International Journal of Cellular & Molecular Biotechnology 2013 (2013) 1-8
Available online at www.ispacs.com/ijcmb
Volume 2013, Year 2013 Article ID ijcmb-00003, 8 Pages
doi:10.5899/2013/ijcmb-00003
Research Article
Identification of ten N2-fixing bacteria using 16S rRNA and their
response to various zinc concentrations
Mohammad Dadook1, Sedigheh Mehrabian1, Saeed Irian2*
(1) Faculty of Biological Science, Islamic Azad University Tehran North Branch, Tehran, IR Iran.
(2) Department of Cell and Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, IR
Iran.
Copyright 2013 © Mohammad Dadook, Sedigheh Mehrabian and Saeed Irian. This is an open access article
distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Abstract
Zinc is presently being used as a micronutrient essential for plant growth in agriculture in the form of
zinc sulphate in fertilizers. Considering the importance of nitrogen-fixing microorganisms in soil fertility
and plant growth, and the toxic effects of zinc, this study aimed at isolating nitrogen-fixing
microorganisms from the asparagus rhizosphere arable soil and examining the sensitivity of the isolated
strains to different zinc concentrations. The asparagus rhizosphere soil was cultivated in a nitrogen-free
environment at 30 °C for 48 hours. Strains were identified by both biochemical and molecular methods.
The presence of the nitrogenase enzyme system was confirmed by testing for the presence of the nifH gene
through PCR analysis. The minimum inhibitory concentration (MIC) and optimal zinc concentration for
the growth of each strain were also determined. A total of 10 different bacterial species were identified in
three different soil samples. The presence of the nifH gene was confirmed in seven different strains. MIC
and the average optimal zinc concentration for bacterial growth were 130.7 ppm and 13 ppm, respectively.
The asparagus rhizosphere soil contains different species of nitrogen stabilizing microorganisms. An
optimal zinc concentration in soil of 20 ppm is suggested.
Keywords: Nitrogen-fixing, nifH, Zinc, 16S rRNA
1 Introduction
Heavy metals are elements with an atomic mass greater than 40g and a specific weight of more than
5g/cm3 [1]. These elements often find their way into soil through environmental contaminants including
the atmospheric pollution in the industrial regions, unlimited use of agricultural fertilizers, and municipal
and industrial sewage system in a nonreturnable fashion [2]. Unlike organic contaminants which can be
converted to nontoxic compounds, metals are intrinsically stable in nature [3]. Certain metals including Zn
* Corresponding Author. Email address: [email protected]; [email protected], Tel: +9821-88329220, Fax: 009821-4553366
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
2 of 8
are essential for plant growth and development, when used as a micronutrient, however, when used in
greater amounts, may result in metabolic disorders, eventually leading to a halt in growth of most plants
and microorganisms [4]. An important mechanism through which heavy metals, including zinc, induce
toxicity is by means of generating free radicals and oxidative stress [5].
In general, variation and distribution of microorganisms is a reflection of soil fertility. As nitrogen is an
essential element for plants, nitrogen-fixing bacteria would therefore provide molecular nitrogen for plant
use [6]. Azotobacter species belong to the Gram-negative and the polymorphic family of Azotobacteraceae
capable of forming capsule and microcyst [7]. By fixing nitrogen and producing thiamin, riboflavin,
nicotin, indole-3- acetic acid (IAA) and gibberellin, these bacteria participate in plant cell growth [8].
A great number of nitrogen-fixing microorganisms called nitrogen-fixing free living endophytes inhabiting
both root and the stem of plants such as Azospirillum Gluconacetobacter diazotrophicus, Herbaspirillum,
Azoarcus, Enterobacter, Klebsiella, Pseudomona, Azorhizobium, Beijerinckia, Azotobacter [9].
Molecular nitrogen is converted to ammonia by the nitrogenase system in the biological process of
nitrogen fixation. Synthesis of a functional nitrogenase requires the products of nif genes. The structural
gene nifH, as an important nif gene, is involved in the formation of the Fe-protein complex [9]. Nitrogenfixing bacteria can now be identified on the basis of the presence in their genome of nif DNA through PCR
or sequencing techniques [10, 11].
Due to the key role played by the nitrogen-fixing microorganisms in the agricultural soil and the
importance of the metal zinc as an essential micronutrient in biological cycles along with its toxic effect on
the environment, this study aimed at investigating the degree of sensitivity to different concentrations of
zinc, in the form of ZnSO4, of nitrogen fixing microorganisms isolated from the rhizosphere of asparagus
plants in a laboratory environment.
2 Materials and Methods
All chemicals and reagents were purchased from Merk-Germany.
2.1. Soil sampling
Three soil samples were collected during April 2012 in Aznova Behnamir, Mazandaran province-Iran.
Samples were withdrawn at a depth of 0-30 cm below the surface, collected into sterile vials and
transferred to a laboratory. A fraction of each sample was also sent to Babol Geology Laboratory to assay
for both physicochemical properties and the nutrient element content.
2.2. Isolation of nitrogen-fixing microorganisms form agricultural soil
Isolation of nitrogen fixing microorganisms was performed in duplicates by the dilution-pour plates
method (10-1- 10-10) on mannitol N-free agar medium containing: mannitol 10g, K2HPO4 0.75g, MgSO4
0.5g, CaCO3 3g, sodium molybdate 0.02g, agar 18g and H2O dist. 1000 ml. Samples were incubated for 48
h at 30 ºC before being subjected to both microscopic and macroscopic examination. Identification of the
strains was performed using the routine microbiological methods including both biochemical and
molecular tests [12, 13].
2.3. Culture inoculation
Isolated colonies were grown on BHI agar plates at 30 °C for 24 h. Bacterial colonies were then inoculated
into sterile physiological serum and the OD was adjusted to 0.8-1 at 600 nm, equivalent to 5x10-8 cfu/ml.
2.4. Sensitivity assay to different concentrations of zinc sulfate
To assay for the sensitivity of the isolated strains to zinc sulfate, samples of 0.1 -10 mM serial
concentrations of ZnSO4•7H2O [287.34 MW] were prepared in LB broth medium and sterilized. Then 1ml
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
3 of 8
of the bacterial sample was added to each medium and incubated at 30 °C for 24 h on a shaking incubator
prior to measuring the OD at 600 nm.
2.5. Identification of nifH and 16S rRNA genes
2.5.1. Bacterial DNA extraction
Isolated bacteria were cultured in LB medium on a shaking incubator at 30 °C for 18 h. These cultures
were then centrifuged at 12,000 rpm for 2 min. Genomic DNA was extracted using the MBST DNA
Extraction kit.
2.5.2. Polymerase Chain Reaction (PCR) of nifH and 16S rRNA genes
PCR reaction mix was prepared in a 25 μl volume containing 18 μl H2O, 2.5 μl of 10X PCR buffer, 1 μl
dNTPs, 1 μl each of the forward and reverse primers (see below), 1 μl genomic DNA and 0.5 μl Taq DNA
Polymerase. All reagents, Taq polymerase and DNA ladder were purchased from Metabion-Germany.
2.6. Primers for PCR
Primer sequences used in the PCR reactions were as following:
Nif H1 F: TTCCATCAGCAGCTCTTCGA
Nif H1 R: GGCAAAGGTGGTATCGGTAA
ppnif H F: GCAAGTCCACCACCTCC
ppnif H R: TCGCGTGGACCTTGTTG
16S F: AGAGTTGGATCCTGGCTCAG
16S R: AAGGAGGTGATCCAGCCGCA
2.7. Thermocycling conditions
For nifh gene, the PCR thermocycling condition was 95 °C for 3 min (preheating), 95 °C for 30 s, 57 °C
for 30 s, and 72 °C for 45 s for 30 cycles, followed by a final heating at 72 °C for 7 min. The PCR
thermocycling condition for 16S rRNA gene was 95 °C for 3 min (preheating), 95 °C for 60 s, 50 °C for
30 s, and 72 °C for 60 s for 30 cycles, followed by a final heating at 72 °C for 10 min. The PCR product
size was confirmed by electrophoresis on a 1% agarose gel (Bio-Rad-USA).
2.8. Sequencing of the PCR products
PCR products were sent to FazaPazhouh Co. for sequencing using 16S F:
AGAGTTGGATCCTGGCTCAG or 16S R: AAGGAGGTGATCCAGCCGCA primers in an ABI 3730 xl
DNA analyzer.
3 Results
Results obtained from Babol Geology Laboratory revealed a soil sample with a zinc concentration of
3.74 ppm with both normal pH and salinity (Tables 1 and 2). A total of 10 different species of nitrogenfixing bacteria including NFB1: Stenotrophomonas maltophilia, NFB2: Azotobacter chroococcum, NFB3:
Rhizobium radiobacter, NFB4: Stenotrophomonas maltophilia, NFB5: Pseudomonas umsongensis, NFB6:
Pseudomonas geniculate, NFB7: Rhizobium massiliae, NFB8: Bacillus altitudinis, NFB9: Bacillus
aryabhattai, NFB10: Acinetobacter calcoaceticus were isolated from the asparagus rhizosphere and
identified by blast analysis of their 16S rRNA sequences at the NCBI data center.
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
4 of 8
In detecting sensitivity to zinc and MIC determination, Pseudomonas geniculata with a MIC value of 32.7
ppm was the most sensitive. The minimum inhibitory concentration of all the strains in 2 mmol of zinc
sulfate amounted to 130.8 ppm, while the optimal growth rates of bacteria determined by OD analysis
were 0.1 and 0.2 mmol, equivalent to 6.53 and 13 ppm, respectively (Figure 1).
Finally, the reported MIC values were 130.8 ppm (20% frequency) for Pseudomonas umsongensis and
Rhizobium massiliae; 65.39 ppm (10% frequency) for Stenotrophomonas maltophilia; 58.86 ppm (20%
frequency) for Rhizobium radiobacter and Bacillus altitude; 52.32 ppm (30% frequency) for Azotobacter
chroococcum, Stenotrophomonas maltophilia and Acinetobacter calcoaceticus; 45.78 ppm (10%
frequency) for Bacillus aryabhattai; and 32.7 ppm (10% frequency) for Pseudomonas geniculate (Figure
2).
The presence of the band corresponding to the nifH gene using nifH1 forward and reverse primers was
only detected in DNA extracted from NFB2: A. chroococcum strain with a frequency of 10%, while the
band corresponding to the nifH gene using ppnifH forward and reverse primers was observed in NFB4:
Stenotrophomonas maltophilia, NFB3: Rhizobium radiobacter, NFB1: Stenotrophomonas maltophilia,
NFB5: Pseudomonas umsongensis, NFB6: Pseudomonas geniculate and NFB7: Rhizobium massiliae
strains with a 60% frequency (Figure 3).
Table 1: Soil physiochemical decomposition results. Text. S. (Soil Texture); O. C. (Organic Carbon); O.M. )Organic
Material); EC X 10-3 )Electrical Conductivity); T.N.V. )Total Neutralizing Value(; Si.L (silt, loam)
Depth of
soil
sampling
(cm)
SAND %
SILT %
CLAY %
TEXT.S
O.C %
O.M %
pH
EC x 10-3
T.N.V %
0-30
16
64
20
Si.L
1/65
2/85
7/7
0/52
16/25
Table 2: Nutritive elements of the soil
Depth of
soil
sampling
(cm)
Total
Nitrogen
%
Potassium
(ppm)
Magnesium
(ppm)
Iron
(ppm)
Manganese
(ppm)
Zinc
(ppm)
Copper
(ppm)
0-30
0.16
380
232
1.83
4.24
3.74
2.14
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
5 of 8
Figure 1: Growth average of strains in different zinc concentrations in a 24 h period.
Figure 2: MIC values for the bacterial strains in a 24 h period.
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
Figure 3A
6 of 8
Figure 3B
Figure 3: Images of a 1% agarose gel showing the presence of the band corresponding to nifH gene (700 bp) in DNA
extracted from NFB6: Ps. geniculate, NFB5: Ps. umsongensis, NFB3: Rh. radiobacter, NFB7: Rh. massiliae, NFB1:
St. maltophilia, NFB4: St. maltophilia strains (A) and NFB2: A. chroococcum (B) strains. Molecular marker bands
are in bas pairs. No band was detected in NFB10: A. calcoaceticus (A), NFB8: B. altitudinis and NFB9:B.aryabhattai
(B) strains.
4 Discussion
The present study isolated and identified nitrogen-fixing soil-borne bacteria through 16S rRNA
sequencing, and their sensitivity to zinc as well as the presence of nifH gene in these strains were also
studied. All samples were capable of growth in a zinc-free medium, where the only source for nitrogen
was the nitrogen molecule available in the air. These species were shown to have an optimal growth rate in
a medium containing a zinc concentration of 6.53 to 13 ppm, while a zinc concentration beyond 13 ppm
resulted in a growth reduction, and the absence of growth was detected at a zinc concentration of 130.8
ppm. Of the examined species, 30% had a MIC value of 52.32 ppm, while a MIC value of 130.8 ppm was
revealed for 20% of the species.
Babich and Stotzky (1984) investigated the effect of zinc on soil-borne bacteria and showed that 2 mmole
of zinc reduces the activity of bacteria [14]. Cevik and Karaca (2003) showed that bacteria in pot soil are
sensitive to 50 mg kg-1 zinc [15]. In the present study, we determined a threshold value of 13 ppm for soil
Zn to allow the different strains of bacteria to survive, while concentrations greater than 13 ppm resulted in
a linear growth reduction.
In a study performed by Shakibaei et al. (2008), bacteria were sensitive to Zn at 30 ppm [16], a finding
that is in line with our results. Malakootian and Toolabi (2011), studying the sensitivity of waste waterborne bacteria to ZnO nanoparticles, showed that bacteria were not sensitive to an 80 ppm concentration,
while 100 and 1000 ppm concentrations resulted in 36% and 84% bacterial death, respectively [17]. Our
results are not in line with those of the latter study, and the difference could be due to the difference in the
sampling locations as well as the type of microorganisms sampled, in addition to the type of Zn metal
used. Rajapaksha et al. (2004) have also shown that an increasing concentration of Zn for a short period of
time linearly reduces the population size of soil-borne bacteria [18]. In our previous study, we
demonstrated a growth cessation of the nitrogen fixing bacteria Azotobacter chroococcum at a zinc
concentration of 50 ppm [19].
Our PCR results revealed the presence of nifH gene in 70% of the investigated strains. The presence of
nifH gene along with its sequence, identified here, is in agreement with those of others [20].
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
7 of 8
The nifH gene product serves as a component of the nitrogenase system and has a role in the formation of
the Fe-protein complex. It is therefore safe to assume that the presence of the nifH gene is indicative of the
existence of the nitrogenase system and the ability to fix molecular nitrogen [10].
5 Conclusion
In conclusion, the results of the present study demonstrated that of the 10 isolated bacterial strains, all
were sensitive to a 130.8 ppm concentration of zinc, and that a 6.53 ppm concentration of zinc is optimum
for the growth of these bacteria. According to our results, it appears that the optimal activity and growth of
the isolated strains are in the presence of a 6.53 to 13 ppm zinc concentration. The nifH gene was detected
in 70% of the investigated strains, an indication of the presence of the nitrogenase enzyme system, and
thus the ability to fix nitrogen. The absence of the gene in the remaining strains might be due to the
differences in the sequence of this gene in these strains. Finally, it is concluded that increasing the
concentration of zinc in the agricultural soil, may result in lowering the number of beneficial
microorganisms.
References
[1] M. Canli, G. Alti, The relationships between heavy metal (Cd, Cr, Cu, Fe, Pb, Zn) levels and the size of
six Mediterranean fish species, Environ. Pollut, 121 (2003) 129-136.
http://dx.doi.org/10.1016/S0269-7491(02)00194-X
[2] X. Chen, S. Hu, C. Shen, C. Dou, J. Shi, Y. Chen, Interaction of Pseudomonas putida CZ1 with clays
and ability of the composite to immobilize copper and zinc from solution, Bioresour Technol, 100 (1)
(2009) 330-337.
http://dx.doi.org/10.1016/j.biortech.2008.04.051
[3] M. R. Bruins, S. Kapil, F.W. Oehme, Microbial resistance to metals in the environment, Ecotoxicol
Environ Saf, 45 (3) (2000) 198-207.
http://dx.doi.org/10.1006/eesa.1999.1860
[4] R. Ashraf, T. Adam, Effect of heavy metals on soil microbial community and Mung beans seed
germination, Pak. J. Bot, 39 (2) (2007) 626-636.
[5] D. H. Nies, Microbial heavy-metal resistance, Appl. Microbiol. Biotechnol, 51 (1999) 730-750.
http://dx.doi.org/10.1007/s002530051457
[6] N. Tejera, C. Lluch, M.N. Martinez-Toledo, Gonzàlez-López J. Isolation and characterization of
Azotobacter and Azospirillum strains from the sugarcane rhizosphere, Plant and Soil, 270 (2005) 223232.
http://dx.doi.org/10.1007/s11104-004-1522-7
[7] M. E. Eleiwa, E. R. Hamed, H. S. Shehata, Biofertilizers and/or some micronutrients role on wheat
plants grown on newly reclaimed soil, Afr. J. Ecol, 50 (4) (2012) 464-475.
http://dx.doi.org/10.1111/j.1365-2028.2012.01342.x
[8] S. Martyniuk, M. Martyniuk, Occurrence of Azotobacter spp. in some Polish soils, Pol. J. Environ.
Stud, 12 (3) (2003) 371-374.
International Scientific Publications and Consulting Services
International Journal of Cellular & Molecular Biotechnology
http://www.ispacs.com/journals/ijcmb/2013/ijcmb-00003/
8 of 8
[9] E. C. Cocking, Endophytic colonization of plant roots by nitrogen-fixing bacteria, Plant and Soil, 252
(1) (2003) 169-175.
http://dx.doi.org/10.1023/A:1024106605806
[10] C. Franche, K. Lindström, C. Elmerich, Nitrogen-fixing bacteria associated with leguminous and nonleguminous plants, Plant and Soil, 321 (2009) 35-59.
http://dx.doi.org/10.1007/s11104-008-9833-8
[11] E. L. Reinhardt, P. L. Ramos, G. P. Manfio, H. R. Barbosa, C. Pavan, C. A. Moreira-Filho, Molecular
characterization of nitrogen-fixing bacteria isolated from Brazilian agricultural plants at SÃO Paulo
state, Braz. J. Microbiol, 39 (2008) 414-422.
http://dx.doi.org/10.1590/S1517-83822008000300002
[12] J. G. Holt, N. R. Krieg, P. H. A. Sneath, Bergey’s Manual™ of determinative bacteriology, Eds,
Staley J.T. and S.T. Williams, 9th ed. Williams & Wilkins, Baltimore, Md, USA, (1994).
[13] D. J. Brenner, K. R. Krieg, J. T. Staley, Bergey’s Manual of Systematic Bacteriology, Eds, Garrity,
G.M, MI 48824-4320, USA, (2005).
[14] H. Babich, G. Stotzky, Heavy metal toxicity to microbe-mediated ecologic processes: a review and
potential application to regulatory policies, Environ. Res, 36 (1) (1985) 111-137.
http://dx.doi.org/10.1016/0013-9351(85)90011-8
[15] N. Cevik, A. Karaca, Effect of Cadmium, Zinc, Copper and Fluoranthene on Soil Bacteria, Fres.
Environ. Bull, 15 (1) (2006) 55-60.
[16] M. R. Shakibaie, A. Khosravan, A. Frahmand, S. Zare, Application of metal resistant bacteria by
mutational enhancement technique for bioremediation of Copper and Zinc from industrial wastes,
Iran J. Environ. Health Sci. Eng, 5 (4) (2008) 251-256.
[17] M. Malakootian, A. Toolabi, Determining and Comparing the Effect of Nanoparticle CuO, TiO2 and
ZnO in Removing Gram Positive and Negative Bacteria from Wastewater Iran, J Yazd Uni. Healt, 29
(3) (2011) 1-11.
[18] R. M. C. P. Rajapaksha, M. A. Tobor-Kapłon, E. Bååth, Metal Toxicity Affects Fungal and Bacterial
Activities in Soil Differently, Appl. Environ. Microbiol, 70 (5) (2004) 2966-2973.
http://dx.doi.org/10.1128/AEM.70.5.2966-2973.2004
[19] M. Dadook, S. Mehrabian, M. Salehi, S. Irian, Morphological, biochemical and molecular
characterization of 12 N2 fixing bacteria isolated from Mazandaran- Iran and their response to
various zinc concentration, Jund. J. Microbiol, (In Press).
[20] T. Ueda, Y. Suga, N. Yahiro, T. Matsuguchi, Remarkable N2-fixing bacterial diversity detected in
rice roots by molecular evolutionary analysis of nifH gene sequences, J. Bacteriol, 177 (5) (1995)
1414-1417.
International Scientific Publications and Consulting Services