ARTICLE IN PRESS
Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
www.elsevier.com/locate/ympev
Global eukaryote phylogeny: Combined small- and large-subunit
ribosomal DNA trees support monophyly of Rhizaria, Retaria
and Excavata
David Moreira a,¤, Sophie von der Heyden b,1, David Bass b, PuriWcación López-García a,
Ema Chao b, Thomas Cavalier-Smith b
a
Unité d’Ecologie, Systématique et Evolution, UMR CNRS 8079, Université Paris-Sud, Bâtiment 360, 91405 Orsay Cedex, France
b
Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, UK
Received 26 July 2006; revised 11 October 2006; accepted 2 November 2006
Abstract
Resolution of the phylogenetic relationships among the major eukaryotic groups is one of the most important problems in evolutionary biology that is still only partially solved. This task was initially addressed using a single marker, the small-subunit ribosomal DNA
(SSU rDNA), although in recent years it has been shown that it does not contain enough phylogenetic information to robustly resolve
global eukaryotic phylogeny. This has prompted the use of multi-gene analyses, especially in the form of long concatenations of numerous conserved protein sequences. However, this approach is severely limited by the small number of taxa for which such a large number of
protein sequences is available today. We have explored the alternative approach of using only two markers but a large taxonomic sampling, by analysing a combination of SSU and large-subunit (LSU) rDNA sequences. This strategy allows also the incorporation of
sequences from non-cultivated protists, e.g., Radiozoa ( D radiolaria minus Phaeodarea). We provide the Wrst LSU rRNA sequences for
Heliozoa, Apusozoa (both Apusomonadida and Ancyromonadida), Cercozoa and Radiozoa. Our Bayesian and maximum likelihood
analyses for 91 eukaryotic combined SSU+LSU sequences yielded much stronger support than hitherto for the supergroup Rhizaria
(Cercozoa plus Radiozoa plus Foraminifera) and several well-recognised groups and also for other problematic clades, such as the
Retaria (Radiozoa plus Foraminifera) and, with more moderate support, the Excavata. Within opisthokonts, the combined tree strongly
conWrms that the Wlose amoebae Nuclearia are sisters to Fungi whereas other Choanozoa are sisters to animals. The position of some
bikont taxa, notably Heliozoa and Apusozoa, remains unresolved. However, our combined trees suggest a more deeply diverging position
for Ancyromonas, and perhaps also Apusomonas, than for other bikonts, suggesting that apusozoan zooXagellates may be central for
understanding the early evolution of this huge eukaryotic group. Multiple protein sequences will be needed fully to resolve basal bikont
phylogeny. Nonetheless, our results suggest that combined SSU+LSU rDNA phylogenies can help to resolve several ambiguous regions
of the eukaryotic tree and identify key taxa for subsequent multi-gene analyses.
© 2006 Published by Elsevier Inc.
Keywords: SSU rDNA; LSU rDNA; Eukaryotic phylogeny; Combined analysis; Rhizaria; Retaria; Excavata
1. Introduction
For nearly two decades, eukaryote phylogeny has been
studied using SSU rDNA2 as preferred, almost exclusive,
*
Corresponding author. Fax: +33 1 6915 4697.
E-mail address: [email protected] (D. Moreira).
1
Present address: Department of Botany and Zoology, University of
Stellenbosch, Private Bag X1, Matieland 7602, South Africa.
2
Abbreviations used: BP; bootstrap proportion; LSU rDNA; large-subunit ribosomal DNA; ML; maximum likelihood; PP; posterior probability;
SSU rDNA; small-subunit ribosomal DNA.
1055-7903/$ - see front matter © 2006 Published by Elsevier Inc.
doi:10.1016/j.ympev.2006.11.001
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
2
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
marker (for a historical overview see Cavalier-Smith, 2002;
Philippe and Adoutte, 1998; Roger, 1999). Although some
of the earliest eukaryotic molecular phylogenies were constructed using partial LSU rDNA sequences (Baroin et al.,
1988; Perasso et al., 1989), this marker was curiously soon
abandoned under the overwhelming impetus given to the
use of SSU rDNA (Sogin, 1991). Nevertheless, in recent
years a number of studies have demonstrated that any individual marker, including SSU rRNA, has a series of inherent problems that can engender artefactual results when
inferring the global phylogeny of eukaryotes. Among them
are an insuYcient number of informative sites, mutational
saturation, and uneven evolutionary rates across sites and
taxa (Philippe and Adoutte, 1998; Philippe et al., 2000;
Stiller and Hall, 1999). This has prompted eVorts to apply a
total-evidence approach to the reconstruction of eukaryotic
phylogeny by combining diVerent markers into one analysis by direct concatenation (Baldauf et al., 2000; Moreira
et al., 2000; Rodríguez-Ezpeleta et al., 2005) or likelihood
summation (Bapteste et al., 2002). This has provided strong
support for groups whose monophyly was suspected, such
as Plantae (Moreira et al., 2000; Rodríguez-Ezpeleta et al.,
2005) and Conosa (Bapteste et al., 2002), as well as an
improved resolution of internal metazoan phylogeny (Philippe et al., 2005).
A major limitation of this approach is the very reduced
taxonomic sampling for which a large collection of gene
sequences is available, so that many important phyla are
not represented. This problem has been addressed in diVerent ways, one of the most eVective being the massive
sequencing of expressed sequence tags (EST) from diVerent
protist species (Bapteste et al., 2002; de Koning et al., 2005;
Rodríguez-Ezpeleta et al., 2005). Nevertheless, we are still
very far from a comprehensive representation of eukaryotic
diversity. In addition, this approach is diYcult to apply to
organisms that cannot be maintained in pure, or nearly
pure, culture or that resist the extraction of high quality
mRNA. Finally, the computational burden of analysing
huge multi-gene data sets increases substantially with the
addition of more taxa.
The diYcult trade-oV between the merits of a large
amount of sequence information for each taxon and a wide
taxonomic sampling is crucial to the quest for a robust
eukaryotic phylogeny. From a theoretical point of view, an
alternative to the analysis of increasingly longer sequences
for a relatively limited taxon sampling is the use of a larger
taxonomic diversity, even if the number of sites remains relatively small. In fact, several simulation studies have shown
that in many cases the addition of taxa can be more beneWcial than the addition of sites to increase the accuracy of the
phylogenetic tree, even for complex cases prone to be
aVected by artefacts such as long-branch attraction (LBA)
(Graybeal, 1998; Hillis, 1996). For the historical reason
mentioned above and its easy retrieval (by PCR and direct
sequencing), SSU rDNA is the marker with the richest taxonomic representation available today. It is therefore a
good candidate to take part in a combination of few genes
for a wide taxon collection. We have decided to associate it
with a second marker that has been relatively little
explored, the LSU rDNA, considering that both markers
may reasonably be accommodated within a single model of
sequence evolution for a combined analysis. LSU rDNA
oVers the additional advantage of being generally adjacent
to SSU rDNA in the genome so that both markers can be
easily retrieved from uncultured protists from metagenomic
analyses (López-García et al., 2002).
With that aim, we have signiWcantly improved the
taxonomic sampling of LSU rDNA, providing 14
new sequences, enabling us to include six key eukaryotic
groups on LSU trees for the Wrst time: Cercozoa, Radiozoa
( D classical Radiolaria minus Phaeodarea, which appear
to be Cercozoa: Polet et al., 2004; Yuasa et al., 2006), centrohelid Heliozoa and an unknown micro-heliozoan,
Apusomonadida, Ancyromonadida and Jakobea. Maximum likelihood (ML) and, especially, Bayesian analyses of
SSU+LSU rDNA data sets yielded phylogenetic trees with
much better resolution for a wide diversity of eukaryotic
groups than in the corresponding separate SSU and LSU
rDNA analyses. These trees provide support for several
groups (e.g., Conosa, Excavata) that is comparable to that
produced by very large amino acid data sets (Bapteste et al.,
2002; Hampl et al., 2005). We also retrieved intriguing
results, in particular strong support for the monophyly of
the Retaria (Radiozoa and Foraminifera) and indications
of a deep divergence of Ancyromonas (Apusozoa) from
other bikonts. These results suggest that the combination of
both rDNA sequences may provide a valuable marker for
reconstructing global eukaryote phylogeny, with the advantage of the usually easy acquisition of new LSU rDNA
sequences and the already extremely rich SSU rDNA data
base. Combined SSU+LSU rDNA trees can be particularly
useful for identifying key taxa for subsequent EST projects
and multi-gene analyses.
2. Materials and methods
2.1. Protist cultures and DNA extraction
We used culture conditions already described to grow
the two centrohelid heliozoa Sphaerastrum fockii, Pterocystis sp. (von der Heyden, 2004) and an unknown marine
“microheliozoan” (Cavalier-Smith and Chao, 2003a), the
two cryptomonads Cryptomonas ( D Chilomonas) paramecium and Goniomonas sp. ATCC 50108 (von der Heyden
et al., 2004), the four cercozoans Paracercomonas marina
Cavalier-Smith and Bass ATCC 50344 (formerly misidentiWed as Cercomonas longicauda: see Karpov et al., 2006),
Cercomonas sp. strain C-59, Dimorpha-like sp. ATCC 50522
and Thaumatomastix sp. ATCC 50250 (Bass and CavalierSmith, 2004; Cavalier-Smith and Chao, 2003b), and the two
apusozoans Apusomonas proboscidea and Ancyromonas
‘sigmoides’ ATCC 50267 (Cavalier-Smith and Chao,
2003c). Cells were collected and DNA puriWed as described
previously (Cavalier-Smith and Chao, 1995).
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
2.2. Environmental samples and fosmid libraries
A metagenomic library of large DNA fragments
(»35 kbp) was constructed from sea plankton collected
from mesopelagic (500 m) Antarctic water, after Wltration
to retain only the 0.2–5 m biomass fraction. Details on this
library and the screening for fosmid clones with SSU
rDNA genes are in López-García et al. (2002). The two
clones (KW16 and HA2) containing SSU rDNA genes
related to radiolaria were examined also for the presence of
LSU rDNA genes (see below).
2.3. LSU rDNA ampliWcation and sequencing
For both the protist DNA and the environmental
fosmid clones, the LSU rDNA genes were ampliWed by
PCR using speciWc primers 28S-1F (ACCCGCTGAATTT
AAGCAT) and 28S-4R (TTCTGACTTAGAGGCGTTC
AG). PCRs were carried out under the following conditions: 30 cycles (denaturation at 94 °C for 15 s, annealing at
55 °C for 30 s, extension at 72 °C for 2 min) preceded by
2 min denaturation at 94 °C, and followed by 10 min extension at 72 °C. The amplicons were directly sequenced using
the same primers and a set of internal primers, including
28S-568F (TTGAAACACGGACCAAGGAG), 28S-2F
(GCAGATCTTGGTGGTAG), 28S-1611R (CTTGGAS
ACCTGMTGCGG), and 28S-3R (CACCTTGGAGACC
TGCT). All sequences have been submitted to GenBank
under Accession Nos. AY752987–AY752993 and
DQ386164–DQ386169.
2.4. Reclinomonas americana LSU rDNA sequence assembly
A set of partial LSU rDNA sequences (»400–800 bp) of
the jakobid R. americana was generously provided by Drs.
B. Franz Lang, Gertraud Burger and Michael W. Gray.
These sequences were obtained through the Protist EST
Program (PEP: http://megasun.bch.umontreal.ca/pepdb/
pep_main.html). The partial sequences were assembled into
a nearly complete LSU rDNA sequence manually.
3
available sequences were done by neighbour-joining (NJ)
using MUST (Philippe, 1993). This helped to identify the
slowest evolving species (those with the shortest branches)
within each taxonomic group, which were subsequently
analysed in more detail using maximum likelihood (ML)
and Bayesian methods. For some groups (in particular
Conosa and Excavata), most species showed long branches,
so that we were constrained to include them in our analyses.
The conserved positions of the alignment used for phylogenetic reconstruction were chosen using GBLOCKS (Castresana, 2000). For both the ML and Bayesian methods we
applied a general time reversible (GTR) model of nucleotide substitution, with a six-category discrete approximation of a distribution plus invariable sites (GTR++I
model), which was selected using MODELTEST (Posada
and Crandall, 1998) as the best of 56 testable substitution
models. ML trees were reconstructed with PHYML v. 2.4.4
(Guindon and Gascuel, 2003) and bootstrapped using 1000
replicates. Bayesian trees were inferred using MrBAYES 3
(Ronquist and Huelsenbeck, 2003). All the Markov chain
Monte Carlo searches were run with 4 chains for 1,000,000
generations, with trees being sampled every 100 generations. The Wrst 2000 trees were discarded as “burnin”, keeping only trees generated well after those parameters
stabilised. Stabilisation of the chain parameters (tree likelihood, shape parameter and proportion of invariant sites)
was studied with the program TRACER (Rambaut and
Drummond, 2003). Additional Bayesian trees were also
reconstructed using other model speciWcations: GTR++I
with allowance for covarions, GTR++I with intersite rate
autocorrelation, and GTR++I with covarions and intersite rate autocorrelation. For each data set and model speciWcation three independent runs were carried out and the
tree topologies obtained were compared to check whether
they were congruent or not using the Approximately Unbiased (AU) test (Shimodaira, 2002) implemented in the program CONSEL (Shimodaira and Hasegawa, 2001).
Sequence alignments are available upon request.
3. Results and discussion
2.5. Data set construction
3.1. The eukaryotic LSU rDNA tree
The 14 new sequences were added to a data set of LSU
rDNA sequences (»350) retrieved from GenBank (http://
ncbi.nlm.nih.gov/) and aligned using the ED program of the
package MUST (Philippe, 1993). A SSU+LSU rDNA data
set containing 110 taxa was constructed by concatenation
of the aligned SSU and LSU rDNA sequences from each
species. When both markers were not available for the same
species, we concatenated the sequences from two closely
related species (see Supplementary material Table 1).
We have substantially improved the broad-scale taxonomic sampling of the LSU rDNA with 14 new sequences,
especially for groups of uncertain phylogenetic aYnity:
Cryptomonada, Centrohelida, Ancyromonadida, Apusomonadida, Cercozoa and Radiozoa. Bayesian analysis of a
LSU rDNA data set (91 taxa, 1513 sites) yields a tree that
supports with strong posterior probability (PP D 1) the
monophyly of major clades such as opisthokonts, Conosa
and Rhizaria (Fig. 1). In general, support for the diVerent
groups is stronger in the LSU rDNA tree than in the corresponding SSU rDNA tree (see Supplementary material
Fig. 1). This is particularly noticeable for Conosa (PP D 1
vs. 0.63) and Heterokonta (PP D 1 vs. 0.72), whereas other
groups, such as Excavata, are polyphyletic in the SSU
2.6. Phylogenetic analysis
Preliminary phylogenetic analyses of the individual LSU
and concatenated SSU+LSU rDNA data sets including all
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
4
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
Fig. 1. Unrooted Bayesian phylogenetic tree constructed with an LSU rDNA data set (91 taxa, 1513 sites; GTR++I plus covarion model). New
sequences obtained in this work are highlighted in bold. Several long branches were shortened to one fourth of their actual length (labelled 1/4). Numbers
at nodes are posterior probabilities and ML bootstrap proportions (only those higher than 0.50 and 50%, respectively, are shown). Other evidence (Richards and Cavalier-Smith, 2005) indicates that the root of the eukaryote tree lies between unikonts (opisthokonts plus Amoebozoa) and bikonts (all other
eukaryotes, including kingdoms Plantae and Chromista). However, as unikonts do not appear monophyletic on this tree or Fig. 2, both are arbitrarily
drawn as if rooted between opisthokonts and other eukaryotes.
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
rDNA tree but monophyletic in the LSU tree. We do not
Wnd any case where SSU rDNA provides much stronger
support than LSU rDNA for a given node. In all our trees,
posterior probabilities are higher than the corresponding
ML bootstrap proportions (ML BP), in agreement with the
general trend observed in the comparisons between these
two measures of statistical support (Douady et al., 2003;
Erixon et al., 2003; Suzuki et al., 2002).
The SSU and LSU rDNA trees diVer in the position of
several taxa, but all of these concern weakly supported
nodes (PP < 0.80). In fact, an approximately unbiased (AU)
test (Shimodaira, 2002) shows that the two tree topologies
are not signiWcantly diVerent (P D 0.78). To maximise the
phylogenetic information, we therefore also analysed a concatenation of both markers. We considered that both could
be accommodated in a single concatenated analysis with
the same substitution model, GTR++I, since the two
exhibit similar values for several model parameters: similar
nucleotide frequencies, parameter values of the distribution of 0.53 and 0.54, and proportion of invariant sites of
0.13 and 0.16 for the SSU and LSU rDNA, respectively.
That homogeneity could help circumvent problems
encountered when markers with signiWcantly diVerent substitution patterns are analysed together (Bapteste et al.,
2002; Pupko et al., 2002).
3.2. The eukaryotic SSU+LSU rDNA tree
Concatenation of SSU and LSU rDNA sequences
allows the use of over 2500 well conserved sites for phylogenetic reconstruction, excluding all columns that contained a
gap in more than one taxon (the exact number depends on
the set of species analysed). For a few taxa (Didymium sp.,
rotaliid foraminifer, Fucus sp., Mallomonas sp., Goniomonas
sp. and Spathidium sp.), we concatenated SSU and LSU
rDNA sequences from two closely related species because
both gene sequences were not available for exactly the same
species. To study the impact of the taxonomic sampling, we
constructed phylogenetic trees using a variety of species
combinations. Fig. 2 shows an unrooted Bayesian tree with
the largest representation of eukaryotic phyla available for
these markers (91 taxa, 2574 sites). Several deep nodes of
this SSU+LSU rDNA tree show only moderate support,
which indicates that the concatenation of the two markers
is not enough to obtain a global eukaryotic phylogeny with
a good resolution of all nodes. Nevertheless, as in the individual LSU rDNA tree, various eukaryotic supergroups are
supported by strong posterior probabilities (PP D 1), in particular opisthokonts, Conosa and Rhizaria.
The internal phylogeny of opisthokonts shows several
interesting relationships. The nucleariid Wlose amoeba
Nuclearia simplex branches robustly as sister taxon to the
Fungi (PP D 1, ML BP D 95). This result conWrms, with a
larger taxonomic sampling, a previous analysis of opisthokont phylogeny also based on concatenated SSU+LSU
rDNA sequences (Medina et al., 2003) and refuted a putative aYnity with choanoXagellates based on 18S rRNA
5
alone (Cavalier-Smith, 2000). The sisterhood of fungi and
nucleariid amoebae also agrees with a recent multi-protein
sequence analysis (elongation factor 1, actin, -tubulin
and heat shock protein 70) of opisthokont internal relationships (Steenkamp et al., 2005). Our phylogenetic trees also
agree with this multi-protein analysis for the position of
Ichthyosporea, which emerge within a clade also including
Metazoa ( D Animalia) and ChoanoXagellatea (Steenkamp
et al., 2005). This position is also retrieved by phylogenetic
analyses of a data set of concatenated proteins encoded by
mitochondrial DNA (Lang et al., 2002). In our concatenated SSU+LSU rDNA trees Ichthyosporea (represented
by Ichthyophonus hoferi) branch robustly (PP D 1, ML
BP D 99) at that position (Fig. 2). This relationship is also
retrieved using ML tree reconstruction, and it is not
aVected by the use of diVerent combinations of metazoan
sequences, nor even by the inclusion of the fast evolving
sequences characteristic of bilaterian animals (not shown).
A second species frequently classiWed as an ichthyosporean, Capsaspora owczarzaki (Hertel et al., 2002), branches
strongly (PP D 1, ML BP D 86) as sister to choanoXagellates
in our concatenated analysis. This agrees with a recent
analysis of combined SSU+LSU rDNA+actin sequences
(Ruiz-Trillo et al., 2004), although in that analysis the clade
comprising C. owczarzaki, one ichthyosporean and one
choanoXagellate was sister to animals only when the
sequence evolution model took covarions into account. As
mentioned above, our analyses retrieve a more stable topology, with C. owczarzaki always grouping with choanoXagellates in a clade sister to animals independently of the
sequence evolution model applied. This increased stability
could be due to the inclusion of a second choanoXagellate
species in our analyses. Moreover, AU tests carried out
with the SSU+LSU data set show that topologies where the
Ichthyosporea, C. owczarzaki and the ChoanoXagellatea
are constrained to branch as sisters of N. simplex + Fungi
are signiWcantly worse (P < 0.05). The aYnity of C. owczarzaki with choanoXagellates appears to be supported mostly
by the LSU rDNA since, in individual analyses (Fig. 1), this
marker supports this relationship strongly (PP D 0.98, ML
BP D 87), whereas the SSU rDNA yields trees where C.
owczarzaki is sister of I. hoferi with weaker support
(PP D 0.73, ML BP D 54; Supplementary material Fig. 1).
Increasing the sampling of LSU rDNA sequences for other
nucleariid and ichthyosporean species, as well as for other
opisthokonts of uncertain aYnity, such as ministeriids, corallochytreans and Eccrinales (Cafaro, 2005; Cavalier-Smith
and Chao, 2003c; Steenkamp et al., 2005), will help test this
possible reorganisation of opisthokont phylogeny.
Conosa, one of the two subphyla of phylum Amoebozoa
(Cavalier-Smith, 2004), is another group well supported by
the SSU+LSU rDNA analyses (Fig. 2). The two conosan subgroups Archamoebae (represented by species of the genera
Phreatamoeba and Entamoeba) and Mycetozoa (Dictyostelium, Didymium and Physarum) emerge in all Bayesian trees as
sisters with strong support (PP D 1), which is weaker for the
ML analyses (ML BP D 65). Inspection of the bootstrapped
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
6
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
Fig. 2. Unrooted Bayesian phylogenetic tree constructed with a SSU+LSU rDNA data set (91 taxa, 2574 sites; GTR++I plus covarion model). Taxa for
which the SSU and LSU rDNA sequences belonged to diVerent but related species are labelled as ‘composite’ (see Supplementary Material Table 1 for
details). Several long branches were shortened to one fourth of their actual length (labelled 1/4). Triangles indicate the alternative positions for the species
A. sigmoides that were examined using the AU test. Numbers at nodes are posterior probabilities and ML bootstrap proportions (only those higher than
0.50 and 50%, respectively, are shown).
ML trees reveals that this is due to the branching of the foraminiferan sequence within the Conosa in a proportion of
these trees (not shown). Good support is also found for the
sisterhood of Alveolata and Heterokonta (Fig. 2), both by the
Bayesian (PP D0.97) and ML analyses (BP D 81).
In contrast, for a number of groups the concatenated
SSU+LSU rDNA data set did not improve signiWcantly the
results obtained by analysing the genes separately. One case
concerned Plantae, which encompass the three primary
photosynthetic eukaryotic groups: Glaucophyta, Rhodophyta and Viridaeplantae (Moreira et al., 2000; RodríguezEzpeleta et al., 2005). Plantae emerge mixed with some
chromistan groups in our trees; thus neither Plantae nor
Chromista is recovered as holophyletic. One possible
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
source of problems could be the biased nucleotide composition of the rhodophyte sequences, as shown by a chi-square
test (Schmidt et al., 2002), and their faster evolutionary rate
(longer branches) compared with several of the glaucophytes and green plants. The probably spurious attraction
between glaucophytes and cryptophytes, which has already
been noticed in several SSU rDNA analyses (e.g., CavalierSmith and Chao, 2003a; Nikolaev et al., 2004), appears also
to be important in hampering the inference of monophyletic Plantae and Chromista. This attraction seems mostly
due to the SSU part of the SSU+LSU rDNA concatenation
(see Supplementary material Fig. 1), since the LSU rDNA
alone did not support any robust location for these two
groups (Fig. 1).
We observe a similarly inconstant position for centrohelid heliozoa, which very often branch with weak support
close to cryptophytes and glaucophytes (Fig. 2) or as an
independent lineage. Even the monophyly of Heliozoa (centrohelids plus the microheliozoan) remains uncertain, since
the undetermined marine “microheliozoan” (which is probably not a centrohelid) branches far from the two centrohelids (Pterocystis sp. and Sphaerastrum fockii) in many
single-gene trees (Supplementary material Fig. 2), despite
being consistently together on the concatenated trees. It
appears that the two heliozoan branches group together
weakly on 18S rRNA trees when long branch taxa are
excluded and more nucleotides used (Cavalier-Smith and
Chao, 2003c; Nikolaev et al., 2004), but are separate, with
the microheliozoan weakly grouping instead with red algae,
when long branch taxa and fewer nucleotides are included
(Supplementary Fig. 1 and Cavalier-Smith, 2004). Their
grouping together as a weakly supported heliozoan clade
on the concatenated trees that include long branch taxa
(Fig. 2), and with distinctly stronger support when long
branch taxa are excluded and over 900 more nucleotides
used (Supplementary Fig. 2), suggests that the relationship
is real, but additional gene sequences are required to demonstrate it convincingly. Neither our combined SSU+LSU
rDNA analyses nor the Wrst protein phylogenies including
centrohelid sequences (Nikolaev et al., 2004; Sakaguchi
et al., 2005) have resolved the phylogenetic position of this
group within bikonts.
Albeit with only moderate support (PP D 0.72, ML
BP D 67), our combined tree did reproducibly recover the
sister relationship between Rhodophyta and Viridaeplantae, which is only occasionally found on 18S rRNA trees
and was absent from a recent tree using 143 nuclear proteins (Rodríguez-Ezpeleta et al., 2005), probably because of
the very long rhodophyte branch, but is clearly supported
by a shared gene replacement of fructose bis-phosphate
aldolase (Patron et al., 2004).
We also used the SSU+LSU rDNA data set to investigate the phylogeny of Excavata, represented in our analyses
by jakobid, diplomonad, Trichomonas and euglenozoan
sequences. This was a diYcult analysis because the long
branches of most excavates were prone to be attracted by
those of Amoebozoa. Data sets excluding Amoebozoa sup-
7
port the monophyly of Excavata with strong PP (1) but
weak ML BP (56) (not shown). When Amoebozoa are
included, excavates still emerge as a monophyletic group
though with weaker support (PP D 0.87, ML BP D 17)
(Fig. 2). This suggests that the SSU+LSU rDNA data set
contains just enough phylogenetic information to support
the monophyly of excavates even if other fast evolving
groups are included. However, only the Bayesian analysis is
able to retrieve this result, whereas the ML phylogenetic
trees yield a mix of all the long branching amoebozoa and
excavate sequences within an unsupported (ML BP D 28)
group (not shown). Within excavates, our analyses strongly
support (PP D 1, ML BP D 85) the monophyly of the phylum Metamonada (Cavalier-Smith, 2003a), represented by
several diplomonads and the parabasalian Trichomonas
vaginalis (Fig. 2). This agrees with a recent multi-gene (six
nuclear protein-coding genes) phylogeny, which also conWrms the inclusion of Carpediemonas within Metamonada
(Simpson et al., 2006). In our SSU+LSU rDNA trees metamonads branch weakly (PP D 0.64, ML BP D 32) as sisters
of Euglenozoa, and the jakobid Reclinomonas americana
occupies a sister position to all the other excavates,
whereas, in that multi-gene analysis, Euglenozoa were sisters of Reclinomonas and Heterolobosea (Naegleria) with
quite robust support (ML BP D 85). Interestingly, the support in our analyses for the monophyly of all Excavata is
comparable to that found in another recent multi-marker
analysis (SSU rDNA + 8 protein genes) which, in contrast
to our data sets, did not include any other long-branching
taxa that might interfere with the long branches of the excavate species (Hampl et al., 2005).
3.3. The monophyly of Rhizaria and the position of
Foraminifera: evidence for the Retaria?
The determination of new LSU rDNA sequences from
several cercozoan species and two environmental clones
related to the radiozoan groups Taxopodida and Polycystinea allows testing the reliability of grouping these clades,
together with Foraminifera, within the infrakingdom
Rhizaria (Cavalier-Smith, 2002; Nikolaev et al., 2004). In
the recent past, SSU rDNA analyses have provided contradictory results and variable support for this supergroup,
especially because of the extremely fast evolutionary rate of
the foraminiferan sequences that induced LBA artefacts.
Thus, some ML analyses (which did not include radiolarian
sequences) were able to retrieve a relationship between
Foraminifera and Cercozoa only when other fast-evolving
taxa were removed (Berney and Pawlowski, 2003). Nevertheless, more recent analyses (both including radiolarian
sequences) did retrieve the monophyly of Rhizaria, even in
the presence of several fast-evolving groups, but with only
moderate (ML BP D 72; Nikolaev et al., 2004) or very low
(distance ME BP D 20: Cavalier-Smith and Chao, 2003c)
bootstrap values.
Our Bayesian global eukaryotic phylogenetic trees
constructed using both the LSU and SSU+LSU rDNAs
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
8
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
provide much stronger support than hitherto for the
holophyly of Rhizaria (PP 1). They also support
(PP D 0.92–0.97) a clade comprising Foraminifera and
Radiozoa (represented in our analyses by environmental
polycystinean- and taxopodid-related sequences) within the
Rhizaria (Figs. 1 and 2). The monophyly of Rhizaria and
the Foraminifera/Radiozoa grouping are also both reasonably supported by our SSU+LSU rDNA ML tree (78% and
75%). This Foraminifera/Radiozoa clade contradicts some
previous single-gene trees that suggested that the closest
relatives of Foraminifera might be species of the endomyxan cercozoan genus Gromia, which are marine Wlose
testate amoebae. Both SSU rDNA and RNA polymerase
II phylogenies retrieved a relationship with Gromia,
although with only moderate bootstrap support (Berney
and Pawlowski, 2003; Longet et al., 2003). However,
radiozoan sequences were not included in those analyses;
when Radiozoa were included, Foraminifera grouped with
polycystines in SSU rRNA distance analyses with strong
(Cavalier-Smith and Chao, 2003b) or weak support
(Cavalier-Smith and Chao, 2003c). A more recent work
incorporating several radiozoan sequences in a supertree
analysis combining SSU rDNA and actin phylogenies
(Nikolaev et al., 2004) also retrieved sisterhood of Foraminifera and Gromia. However, that was essentially due to the
results of the SSU rDNA analysis, which were incompatible
with those of the actin phylogeny because Foraminifera
showed two deeply divergent actin paralogues, one related
to Gromia and the other to the polycystine Radiolaria.
Another source of information was provided by the
extremely well conserved protein polyubiquitin. One- or
two-amino acid insertions have been found in the
ubiquitin monomer-monomer junctions of the polyubiquitin sequences of Cercozoa (including Gromia) and
Foraminifera (Archibald et al., 2003; Bass et al., 2005).
These insertions appear to be absent in the rest of
eukaryotes studied, including the polycystine Radiozoa
and the Acantharea (Bass et al., 2005). Given the
extraordinary degree of evolutionary conservation of
polyubiquitin, the insertions shared by Foraminifera and
Cercozoa were considered a potentially good character
for the sisterhood of these two groups to the exclusion of
Radiozoa (Bass et al., 2005). However, the case of Phaeodarea shows that these insertions may be not as stable
as previously thought. Although Phaeodarea were considered for a long time to be members of the Radiolaria
(Haeckel, 1887), recent phylogenetic analyses based on
SSU rDNA sequence comparison have robustly shown
that Phaeodarea belong in Cercozoa within the subphylum Filosa (Polet et al., 2004; Yuasa et al., 2006). Nevertheless, their polyubiquitin sequences lack the insertions
between the ubiquitin monomers found in other Cercozoa (Bass et al., 2005). If Phaeodarea really branch within
Cercozoa, they have lost the insertion, which could therefore also be the case for Radiozoa, making this character
unreliable for excluding their possible closer relationship
to Foraminifera.
We have studied this problem using a SSU+LSU rDNA
data set that included a partial 5⬘-end LSU rDNA sequence
(1507 bp) of Gromia oviformis (Pawlowski et al., 1994).
Addition of this sequence to our concatenated SSU+LSU
rDNA data set reduced the number of conserved sites useful for phylogenetic inference (to a Wnal number of »2200,
depending on the set of species retained), but the concatenation was still signiWcantly larger than the separated SSU
and LSU rDNA data sets. As in the global eukaryotic phylogeny (Fig. 2), a Bayesian phylogenetic tree of all rhizarian
sequences plus several slow evolving outgroup species
retrieves with strong statistical support (PP D 1, ML
BP D 100) the monophyly of Foraminifera plus Radiozoa
(Fig. 3A). G. oviformis emerges with equal support at the
base of the other cercozoan sequences. The same result is
obtained when two additional partial foraminiferan
SSU+LSU rDNA sequences are included, despite an even
smaller number of usable sites (2077; Fig. 3B). DiVerent
combinations of outgroup sequences yield the same results
(not shown). However, if Radiozoa are removed from the
data sets, Foraminifera turn out to branch with moderate
support (PP D 0.87, ML BP D 78) as sisters of G. oviformis
(Fig. 3C). Overall these results favour Foraminifera being
more closely related to Radiozoa than to Gromia, and suggest that the placement of Foraminifera within the endomyxan Cercozoa, seen in the absence of radiozoan
sequences, is artefactual.
A speciWc relationship between Foraminifera and
Radiozoa was already advanced by Cavalier-Smith
(1999), who erected an infrakingdom Retaria to accommodate these two groups (Cavalier-Smith, 1999); later
Retaria was reduced in rank to phylum (Cavalier-Smith,
2002), making Radiozoa and Foraminifera subphyla
(Cavalier-Smith, 2003a). However, although our results
support this, the conXicting evidence in the literature
with diVerent taxon samples makes it desirable to verify
the monophyly of Retaria using sequences of several conserved proteins from diVerent members of the Rhizaria,
and to determine whether Radiozoa are sisters of Foraminifera (Fig. 3A) or ancestral to them (Fig. 3B). This relationship should also be tested by new LSU rRNA
sequences from other deeply branching cercozoan
groups, such as Haplosporidia and Phytomyxea (Nikolaev et al., 2004; Reece et al., 2004). If retarian monophyly were conWrmed, this would imply that the amino
acid insertion in the polyubiquitin sequence was reversed
in Radiozoa. However, since all available radiolarian
polyubiquitin sequences have been obtained from specimens directly collected from seawater samples, it cannot
be excluded that they actually belonged to undetected
contaminant organisms (Bass et al., 2005). The possibility
that the root of the Rhizaria lies between the monophyletic phyla Retaria and Cercozoa (with Gromia a deeply
branching member of the endomyxan Cercozoa) suggests
that the ancestral rhizarian might even have been
endowed with an organic and/or mineralised test in its
trophic phase.
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
9
Fig. 3. Bayesian phylogenetic trees of the Rhizaria constructed with SSU+LSU rDNA data sets: (A) 9 rhizarian taxa, 2189 sites; (B) 11 rhizarian taxa,
2077 sites; (C) 7 rhizarian taxa, 2186 sites. GTR++I plus covarion model. Taxa for which the SSU and LSU rDNA sequences belonged to diVerent but
related species are labelled as ‘composite’ (see Supplementary Material Table 1 for details). Several long branches were shortened to one sixth of their
actual length (labelled 1/6). Numbers at nodes are posterior probabilities and ML bootstrap proportions. All the trees were rooted using nine slowly evolving sequences (Cyanophora paradoxa, Gnetum gnemon, Saccharomyces cerevisiae, Suberites Wcus, Prymnesium patelliferum, Perkinsus andrewsi, Prorocentrum micans, Skeletonema pseudocostatum and Pelagomonas calceolata) as outgroup.
3.4. The positions of Ancyromonadida and Apusomonadida
(Apusozoa) remain unresolved
All our SSU+LSU rDNA analyses place the zooXagellate Ancyromonas with the opisthokonts and Conosa, often
branching weakly between these two groups (Fig. 2). This
agrees with the Wrst SSU rDNA phylogenies reconstructed
for this organism (Atkins et al., 2000; Cavalier-Smith,
2000). Support for such separation of Ancyromonas from
other bikonts was strong in the Bayesian analyses (PP D 1)
but weaker in the ML trees (ML BP D 71). The latter
appears to be mainly due to the attraction of Ancyromonas
towards Apusomonas proboscidea observed in several ML
trees, also discussed by Atkins et al. (2000). Cavalier-Smith
(1998a,b) placed Ancyromonas (Ancyromonadida: Cavalier-Smith, 1998a) and Apusomonadida (Apusomonas plus
Amastigomonas) in Apusozoa, later grouping both orders
with Hemimastigida (e.g., Hemimastix, Spironema, for
which sequence data are not yet available) as the class
Thecomonadea within a more narrowly deWned phylum
Apusozoa, which now also includes the class Diphyllatea
(Cavalier-Smith, 2000, 2003a,b). Although on most early
SSU rDNA trees Ancyromonas and Apusomonadida were
separate (but often close) deep branches among the bikonts
(Cavalier-Smith, 2000, 2002, 2004), on some well sampled
gamma-corrected ML and distance trees they do weakly
group together (Cavalier-Smith, 2003a,b; Nikolaev et al.,
2006). It has therefore been unclear whether Thecomonadea and Apusozoa are monophyletic or not (Atkins et al.,
2000; Cavalier-Smith and Chao, 2003a). To test that further
we analysed an additional sequence data set excluding all
long-branch species, which allowed maximising the number
of conserved positions useful for phylogenetic reconstruction (905 additional sites for a total of 3479). Bayesian analyses of this data set also support strongly (PP D 1) the
proximity of Ancyromonas to the opisthokonts and no relationship with A. proboscidea (Supplementary material
Fig. 2). In our Bayesian trees, A. proboscidea branches with
moderate support (PP 7 0.87) within a group containing
Rhizaria, Alveolata and Heterokonta (Fig. 2 and Supplementary Fig. 2). In contrast, the corresponding ML trees
(not shown) join Ancyromonas and A. proboscidea in a
weak monophyletic group (ML BP < 53) sister to the opisthokonts. This leaves open the possibility that these two
Xagellates are indeed related (Cavalier-Smith, 1998a,b,
2000, 2003a,b), but additional sequence data are necessary
to solve this question. In fact, an AU test carried out on the
widest SSU+LSU rDNA data set (91 taxa, Fig. 2) does not
reject the possibility that these two species form a monophyletic group at the base of the bikonts (P D 0.086). We
have also tested topologies where Ancyromonas alone, or
with A. proboscidea, branches as sister to Conosa,
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
10
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
Excavata, Viridaeplantae, Cryptomonada, Haptophyta,
Heliozoa, Glaucophyta, Rhizaria, Rhodophyta, Heterokonta or Alveolata. All of them are rejected (P < 0.05), supporting the deep divergence of Ancyromonas (alone or with
Apusomonas) from all these bikonts in our trees.
This tendency of Ancyromonas to group with opisthokonts and conosans is intriguing (see also Nikolaev
et al. (2006) where Thecomonadea as a whole weakly
occupy this position on the SSU rRNA tree, but other
putative Apusozoa—Diphylleia and Breviata—group
weakly with the excavates). Several lines of evidence suggest
that Amoebozoa are the closest relatives of opisthokonts
(Richards and Cavalier-Smith, 2005; Stechmann and Cavalier-Smith, 2003). Although we do not retrieve this result in
our SSU+LSU rDNA trees, because Ancyromonas appears
even closer to opisthokonts, Amoebozoa are the second
closest group to opisthokonts, and statistical support for
the relative positions of Ancyromonas and Amoebozoa with
respect to opisthokonts is weak (PP D 0.73, ML BP < 54).
Thus our analyses are compatible with the very probable
sisterhood of Amoebozoa and opisthokonts. If we accept
that the root of the eukaryotic tree is between
opisthokonts + Amoebozoa (i.e., unikonts) and the rest of
the phyla (bikonts), one could argue that the aYnity of
Ancyromonas (or Ancyromonas plus apusomonads: Nikolaev et al., 2006) towards the opisthokonts and conosans
might arise because this lineage is really sister to all other
bikonts. Because of its very deep branching near the unikont-bikont divergence, Ancyromonas may be a very
important model for the study of early evolution of eukaryotes as a whole or bikonts in particular. We stress that it
has not yet been established whether Ancyromonas possesses the DHFR-TS fusion gene characteristic of bikonts
(Richards and Cavalier-Smith, 2005; Stechmann and Cavalier-Smith, 2003) or the myosin II gene characteristic of unikonts (Richards and Cavalier-Smith, 2005). We are actively
pursuing this question to clarify its position by these molecular cladistic markers. Also important for clarifying the
basal branching of bikonts and the evolutionary aYnities
and proper circumscription of Apusozoa will be sequences
for other Ancyromonas species and for Micronuclearia, a
non-Xagellate protozoan with cortical and mitochondrial
ultrastructural resemblances to it (Mikrjukov and Mylnikov, 2001), and LSU rRNA sequences for Breviata, which
SSU rRNA trees weakly group with apusomonads or
Ancyromonas, or with Diphylleia and/or loukozoan excavates (Cavalier-Smith, 2003a, 2004; Cavalier-Smith and
Chao, 2003c; Nikolaev et al., 2006; Walker et al., 2006).
(e.g., Baldauf et al., 2000; Hampl et al., 2005; Moreira et al.,
2000; Steenkamp et al., 2005), especially thanks to the construction of the Wrst expressed sequence tag (EST) data
bases for several protist species (Bapteste et al., 2002; Rodríguez-Ezpeleta et al., 2005) and the Wrst phylogenetic inferences made possible by the complete sequencing of a few
protist genomes (e.g., Eichinger et al., 2005). However,
despite great eVorts, especially for massive EST sequencing,
this approach is yielding results at a still relatively slow
pace so that, today, we have a huge number of sequences
but for only a very small number of protist species (Rodríguez-Ezpeleta et al., 2005). In addition to this multi-gene
way, a complementary approach to the challenge of reconstructing the evolutionary history of eukaryotes could be
the use of fewer markers but a much richer taxonomic sampling (Graybeal, 1998). Obviously, SSU rDNA oVers the
best sampling, but we have shown that it can be eYciently
combined with LSU rDNA that, like its small subunit
counterpart, has the advantage of being easy to amplify by
PCR and to sequence, even from uncultured organisms
(López-García et al., 2002). Hence, with relatively modest
eVort it should be possible to gather a SSU+LSU rDNA
database with a rich taxonomic sampling very rapidly. It
will certainly not resolve the entire eukaryotic phylogeny
(see, for example, the ambiguous results for centrohelid
heliozoa) but it can provide a more reliable and more comprehensive backbone that could be useful, among other
things, to identify key species for EST projects.
4. Conclusions
References
For several decades, inference of global eukaryotic phylogeny has been mainly based on single-marker analyses
that, in most cases, have proved to be aVected by a number
of tree reconstruction artefacts (Philippe and Adoutte,
1998). This promoted the preferential use of a multi-marker
approach using increasingly larger multi-gene data sets
Archibald, J.M., Longet, D., Pawlowski, J., Keeling, P.J., 2003. A novel
polyubiquitin structure in cercozoa and foraminifera: evidence for a
new eukaryotic supergroup. Mol. Biol. Evol. 20, 62–66.
Atkins, M.S., McArthur, A.G., Teske, A.P., 2000. Ancyromonadida: a new
phylogenetic lineage among the protozoa closely related to the common ancestor of metazoans, fungi, and choanoXagellates (Opisthokonta). J. Mol. Evol. 51, 278–285.
Acknowledgments
DM and PLG thank the French Centre National de la
Recherche ScientiWque (CNRS), section ‘Dynamique de
la Biodiversité’ for an ATIP grant. TCS thanks the UK
Natural Environment Research Council (NERC) for
research grants and a Professorial Fellowship. S.H. and
D.B. thank NERC for research studentships. T.C.S. and
D.M. thank the Canadian Institute for Advanced
Research Evolutionary Biology Program for Fellowship
and Associateship support. We thank Franz Lang, Gertraud Burger and Michael Gray for providing Reclinomonas sequences.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at doi:10.1016/j.ympev.
2006.11.001.
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., Doolittle, W.F., 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data.
Science 290, 972–977.
Bapteste, E., Brinkmann, H., Lee, J.A., Moore, D.V., Sensen, C.W., Gordon, P., DuruXe, L., Gaasterland, T., Lopez, P., Muller, M., Philippe, H.,
2002. The analysis of 100 genes supports the grouping of three highly
divergent amoebae: Dictyostelium, Entamoeba, and Mastigamoeba.
Proc. Natl. Acad. Sci. USA 99, 1414–1419.
Baroin, A., Perasso, R., Qu, L.H., Brugerolle, G., Bachellerie, J.P., Adoutte,
A., 1988. Partial phylogeny of the unicellular eukaryotes based on
rapid sequencing of a portion of 28S ribosomal RNA. Proc. Natl.
Acad. Sci. USA 85, 3474–3478.
Bass, D., Cavalier-Smith, T., 2004. Phylum-speciWc environmental DNA
analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int. J. Syst. Evol. Microbiol. 54, 2393–2404.
Bass, D., Moreira, D., Lopez-Garcia, P., Polet, S., Chao, E.E., von der Heyden, S., Pawlowski, J., Cavalier-Smith, T., 2005. Polyubiquitin insertions
and the phylogeny of Cercozoa and Rhizaria. Protist 156, 149–161.
Berney, C., Pawlowski, J., 2003. Revised small subunit rRNA analysis provides further evidence that Foraminifera are related to Cercozoa. J.
Mol. Evol. 57 (Suppl. 1), S120–S127.
Cafaro, M.J., 2005. Eccrinales (Trichomycetes) are not fungi, but a clade of
protists at the early divergence of animals and fungi. Mol. Phylogenet.
Evol. 35, 21–34.
Castresana, J., 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17, 540–
552.
Cavalier-Smith, T., 1998a. Neomonada and the origin of animals and
fungi. In: Coombs, G.H., Vickerman, K., Sleigh, M.A., Warren, A.
(Eds.), Evolutionary relationships among Protozoa. Chapman and
Hall, London, pp. 375–407.
Cavalier-Smith, T., 1998b. A revised six-kingdom system of life. Biol. Rev.
Camb. Philos. Soc. 73, 203–266.
Cavalier-Smith, T., 1999. Principles of protein and lipid targeting in secondary symbiogenesis: euglenoid, dinoXagellate, and sporozoan plastid origin and the eukaryote family tree. J. Eukaryot. Microbiol. 46, 347–366.
Cavalier-Smith, T., 2000. Fleagellate megaevolution. In: Leadbeater,
B.S.C., Green, J.C. (Eds.), The Xagellates: Unity, diversity and evolution. Taylor and Francis Limited, London, pp. 361–390.
Cavalier-Smith, T., 2002. The phagotrophic origin of eukaryotes and phylogenetic classiWcation of Protozoa. Int. J. Syst. Evol. Microbiol. 52,
297–354.
Cavalier-Smith, T., 2003a. The excavate protozoan phyla Metamonada
Grassé emend. (Anaeromonadea, Parabasalia, Carpediemonas,
Eopharyngia) and Loukozoa emend. (Jakobea, Malawimonas): their
evolutionary aYnities and new higher taxa. Int. J. Syst. Evol. Microbiol. 53, 1741–1758.
Cavalier-Smith, T., 2003b. Protist phylogeny and the high-level classiWcation of Protozoa. Eur. J. Protistol. 39, 338–348.
Cavalier-Smith, T., 2004. Only six kingdoms of life. Proc. Roy. Soc. Lond.
B 271, 1251–1262.
Cavalier-Smith, T., Chao, E.E., 1995. The opalozoan Apusomonas is
related to the common ancestor of animals, fungi and choanoXagellates. Proc. Roy. Soc. Lond. B. 261, 1–6.
Cavalier-Smith, T., Chao, E.E., 2003a. Molecular phylogeny of centrohelid
heliozoa, a novel lineage of bikont eukaryotes that arose by ciliary loss.
J. Mol. Evol. 56, 387–396.
Cavalier-Smith, T., Chao, E.E., 2003b. Phylogeny and classiWcation of phylum Cercozoa (Protozoa). Protist 154, 341–358.
Cavalier-Smith, T., Chao, E.E., 2003c. Phylogeny of Choanozoa, Apusozoa, and other protozoa and early eukaryote megaevolution. J. Mol.
Evol. 56, 540–563.
de Koning, A.P., Tartar, A., Boucias, D.G., Keeling, P.J., 2005. Expressed
sequence tag (EST) survey of the highly adapted green algal parasite,
Helicosporidium. Protist 156, 181–190.
Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E.J., 2003.
Comparison of Bayesian and maximum likelihood bootstrap measures
of phylogenetic reliability. Mol. Biol. Evol. 20, 248–254.
11
Eichinger, L., Pachebat, J.A., Glockner, G., Rajandream, M.A., Sucgang,
R., Berriman, M., Song, J., Olsen, R., Szafranski, K., Xu, Q., Tunggal,
B., Kummerfeld, S., Madera, M., Konfortov, B.A., Rivero, F., Bankier,
A.T., Lehmann, R., Hamlin, N., Davies, R., Gaudet, P., Fey, P., Pilcher,
K., Chen, G., Saunders, D., Sodergren, E., Davis, P., Kerhornou, A.,
Nie, X., Hall, N., Anjard, C., Hemphill, L., Bason, N., Farbrother, P.,
Desany, B., Just, E., Morio, T., Rost, R., Churcher, C., Cooper, J., Haydock, S., van Driessche, N., Cronin, A., Goodhead, I., Muzny, D., Mourier, T., Pain, A., Lu, M., Harper, D., Lindsay, R., Hauser, H., James, K.,
Quiles, M., Madan Babu, M., Saito, T., Buchrieser, C., Wardroper, A.,
Felder, M., Thangavelu, M., Johnson, D., Knights, A., Loulseged, H.,
Mungall, K., Oliver, K., Price, C., Quail, M.A., Urushihara, H., Hernandez, J., Rabbinowitsch, E., SteVen, D., Sanders, M., Ma, J., Kohara, Y.,
Sharp, S., Simmonds, M., Spiegler, S., Tivey, A., Sugano, S., White, B.,
Walker, D., Woodward, J., Winckler, T., Tanaka, Y., Shaulsky, G.,
Schleicher, M., Weinstock, G., Rosenthal, A., Cox, E.C., Chisholm,
R.L., Gibbs, R., Loomis, W.F., Platzer, M., Kay, R.R., Williams, J.,
Dear, P.H., Noegel, A.A., Barrell, B., Kuspa, A., 2005. The genome of
the social amoeba Dictyostelium discoideum. Nature 435, 43–57.
Erixon, P., Svennblad, B., Britton, T., Oxelman, B., 2003. Reliability of
Bayesian posterior probabilities and bootstrap frequencies in phylogenetics. Syst. Biol. 52, 665–673.
Graybeal, A., 1998. Is it better to add taxa or characters to a diYcult phylogenetic problem? Syst. Biol. 47, 9–17.
Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to
estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–
704.
Haeckel, E., 1887. Report on radiolaria collected by H.M.S. Challenger
during the years 1873–1876. Rep Sci Res Voyage H.M.S. Challenger
1873–76 18, 1–1803.
Hampl, V., Horner, D.S., Dyal, P., Kulda, J., Flegr, J., Foster, P.G., Embley,
T.M., 2005. Inference of the phylogenetic position of oxymonads based
on nine genes: support for Metamonada and Excavata. Mol. Biol.
Evol. 22, 2508–2518.
Hertel, L.A., Bayne, C.J., Loker, E.S., 2002. The symbiont Capsaspora
owczarzaki, nov. gen. nov. sp., isolated from three strains of the pulmonate snail Biomphalaria glabrata is related to members of the Mesomycetozoea. Int. J. Parasitol. 32, 1183–1191.
Hillis, D.M., 1996. Inferring complex phylogenies. Nature 383, 130–131.
Karpov, S.A., Bass, D., Mylnikov, A.P., Cavalier-Smith, T., 2006. Molecular phylogeny of Cercomonadidae and kinetid patterns of Cercomonas
and Eocercomonas gen. nov (Cercomonadida, Cercozoa). Protist 157,
125–158.
Lang, B.F., O’Kelly, C., Nerad, T., Gray, M.W., Burger, G., 2002. The closest unicellular relatives of animals. Curr. Biol. 12, 1773–1778.
Longet, D., Archibald, J.M., Keeling, P.J., Pawlowski, J., 2003. Foraminifera and Cercozoa share a common origin according to RNA polymerase II phylogenies. Int. J. Syst. Evol. Microbiol. 53, 1735–1739.
López-García, P., Rodríguez-Valera, F., Moreira, D., 2002. Towards the
monophyly of Haeckel’s Radiolaria: 18S rRNA environmental data
support the sisterhood of Polycystinea and Acantharea. Mol. Biol.
Evol. 19, 118–121.
Medina, M., Collins, A.G., Taylor, J.W., Valentine, J.W., Lipps, J.H., Amaral-Zettler, L., Sogin, M.L., 2003. Phylogeny of Opisthokonta and the
evolution of multicellularity and complexity in Fungi and Metazoa.
Int. J. Astrobiol. 2, 203–211.
Mikrjukov, K.A., Mylnikov, A.P., 2001. A study of the Wne structure and the
mitosis of a lamellicristate amoeba, Micronuclearia podoventralis gen. et
sp. nov. (Nucleariidae, Rotosphaerida). Eur. J. Protistol. 37, 15–24.
Moreira, D., Le Guyader, H., Philippe, H., 2000. The origin of red algae
and the evolution of chloroplasts. Nature 405, 69–72.
Nikolaev, S.I., Berney, C., Fahrni, J.F., Bolivar, I., Polet, S., Mylnikov, A.P.,
Aleshin, V.V., Petrov, N.B., Pawlowski, J., 2004. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes. Proc. Natl. Acad. Sci. USA 101, 8066–8071.
Nikolaev, S.I., Berney, C., Petrov, N.B., Mylnikov, A.P., Fahrni, J.F., Pawlowski, J., 2006. Phylogenetic position of Multicilia marina and the evolution of Amoebozoa. Int. J. Syst. Evol. Microbiol. 56, 1449–1458.
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001
ARTICLE IN PRESS
12
D. Moreira et al. / Molecular Phylogenetics and Evolution xxx (2006) xxx–xxx
Patron, N.J., Rogers, M.B., Keeling, P.J., 2004. Gene replacement of fructose-1,6-bisphosphate aldolase supports the hypothesis of a single photosynthetic ancestor of chromalveolates. Eukaryot. Cell. 3, 1169–1175.
Pawlowski, J., Bolivar, I., Guiard-MaYa, J., Gouy, M., 1994. Phylogenetic
position of foraminifera inferred from LSU rRNA gene sequences.
Mol. Biol. Evol. 11, 929–938.
Perasso, R., Baroin, A., Qu, L.H., Bachellerie, J.P., Adoutte, A., 1989. Origin of the algae. Nature 339, 142–144.
Philippe, H., 1993. MUST, a computer package of Management Utilities
for Sequences and Trees. Nucleic Acids Res. 21, 5264–5272.
Philippe, H., Adoutte, A., 1998. The molecular phylogeny of Eukaryota:
solid facts and uncertainties. In: Coombs, G., Vickerman, K., Sleigh,
M., Warren, A. (Eds.), Evolutionary relationships among Protozoa.
Chapman and Hall, London, pp. 25–26.
Philippe, H., Lopez, P., Brinkmann, H., Budin, K., Germot, A., Laurent, J.,
Moreira, D., Muller, M., Le Guyader, H., 2000. Early-branching or
fast-evolving eukaryotes? An answer based on slowly evolving positions. Proc. Roy. Soc. Lond. B Biol. Sci. 267, 1213–1221.
Philippe, H., Lartillot, N., Brinkmann, H., 2005. Multigene analyses of
bilaterian animals corroborate the monophyly of Ecdysozoa, Lophotrochozoa, and Protostomia. Mol. Biol. Evol. 22, 1246–1253.
Polet, S., Berney, C., Fahrni, J., Pawlowski, J., 2004. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of
Haeckel’s Radiolaria. Protist 155, 53–63.
Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of
DNA substitution. Bioinformatics 14, 817–818.
Pupko, T., Huchon, D., Cao, Y., Okada, N., Hasegawa, M., 2002. Combining multiple data sets in a likelihood analysis: which models are the
best? Mol. Biol. Evol. 19, 2294–2307.
Rambaut, A., Drummond, A., 2003. TRACER: A program for analysing
results from Bayesian MCMC programs. Version 1.2, Oxford.
Reece, K.S., Siddall, M.E., Stokes, N.A., Burreson, E.M., 2004. Molecular
phylogeny of the Haplosporidia based on two independent gene
sequences. J. Parasitol. 90, 1111–1122.
Richards, T.A., Cavalier-Smith, T., 2005. Myosin domain evolution and
the primary divergence of eukaryotes. Nature 436, 1113–1118.
Rodríguez-Ezpeleta, N., Brinkmann, H., Burey, S.C., Roure, B., Burger, G.,
LoVelhardt, W., Bohnert, H.J., Philippe, H., Lang, B.F., 2005. Monophyly of primary photosynthetic eukaryotes: green plants, red algae,
and glaucophytes. Curr. Biol. 15, 1325–1330.
Roger, A.J., 1999. Reconstructing early events in eukaryotic evolution.
Am. Nat. 154, S146–S163.
Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19, 1572–1574.
Ruiz-Trillo, I., Inagaki, Y., Davis, L.A., Sperstad, S., Landfald, B., Roger,
A.J., 2004. Capsaspora owczarzaki is an independent opisthokont lineage. Curr. Biol. 14, R946–R947.
Sakaguchi, M., Nakayama, T., Hashimoto, T., Inouye, I., 2005. Phylogeny
of the centrohelida inferred from SSU rRNA, tubulins, and actin genes.
J. Mol. Evol. 61, 765–775.
Schmidt, H., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREEPUZZLE: maximum likelihood phylogenetic analysis using quartets
and parallel computing. Bioinformatics 18, 502–504.
Shimodaira, H., 2002. An approximately unbiased test of phylogenetic tree
selection. Syst. Biol. 51, 492–508.
Shimodaira, H., Hasegawa, M., 2001. CONSEL: for assessing the conWdence of phylogenetic tree selection. Bioinformatics 17, 1246–1247.
Simpson, A.G., Inagaki, Y., Roger, A.J., 2006. Comprehensive multigene
phylogenies of excavate protists reveal the evolutionary positions of
“primitive” eukaryotes. Mol. Biol. Evol. 23, 615–625.
Sogin, M.L., 1991. Early evolution and the origin of eukaryotes. Curr.
Opin. Genet. Dev. 1, 457–463.
Stechmann, A., Cavalier-Smith, T., 2003. The root of the eukaryote tree
pinpointed. Curr. Biol. 13, R665–R666.
Steenkamp, E.T., Wright, J., Baldauf, S.L., 2005. The protistan origins of
animals and fungi. Mol. Biol. Evol. 23, 93–106.
Stiller, J., Hall, B., 1999. Long-branch attraction and the rDNA model of
early eukaryotic evolution. Mol. Biol. Evol. 16, 1270–1279.
Suzuki, Y., Glazko, G.V., Nei, M., 2002. Overcredibility of molecular phylogenies obtained by Bayesian phylogenetics. Proc. Natl. Acad. Sci.
USA 99, 16138–16143.
von der Heyden, S., 2004. Testing ubiquitous dispersal and freshwater/
marine divergence in free-living protist groups. DPhil Thesis, University of Oxford.
von der Heyden, S., Chao, E., Cavalier-Smith, T., 2004. Genetic diversity of
goniomonads: an ancient divergence between freshwater and marine
species. Eur. J. Phycol. 39, 343–350.
Walker, G., Dacks, J.B., Embley, T.M., 2006. Ultrastructural description of
Breviata anathema, n. gen., n. sp., the organism previously studied as
“Mastigamoeba invertens”. J. Eukaryot. Microbiol. 53, 65–78.
Yuasa, T., Takahashi, O., Dolven, J.K., Mayama, S., Matsuoka, A., Honda,
D., Bjørklund, K.R., 2006. Phylogenetic position of the small solitary
phaeodarians (Radiolaria) based on 18S rRNA sequences by single cell
PCR analysis. Marine Micropal. 59, 104–114.
Please cite this article in press as: Moreira, D. et al., Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA
trees support monophyly of Rhizaria, Retaria and Excavata, Mol. Phylogenet. Evol. (2006), doi:10.1016/j.ympev.2006.11.001