Supplemental Data – Singh et al.
FIBRILLIN 4 is required for plastoglobule development and stress resistance
in apple and Arabidopsis1
Dharmendra K. Singh, Siela N. Maximova, Philip J. Jensen, Brian L. Lehman, Henry K. Ngugi,
and Timothy W. McNellis*
Departments of Plant Pathology (D.K.S., P.J.J., H.K.N, T.W.M) and Horticulture (S.N.M.), Penn
State University, University Park, PA 16802, USA; Penn State University Fruit Research and
Extension Center, Biglerville, PA 17307, USA (B.L.L., H.K.N.); Intercollege Graduate Degree
Program in Plant Biology, Penn State University, University Park, PA 16802, USA (D.K.S.)
* Corresponding author; e-mail [email protected]
1
This research was supported by United States National Science Foundation Plant Genome
Research Program Grant DBI-0420394 (grant to T.W.M., Robert. M. Crassweller, James W.
Travis, and S.N.M.).
1
2
Supplemental Figure S1.
Construction of the apple FIB4 RNAi binary vector used for
Agrobacterium tumefaciens-mediated genetic transformation of apple
RNA interference technology was used to develop apple fib4 KD trees. RNA was
extracted from apple leaves as described in the experimental methods. Reverse transcription was
performed using the RETROscript kit with the oligo dT primer as described by the manufacturer
(Ambion, Austin, TX). Full-length FIB4 cDNA (Accession number AY383624) was amplified
by performing PCR using the cDNA as template (see Supplemental Table S1 for primers). The
full length FIB4 cDNA PCR product was cloned into the pCR2.1 vector according to the
manufacturer’s instructions (TOPO TA cloning kit, Invitrogen, Carlsbad, CA). A 460 bp FIB4
cDNA fragment (comprised of base pairs 149 to 608 of the FIB4 cDNA) was amplified by PCR
using the cloned, full-length FIB4 cDNA as the template (see Table S1 for primers). The
amplified fragment had two restriction sites at the 5 end: XhoI and XbaI; and two restriction
sites at the 3 end: KpnI and ClaI. The PCR product was subcloned into pCR2.1. The 460 bp
FIB4 segment was ligated into pHannibal (Wesley et al., 2001) twice: first as an XbaI/ClaI
fragment and then as an XhoI/KpnI fragment to produce a FIB4 RNAi cassette (Supplemental
Fig. S1). The FIB4 RNAi cassette was excised from pHannibal with NotI and ligated into the
plant transformation vector pGH00.0131 (Maximova et al., 2003) cut with SpeI to create
pGY06.0228 (Supplemental Fig. S1).
pGY06.0228 was introduced into Agrobacterium tumefaciens strain AGLII using
electroporation, and apple transformations were performed as described previously (Maximova
et al., 1998). Transformed primordia were identified by their kanamycin resistance and EGFP
fluorescence, and transgenic plants were regenerated as described by Maximova et al., (1998).
Rooted apple plants were transferred to potting mix (Redi-Earth, Sun Gro Horticulture, Bellevue,
WA) and acclimatized in a growth chamber.
References:
Maximova S, Miller C, Antúnez de Mayolo G, Pishak S, Young A, Guiltinan MJ (2003)
Stable transformation of Theobroma cacao L. and influence of matrix attachment regions
on GFP expression. Plant Cell Rep 21:872-883
Maximova SN, Dandekar AM, Guiltinan MJ (1998) Investigation of Agrobacterium-mediated
transformation of apple using green fluorescent protein: high transient expression and
3
low stable transformation suggest that factors other than T-DNA transfer are ratelimiting. Plant Mol Biol 37:549-559
Wesley SV, Helliwell CA, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP,
Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM
(2001) Construct design for efficient, effective and high-throughput gene silencing in
plants. Plant J 27:581-590
4
Supplemental Figure S2. Confirmation of reduced expression of the FIB4 gene in fib4 KD
apple trees and phenotype of wild-type and transgenic trees. A, EGFP and 18S transcript
accumulation was assayed in untransformed wild-type (WT) ‘Royal Gala’, transgenic vector
control (VC), and three independent fib4 KD lines using conventional reverse-transcription PCR.
Two independent reactions were performed with RNA samples from two trees of each plant
type. The EGFP transformation marker gene was expressed in VC and fib4 KD apple trees but
not in untransformed WT trees. EGFP, enhanced GFP transformation marker; 18S, 18S rRNA
control reaction. B, Expression of FIB4 in WT, VC and fib4 KD trees was analyzed using
quantitative real-time PCR with gene-specific TagMan primers and probes (Supplemental Table
S2). FIB4 transcript level in fib4 KD trees was less than 10% of that in WT or VC, indicating
successful silencing.
C, WT, VC, and fib4 KD apple trees were phenotypically
indistinguishable. Representative plants were photographed at two months after transfer from
tissue culture media to soil.
5
Supplemental Figure S3. Internal [CO2] and stomatal conductance of fib4 KD and WT apple
trees. Exposure to higher photosynthetically active radiation (PAR) caused reduction of internal
[CO2] and stomatal conductance (Gs) in both fib4 KD and WT. At 100 µE·m-2·s-1 PAR, internal
[CO2] was slightly, but significantly, lower in fib4 KD than WT; in contrast, at 1000 µE·m-2·s-1
PAR, internal [CO2] was significantly higher in fib4 KD than WT. No significant differences in
stomatal conductance were observed between fib4 KD and WT at any level of PAR tested.
Graphs are from one representative experiment. The experiment was repeated twice with similar
results. For each experiment, three leaves from each of five trees were used to measure internal
[CO2] and stomatal conductance. Data are means  SEM of 15 replicates; asterisk, p < 0.05
using Student’s t-test.
6
Supplemental Figure S4. Effects of transfer from 90 Em-2s-1 PAR to 600 Em-2s-1 PAR for
6 d on WT and fib4 KD plants. Photographs were taken 6 d after transfer to higher light
intensity. Six plants were used for the experiment; representative plants are shown.
7
Supplemental Figure S5. Expression of Pathogenesis Related (PR) genes were induced in
wild-type (WT) and fib4 KD apple tree during E. amylovora infection. Expression of PR genes
in WT and fib4 KD at 0 h and 48 h after inoculating leaves by cutting across the midvein with a
scissors dipped into a 0.2 OD600nm suspension of E. amylovora strain Ea581. Tissues with
actively progressing infections were excised as described by Norelli et al., 2009. RNA was
extracted from six leaves from each of two plants per time point per genotype. Quantitative realtime polymerase chain reaction was performed using primers and probes specific to three apple
PR genes: PR2, PR8, and PR10 (see Table S2 for primers and probes). PR2 and PR8 expression
was induced by E. amylovora infection in both host genotypes. However, the induction of PR2
and PR8 expression was significantly lower in fib4 KD trees compared to WT. Abbreviations: C,
mock treatment; T, inoculated with E. amylovora. Asterisk, p < 0.05 using Student’s t-test.
8
Supplemental Figure S6. Confirmation of T-DNA insertion in the Arabidopsis FIB4 gene.
Seeds of two Arabidopsis T-DNA insertion mutants in the Columbia-0 (Col-0) genetic
background, fib4-1 (SALK_014831) and fib4-2 (SALK_122950) were obtained from the
Arabidopsis Biological Resource Center, a publicly accessible collection of T-DNA insertion
9
lines (http://www.biosci.ohio-state.edu/pcmb/Facilities/abrc/abrchome.htm) (Alonso et al.,
2003). A, A schematic diagram of the Arabidopsis FIB4 gene and the locations of T-DNA
insertions in fib4-1 and fib4-2. Solid black boxes represent exons numbered in order; inserts
represent T-DNA; gray boxes represent untranslated regions; black lines represent introns; green
line represents a non-genic region; red line represents quantitative real time PCR amplification
region RT1; blue line represents quantitative real time PCR amplification region RT2. Labeled
arrows indicate locations, directions, and names of conventional PCR primers. The presence of a
homozygous T-DNA insertion in the first exon of FIB4 in SALK_122950 (fib4-2) (B) and in the
fourth exon of BLN1 in SALK_014831 (fib4-1) (C) were confirmed by PCR. Primer pairs used
are indicated (A); template was genomic DNA. DNA sequencing of the PCR product obtained
using genomic DNA from fib4-1 and primer pair LBb1-RP1 showed that the T-DNA left border
lay adjacent to nucleotide 1,575 of FIB4. DNA sequencing of the PCR product obtained using
genomic DNA from fib4-2 and primer pair LBb1-RP2 showed that the T-DNA left border lay
adjacent to the 5th nucleotide of FIB4. The expression of FIB4 transcript in fib4-1 and fib4-2 was
13% and 21% of that in Col-0, respectively when using quantitative real-time PCR amplification
region RT2 (D). When using real-time PCR amplification region RT1, the expression of FIB4
transcript in fib4-2 was determined to be 19% of that in Col-0, while FIB4 transcript was not
detected in FIB4-1, probably because the reverse primer in RT1 overlapped the T-DNA insertion
site in fib4-1 (E).
10
Supplemental Figure S7. The fib4-1 and fib4-2 are more sensitive to ozone than wild type Col0 plants. Ozone exposure at 500 ± 50 ppb O3 for 3 h caused more extensive electrolyte leakage
in fib4-1 and fib4-2 leaves than in Col-0 as measured by relative ion leakage at 6 h after the start
of ozone treatment. Data are mean  SEM; n = 5/genotype; asterisk, p < 0.05 using Student’s ttest.
11
Supplemental Table S1. PCR primer sequences.
Target Gene
FIB4 (apple)
Accession
Number
(Gene Bank,
NCBI)
AY383624
FIB4 (apple)
-
EGFP
-
Gene
Function or
Experiment
Description
Apple FIB4
full-length
cDNA
amplification
Apple FIB4
RNAi insert
amplification
Label -
FIB4 (apple)
AY383624
FIB4
fib4-2
(Arabidopsis)
fib4-1
(Arabidopsis)
At3g23400
(Salk_122950)
At3g23400
(Salk_014831)
T-DNA
analysis
T-DNA
analysis
12
Primer Sequences
Product
Size
(bp)
Forward: 5-atggcttctttgagctctctccc3
Reverse:
5-ctatgaaacaacaaaaacccttagctcg-3
Forward: 5-gcgctcgagtctagaggttcg
tcaaatcgccgtcac-3
Reverse: 5- gcgggtaccatcgatgagca
cctagttcaagctccac-3
Forward: 5-ccaggagcgcaccatcttct-3
Reverse: 5-ctcgtccatgccgagagtga-3
Forward: 5-ggacgaggtttctgttctcg-3
Reverse: 5-gcggatatcagcatcaaggt-3
LP: 5- acggcaaatgttcacgtaatc-3
RP: 5-ttctttagcagccacttcagc-3
LP: 5-tcttgcttgagtttgaatggg-3
RP: 5-ttgccaatccgttctctctac-3
843
490
426
637
1202
1070
Supplemental Table S2. Real-time PCR primer and probe sequences.
Target Gene
Gene
Function or
Experiment
Description
β-1, 3glucanase
Primer and Probe Sequences
PR2 (apple)
Accession
Number
(Gene Bank,
NCBI)
AY548364
PR8 (apple)
DQ318214
Chitinase type
III
Forward: 5-ccaggtcactcaaaggacacaa-3
Reverse: 5-tatccgggaacgggcatt-3
Probe: 5-cagggaaaaacggtctatttagccgca-3
PR10 (apple)
AY026911
Ribonuclease
like
Forward: 5-caccattgagaaggtctcttacga-3
Reverse: 5-tggctgatactcttgatgatgga-3
Probe: 5-accaagttggtggcatctggaagtgg-3
FIB4 (Apple)
AY383624
FIB4
Forward: 5-cctaagttaccggaaggactacga-3
Reverse: 5-ttgacgttacctaccttgatgctg-3
Probe: 5-ctccgtctaacccaggaagtggtgaa-3
FIB4
(Arabidopsis)
At3G23400
FIB4
Forward_1: 5-aattcgtctctcgttgaagtatcca-3
Reverse_1: 5-ctcctcctgatccagatgatgat-3
Probe_1: 5-tggcggagaaagtgacccaccac-3
ACTIN 2
(Arabidopsis)
At3g18780.2
Forward: 5-tctgcagaggtcgggtctct-3
Reverse: 5-gatttggccttgcagattgg-3
Probe: 5-tgccatccaaaacatccacagtgca-3
Forward_2: 5- tcgcagattcctccgtttg-3
Reverse_2: 5-ttccagggtttgacgatggt-3
Probe_2: 5-tcccgaggcttcccgacagtttc-3
Forward: 5-gattcagatgcccagaagtcttg-3
Reverse: 5-tctcgtggattccagcagct-3
Probe: 5-ccagccctcgtttgtgggaaagg-3
ACTIN 2
13