Malo et al., 2010 SUPPLEMENTARY MATERIALS Malo et al., 2010 Table of Contents 1. Materials and Methods 2. Supplementary Figure 1 Activity of calf intestinal alkaline phosphatase (cIAP) in autoclaved tap water. 3. Supplementary Figure 2 IAP activity in the stools of mice receiving different amounts of cIAP in the drinking water. 4. Supplementary Figure 3 Effects of cIAP on bacterial growth in vitro. Supplementary Materials and Methods Materials. Calf intestinal alkaline phosphatase (cIAP) and DNA restriction enzymes were purchased from New England Biolabs (Ipswich, MA). p-Nitrophenyl phosphate disodium salt hexahydrate (pNPP) was purchased from Sigma (St. Louis, MO). LB-broth, Brain Heart Infusion (BHI) media, LB-agar, BHI agar, McConkey agar and Brucella agar (5% horse blood) plates were purchased from Fisher Scientific (Pittsburgh, PA). The CO2 producing gas pack and anaerobic condition indicators were also obtained from Fisher Scientific. The kits for isolation of bacterial DNA from mouse stool were obtained from MoBio Laboratories (Carlsbad, CA) and Qiagen (Valencia, CA). Taq DNA polymerase and dNTP mixes were purchased from Promega (Madison, WI). TaqGold® DNA polymerase was purchased from Applied Biosystems (Foster City, CA). The kit for protein assay was obtained from Bio-Rad (Hercules, CA). The primers for 1 Malo et al., 2010 genotyping and amplification of 16S rRNA genes were synthesized by Fisher Scientific. The TOPO TA cloning kit was purchased from Invitrogen (Carlsbad, CA).) Animals. IAP knockout (KO) mice (Mus musculus C57BL/6) construction has been described[1] and heterozygous mice were obtained from the Burnham Institute for Medical Research (La Jolla, CA). These animals were subsequently bred at the MGH animal facility to create homozygous IAP-KO, heterozygous and wild-type C57BL/6 (WT) littermates. Confirmation of genotype was performed by PCR analysis.[1] The animal experiments were reviewed and approved by the IACUC at MGH. Animals in this study were maintained in accordance with the guidelines of the Committee on Animals of Harvard Medical School (Boston, MA) and those prepared by the Committee on the Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Research Council (Department of Health, Education and Human Services, publication no. 85-23 (National Institute of Health), revised 1985). Bacterial culture. Streptomycin-resistant E. coli was grown on MacConkey agar plates containing streptomycin (100 g/ml), and Streptomycin-resistant Salmonella typhimurium SL1344 was grown on Hektoen plates also containing streptomycin (100 g/ml). For stool culture, individual stool samples from different animals were collected fresh directly in BHI media (200 l) in microfuge tubes, kept on ice, weighed and then determined the weight of stool by subtracting the pre-determined weight of tube and media. BHI media was added to each tube obtaining a specific weight:volume ratio (1 mg stool:10 l BHI). The stool sample was then vortexed to homogenize followed by serial dilution and plating on MacConkey agar, LB-agar, BHI-agar and Brucella (5% horse blood) agar plates. For the growth of aerobic bacteria, plates 2 Malo et al., 2010 were incubated in ambient air for 24 h at 37oC; anaerobic plates were incubated in a table-top anaerobic chamber with gas packs (Fisher Scientific) for 7 days at 37oC. Samples were plated on the bench and then placed in the chambers. The change of color of the anaerobic indicator inside the chamber was rigorously monitored. Colony forming units (CFU) were counted and expressed as average CFU/gm of stool +/- SEM. To determine the effects of calf IAP (cIAP) on bacterial growth in vitro, cultures of E. coli, Salmonella typhimurium, Staphylococcus aureus and Listeria monocytogenes were grown in LB-broth containing 20 l/ml (200 U/ml) of cIAP (New England Biolabs) or 20l/ml ‘vehicle for cIAP’ (50 mM KCl, 10 mM Tris-HCl (pH 8.2), 1 mM MgCl2, 0.1 mM ZnCl2, and 50% glycerol). Each culture (200 l) was grown in 5 wells of a 96-well clear-bottom plate at 37oC in a shaking incubator, and absorbance (OD600) was determined hourly. Bacterial growth in a culture at a definite time-point was calculated as average Absorbance (OD600) +/- SD. Terminal restriction fragment length polymorphism (TRFLP) analyses. Fecal samples of equal weight were collected from 8 animals in each group (WT and KO). Using the MoBio PowerSoil® soil DNA kit (MoBio Laboratories, Carlsbad, CA) bacterial DNA was extracted from each sample following manufacture’s protocol. Success of each extraction was determined by measuring DNA concentration in the extraction product with a Spectramax spectrophotometer (Molecular Devices, Palo Alto CA). PCR was performed to amplify an approximately 500 bp bacterial DNA fragment using primers homologous to conserved regions on the bacterial 16S rRNA AGAGTTTGTTCMTGGCTCAG-3’) gene.[2] and the The forward reverse primer primer (16s.8F: 5’- (16s.530R: 5’- GTATTACCGCGGCTGCTGG-3’)[2] were synthesized by GenSet (La Jolla, CA) (see 3 Malo et al., 2010 Supplementary table 1). The forward primer was fluorescently labeled with a phosphamide dye (D4). PCR reactions were carried out in 50 l using 1 µl of undiluted DNA extract, 5 µl of 10x Buffer, 3 µl of 10 mM dNTP, 2 µl of 20 mg/ml BSA, 7 µl of 25 mM MgCl 2, 1 µl (10 pmole) of each primer, and 0.3 µl of 5 U/l TaqGold® DNA polymerase (Applied Biosystems). Reaction temperatures and times were 96°C for 10 min, 35 cycles of 94°C for 1 min, 46.5°C for 1 min, 72°C for 2 min followed by a final extension step of 10 min at 72°C. All reactions were performed in triplicate and then combined using a MoBio Ultraclean PCR Cleanup Kit (MoBio Laboratories) following manufacturer’s protocol. PCR products were quantified using a fluorometer tuned to the labeling dye. TRFLP was performed following the protocols as previously described.[2] An enzyme digest was performed on 75 ng of cleaned PCR product using one of three restriction endonucleases Dpn II, Hae III and Hpa II (New England Biolabs). Each 40 µl digestion used 75 ng of DNA, 1 U of enzyme, and 4 µl of buffer. The samples were digested for 4 h at 37°C and inactivated for 20 min at 65°C or 85°C depending on the enzymes inactivation requirement. The digestion products were precipitated by ethanol and resuspended in 20 µl of formamide containing 0.25 µl of CEQ 600 base pair DNA standard ladder. Terminal restriction fragment profiles were obtained using a Beckman Coulter CEQ8000 DNA analysis system. Terminal restriction fragment (TRF) length in nucleotides and TRF peak area were exported from the CEQ8000 into Excel (Microsoft, Seattle, WA). To standardize the data for comparison between samples, the area under each TRF peak was normalized to total amount of DNA analyzed and expressed as parts per million (ppm). Peaks with an area of less than 10,000 ppm (<1% of the total for that sample) were excluded from analysis to reduce noise. 4 Malo et al., 2010 Supplementary Table 1 Primers used in this study Taxonomic rank Primer Sequence (5’ – 3’) Genespecificity PCR product All Bacteria (for TRFLP and cloning) Kingdom F. AGAGTTTGTTCMTGGCTCAG R. GTATTACCGCGGCTGCTGG 16S rRNA 523 bp All Bacteria (for qPCR) Kingdom F. ACTCCTACGGGAGGCAGCAGT R. ATTACCGCGGCTGCTGGC 16S rRNA* 175 bp Group Phylum Enterobacteriaceae Proteobacteria Family F. GTGCCAGCAGCCGCGGTAA R. GCCTCAAGGGCACAACCTCCAAG 16S rRNA* 312 bp Clostridiales Firmicutes Order F. ACTCCTACGGGAGGCAGC R.GCTTCTTAGTCAGGTACCGTCAT 16S rRNA* 154 bp Lactobacillaceae Firmicutes Family F. AGCAGTAGGGAATCTTCCA R. CACCGCTACACATGGAG 16S rRNA* 316 bp Enterococcus Firmicutes Family F. CCCTTATTGTTAGTTGCCATCATT R. ACTCGTTGTACTTCCCATTGT 16S rRNA* 165 bp Bacteroidetes Bacteroidetes Class F. AGCAGCCGCGGTAAT R. GCATTTCACCGCTA 16S rRNA* 184 bp E. coli Proteobacteria Genus F. GACGTCTCGTTGCTGCATAAACC R. CAGCAGCAGACCATTTTCAATCC LacZ (external) 402 bp E. coli Proteobacteria Genus F. ATGATGATTTCAGCCGCGCT R. GCTTCAATCAGCGTGCCGTC LacZ (internal) 280 bp Note: F, forward primer; R, reverse primer; *, see Barman et al. [3]. Statistical analyses. Normalized TRFLP data sets were transformed by taking the square root of the area under each TRF peak to de-emphasize large TRF peaks while still taking relative abundance into account.[4] Transformed data were analyzed by Bray-Curtis similarity and ordinated by multi-dimensional scaling (MDS) using the PRIMER5 statistics package (Primer-E Ltd., Ivybridge, United Kingdom). Significance testing was performed using analysis of similarity (ANOSIM) with PRIMER5. 5 Malo et al., 2010 Construction of the library of bacterial 16S small-subunit ribosomal RNA genes. Stool samples of equal weight from 10 individual wild-type (WT) mice were pooled and used for isolation of bacterial DNA using the DNA isolation kit from Qiagen. Similarly, DNA was isolated from pooled stool samples of 10 IAP-KO animals. The forward and reverse primers[2] that were used in PCR amplification of the 16S rRNA gene fragments for TRFLP analyses (see above) were also used to amplify the same 500 bp 16S rRNA gene fragments for cloning. PCR was performed using Taq DNA polymerase in a thermocycler (PTC-200, MJ Research, Waltham, MA). The PCR conditions were: initial denaturation for 2 min, then 32 cycles of denaturation (94oC for 30 sec), annealing (45oC for 30 sec) and extension (72oC for 60 sec) followed by a final extension step of 5 min at 72oC. The PCR products were verified by electrophoresis through a 2% agarose gel. Using TOPO TA cloning kit (Invitrogen) fresh PCR products were cloned into pCR2.1 TA cloning vector following the manufacturer’s protocol. The transformants were plated on LB-agar plates containing ampicillin (100 g/ml) and X-gal (40 mg/ml) and incubated at 37oC overnight. Approximately one thousand white transformant colonies from each group (WT and KO) were grown at 37oC overnight in 96-well plates, each well containing 150 l of LB-broth with 100 g/ml ampicillin. Sequencing. Using M13 forward and reverse primers bidirectional sequencing was performed on all clones, 1,000 from each library (WT and KO), using dye-labeled dideoxynucleotide chain terminators at the Molecular Cloning Laboratory (South San Francisco, CA). Phylogenetic analyses. Cloned 16S rRNA gene sequences were analyzed with the ‘Classifier’ program developed by Michigan State University (http://rdp.cme.msu.edu/). The program 6 Malo et al., 2010 produced the name and number of 16S rRNA gene sequences, and arranged them in taxonomical hierarchy. Percentage of each sequence was calculated using the Microsoft Excel program. Chi squared analysis was performed to determine statistical significance in the distribution of clones in WT and KO libraries, and p<0.05 was considered significant. Quantitative real-time PCR (qPCR) Semi-quantitative limited-cycle PCR (<20 cycles) was performed on WT and KO stool DNA using Taq DNA polymerase with E. coli LacZ and subphylum-specific 16S rRNA gene primers (see Supplementary table 1) in a thermocycler (MJ Research). Quantitative real-time PCR was performed in an IQ5 Thermocycler (Bio-Rad, Hercules, CA) using SYBR Green PCR kit from New England Biolabs (Ipswich, MA). Primers were synthesized by the MGH Core DNA Synthesis Facility. For absolute quantitation of bacterial DNA, serial dilutions of a known amount of E. coli DH5 genomic DNA were subjected to qPCR amplification with the 16S rRNA gene universal primers (synthesizing 175 bp fragment, see Supplementary table 1), and a standard curve was generated by plotting CT’s against the known amounts of DNA. DNA isolated from WT and KO stools were subjected to qPCR using universal as well as subphylum-specific 16S rRNA gene primers. Quantitation of Eubacterial DNA as well as subphylum-specific bacterial DNA was calculated by comparing the known CT values against the standard values. The fold change for Eubacteria was determined by dividing the total amount of IAP-KO stool DNA with the total amount of WT stool DNA, whereas the fold change of a specific bacterial group was calculated by dividing the percentage of the specific bacterial group in IAP-KO mice stool with the 7 Malo et al., 2010 percentage of the respective bacterial group in WT mice stool. Each PCR was repeated at least 3 times. Intestinal alkaline phosphatase (IAP) assay. IAP activity was determined following the protocol as described in Baykov et al.[5] Briefly, individual stool samples were homogenized in water (10 mg/100 l), centrifuged, and supernatant was collected. Then 25 l of the stool supernatant (or aqueous cIAP solution as a control) were mixed with 175 l of phosphatase assay reagent containing 5 mM of p-nitrophenyl phosphate (pNPP) followed by determination of optical density at 405 nm after a specific time period when the samples usually turned yellow due to release of p-nitrophenol. Protein concentrations of stool supernatants were measured using a kit from Bio-Rad (Hercules, CA). The specific activity of the enzyme is expressed as average pmole pNPP hydrolyzed per min per g of protein +/- SEM. Colonization assay. For studying colonization of E. coli, a commensal E. coli was isolated from the stool of a WT mouse, and a spontaneous streptomycin-resistant mutant was isolated by culturing the bacterial sample in a MacConkey plate containing streptomycin (100 g/ml). Spontaneous streptomycin resistant mutants are frequently a result of mutations in the rpsL gene and are phenotypically stable.[6] Salmonella typhimurium SL1344 was grown in LB-broth and CFU was determined by plating on Hektoen plates. Doses of bacteria for oral gavage varied from 20,000 to 500,000 CFU depending on the experiments. After oral gavage, the presence as well as quantity of bacteria was determined by stool culture on selective media. 8 Malo et al., 2010 Oral supplementation of IAP. For oral administration of IAP we determined the efficacy and stability of calf IAP (cIAP) in drinking water and observed that cIAP was reasonably functional and stable in autoclaved tap water (see below, Supplementary fig. S1). We also fed 5 WT mice different doses of cIAP in the drinking water (autoclaved tap water) and observed that IAP activity was dose-dependent (Supplementary fig. S2). If not indicated otherwise, for in vivo studies, the dose of cIAP was 200 U/ml (20 l/ml) drinking water. The control animals received ‘vehicle for cIAP’ (see above, 20 l/ml) in the drinking water. Antibiotic treatment. If required, mice were fed streptomycin (5 mg/ml) and/or ciprofloxacin (0.5 mg/ml) in their drinking water for 3 days. Determination of pH. Individual mouse stool samples were suspended in water (pH 7.0) at a specific weight:volume ratio (1 mg stool:10 l water). The stool samples were then vortexed to homogenize and centrifuged to collect supernatant. The pH of the supernatant was then determined using pH paper strips. The pH of luminal fluids (duodenum and ileum) was determined by directly applying the fluid on pH paper strips. Restoration of gut flora after antibiotic treatment. Two groups of wild-type (C57BL/6) mice (n = 5 for each group) were allowed to drink autoclaved tap water containing 5 mg/ml streptomycin for 3 days. One group (cIAP+ Group) also received 200 U/ml cIAP (20 l/ml) (New England Biolabs) along with streptomycin, and cIAP was continued until normal gut flora was reestablished (usually by Day 7). The other group (cIAP Group) received equal amounts (20 l/ml) of ‘vehicle for cIAP’ for the total duration of the experiment. Water containing cIAP 9 Malo et al., 2010 and ‘vehicle for cIAP’ was replaced daily. The fecal sample from each animal was plated everyday on MacConkey agar plates to determine the restoration of Gram-negative bacteria, especially E. coli. The experiment was repeated 6 times and duration of experiments varied from 7-35 days. Data on the day of first appearance of E. coli in an animal’s stool were compiled for 39 animals in each group. Statistical significance of the difference in the number of animals with E. coli on a specific point of time (Day) was determined by two-tailed Fisher’s Exact Test, and p<0.05 was considered significant. 10 Relative cIAP Activity in Water (%) Malo et al., 2010 100 100 90 90 80 80 70 70 60 60 50 50 40 40 cIAP Buffer Series1 cIAP Buffer Series2 30 30 20 20 10 10 00 1 0 2 3 24 48 Time (h) 4 120 Supplementary Figure 1 Activity of calf intestinal alkaline phosphatase (cIAP) in autoclaved tap water. Two units of cIAP (New England Biolabs) were dissolved in 1 ml autoclaved tap water in the presence or absence of cIAP buffer, and cIAP activity was determined at specific time intervals following the protocol as described.[5] The results show that cIAP retains more than 80% of its activity in the tap water without any added cIAP buffer. We wanted not to use any buffer in the drinking water because cIAP buffer has high pH (7.9) as well as higher concentrations of salts (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT), which might affect the background bacterial growth and mask the effects of cIAP. Note: Animals received cIAP in autoclaved drinking water, which was replaced everyday. 11 pmole pNPP hydrolyzed/min/g protein Malo et al., 2010 3000 3.00 2500 2.50 2000 2.00 1500 1.50 1000 1.00 500 0.50 0 0.00 0 50 100 200 400 0cIAP in50Drinking 100Water 200 (U/ml)400 Supplementary Figure 2 IAP activity in the stools of mice receiving different amounts of cIAP in the drinking water. A group of mice (n = 5) was allowed to drink water containing a specific amount of cIAP for 24 h followed by determination of IAP activity in their stools. Specific activity (S.A.) of IAP was expressed as average pmole pNPP hydrolyzed/min/g protein +/- SEM. The results show that the IAP activity in a stool sample is dose-dependent; the higher the amount in the drinking water, the higher the activity in stool, indicating that oral administration of IAP in the drinking water could be an effective route of delivery to increase intestinal luminal concentration of IAP. 12 Malo et al., 2010 B 1.2 1.2 E. coli 1.01 cIAP cIAP 0.8 0.8 1.2 1.2 Bacterial Growth (OD600) Bacterial Growth (OD600) A 0.6 0.6 0.4 0.4 0.2 0.2 0.00 S. typhimurium 1.01 cIAP cIAP 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.00 0 0 10 11 11 12 12 1 22 33 4 55 66 77 8 9 10 1 0 9 10 11 11 12 12 13 12 23 34 45 56 67 78 8 9 10 Time (h) 1.8 1.8 Bacterial Growth (OD600) Time (h) D S. aureus 1.6 1.6 1.4 1.4 1.2 1.2 cIAP cIAP 1.01 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.00 1.8 1.8 Bacterial Growth (OD600) C L. monocytogenes 1.6 1.6 1.4 1.4 1.2 1.2 cIAP cIAP 1.01 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.00 0 9 10 1 12 23 34 45 56 67 78 89 10 11 11 12 12 13 Time (h) 1 23 4 3 5 4 5 8 10 9 10 10 2 6 67 78 9 11 11 12 12 13 Time (h) Supplementary Figure 3 Effects of cIAP on bacterial growth in vitro. Overnight bacterial culture was diluted 20-fold in LB-broth +/- cIAP (200 U/ml = 20 l/ml). The control culture received 20 l/ml ‘vehicle for cIAP’ (see above) instead of cIAP. Each culture was grown in 5 wells of a 96-well plate at 37oC in a shaking incubator, and absorbance (OD600) was determined hourly. Bacterial growth in a culture at a definite time-point was calculated as average Absorbance (OD600) +/- SD. (A) Growth of Gram-negative bacterium E. coli in the presence of cIAP (cIAP) or absence of cIAP (cIAP). (B) Growth of Gram-negative bacterium Salmonella typhimurium in the presence of cIAP (cIAP) or absence of cIAP (cIAP). (C) Growth of Grampositive bacterium Staphylococcus aureus in the presence of cIAP (cIAP) or absence of cIAP (cIAP). (D) Growth of Gram-positive bacterium Listeria monocytogenes in the presence of 13 Malo et al., 2010 cIAP (cIAP) or absence of cIAP (cIAP). The experiment was repeated more than 5 times and similar results were obtained. Note: The results show no significant effect of cIAP on bacterial growth in vitro. 14 Malo et al., 2010 Supplementary References 1. Narisawa S, Huang L, Iwasaki A, et al. Accelerated fat absorption in intestinal alkaline phosphatase knockout mice. Mol Cell Biol 2003; 23: 7525-30. 2. Kaplan CW, Astaire JC, Sanders ME, et al. 16S ribosomal DNA terminal restriction fragment pattern analysis of bacterial communities in feces of rats fed Lactobacillus acidophilus NCFM. Appl Environ Microbiol 2001; 67: 1935-9. 3. Barman M, Unold D, Shifley K, et al. Enteric salmonellosis disrupts the microbial ecology of the murine gastrointestinal tract. Infect Immun 2008; 76:907-15. Epub 2007 Dec 26. 4. Blackwood CB, Marsh T, Kim SH, et al. Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. Appl Environ Microbiol 2003; 69: 926-32. 5. Baykov AA, Evtushenko OA, Avaeva SM. A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay. Anal Biochem 1988; 171: 266-70. 6. Lagatolla C, Dolzani L, Monti-Bragadin C. Characterization of the phenotype conferred by two different rpsL alleles coding for streptomycin dependence. New Microbiol 1998; 21: 105-11. 15
© Copyright 2026 Paperzz