Indian Journal of Biotechnology
Vol 8, January 2009, pp 53-60
Down-regulation of an abiotic stress related Nicotiana benthamiana WRKY
transcription factor induces physiological abnormalities
K Archana, N Rama, H M Mamrutha and Karaba N Nataraja*
Department of Crop Physiology, University of Agricultural Sciences, GKVK, Bangalore, India
Received 24 December 2007 revised 31 July 2008; accepted 3 October 2008
Transcription factors (TFs), the DNA binding proteins, play key role in biotic and abiotic stress responses in plants by
regulating the expression of downstream target genes. Many different TFs have been cloned and characterized in model
plants and a few of them have been shown to have direct role in abiotic stress tolerance. In the present report, we have
cloned a partial cDNA of AtWRKY75 like gene (NbWRKY) from the model plant, Nicotiana benthamiana, and studied its
expression under whole plant desiccation (drought) stress. To induce drought stress, soil water status (field capacity, FC)
was maintained between 60-65% by controlled irrigation and replacing water transpired twice a day. The extent of drought
stress was assessed by monitoring the leaf water status and quantifying photosynthetic pigments. The semi-quantitative
RT-PCR revealed constitutive expression of NbWRKY and up-regulation under drought. Down-regulation of NbWRKY by
virus induced gene silencing (VIGS) produced chlorosis and senescing phenotype in N. benthamiana. The silenced plants
showed reduced photosynthesis, efficiency of open PSII reaction centre, and exhibited the symptoms of photoinhibition. The
results indicated the indispensable role of NbWRKY in basic physiological processes.
Keywords: VIGS, transcription factor, WRKY, abiotic stress, gene silencing
Introduction
Plants have various adaptive strategies to acclimate
to the changing environment1. Acclimation to diverse
abiotic factors such as water stress, temperature
fluctuations, etc., results from adjustments in
physiological and biochemical processes upon
exposure2-4. Under stressful environments, a cascade
of responsive events are activated, which begin with
stress perception and end with the synthesis of target
proteins and associated products5,6. It has been
demonstrated that the abiotic stresses regulate gene
expression mostly at the transcriptional level7,8.
Studies on the stress signaling pathways have
identified several regulatory proteins including
transcription factors (TFs). A large number of abiotic
stress related TFs have been identified such as
DREBs, ERF, Zinc finger, WRKY, MYB, HLH, bZIP, HD-Zip and NAC9-11. Amongst these, TFs, most
studied ones are DREBs, which regulate the
expression of drought stress related functional genes.
Constitutive expression of DREB 1A resulted in
acquired tolerance to drought and freezing9. Similarly,
overexpression of Arabidopsis TF HARDY improved
_________
*Author for correspondence:
Te: 91-80-23636713; Fax: 91-80-23636713
E-mail: [email protected]
water use efficiency in rice12. Although the recent
discoveries identified different TFs associated with
environmental stresses, knowledge on their relevance
in drought, an important abiotic stress response is
limited11. We have made an attempt to study the
significance of a member of WRKY family TF under
drought in model plant Nicotiana benthamiana.
The WKRY TFs are unique to plants, belonging to
different groups13,14. The WRKY proteins have been
implicated in cellular defense against a variety of
biotic and abiotic stresses including drought and NaCl
stress15-19. Some of these TFs are induced during
ripening and thought to be associated with abiotic
stress conditions during ripening20, while a few others
are involved in carbohydrate anabolism21. More than
50% of the WRKY proteins reported in Arabidopsis
have been shown to respond to both biotic and abiotic
stresses, and a few members have been directly linked
to abiotic stress response in different plants13.
WRKY38 has been shown to play a regulatory role in
abiotic stress response in barley and OsWRKY24,
−51, −71, and −72 are reported to be induced by stress
hormone abscisic acid (AA)22,23. In order to examine
the relevance of WRKY TF in abiotic stress, a partial
length WRKY-like cDNA, (hereafter referred to as
NbWRKY) was cloned from N. benthamiana. The
NbWRKY studied in this report was upregulated under
54
INDIAN J BIOTECHNOL, JANUARY 2009
drought in N. benthamiana, and its down-regulation
by post-transcriptional gene silencing induces
abnormal physiological functions.
Materials and Methods
Plant Material and Imposition of Drought Stress at Whole
Plant Level
Nicotiana benthamiana plants were raised in pots
by following plant growth and protection methods in
greenhouse. Four-wk-old healthy plants were
subjected to drought stress by withholding irrigation.
Soil moisture status was monitored by gravimetry12
and water status was maintained at 60-65% of field
capacity (FC) for 10 d. At the end of the treatment,
leaf samples were collected from well irrigated and
moisture stressed plants for analysis.
Estimation of Plant Water Status
To assess the drought stress effects, relative water
content (RWC) was quantified by taking leaf discs
from well irrigated and drought stressed plants24.
Fresh leaf discs (10 discs in three replicates) were
floated in water for 6 h after recording the fresh
weight (FW) and allowed to gain full turgidity. Turgid
weight (TW) of the discs was recorded and dried in
oven (at 80°C for 4 d) to a constant weight to record
dry weight (DW). The RWC was estimated and
expressed in per cent using the formula:
RWC = {(FW – DW)/(TW−DW)}*100.
Estimation of Leaf Pigments
Leaf chlorophyll content was quantified in both
stressed and well-irrigated plants to assess the stress
effects. About 100 mg fresh leaf tissue was incubated
in a mixture of DMSO and 80% acetone (1:1 ratio)
overnight under dark to extract the pigments25. To
assess total chlorophyll pigment content, absorbance
was read at 645 (A645) and 663 nm (A663) using
spectrophotometer (UV-VIS, Simadzu, Japan). Total
chlorophyll (mg G FW−1) was estimated using the
formula:
Total chlorophyll = {20.2(A645) +
8.02(A663)}*(V/1000*W)
Cloning of WRKY-like Gene from N. benthamiana
A WRKY gene from N. benthamiana was cloned
by PCR using the gene sequence information of
TC7932 obtained from TIGR N. benthamiana
database (http://www.tigr.org). The gene specific
primers were designed (between 817-838 and 12281249 bp of N. benthamiana WRKY, TC7932) with the
help of DNA STAR software (www.dnastar.com).
The 452 bp of WRKY gene fragment was amplified
using oligonucleotide primers, 5′gttccatggatgatttggccgt3′
(forward) and 5′gttcacgtctcttggtgggaca3′ (reverse)
from cDNA pool. The cDNA pool was generated by
reverse transcription of total RNA isolated from
drought stressed leaf tissue using Tri reagent (Sigma,
USA). For total RNA isolation about 100 mg of leaf
tissue was macerated in a mortar and pestle in liquid
nitrogen, homogenized in 1 mL of triazol reagent
(Sigma, USA) and incubated for 5 min. To the
extraction mix 200 µL of chloroform was added and
incubated for 2-3 min. The contents were then
centrifuged at 12,000 rpm and the colourless aqueous
was transferred into a fresh Eppendorf tube for
precipitating RNA. The RNA was precipitated by
adding 500 µL of isopropyl alcohol, washed with
ethanol (75% v/v), air dried before dissolving the
RNA pellet in 30 µL DEPC water and stored at −70°C
until further use.
For cDNA sysnthesis, about 5 µg of total RNA was
reverse transcribed using 200 U molony murine
leukemia virus reverse transcriptase (MMLV-RT) at
42°C for one h. Twenty six RNA samples were
treated with RNAse free DNAse prior to reverse
transcription (RT) reaction. The RT-reaction was
primed with 2.5 µM Oligo (dT) 15 primer in the
presence of 10 mM dNTPs mix in a total volume of
20 µL. The PCR was carried out using the cDNA in
20 µL reaction mixture containing 2 mM dNTPs,
25 mM MgCl2, 5 pmol of forward and reverse primers
and 1U of Taq DNA polymerase (Bangalore Genie,
India) under standardized conditions using PCR
machine (Master Cycler Gradient, Eppendorf AG,
Germany). The PCR cycling conditions comprised an
initial denaturation at 94°C for 5 min, followed by 25
cycles of 94°C for 1 min, 61°C for 45s, 72°C for
1 min and a final extension of 20 min at 72°C. The
PCR product was purified and cloned into T/A
cloning vector (pTZ57R/T vector, MBI Fermentas).
The ligation reaction was set to a total volume of
10 µL comprising pTZ5R/T vector (150 ng), purified
PCR product (in the ratio of 3:1 - insert to vector
ratio), 10X ligation buffer (1 µL), 10X PEG4000
(1 µL), T4DNA ligase enzyme (2 Units). The reaction
was carried on at 16°C overnight and the reaction
mixture was used for bacterial transformation. The
ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY
recombinant colony with the gene of interest was
identified by colony PCR under standardized
conditions and purified plasmid isolated from the
recombinant clone was sequenced and annotated. The
DNA sequence was analyzed by BLASTp (NCBI
database, http://www.ncbi.nlm.nih.gov) and subjected
for
ClustalW
analysis
(http://www.ebi.ac.uk/
clustalw).
Expression Studies by Semi-Quantitative RT-PCR Analysis
Total RNA was isolated from the leaves of drought
stressed and well-irrigated plants as mentioned above.
The isolated RNA was quantified using microspectrophotometry (NanoDrop Technologies, USA)
and 5 µg of total RNA was reverse transcribed using
200U MMLV RT at 42°C for 1 h26. The reaction was
primed with 2.5 µM OligodT primers in the presence
of 10 mM dNTPs mix in a total volume of 20 µL.
Semi quantitative RT-PCR was performed using
cDNA of control and drought stressed material to
examine the expression pattern of NbWRKY gene27.
For internal control, β-actin (250 bp fragment) was
amplified from cDNA of control and drought stressed
RNA
using
the
oligonucleotide
primers,
5′TCCATAATGAAGTGTGATGT3′ (forward) and
5′GGACCTGACTCGTCATACTC3′ (reverse). The
PCR reaction had cDNA as template (100 ng), actin
forward and reverse primers (3 µM), dNTPs (200
µM), Taq DNA polymerase buffer (1X), Taq DNA
polymersase (1 unit). The cycling conditions
comprised an initial denaturation at 94°C for 5min,
followed by 25 cycles of 94°C for 1 min, 50°C for
45 s, 72°C for 1 min and a final extension of 8 min at
72°C. The NbWRKY and β-actin were amplified from
2 µL of cDNA using the gene specific primers. The
PCR product was resolved on agarose (1.0%) gel and
stained with ethidium bromide28.
Silencing of NbWRKY in N. benthamiana
Construction of pTRV2 Derivative and Agro-infiltration
A 452 bp fragment of NbWRKY gene fragment
released from T/A cloning (pTZ57R/T) vector was
cloned into VIGS vector, pTRV2 as XbaI and BamHI
fragment. pTRV2:PDS (VIGS vector) containing a
fragment of phytoene desaturase (PDS) gene from N.
benthamiana used for silencing experiments27.
Infiltration of Agrobacterium cells (strain GV3101)
carrying pTRV1 vectors and constructs derived from
pTRV2 were cultured as described earlier28. For Agro
infiltration, the cells were grown at 28°C in LB
55
medium with appropriate antibiotics for 24 h,
harvested and suspended in the infiltration buffer
(10 mM MES buffer, 200 µM acetosyringone, 10 mM
MgCl2, glucose 1%, sucrose 2%) to a final absorbance
of 0.8-0.9 at 600 nm. The cells in infiltration medium
were incubated for 2 h with shaking at room
temperature. The Agrobacterium cultures harboring
pTRV1 and pTRV2 or its derivatives (pTRV2:
WRKY; pTRV2: PDS) were mixed in 1:1 ratio
and infiltrated into lower leaves of 4-leaf stage
N. benthamiana plants using 1 mL needle-less
syringe27. The Agrobacterium carrying pTRV2:PDS
was used to silence the endogenous PDS gene, and
treated as positive control in all the silencing
experiments. Twenty infected plants were maintained
under controlled environmental conditions28 for
effective viral infection and systemic silencing, and
observations were made 15-25 d of post-infiltration
(dpi).
Evaluation of Silenced Plants by Physiological Studies
Semi-quantitative RT-PCR was performed28 using
the cDNA synthesized from Agro-infiltrated and
control N. benthamiana plants to examine the extent
of down-regulation of targeted genes. The WRKY
gene silenced or down regulated plants were tested for
variations in physiological processes along with the
control. Photosynthetic gas exchange was recorded
using the portable photosynthetic system (LICOR
6400, USA)12,29, 20-25 dpi on young fully expanded
leaves (above the infiltrated leaves). The
measurements were made at an ambient CO2
concentration of 360 µmol.mol−1 and PPFD of
500-600 µmol.m−2.s−1 using LICOR light source and
chamber temperature of 28°C±0.5. For recording the
maximum quantum yield of PSII (Fv/Fm), intact leaf
was dark-adapted for 30 min before the
measurements. The relative quantum yield of PSII
was calculated as Fv′/Fm′= (Fm′–Fo′)/Fm′, where Fo′
is the minimal fluorescence of light adapted leaf and
Fm′ is the maximal fluorescence during saturating
light12,30.
Results and Discussion
The WRKY genes are reported only in plants with
many sub-families; 72 and 100 proteins are reported
in Arabidopsis and rice, respectively10,31. Most
WRKY proteins studied thus far have been implicated
in regulating biotic stress responses and several of
them play a role in the regulation of abiotic stress
56
INDIAN J BIOTECHNOL, JANUARY 2009
responses including Pi starvation32,33. Environmental
stresses such as high temperature, drought and
freezing induces some of the WRKY genes, which
have either one or two WRKY domains for binding to
the DNA sequence to activate target gene expression.
Many of these stresses induce the production of
reactive oxygen species (ROS), including H2O2,
leading to oxidative stress34. Oxidative stress at the
cellular level has been considered as the major cause
of reduced plant productivity either under abiotic
stress such as drought or biotic stress35. Publicly
available transcriptome data sets of Arabidopsis
generated under abiotic stress reveal that the H2O2
plays a key role in the transcriptional up-regulation of
many stress responsive genes36. Recently it has been
shown that the TF WRKY 75 is associated with H2O2
responses in plants37. From this background, in the
present study, we examined the expression pattern of
a WRKY-like gene (NbWRKY) in N. benthamiana
under whole plant level drought stress.
Assessing the Effect of Drought Stress at Whole Plant Level
To examine the pattern of NbWRKY gene induction
under drought, the stress was imposed at whole plant
level by gravimetry38. The stress was imposed by
controlled irrigation to maintain soil water status at
60-65% FC and water lost though transpiration was
replaced twice a day. The drought stress was
maintained for 10 d before harvesting the healthy
tissue for analysis. The RWC estimated to assess the
effect of drought stress on tissue water status, showed
significant reduction from 81% in drought stressed to
72% in well irrigated plants (100% FC; Fig. 1a),
suggesting that 60-65% FC induced the drought stress
in N. benthamiana leaves. One of the common
changes under drought is the change in total
photosynthetic pigments39. The total chlorophyll
content reduced from 1.99 in well irrigated to
1.45 mg.gFW−1 in stressed plants indicating stress
induced damage (Fig. 1b). The reduction in leaf
pigments is associated with oxidative stress, a
secondary stress under drought35. The observations on
pigment content and RWC indicated that the
gravimetric approach could be used to impose the
required level of drought in N. bethamiana.
Isolation of NbWRKY from Drought Stressed N. benthamiana
TIGR database search revealed that N.
benthamiana EST, TC7932 (similar to UP|Q9FXS1,
WRKY transcription factor NtEIG-D48) is having
72% nucleotide homology with the AtWRKY75,
Fig. 1 — Effect of drought stress on relative water content (RWC
in per cent, a) and total photosynthesis pigments (mg.g−1 fresh
weight, b) in Nicotiana benthamiana leaf tissue. Drought stress
imposed by controlled irrigation and leaf tissue analyzed 10 d
after stress imposition.
which is shown to be associated with abiotic stresses.
The NbWRKY gene fragment (452 bp) showed more
than 95% identity with TC7932 (TIGR,
http://www.tigr.org/tigr-scripts/tgi/Tindex.cgi/species
= N. benthamiana) indicating the successful cloning
of gene of interest. The cloned fragment was also
found to have high nucleotide homology (99%)
with
EST752098
(gi|39867814|gb|CK289376.1;
http://www.ncbi.nlm.nih.gov) from N. benthamiana.
The sequence information of the cloned gene has been
deposited
in
the
NCBI
EST
database
(gi|110354649|gb|EC917355.1|DCP-NB2).
The
analysis of deduced amino acid sequence of the
cloned gene fragment revealed WRKY amino acid
residues with the features of group-IId of WRKY
protein (Fig. 2).
Examining the Expression Levels of NbWRKY
Drought stress induces the expression of many
stress responsive genes, including upstream
regulatory genes11. Manipulation of upstream
signaling cascade molecules like MAPKKK, NPK1
and phospholipase D can result in stress tolerance40,41.
However, alterations of upstream molecules in the
pathway might also activate much wider network of
genes, sometimes other than those specific ones
ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY
57
Fig. 2 — Comparison of deduced amino-acid sequence of the NbWRKY with other related proteins by ClustalW alignment (a). The
highly conserved region designated as WRKY. Alignment shows comparison of NbWRKY with other WRKYs of group II.
resulting in abnormal, unexpected phenotype. Hence,
it is believed that TFs, which regulate the coordinated
expression of many functional genes, are ideal for
imparting stress tolerance. The TF, NbWRKY
examined in this study showed increased expression
under drought stress in N benthamiana. The semiquantitative RT-PCR results indicated up-regulation
of NbWRKY under drought stress (Fig. 3) and there is
no direct evidence on the involvement of this TF in
drought stress so far. The gene is constitutively
expressed in N. benthamiana, and the gene expression
level increases under stress suggesting that the gene is
having functional significance under drought.
Induction of WRKY types of TFs has been recently
reported in Arabidopsis roots subjected to NaCl
stress19. Similarly, the gene seems to be up regulated
under salinity stress when leaf discs were floated in
NaCl (150 mM) solution under laboratory conditions
Fig. 3 — Expression pattern of NbWRKY under well irrigated
condition and different intervals of drought stress. Drought stress
imposed by controlled irrigation and leaf tissue analyzed for the
pattern of gene expression by semi-quantitative RT-PCR. 1, 2 and
3 are the tissues collected from control (well irrigated), 5th and
8th d of drought stress, respectively.
(data not shown). We believe that the NbWRKY an
abiotic stress responsive TF is having significance in
stress acclimation or tolerance and hence attempt was
made to down regulate the gene expression by posttranscriptional gene silencing.
58
INDIAN J BIOTECHNOL, JANUARY 2009
Silencing of NbWRKY in N. benthamiana
In an earlier study, using PDS gene as marker, we
have standardized the environmental conditions
required for silencing in N. benthamiana for tobacco
rattle virus based VIGS vectors27. Silencing of
endogenous NbWRKY in N. benthamiana was
induced in four-leaf stage plants under standardized
condition. Similar to the earlier studies26,27,
photobleached symptoms were noticed in PDS
silenced plants 10 dpi and the symptom persisted
more than 35 d. Under similar environmental
conditions, NbWRKY was down regulated and the
extent of silencing was assessed by semi-quantitative
RT-PCR (Fig. 4b). Down-regulation of NbWRKY by
PTGS induced chlorosis and senescing phenotype
under well-irrigated controlled conditions (Fig. 4a). In
silenced plants, there was significant reduction in the
total chlorophyll content, which is common during
leaf senescence (Fig. 5a). As expected there was
Fig. 4 — (a) Comparison of phenotypes of NbWRKY gene
silenced plants with control (uninfected), mock inoculated and
PDS gene silenced plants of N. benthamiana. A, B & C are uninoculated control, mock inoculated, and PDS gene silenced
plants respectively. D, E & F are the NbWRKY silenced plants.
(b) Semi-quantitative RT-PCR showing down-regulation of
WRKY gene in N. benthamiana 20 d post infiltration. 1, 2 & 3 uninoculated control, mock inoculated, and PDS gene silenced
plants respectively, 4 & 5 NbWRKY silenced plants.
significant reduction in the photosynthesis in
NbWRKY silenced plants when gas exchange
measurements were made 20 dpi at photon flux
densities of 500 µmol.m−2.s−1 (Fig. 5b). The silenced
plants also showed significant reduction in the
efficiency of open PSII reaction centre as evidenced
by reduced Fv’/Fm’ (Fig. 5d). This was due to the
damage to PSII reaction centre as there was reduction
in maximal yield of PSII photochemistry (Fv/Fm) in
dark-adapted leaves (Fig. 5c). The mean Fv/Fm value
in silenced plants was 0.69, which indicates damage
to the PSII reaction centre. These observations on the
silenced plants suggest that the gene is essential for
basic physiological functions, and its silencing can
have lethal effects.
Fig. 5 — Characterization of NbWRKY silenced plants of
N. benthamiana (20 d post infiltration). (a) — total leaf
chlorophyll
(mg/g
fresh
weight);
b — Photosynthesis
(µmol.m−2.s−1), (c) — Maximal PSII reaction centre efficiency,
(d) — Efficiency of PSII reaction centre under light adapted state.
ARCHANA et al: TRANSCRIPTION FACTOR NbWRKY AFFECTS PLANT PHYSIOLOGY
In the present study, we demonstrated that
NbWRKY, a NtEIG-D48 homolog (WERKY-like
gene), is up-regulated under drought stress in N.
benthamiana. Down-regulation of endogenous gene
induces physiological abnormalities suggesting its
relevance in basic plant metabolic processes. Since
the TF is constitutively expressed, the gene might be
having different targets (functional genes) controlling
basic physiological functions.
Acknowledgement
TRV-based silencing vectors (pTRV1 and pTRV2)
were kindly provided by Dr Dinesh Kumar, MCBD,
Yale University, USA. This work was partially
supported by CSIR (Grant No.38 (1074)/03/EMRII),
and DBT, Govt. of India. We wish to thank Ms
Nethra P and Ms Anitha Kumari for their help during
the experiments. We also wish to thank Dr M Udaya
Kumar for useful discussion and Dr G Ramamohan
for critical reading of the manuscript.
References
1 Thomashow M F, Plant cold acclimation: Freezing tolerance
genes and regulatory mechanisms, Plant Mol Biol, 50 (1999)
571-599.
2 Pastori G M & Foyer C H, Common components, networks,
and pathways of cross-tolerance to stress: The central role of
‘redox’ and abscisic acid-mediated controls, Plant Physiol,
129 (2002) 7460-7468.
3 Kang J, Choi H I M & Kim S Y, Arabidopsis basic leucine
zipper proteins that mediate stress responsive abscisic acid
signaling, Plant Cell, 14 (2002) 343-357.
4 Chinnusamy V, Schumaker K & Zhu J K, Molecular and
genetic perspective on cross-talk and specificity in abiotic
stress signaling in plants, J Exp Bot, 55 (2004) 225-236.
5 Bray E A, Plant responses to water deficit, Trends Plant
Sci, 2 (1997) 48-54.
6 Ingram D & Bartles, The molecular basis of dehydration
tolerance in plants, Ann Rev Plant Physiol Plant Mol Biol, 42
(1996) 377-403.
7 Shinozaki K, Kazuko Y S & Seki M, Regulatory network of
gene expression in the drought and cold stress responses,
Curr Opin Plant Biol, 6 (2003) 410-414.
8 Hwang W S, Roh S, Lee B C, Kang S, Kwon G, et al, Plantspecific embryonic stem cells derived from human SCNT
blastocysts, Science, 308 (2005) 1777-1783.
9 Liu Q, Karuga M, Sakuma Y, Abe S, Miura S et al, Two
transcription factors DREB 1 and DREB 2 with an AP2
DNA binding domain separates two cellular transduction
pathways in drought and low temperature response gene
expression, Plant Cell, 13 (1998) 99-106.
10 Qu L J & Zhu Y X, Transcription factor families in
Arabidopsis: Major progress and outstanding issues for
future research, Curr Opin Plant Biol, 9 (2006) 544-549.
11 Agarwal P K, Agarwal P, Reddy M K & Sopory S K, Role of
DREB transcription factors in abiotic and biotic stress
tolerance in plants, Plant Cell Rep, 25 (2006) 1263-1274.
59
12 Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko K R
et al, Improvement of water use efficiency in rice by
expression of HARDY, an Arabidopsis drought and salt
tolerance gene, Proc Natl Acad Sci USA, 104(2007)
15270-15275.
13 Kalde M, Barth M, Somssich I E & Lippok B, Member of
Arabidopsis WRKY group transcription factors are part of
different plant defense signaling pathways, Mol Plant
Microbe Interact, 16 (2003) 295-305.
14 Eulgem T, Rushton P J, Robatzek S & Somssich I E, The
WRKY superfamily of plant transcription factors, Trends
Plant Sci, 5 (2000) 199-206.
15 Rushton P J & Somssich I E, Transcriptional control of plant
genes responsive to pathogens, Curr Opin Plant Biol, 1
(1998) 311-315.
16 Chen W, Provatt N J, Glazebrook J, Katagiri F, Chang H S,
et al, Expression profile matrix of Arabidopsis transcription
factor genes suggests their putative function in response to
environmental stresses, Plant Cell, 14 (2002) 559-574.
17 Robatzek S & Somssich I E, Targets of AtWRKY 6
regulation during plant senescence and pathogen defense,
Genes Dev, 16 (2002) 1139-1149.
18 Rizhsky L, Liang H & Mittler R, The combined effect of
drought stress and heat shock on gene expression in tobacco,
Plant Physiol, 130 (2002) 1143-1151.
19 Jiang Y & Deyholos M K, Comprehensive transcriptional
profiling of NaCl-stressed Arabidopsis roots reveals novel
classes of responsive genes, BMC Plant Biol, 12 (2006) 5-6.
20 Terrier N, Glissant D, Grimplet J, Barrieu F, Abbal P, et al,
Isogene specific oligo arrays reveal multifaceted changes in
gene expression during grape berry (Vitis vinifera L.)
development, Planta, 222 (2005) 832-847.
21 Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S,
et al, A novel WRKY transcription factor, SUSIBA2,
participates in sugar signaling in barley by binding to the
sugar-responsive elements of the iso1 promoter, Plant Cell,
15 (2003) 2076-2092.
22 Mare C, Mazzucotelli E, Crosatti C, Francia E, Stanca A M
et al, Hv-WRKY38: A new transcription factor involved in
cold- and drought-response in barley, Plant Mol Biol, 55
(2004) 399-416.
23 Xie Z, Zhang Z L, Zou X, Huang J, Ruas P et al,
Annotations and functional analyses of the rice WRKY gene
superfamily reveal positive and negative regulators of
abscisic acid signaling in aleurone cells, Plant Physiol, 137
(2005) 176-189.
24 Flower D J & Ludlow M M, Contribution of osmotic
adjustment to the dehydration tolerance of water stressed
pigeon pea [Cajanus cajan (L.) Millsp] leaves, Plant Cell
Environ, 9 (1986) 33-40.
25 Hiscox J D & Israelstam G F, A method for the extraction of
chlorophyll from leaf tissues without maceration, Can J Bot,
57 (1979) 1332-1334.
26 Kotewicz M L, Sampson C M, Alessio J M D & Gerard G F,
Isolation of cloned Moloney murine leukemia virus reverse
transcriptase lacking ribonuclease H activity, Nucleic Acids
Res, 16 (1988) 265-277.
27 Liu Y, Schiff M, Marathe R & Dinesh-Kumar S P, Tobacco
Rar1, EDS1 and NPR1/NIM1 like genes are required for N
mediated resistance to tobacco mosaic virus, Plant J, 30
(2002) 415-429.
60
INDIAN J BIOTECHNOL, JANUARY 2009
28 Nethra P, Nataraja K N, Rama N & Udayakumar M,
Standardization of environmental conditions for induction
and retention of post transcriptional gene silencing using
tobacco rattle virus vector, Curr Sci, 90 (2006) 431-434.
29 Nataraja K N & Jacob J, Clonal differences in photosynthesis
in Havea brasiliensis, Mull.-Arg., Photosynthetica, 36
(1999) 89-98.
30 Genty E, Brazier J L, Lesca P & Riviere J L, Absence of an
isotope effect in induction of cytochrome P-450 and
xenobiotic metabolizing enzyme activities by stable isotopelabelled phenobarbital isotopomers, Biochem Pharmacol, 38
(1989) 3885-3887.
31 Xiong Y, Liu T, Tian C, Sun S, Li J et al, Transcription factors
in rice: A genome-wide comparative analysis between
monocots and eudicots, Plant Mol Biol, 59 (2005) 191-203.
32 Asai T, Tena G, Plotnikova J, Willmann M R, Chiu W L, et
al, MAP kinase signaling cascade in Arabidopsis innate
immunity, Nature (Lond), 415 (2002 ) 977-983.
33 Devaiah B N, Karthikeyan A S & Raghothama K G,
WRKY75 Transcription factor Is a modulator of phosphate
acquisition and root development in Arabidopsis, Plant
Physiol, 143 (2007) 1789-1801.
34 Xiong Y, Contento A L, Nguyen P Q & Bassham D C,
Degradation of oxidized proteins by autophagy during oxidative
stress in Arabidopsis, Plant Physiol, 143(2006) 291-299.
35 Allen R D, Dissection of oxidative stress tolerance using
transgenic plants, Plant Physiol, 107 (1995) 1049-1054.
36 Vanderauwera S, Zimmermann P, Rombauts S,
Vandenabeele S, Langebartels C, et al, Genome-wide
analysis of hydrogen peroxide-regulated gene expression in
Arabidopsis reveals a high light-induced transcriptional
cluster involved in anthocyanin biosynthesis, Plant Physiol,
139 (2005) 806-821.
37 Gechev T S, Minkov I N & Hille J, Hydrogen peroxideinduced cell death in Arabidopsis: Transcriptional and
mutant analysis reveals a role of an oxoglutarate-dependent
dioxygenase gene in the cell death process, IUBMB Life, 57
(2005) 181-188.
38 Impa S M, Nadarajan S, Boominathan P, Shashidhar G,
Bindumadhava H et al, Carbon isotope discrimination
accurately reflects variability in WUE measured at a whole
plant level in rice, Crop Sci, 45 (2005), 2517- 2522.
39 Ratnayaka H H, Molin W T & Sterling T M, Physiological
and antioxidant responses of cotton and spurred anoda under
interference and mild drought, J Exp Bot, 54 (2003)
2293-2305.
40 Kovtun Y, Chiu W L, Tena G & Sheen J, Functional
analysis of oxidative stress activated mitogen-activated
protein kinase cascade in plants, Proc Natl Acad Sci USA,
97 (2000) 2940-2945.
41 Wang J, Rossow W B & Zhang Y C, Abiotic resistance and
chaperones: Possible physiological role of phosphlipase D,
Proc Natl Acad Sci USA, 13 (2000) 3041-3056.