stress at the cellular level has been considered as the major cause of reduced plant productivity either under abiotic stress such as drought or biotic stress35. Publicly available transcriptome data sets of Arabidopsis generated under abiotic stress reveal that the H2O2 plays a key role in the transcriptional up-regulation of many stress responsive genes36. Recently it has been shown that the TF WRKY 75 is associated with H2O2 responses in plants37. From this background, in the present study, we examined the expression pattern of a WRKY-like gene (NbWRKY) in N. benthamiana under whole plant level drought stress. Assessing the Effect of Drought Stress at Whole Plant Level To examine the pattern of NbWRKY gene induction under drought, the stress was imposed at whole plant level by gravimetry38. The stress was imposed by controlled irrigation to maintain soil water status at 60-65% FC and water lost though transpiration was replaced twice a day. The drought stress was maintained for 10 d before harvesting the healthy tissue for analysis. The RWC estimated to assess the effect of drought stress on tissue water status, showed significant reduction from 81% in drought stressed to 72% in well irrigated plants (100% FC; Fig. 1a), suggesting that 60-65% FC induced the drought stress in N. benthamiana leaves. One of the common changes under drought is the change in total photosynthetic pigments39. The total chlorophyll content reduced from 1.99 in well irrigated to 1.45 mg.gFW−1 in stressed plants indicating stress induced damage (Fig. 1b). The reduction in leaf pigments is associated with oxidative stress, a secondary stress under drought35. The observations on pigment content and RWC indicated that the gravimetric approach could be used to impose the required level of drought in N. bethamiana. Isolation of NbWRKY from Drought Stressed N. benthamiana TIGR database search revealed that N. benthamiana EST, TC7932 (similar to UP|Q9FXS1, WRKY transcription factor NtEIG-D48) is having 72% nucleotide homology with the AtWRKY75, Fig. 1 — Effect of drought stress on relative water content (RWC in per cent, a) and total photosynthesis pigments (mg.g−1 fresh weight, b) in Nicotiana benthamiana leaf tissue. Drought stress imposed by controlled irrigation and leaf tissue analyzed 10 d after stress imposition. which is shown to be associated with abiotic stresses. The NbWRKY gene fragment (452 bp) showed more than 95% identity with TC7932 (TIGR, http://www.tigr.org/tigr-scripts/tgi/Tindex.cgi/species = N. benthamiana) indicating the successful cloning of gene of interest. The cloned fragment was also found to have high nucleotide homology (99%) with EST752098 (gi|39867814|gb|CK289376.1; http://www.ncbi.nlm.nih.gov) from N. benthamiana. The sequence information of the cloned gene has been deposited in the NCBI EST database (gi|110354649|gb|EC917355.1|DCP-NB2). The analysis of deduced amino acid sequence of the cloned gene fragment revealed WRKY amino acid residues with the features of group-IId of WRKY protein (Fig. 2). Examining the Expression Levels of NbWRKY Drought stress induces the expression of many stress responsive genes, including upstream regulatory genes11. Manipulation of upstream signaling cascade molecules like MAPKKK, NPK1 and phospholipase D can result in stress tolerance40,41. However, alterations of upstream molecules in the pathway might also activate much wider network of genes, sometimes other than those specific ones ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY 57 Fig. 2 — Comparison of deduced amino-acid sequence of the NbWRKY with other related proteins by ClustalW alignment (a). The highly conserved region designated as WRKY. Alignment shows comparison of NbWRKY with other WRKYs of group II. resulting in abnormal, unexpected phenotype. Hence, it is believed that TFs, which regulate the coordinated expression of many functional genes, are ideal for imparting stress tolerance. The TF, NbWRKY examined in this study showed increased expression under drought stress in N benthamiana. The semiquantitative RT-PCR results indicated up-regulation of NbWRKY under drought stress (Fig. 3) and there is no direct evidence on the involvement of this TF in drought stress so far. The gene is constitutively expressed in N. benthamiana, and the gene expression level increases under stress suggesting that the gene is having functional significance under drought. Induction of WRKY types of TFs has been recently reported in Arabidopsis roots subjected to NaCl stress19. Similarly, the gene seems to be up regulated under salinity stress when leaf discs were floated in NaCl (150 mM) solution under laboratory conditions Fig. 3 — Expression pattern of NbWRKY under well irrigated condition and different intervals of drought stress. Drought stress imposed by controlled irrigation and leaf tissue analyzed for the pattern of gene expression by semi-quantitative RT-PCR. 1, 2 and 3 are the tissues collected from control (well irrigated), 5th and 8th d of drought stress, respectively. (data not shown). We believe that the NbWRKY an abiotic stress responsive TF is having significance in stress acclimation or tolerance and hence attempt was made to down regulate the gene expression by posttranscriptional gene silencing. 58 INDIAN J BIOTECHNOL, JANUARY 2009 Silencing of NbWRKY in N. benthamiana In an earlier study, using PDS gene as marker, we have standardized the environmental conditions required for silencing in N. benthamiana for tobacco rattle virus based VIGS vectors27. Silencing of endogenous NbWRKY in N. benthamiana was induced in four-leaf stage plants under standardized condition. Similar to the earlier studies26,27, photobleached symptoms were noticed in PDS silenced plants 10 dpi and the symptom persisted more than 35 d. Under similar environmental conditions, NbWRKY was down regulated and the extent of silencing was assessed by semi-quantitative RT-PCR (Fig. 4b). Down-regulation of NbWRKY by PTGS induced chlorosis and senescing phenotype under well-irrigated controlled conditions (Fig. 4a). In silenced plants, there was significant reduction in the total chlorophyll content, which is common during leaf senescence (Fig. 5a). As expected there was Fig. 4 — (a) Comparison of phenotypes of NbWRKY gene silenced plants with control (uninfected), mock inoculated and PDS gene silenced plants of N. benthamiana. A, B & C are uninoculated control, mock inoculated, and PDS gene silenced plants respectively. D, E & F are the NbWRKY silenced plants. (b) Semi-quantitative RT-PCR showing down-regulation of WRKY gene in N. benthamiana 20 d post infiltration. 1, 2 & 3 uninoculated control, mock inoculated, and PDS gene silenced plants respectively, 4 & 5 NbWRKY silenced plants. significant reduction in the photosynthesis in NbWRKY silenced plants when gas exchange measurements were made 20 dpi at photon flux densities of 500 µmol.m−2.s−1 (Fig. 5b). The silenced plants also showed significant reduction in the efficiency of open PSII reaction centre as evidenced by reduced Fv’/Fm’ (Fig. 5d). This was due to the damage to PSII reaction centre as there was reduction in maximal yield of PSII photochemistry (Fv/Fm) in dark-adapted leaves (Fig. 5c). The mean Fv/Fm value in silenced plants was 0.69, which indicates damage to the PSII reaction centre. These observations on the silenced plants suggest that the gene is essential for basic physiological functions, and its silencing can have lethal effects. Fig. 5 — Characterization of NbWRKY silenced plants of N. benthamiana (20 d post infiltration). (a) — total leaf chlorophyll (mg/g fresh weight); b — Photosynthesis (µmol.m−2.s−1), (c) — Maximal PSII reaction centre efficiency, (d) — Efficiency of PSII reaction centre under light adapted state. ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY In the present study, we demonstrated that NbWRKY, a NtEIG-D48 homolog (WERKY-like gene), is up-regulated under drought stress in N. benthamiana. Down-regulation of endogenous gene induces physiological abnormalities suggesting its relevance in basic plant metabolic processes. Since the TF is constitutively expressed, the gene might be having different targets (functional genes) controlling basic physiological functions. Acknowledgement TRV-based silencing vectors (pTRV1 and pTRV2) were kindly provided by Dr Dinesh Kumar, MCBD, Yale University, USA. This work was partially supported by CSIR (Grant No.38 (1074)/03/EMRII), and DBT, Govt. of India. We wish to thank Ms Nethra P and Ms Anitha Kumari for their help during the experiments. We also wish to thank Dr M Udaya Kumar for useful discussion and Dr G Ramamohan for critical reading of the manuscript. References 1 Thomashow M F, Plant cold acclimation: Freezing tolerance genes and regulatory mechanisms, Plant Mol Biol, 50 (1999) 571-599. 2 Pastori G M & Foyer C H, Common components, networks, and pathways of cross-tolerance to stress: The central role of ‘redox’ and abscisic acid-mediated controls, Plant Physiol, 129 (2002) 7460-7468. 3 Kang J, Choi H I M & Kim S Y, Arabidopsis basic leucine zipper proteins that mediate stress responsive abscisic acid signaling, Plant Cell, 14 (2002) 343-357. 4 Chinnusamy V, Schumaker K & Zhu J K, Molecular and genetic perspective on cross-talk and specificity in abiotic stress signaling in plants, J Exp Bot, 55 (2004) 225-236. 5 Bray E A, Plant responses to water deficit, Trends Plant Sci, 2 (1997) 48-54. 6 Ingram D & Bartles, The molecular basis of dehydration tolerance in plants, Ann Rev Plant Physiol Plant Mol Biol, 42 (1996) 377-403. 7 Shinozaki K, Kazuko Y S & Seki M, Regulatory network of gene expression in the drought and cold stress responses, Curr Opin Plant Biol, 6 (2003) 410-414. 8 Hwang W S, Roh S, Lee B C, Kang S, Kwon G, et al, Plantspecific embryonic stem cells derived from human SCNT blastocysts, Science, 308 (2005) 1777-1783. 9 Liu Q, Karuga M, Sakuma Y, Abe S, Miura S et al, Two transcription factors DREB 1 and DREB 2 with an AP2 DNA binding domain separates two cellular transduction pathways in drought and low temperature response gene expression, Plant Cell, 13 (1998) 99-106. 10 Qu L J & Zhu Y X, Transcription factor families in Arabidopsis: Major progress and outstanding issues for future research, Curr Opin Plant Biol, 9 (2006) 544-549. 11 Agarwal P K, Agarwal P, Reddy M K & Sopory S K, Role of DREB transcription factors in abiotic and biotic stress tolerance in plants, Plant Cell Rep, 25 (2006) 1263-1274. 59 12 Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko K R et al, Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene, Proc Natl Acad Sci USA, 104(2007) 15270-15275. 13 Kalde M, Barth M, Somssich I E & Lippok B, Member of Arabidopsis WRKY group transcription factors are part of different plant defense signaling pathways, Mol Plant Microbe Interact, 16 (2003) 295-305. 14 Eulgem T, Rushton P J, Robatzek S & Somssich I E, The WRKY superfamily of plant transcription factors, Trends Plant Sci, 5 (2000) 199-206. 15 Rushton P J & Somssich I E, Transcriptional control of plant genes responsive to pathogens, Curr Opin Plant Biol, 1 (1998) 311-315. 16 Chen W, Provatt N J, Glazebrook J, Katagiri F, Chang H S, et al, Expression profile matrix of Arabidopsis transcription factor genes suggests their putative function in response to environmental stresses, Plant Cell, 14 (2002) 559-574. 17 Robatzek S & Somssich I E, Targets of AtWRKY 6 regulation during plant senescence and pathogen defense, Genes Dev, 16 (2002) 1139-1149. 18 Rizhsky L, Liang H & Mittler R, The combined effect of drought stress and heat shock on gene expression in tobacco, Plant Physiol, 130 (2002) 1143-1151. 19 Jiang Y & Deyholos M K, Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes, BMC Plant Biol, 12 (2006) 5-6. 20 Terrier N, Glissant D, Grimplet J, Barrieu F, Abbal P, et al, Isogene specific oligo arrays reveal multifaceted changes in gene expression during grape berry (Vitis vinifera L.) development, Planta, 222 (2005) 832-847. 21 Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, et al, A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the iso1 promoter, Plant Cell, 15 (2003) 2076-2092. 22 Mare C, Mazzucotelli E, Crosatti C, Francia E, Stanca A M et al, Hv-WRKY38: A new transcription factor involved in cold- and drought-response in barley, Plant Mol Biol, 55 (2004) 399-416. 23 Xie Z, Zhang Z L, Zou X, Huang J, Ruas P et al, Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells, Plant Physiol, 137 (2005) 176-189. 24 Flower D J & Ludlow M M, Contribution of osmotic adjustment to the dehydration tolerance of water stressed pigeon pea [Cajanus cajan (L.) Millsp] leaves, Plant Cell Environ, 9 (1986) 33-40. 25 Hiscox J D & Israelstam G F, A method for the extraction of chlorophyll from leaf tissues without maceration, Can J Bot, 57 (1979) 1332-1334. 26 Kotewicz M L, Sampson C M, Alessio J M D & Gerard G F, Isolation of cloned Moloney murine leukemia virus reverse transcriptase lacking ribonuclease H activity, Nucleic Acids Res, 16 (1988) 265-277. 27 Liu Y, Schiff M, Marathe R & Dinesh-Kumar S P, Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N mediated resistance to tobacco mosaic virus, Plant J, 30 (2002) 415-429. 60 INDIAN J BIOTECHNOL, JANUARY 2009 28 Nethra P, Nataraja K N, Rama N & Udayakumar M, Standardization of environmental conditions for induction and retention of post transcriptional gene silencing using tobacco rattle virus vector, Curr Sci, 90 (2006) 431-434. 29 Nataraja K N & Jacob J, Clonal differences in photosynthesis in Havea brasiliensis, Mull.-Arg., Photosynthetica, 36 (1999) 89-98. 30 Genty E, Brazier J L, Lesca P & Riviere J L, Absence of an isotope effect in induction of cytochrome P-450 and xenobiotic metabolizing enzyme activities by stable isotopelabelled phenobarbital isotopomers, Biochem Pharmacol, 38 (1989) 3885-3887. 31 Xiong Y, Liu T, Tian C, Sun S, Li J et al, Transcription factors in rice: A genome-wide comparative analysis between monocots and eudicots, Plant Mol Biol, 59 (2005) 191-203. 32 Asai T, Tena G, Plotnikova J, Willmann M R, Chiu W L, et al, MAP kinase signaling cascade in Arabidopsis innate immunity, Nature (Lond), 415 (2002 ) 977-983. 33 Devaiah B N, Karthikeyan A S & Raghothama K G, WRKY75 Transcription factor Is a modulator of phosphate acquisition and root development in Arabidopsis, Plant Physiol, 143 (2007) 1789-1801. 34 Xiong Y, Contento A L, Nguyen P Q & Bassham D C, Degradation of oxidized proteins by autophagy during oxidative stress in Arabidopsis, Plant Physiol, 143(2006) 291-299. 35 Allen R D, Dissection of oxidative stress tolerance using transgenic plants, Plant Physiol, 107 (1995) 1049-1054. 36 Vanderauwera S, Zimmermann P, Rombauts S, Vandenabeele S, Langebartels C, et al, Genome-wide analysis of hydrogen peroxide-regulated gene expression in Arabidopsis reveals a high light-induced transcriptional cluster involved in anthocyanin biosynthesis, Plant Physiol, 139 (2005) 806-821. 37 Gechev T S, Minkov I N & Hille J, Hydrogen peroxideinduced cell death in Arabidopsis: Transcriptional and mutant analysis reveals a role of an oxoglutarate-dependent dioxygenase gene in the cell death process, IUBMB Life, 57 (2005) 181-188. 38 Impa S M, Nadarajan S, Boominathan P, Shashidhar G, Bindumadhava H et al, Carbon isotope discrimination accurately reflects variability in WUE measured at a whole plant level in rice, Crop Sci, 45 (2005), 2517- 2522. 39 Ratnayaka H H, Molin W T & Sterling T M, Physiological and antioxidant responses of cotton and spurred anoda under interference and mild drought, J Exp Bot, 54 (2003) 2293-2305. 40 Kovtun Y, Chiu W L, Tena G & Sheen J, Functional analysis of oxidative stress activated mitogen-activated protein kinase cascade in plants, Proc Natl Acad Sci USA, 97 (2000) 2940-2945. 41 Wang J, Rossow W B & Zhang Y C, Abiotic resistance and chaperones: Possible physiological role of phosphlipase D, Proc Natl Acad Sci USA, 13 (2000) 3041-3056.
© Copyright 2026 Paperzz