Plasticity and function of
human skeletal muscle in relation
to disuse and rehabilitation:
Influence of ageing and surgery
Charlotte Suetta
Forsvaret finder sted fredag den 20. maj 2016, kl. 14.00 i Auditoriet på Medicinsk Museion, Bredgade 62, 1260 København K.
Plasticity and function of
human skeletal muscle in relation
to disuse and rehabilitation:
Influence of ageing and surgery
Charlotte Suetta
Institute of Sports Medicine,
Department of Orthopedic Surgery M, Bispebjerg Hospital
Centre for Healthy Aging,
Faculty of Health and Medical Sciences, University of Copenhagen
Department of Clinical Physiology, Nuclear Medicine & PET
Rigshospitalet Glostrup, University of Copenhagen
The Faculty of Health and Medical Sciences at the University of Copenhagen
has accepted this dissertation for public defence for the doctoral degree in
Medical Science, Copenhagen, 10 March 2016.
1. THE PRESENT THESIS IS BASED ON THE
FOLLOWING PAPERS:
Ulla Wewer, Head of Faculty
I. Suetta C, Magnusson SP, Rosted A, Aagaard P, Jakobsen AK, Larsen
LH, Duus B, Kjaer M. Resistance training in the early post-operative
phase reduces hospitalization and leads to muscle hypertrophy in elderly hip surgery patients – a controlled randomized Study. J Am
Geriatr Soc. Dec;52(12):2016-22, 2004
II. Suetta C, Aagaard P, Rosted A, Jakobsen AK, Duus B, Kjaer M, Magnusson SP. Training-induced changes in muscle CSA, muscle strength,
EMG and rate of force development in elderly subjects after longterm unilateral disuse. J Appl Physiol. 97, 1954-1961, 2004
III. Suetta C, Andersen JL, Dalgas U, Berget J, Koskinen SO, Aagaard P,
Magnusson SP, Kjaer M: Resistance training induces qualitative
changes in muscle morphology, muscle architecture and muscle function in elderly postoperative patients. J Appl Physiol. 2008
Jul;105(1):180-6.
IV. Suetta C, Clemmensen C, Andersen JL, Magnusson SP, Schjerling P,
Kjaer M. Coordinated increase in skeletal muscle fiber area and expression of IGF-1 with resistance exercise in elderly postoperative
patients. Growth Horm IGF Res. 2010 Apr;20(2):134-40.
V. Suetta C, Aagaard P, Magnusson SP, Andersen LL, Sipilä S, Rosted A,
Jakobsen AK, Duus B, Kjaer M: Muscle size, neuromuscular activation
and rapid force characteristics in elderly men and women - effects of
unilateral long-term disuse due to hip-osteoarthritis. J Appl Physiol.
2007 Mar;102(3):942-8.
VI. Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K, Simonsen L, Ortenblad N, Magnusson SP, Kjaer M, Aagaard P. Effects of ageing on human skeletal muscle after immobilisation and re-training. J
Appl Physiol. 2009 Oct;107(4):1172-80
VII. Suetta C, Frandsen U, Jensen L, Munk Jensen M, Jespersen JG,
Hvid LG, Bayer M, Petersson SJ, Schrøder HD, Andersen JL, Heinemeier KM, Aagaard P, Schjerling P, Kjaer M. Aging affects the transcriptional regulation of human skeletal muscle atrophy. PLoS One
2012;7(12):e51238
VIII. Suetta C, Frandsen U, Mackey A, Jensen L, Hvid LG, Bayer M, Petersson SJ, Schrøder HD, Andersen JL, Aagaard P, Schjerling P, Kjaer
M. Aging is associated with diminished muscle re-growth and myogenic precursor cell expansion in the early phase after immobility-induced atrophy in human skeletal muscle. J Physiol. 2013 Aug 1;591(Pt
15):3789-804.
IX. Hvid LG, Suetta C, Nielsen JH, Jensen MM, Frandsen U, Ørtenblad N,
Kjaer M, Aagaard P. Aging impairs the recovery in mechanical muscle
function following 4 days of disuse. Exp Gerontol. 2014 Apr;52:1-8.
Opsætning: Datagraf Communications A/S
ISBN 978-87-92997-16-6
4 Study I, II & V has previously been part of the PhD dissertation “Muscle
function in the elderly after hip-replacement surgery – effects of long-term
disuse and physical training.” Faculty of Health, University of Copenhagen,
June 2004.
2. PREFACE
The present thesis is based on experimental work performed
during my employment at Institute of Sports Medicine Copenhagen (ISMC), Bispebjerg Hospital as a research fellow from
2000-2003 and in a Post-doc position from 2005-2008.
A large number of persons have been important to make
this possible, but most of all I am deeply grateful to Professor,
DMSci Michael Kjær for being an inspiring and supportive supervisor and mentor. His thorough knowledge in physiology
and pathophysiology combined with his scientific and human
generosity has been an invaluable help and immense inspiration.
Associate professor, PhD, MSci Ulrik Frandsen deserves
unlimited gratitude for his scientific enthusiasm, inspiring discussions, innovative ideas and fruitful collaboration.
I also wish to thank all my co-authors and colleagues for
sharing and contributing with their highly skilled expertise and
effort. In particular, Professor, DMSci Peter Magnusson for his
analytical skills and support, Associate professor, PhD, MSci
Abigail Mackey for her outstanding work on the stem cell analyses and PhD, MSc Jesper Løvind Andersen for sharing his
knowledge and invaluable help with the vast number of muscle biopsies analysed throughout the years. Special thanks also
goes to PhD, MSc Peter Schjerling for his expertise and dedicated help with the gene expression analyses and PhD, MSc
Lars Hvid for his enthusiastic assistance and positive attitude
during the long experimental hours. Further, I would like to
thank the laboratory staff at Institute of Sports Medicine
Copenhagen for their invaluable help, for which I am truly
grateful.
I would also like to express my gratitude to Professor,
DMSci Jens Bülow and Consultant, MD, DMSci Lene Rørdam
for sharing their outstanding expertise in Clinical Physiology
and Nuclear Medicine and most of all for their support and
help whenever needed. My warmest gratitude also goes to
MD, DMSci Erik Martin Jensen for being a supportive and outstanding mentor.
Further, I would like to express my deepest gratitude to all
the patients and participants who volunteered to participate
in the experiments and dedicated their time and muscle tissue
to make our experiments possible.
The financial support from IMK-almene Fond, H:S Research
Foundation, The Danish National Research Foundation, The
Research Foundation at Bispebjerg hospital, The A.P. Møller
and Chastine Mc-Kinney Møller Foundation, The Danish
Rheumatology Association, Faculty of Health Sciences,
University of Copenhagen, The Danish Ministry of Culture,
Lundbeck Foundation and the Nordea Founda­tion (Healthy
Ageing Grant) is gratefully acknowledged.
Finally, I wish to thank my parents for their unlimited support and Sophia, Ina, Line and Søren for being just the way
they are. Most of all, I would like to thank my husband, friend
and colleague Per Aagaard for his support, encouragement
and enthusiasm in all aspects of science and life.
Copenhagen, May 2015
Charlotte Suetta
5
3. LIST OF CONTENT
1. List of papers4
2. Preface5
3. List of content6
4. Introduction7
5. Material and methods8
5.1Subjects
8
5.2Immobilisation protocols
8
5.3Re-training procedure
8
5.3.1Hip-replacement patients
8
a. Home-Based Standard Rehabilitation
9
b. Neuromuscular Electrical Stimulation
9
c. Resistance exercise
9
5.3.2Re-training subsequent to immobilisation
9
5.4Functional capacity
10
5.5Mechanical muscle function
10
5.5.1Isokinetic muscle strength
10
5.5.2Interpolated twitch technique (ITT)
10
a. Resting muscle twitches
10
b. Superimposed twitches
10
5.6Muscle size and architecture
10
5.6.1Computed tomography (CT
10
5.6.2Magnetic Resonance Imaging (MRI)
11
5.6.3Ultrasound (UL)
11
5.6.4Dual-energy X-ray absorptiometry (DEXA)
11
5.7Neural activation.
11
5.7.1Electromyographic recordings (EMG) 11
5.8Cellular and molecular analyses
11
5.8.1Muscle fibre CSA and fibre type composition 12
5.8.2Myogenic stem cells and myonuclei
12
5.8.3Gene expression analyses
13
5.8.4Protein quantification 13
6  6. Results & discussion13
6.1Effects of skeletal muscle disuse 13
6.1.1 The impact of chronic disuse on aged human 13
skeletal muscle
a. Skeletal muscle size and architecture
13
b. Neuromuscular function
14
6.1.2 The effect of ageing on skeletal muscle disuse 14
a. Changes in muscle size and muscle
15
architecture
b. Changes in neuromuscular function
15
c. Molecular regulation of muscle
17
disuse-atrophy
6.2Re-growth of human skeletal muscle
18
6.2.1 Effects of re-training in elderly postoperative 18
patients
a. Skeletal muscle size and architecture 19
b. Neuromuscular function and functional
19
capacity
c. The effect of post-operative re-training on 20
the IGF-1 pathway
6.2.2 The effect of ageing on skeletal muscle 21
re-growth
a. Skeletal muscle size and architecture
21
b. Neuromuscular function
22
c. Myogenic stem cells
22
d. Molecular regulation of muscle re-growth 23
 7. Major conclusions24
 8. Perspectives25
 9. Summary26
10. Danish summary26
11. References27
4. Introduction
In humans skeletal muscle tissue accounts for about 40%
of the total body mass and, in addition to being a a crucial
factor for locomotion, skeletal muscle represent a key element in maintaining metabolic function and as an energy
reservoir in catabolic conditions. Thus, deteriorations in
the contractile and metabolic properties of skeletal muscle
have significant negative effects on human health and even
short periods of muscle disuse rapidly leads to a number of
negative consequences, such as skeletal muscle atrophy (Wall
et al., 2014) reduced muscle strength (Deschenes et al.,
2008;Hvid et al., 2013;Wall et al., 2014) and a decline in basal
metabolic rate (Haruna et al., 1994) in otherwise healthy individuals.
In parallel, the loss of muscle mass observed with ageing
i.e. sarcopenia and the concomitant decline in muscle strength
and power have extensive consequences for the elderly since
associated with an impaired ability to perform tasks of daily
living, along with an increased risk of disability and mortality
(Metter et al., 2002;Rantanen et al., 2000). Moreover, periods
of skeletal muscle disuse due to a higher degree of comorbidity and hospitalisation per se results in a rapid and accelerated loss of skeletal muscle mass (Janssen et al., 2002). In
fact, immobilisation due to major surgery and hospitalisation
markedly increases the risk of deterioration in muscle function, often leading to onset of disability in frail elderly individuals (Covinsky et al., 2003;Kortebein, 2008). In addition,
the re­covery of losses in muscle mass and muscle strength
is often very slow (Visser et al., 2000;Trudelle-Jackson et al.,
2002; Reardon et al., 2001a) and many elderly patients fail
to regain the level of function that was present prior to hospital admission (Covinsky et al., 2003;Visser et al., 2000;Hirsch
et al., 1990; Sager et al., 1996). Thus attempts to counteract
the muscle atrophy associated with surgery and hospitalisation in the elderly seem highly relevant. We therefore set to
investigate the mode and magnitude of muscle activity
required to effectively counteract the decline in muscle mass
and function associated with surgery and hospitalisation
(Study I-IV).
The observation that skeletal muscle disuse leads to substantial atrophy is far from new and the negative effects of
unloading on skeletal muscle are relatively well described in
young individuals (Berg & Tesch, 1996;Berg et al., 1997;de
Boer et al., 2007a;Hespel et al., 2001;LeBlanc et al., 1997). In
contrast, very little is known about how immobilisation and
skeletal muscle disuse affects skeletal muscle size and function in old adults (Urso et al., 2006;Deschenes et al., 2008;
Kortebein et al., 2007a). Thus, our present knowledge is primarily based on animal data where hind-limb suspension (HS)
has been used as a model of muscle unloading to investigate
the underlying mechanisms associated with disuse muscle atrophy in aging (Vandervoort, 2002a;Alway et al., 2001;Alway
et al., 2003;Aagaard et al., 2010a;Bodine et al., 2001b;Booth &
Seider, 1979;Booth & Gollnick, 1983;Brown & Hasser, 1996;
Brown & Hasser, 1996;Desche­nes et al., 2003;Desplanches et
al., 1987). Although it is evident that aging leads to a multitude
of changes in the neuromuscular system that are similar to
those evoked by unloading (Vandervoort, 2002a; Aagaard et
al., 2010a), the lack of research into the effect of unloading in
elderly humans makes it difficult to ascertain what effects can
be attributed to a decreased physical activity per se and which
to the aging process, as such. An important question is therefore whether processes responsible for the loss of muscle
mass due to acute or chronic disuse are similar to those underlying sarcopenia and additionally, whether skeletal muscle disuse leads to similar effects in old and young individuals. On
this background, studies V and VI were carried out, in order to
investigate the effects of skeletal muscle disuse in aged individuals, initially in individuals exposed to chronic disuse (Study
V) while in Study VI, we intended to discriminate between the
differential effects of a defined period of muscle disuse and
aging per se.
Moreover, based on previous animal data demonstrating
an attenuated recovery response after immobilisation and injury in old compared to young muscle tissue (Brooks &
Faulkner, 1990;Cha­kravarthy et al., 2000;Grounds, 1998; Zar­
zhevsky et al., 2001) we investigated the ability of young and
older individuals to recover muscle mass and mechanical muscle function after 14 days and 4 days of immobilisation, respectively (Study VI and IX).
At the molecular level effective cellular communication is
known to play an essential role in skeletal muscle plasticity and
in adult skeletal muscle tissue the size of the muscle is, in essence, determined by the relative rates of protein synthesis
and protein degradation (Glover et al., 2008). Thus, skeletal
muscle atrophy is a consequence of a reduction in muscle protein synthesis and/or an increase in protein degradation. How­
ever, despite the existence of several robust candidate pathways (Rennie et al., 2004;Sandri, 2008), the molecular
mechanisms responsible for the regulation of skeletal muscle
atrophy and the subsequent restoration in skeletal muscle
mass in response to exercise based rehabilitation are relatively
unknown, particularly in humans. A better understanding of
the pathways regulating myofibrillar protein synthesis and protein degradation in humans and their temporal relationship
to changes in muscle function and lean mass is hence of considerable clinical importance and has far-reaching implications
to counteract muscle wasting during periods of skeletal muscle
disuse. In animal models, loss of muscle mass with immobilisation or unloading has been shown primarily to occur through
an accelerated degradation of myofibrillar proteins via the
ubiquitin-proteasome pathway (Bodine et al., 2001a;Gomes
et al., 2001). Somewhat in contrast, studies in young human
individuals have suggested that a decline in protein synthesis
rather than accelerated protein breakdown is responsible
for the atrophy related muscle loss (de Boer et al., 2007b;
Gibson et al., 1987;Glover et al., 2008). With aging, loss of muscle has been associated with increased inflammation (Bruuns­
gaard & Pedersen, 2003) and decreased anabolic signalling
(Cuth­bert­son et al., 2005), increased apoptosis (Dirks & Leeu­
wenburgh, 2002;Dupont-Verste­egden, 2005), impaired myogenic responsiveness (Carlson et al., 2009;Conboy et al., 2005;
Grounds, 1998) as well as decreased mitochondrial function
(Mar­cinek et al., 2005). Moreover, aging has been found to affect signalling pathways that regulate myogenic growth factors
and myofibrillar protein turnover in skeletal muscle of rodents
7
(Alway et al., 2001). In order to investigate some of these cellular and molecular mechanisms suggested being responsible
for the age-related changes in skeletal muscle with disuse and
recovery, including the differential involvement and time
course of such signalling pathways, Study VII and VIII was carried out.
The present thesis provides an overview of the information gathered from Study I-IX and the current knowledge
about the plasticity of aging muscle in relation to disuse and
re-training.
5. Material and methodS
While relevant details related to Material and Methods are described below, more detailed information can be found in the
respective articles.
5.1 Subjects
The patient population recruited for Study I-V consisted of patients scheduled for a primary unilateral hip-replacement operation at Bispebjerg University Hospital, Copenhagen, Denmark from May 2000 to May 2002. Eligibility criteria included;
age 60 years or older, unilateral primary hip replacement due
to primary hip osteoarthritis in patients without cardiopulmonary, neurological or cognitive problems. In the two immobilisation studies (Study VI – IX) comparable groups of healthy
young (20-30 years) and elderly (60-75 years) individuals were
recruited. Prior to inclusion, all subjects were screened by a
physician to exclude individuals with cardiovascular disease,
diabetes, neural- or musculoskeletal diseases, inflammatory or
pulmonary disorders or any known predisposition to deep venous thrombosis. Anthropometrical data of the patients and
subjects are provided in Table 1.
Table1.Anthropometricaldataofthestudyparticipants
Study
N=
Age
RetrainingafterHip-replacement
StudyI-IV
Conventionalrehab
NMES
Resistancetraining
Chronicdisuse
StudyV
Men
Women
4daysimmobilisationstudy
StudyVII,IX
Young
Old
14daysimmobilisationstudy
StudyVII,VIII
Young
Old
8 5.2 Immobilisation protocols
Two different immobilisation studies were conducted. In the
first experiments (Study VI, VII & VIII), subjects had one lower
limb immobilised for 14 days by unilateral whole-leg casting
using a lightweight fibre cast applied from just above the
malleoli to just below the groin. The cast was positioned in 30
degrees of knee joint flexion to circumvent walking ability of
the casted limb and the subjects were carefully instructed to
perform all ambulatory activities on crutches and abstain from
ground contact as well as performing isometric contractions of
quadriceps of the immobilised leg.
In the following short-term study (Study VII & IX), subjects
had a randomly assigned leg immobilised for 4 days using a
knee brace (DonJoy, Orthopedics, Sunny Vista, CA, US) fixated
at a knee angle of 30 degrees (similar to the cast). Using a kneebrace instead of a whole-leg cast enabled us to obtain muscle
biopsies during the immobilisation period without removing the
brace. Both methods have previously been shown equally effective of inducing muscle atrophy in young individuals (de Boer et
al., 2007a;Deschenes et al., 2008;Hespel et al., 2001). Similarly
to the 14 days immobilisation intervention, subjects were provided with crutches during the immobilisation period.
5.3 Re-training procedures
5.3.1 Hip-replacement patients
Patients were stratified by age and sex and randomly allocated
to one of three groups: home-based standard rehabilitation
(SR), SR plus unilateral lower-limb resistance training (RT), or
SR plus unilateral neuromuscular electrical stimulation (ES).
The RT and electrical stimulation (ES) groups performed the
additional training or received ES on the operated leg, so the
non-operated side could serve as a within-subject control.
Gender
Bodyweight
Height
BMI
2
12
11
13
(years)
68(62-78)
69(60-75)
69(60-86)
19
20
69(60-79)
70(60-86)
5M/7W
5M/6W
7M/6W
M
W
(kg)
81.3±5.8
79.0±4.2
77.8±4.5
(cm)
169.8±2.1
167.7±2.8
168.0±2.0
(kg/m )
28.2±1.7
27.9±0.9
27.4±1.4
85.8±3.6
71.5±3.6
173±2.0
163±1.0
29±1.0
27±1.0
11
11
24.3(21-30)
67.2(60-72)
M
M
74.3±2.4
87.7±3.0
180.4±2,7
178.8±1.7
22.9±0.5
27.5±0.6
11
9
24.4(21-27)
67.3(61-74)
M
M
72.2±2.3
84.8±3.4
181.4±1.8
178.7±2.6
22.1±0.5
26.3±0.5
5.3.1.a Home-Based Standard Rehabilitation
All three intervention groups were provided the same standard rehabilitation procedure for hip-replacement patients at
Bispebjerg Hospital. The standard rehabilitation program consisted of 15 functional exercises with no use of external loads.
The SR group was instructed to perform the exercises twice a
day and attend weekly control sessions in the Physical Therapy
department, during which an experienced physical therapist
guided them through all the exercises to ensure they were performed correctly. Identical instructions were given to the two
other treatment groups.
5.3.1.b Neuromuscular Electrical Stimulation ((NMES)
The ES group began the stimulation program on the operated
leg the day after hip surgery. Patients were carefully instructed in the use of the stimulator and the placement of the
electrodes. The stimulator was a pocket-sized battery-ope­
rated unit (Elpha 2000, Biofina, Denmark) that delivered a
constant biphasic current (0–60 mA). After careful preparation
of the skin, two stimulation electrodes (Bio-Flex, 50 x 89
mm, Biofina A/S; Odense, Denmark) were placed over
the quadriceps muscle belly 5 cm below the inguinal ligament
and 5 cm above the patella. The pulse rate was 40 Hz, with
a pulse width of 250 µs, and stimulation time of 10 s, followed by 20 s of rest (Hartkopp et al., 2003). The amplitude increased and decreased gradually during the first
and last 2 s. The intensity of the stimulation was adjusted
according to patient tolerance, at maximal tolerable
stimulus intensity. The total stimulation time was 1 h/d for
12 weeks, and all patients registered total stimulation
time and intensity. After discharge from the hospital, the stimulator was used at home, and weekly controls were conduc­
ted.
5.3.1.c Resistance exercise
Resistance training was performed as unilateral progressive exercise for the operated lower limb. The post-operative training
was initialized the first day after surgery and consisted of daily
knee extension exercises (3 x 10 reps) in a seated position with
sandbags strapped around the ankle. As soon as possible (~day
5-7 post surgery) training was performed by use of adjustable
leg-press and knee-extension machines (Techno gym International) three times per week. Following a brief 10 min warm-up
on a stationary bicycle, knee-extension and leg-press exercises
were performed. A trained physical therapist carefully supervised all training sessions. Training intensity was progressively
increased in intensity from 20 RM (~50% of 1-RM) the first
week, 15 RM (~65% of 1-RM) during week 2-4, 12 RM (~70% of
1-RM) during week 5-6 and 8 RM (~80% of 1-RM) the last six
weeks. Training loads were carefully adjusted on a weekly basis,
measured by a multiple-RM testing based on goal repetitions,
to ensure that all patients exercised at the intended intensity.
5.3.2 Re-training subsequent to immobilisation
The re-training protocol for the 2 weeks immobilisation protocol consisted of a 4 weeks supervised resistance exercise for
the intervention leg that was fairly similar to the above program (cf. 5.3.1c) during week’s two to six. The program was
previously shown to elicit increases in muscle size and maximal
muscle strength in elderly individuals (Esmarck et al., 2001).
Training sessions were carried out three times per week and
after a 10 min warm-up on a stationary bike, subjects performed knee extension, leg press, and knee flexion, with all the
machines being adjustable (Technogym International). The
subjects were instructed to use moderate (~1-2 s) and slow
speed (~3-4s) in the concentric and eccentric contraction phases, respectively. Load intensity was 3-4 sets x 12 reps (at 15
Table2.OverviewofmethodsusedinStudyI-IX
Study
I
II
III
IV
V
VI
VII
VIII
IX
Functionalperformance
X
X
X
X
Dynamometry
Interpolatedtwitch
SurfaceEMG
CTImaging
MRImaging
UltrasoundImaging
DexaImaging
Musclebiopsyanalyses
Geneexpressionanalyses
WesternBlottinganalyses
Satellitecellanalyses
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
9
repetition maximum (RM)) in week 1, followed by 5 sets x 10
reps (at 12 RM) in weeks 2 and 3, and 4 sets x 10 reps (at 12
RM) in week 4. Training loads were determined and progressively adjusted on a weekly basis by use of 5-RM testing. The 7
days re-training protocol following 4 days of immobilisation
was designed in a similar way as the first week of the 4 week
re-training period with a load intensity of 3-4 sets x 12 reps (at
15 RM) determined by use of 5-RM testing.
5.4 Functional capacity
To evaluate changes in functional performance in the group of
hip-replacement patients (Study I) a number of functional parameters were obtained that have previously been shown to
correlate significantly with risk of physical disability, dependency and falls (Dargent-Molina et al., 1996;Janssen et al.,
2002). Maximal gait speed over a 10-meter course was measured to the nearest 0.1 s and stair-climbing performance was
measured as the time to ascend 10 steps (height 20 cm). Both
tests were started from a standing position and stopped when
both feet were at the determined ending position. The ability
to rise from a chair (Sit-to-stand test) was measured on a
standardised chair, as the 5-repetition time to the nearest 0.1
s. Furthermore, maximum stair walking power per kg body
mass (watt/kg) was calculated as the distance of vertical displacement of the body centre mass times g (9.81 m/s2), i.e.
the change in potential energy, divided by the fastest time of
stair ascent (Study III). Each subject performed three trials, and
the stairs consisted of 10 steps each with a height of 16.5 cm
leading to a total vertical displacement of 1.65 m.
All three tests are highly validated showing high test-retest
reliability and with strong relationships to muscle strength, frailty and mortality (Guralnik et al., 1995;Rantanen et al., 2000;
Rantanen et al., 2003). Moreover, the tests are easy to carry
out, cheap and not very time-consuming. There are, however,
also certain limitations of these tests. The most important being
a relatively low sensitivity and an early ceiling effect, which
makes them best suitable for frail populations.
5.5 Mechanical muscle function
5.5.1 Isokinetic muscle strength
To assess mechanical muscle function, isokinetic dynamometry (Kinetic Communicator, Chattecx, Chattanooga, TN, KinCom) was employed in Study I-III, V-VII and IX. Dynamic muscle
strength was measured as the maximal voluntary isokinetic
knee extensor moment (peak moment, Nm) during concentric
quadriceps contraction performed at slow (60°/s) and fast
(180°/s) knee joint angular velocity. Maximal isometric quadriceps and hamstring muscle strength were assessed at a 60°
knee joint angle (0° = full knee extension) and the trial with the
highest maximal voluntary contraction moment (MVC) was selected for further analyses of rate of force development (RFD)
and contractile impulse (Aagaard et al., 2002). Individual settings of the seat, backrest, dynamometer head and lever arm
length was registered, so identical positioning was ensured for
each subject at all time-points. All measurements were performed on both thighs, and were preceded by a familiarisation
trial conducted on a separate day. Verbal encouragement was
given and visual feedback was provided as a real-time display
10 of the force output (Kellis & Baltzopoulos, 1997). Successive
trials were performed until peak moment could not be improved any further (Aagaard et al., 2002), which typically included 7-9 attempts at each velocity. Reliability and validity of
the KinCom dynamometer has been verified in detail by Farrell
& Richards and is characterized by a high validity and reliability
(Farrell & Richards, 1986). Furthermore, strong test-retest robustness has previously been demonstrated for the use of
isokinetic dynamometry to assess maximal strength of the
knee extensors, knee flexors and plantar flexors in both young
(Sleivert & Wenger, 1994;Wennerberg, 1991) and old adults
(Holsgaard et al., 2007).
5.5.2 Interpolated twitch technique (ITT)
In Study V and VI maximal evoked muscle force was measured
using a custom-made set-up (Harridge et al., 1999) with the
subjects seated in an upright position with a rigid back support
and the hip and knee joint flexed at 90° (Harridge et al., 1999).
A steel cuff was strapped around the lower leg, approximately
2 cm above the medial malleoli and was connected via a rigid
steel bar to a strain gauge load cell (Bofors KRG-4, Bofors, Sweden), which was connected to a linear instrumentation-amplifier (Gould 5900, Gould Inc. Valley View, OH USA).
5.5.2.a Resting muscle twitches
Each test session was initiated by determination of the maximal twitch response in the resting muscle. Twitch contractions
were evoked in the passive muscle using electrical stimulation
consisting of single square wave pulses of 0.1 ms duration delivered by a direct current stimulator (Digitimer Electronics,
model DS7). Stepwise increments in the current were delivered until no further increase in twitch amplitude was seen
(Harridge et al., 1996).
5.5.2.b Superimposed twitches
To evaluate the ability to activate the quadriceps muscle, i.e.
to assess the magnitude of central activation (neuromuscular
activation), electrically evoked muscle doublet-twitches were
superimposed onto maximal voluntary muscle contraction
(Merton, 1954;Strojnik & Komi, 1998). Contractions were
evoked using doublet square-wave pulses of 0.1 ms duration
and a minimum of two trials was performed with a requirement to reach within ≥95% of the peak MVC force measured in
preceding trials. Supra-maximal doublet stimulation (100 ms
pulse duration, 10 ms interpulse interval) was manually delivered 5 s before (non-potentiated resting doublet), at the highest attained force plateau (superimposed doublet), and 2 s after (potentiated resting doublet), with the latter response
being used as the resting reference twitch.
5.6 Muscle size and architecture
5.6.1 Computed tomography (CT)
Computed tomography (CT, Picker 5000, Ohio, US) was used to
obtain anatomical cross-sectional area of the quadriceps femoris muscle in the population of patients undergoing hip-replacement surgery (Study I, II and V). A slice thickness 8 mm
was used and a scanning time of 5s with an image matrix of
512 x 512 pixels. Axial scans of the quadriceps muscle were
obtained at the midpoint between the great trochanter and
lateral joint line of the knee. A trained radiologist measured
cross sectional areas using the Picker VOXEL-Q CT/MR Software Package for real-time Analysis after each scan was blinded for both subject and time point. Each scan was evaluated
three times and the mean value was recorded as the result.
The coefficient of variation between two consecutive measurements was < 2%.
5.6.2 Magnetic resonance imaging (MRI)
In Study VI muscle cross sectional area and muscle volume of
the quadriceps muscle was measured by use of axial Magnetic
Resonance Imaging (MRI) (Aagaard et al., 2001). Imaging was
performed in a body array coil with the subject in a supine position with both limbs extended and relaxed. Prior to the first
scan a localising scan centred mid femur was conducted to ensure the knee joint was included in the field (Field of View, FOV
48). The subsequent scan was centred just below the femur
condyles to ensure the same scan position at all time-points.
Dependent on the femur length of the subject 7-8 T1-weighted
transverse scans with a FOV 42 and matrix 512 + 512 pixel matrix were obtained with a slice thickness of 10 mm and an inter-slice gap of 50 mm. After blinding of each scan the Anatomical Cross Sectional Area (ACSA) of each scan was measured
three times using Web1000 imaging software. The mean value
of the three measurements was recorded as the result and the
coefficient of variation between consecutive measurements
was < 5 %. Subsequently, Quadriceps muscle volume (Qvol)
was calculated by the summation of 6 successive ACSA values
(scan 2-7), each multiplied by the sum of the slice thickness
and inter-slice gap. Based on cadaver analysis, a high validity
has been reported for the non-invasive assessment of human
skeletal muscle CSA and volume by means of MRI (Beneke et
al., 1991;Mitsiopoulos et al., 1998). Furthermore, high testretest reliability is reported for the repeated recording of
transversal anatomical CSA of the human quadriceps femoris
muscle by means of MRI, demonstrating excellent test-retest
reliability (Reeves et al., 2004a).
5.6.3 Ultrasound (UL)
To assess changes in muscle architecture measurements of
muscle fibre pennation angle and muscle thickness ultrasonography was performed in Study III and VI. Sagittal ultrasound
images of the quadriceps femoris muscle were recorded with
the using a Siemens real-time scanner with a 7.5 MHz linear
array transducer. Images were obtained with the subject in a
seated position (90 deg. flexion in the hip and knee joint) at 50
% of femur length over the mid-belly of VL muscle (Aagaard et
al., 2001). Vastus lateralis (VL) fibre pennation angle (qp) was
measured as the angle between VL muscle fibre fascicles and
the deep aponeurosis of the insertion, i.e. the fascia separating
VL and the vastus intermedius muscle (Herbert & Gandevia,
1995;Reeves et al., 2006;Rutherford & Jones, 1992). Two images from each limb were obtained from all subjects. Each image was evaluated three times and the mean value was recorded as the average fibre pennation angle. The coefficient of
variation between two consecutive measurements was < 5%.
In order to obtain ultrasound images from an identical position
at the thigh during longitudinal sessions, anatomical landmarks were carefully drawn on a transparent sheet. Moderate-to-excellent test-retest reliability has been reported for
the measurement of qp in the human quadriceps femoris muscle in vivo (Reeves et al., 2004b;Raj et al., 2012;Blazevich et al.,
2006) as well as in other lower limb muscles (Aggeloussis et al.,
2010;Raj et al., 2012).
5.6.4 Dual-energy X-ray absorptiometry (DEXA)
In Study VI, Dual-energy X-ray absorptiometry (DEXA) (Lunar
DPX, version 3.6Z software) was used to assess whole body
composition and percent body fat. Subjects were measured in
supine position on the same time of the day on consecutive
measurements. Good-to-excellent test-retest reliability has
been reported for the measurement of body composition,
body fat and lean muscle mass in young and old women (Madsen et al., 1997).
5.7 Neural activation
5.7.1 Electromyographic recordings (EMG)
In Study II and V surface EMG-recordings were carried out to
measure neuromuscular activity in the quadriceps and hamstring muscles. After careful preparation of the skin, pairs of
surface electrodes (Medicotest Q-10-A, 20 mm inter electrode
distance) were placed over the belly of vastus lateralis (VL),
vastus medialis (VM) and rectus femoris (RF). All electrode positions were carefully measured for each subject to ensure
identical recording sites throughout all tests. EMG and dynamometer strain-gauge signals were synchronously sampled
with a 1000-Hz analogue-to-digital conversion rate using an
external analogue-to-digital converter (dt 2801-A, Data Translation, Marlboro, MA). Subsequent, during later off-line analysis, EMG signals were digitally high-pass filtered with a fourthorder, zero-lag Butterworth filter with a 5-Hz cut-off frequency,
followed by a moving root-mean-square filter with a time constant of 50 ms. Maximum EMG amplitude of the RMS-filtered
signal was identified for the entire contraction phase and to
reflect neural adaptations in the early phase of contraction,
integrated EMG (iEMG) and mean average voltage EMG
(MAV=iEMG/integration time) were calculated in time intervals of 0-30 ms, 50 ms, 100 ms and 200 ms relative to the onset
of EMG integration, which was initiated 70 ms before force onset to account for electromechanical delay (Aagaard et al.,
2002). The degree of antagonist co-contraction was calculated
by dividing maximum antagonist hamstring EMG by maximum
agonist hamstring EMG measured during maximal isometric
knee flexion. For the quadriceps muscle acceptable reproducibility has been observed for the surface EMG recorded during
static as well as dynamic contraction conditions, including
isokinetic knee extension (Moritani & deVries, 1979;Viitasalo
et al., 1980).
5.8 Cellular and molecular analyses
In Study III, IV and VII-IX muscle samples were obtained
from the middle portion of m. vastus lateralis utilizing the
percutaneous needle biopsy technique of Bergström (Bergström, 1962) in order to perform cellular and molecular analyses.
11
sarcopenia in older individuals.
Figure 1. Overall study scope and experimental methods applied (further details in the text).
Figure 1. Overall study scope and experimental methods applied (further details in the text).
has been reported for the assessment of fibre type composi5.8.1 Muscle fibre CSA and fibre type composition
Based
on such
experiments,
we blood,
here present
and
from
three
different
tion (ICC of
0.88,discuss
0.82, 0.56data
for type
I, IIa and
IIx fibres)
and fi- human
After
dissecting
the recent
muscle samples
of all visible
muscleand
disuse
interventions
focus
on the
effects
of ageing
muscle disuse-atrophy.
bre-type
specific on
areaskeletal
(ICC of 0.74-0.82)
(Simoneau et al., At the
adipose
connective
tissue, the to
muscle
samples
were
1986).
Moreover,
a
4-7%
variation
in
fibre
composition
oriented
in
embedding
medium
(Tissue
Tec)
frozen
in
isopenoutset, our population of elderly patients with hip-osteoarthritis were examined in type
order
to enhance our
tane cooled with liquid nitrogen and stored at -80° C. Subse- has been reported between duplicate biopsy samplings, while
knowledge about the effects of chronic muscle disuse on aging skeletal muscle (Study III). Further, in
quently serial transverse sections (10 mm) were cut in a the variation in fibre type distribution within a single biopsy
order toatinvestigate
potential
age-related
differences
to (2-3%)
human
skeletal
muscle
disuse,(Blomstrand
we studied two
when
200 fibres
were analysed
cryotome
-20° C and stained
for myofibrillar
ATPase
at was small
1982).individuals,
However, it should
be recognized,
that greatpH
9.4 after both periods
alkaline (pH
and acid (pH 4.3inand
4.6) & Ekblom,
well-defined
of10.3)
immobilisation
able-bodied
elderly
compared
to young
individuals
er
variations
(12-19%)
in
fibre
type
composition
and
area
have
pre-incubations
(Brooke
&
Kaiser,
1970).
All
samples
of
each
with a comparable activity level (Study VI-VIII).
individual person were stained in the same batch to been reported with duplicate biopsy sampling procedures
avoid inter-assay variation. Fibre type distribution (fibre num- in the human VL muscle (Halkjaer-Kristensen & Ingemannber percentage, fibre area percentage) and fibre cross-section- Hansen, 1981). Yet, despite the needle biopsy sampling techal area for each of the three major fibre types (I, IIA, IIX) nique in the human VL muscle may show substantial with-in
6.1.1 The impact of chronic disuse on aged human skeletal muscle
were analysed in a blinded fashion using computerized digi- subject variability (Lexell & Taylor, 1989;Lexell & Taylor, 1991),
tal image analysis techniques. Since myofibre area is this remains the only known method for the evaluating of
cellular morphology
and phenotype
in human
known
to vary
in a pain
systematic
along the length
and depth
Chronic
joint
is away
surprisingly
frequent
condition,
which is estimated
to composition
affect more
than 33% of
skeletal
muscle
in
vivo.
of
the
human
VL
muscle
(Lexell
&
Taylor,
1989),
all
biopindividuals above the age of 45 years of age (Felson et al., 2000). Furthermore, osteoarthritis (OA) has
sies were obtained by the same investigator, and careful
been were
shown
to tobeextract
the most
cause
of inactivity
andstem
long-term
disability in persons above the
5.8.2 Myogenic
cells and myonuclei
efforts
made
tissue common
from the same
depth
agewith
of 65
years
(Felson
et al.,
osteoarthritis
on disability
is therefore
substantial
Study
VIII myogenic stem
cells, also referred
to as satellite
and
~2 cm
distance
between
each2000).
biopsy, The
whichimpact
has Inof
(SCs), were
identified
by using medical
antibody staining
of monobeen
to beof
sufficient
to avoid
theto
influence
of muscle iscells
and shown
the risk
disability
due
osteoarthritis
greater
than
any other
condition
in elderly
damage from repeated biopsies (Guerra et al., 2011). Using nuclear cells located between the basal lamina and the sar­
persons (Guccione et al., 1990). Moreover, the presence of concurrent chronic conditions further
comparable procedures, relatively high test-retest reliability colemma, to mark SCs expressing Pax-7 (Kadi et al., 2005;Mack12 17
ey et al., 2009). In contrast to the membrane localization of
membrane-bound neural cell adhesion molecule (N-CAM/
CD56), the paired-box transcription factor Pax-7 is confined to
the satellite cell nucleus (Mackey et al., 2009), resulting in a
lower density of Pax-7+ compared to the number of CD56+
cells ty­
pically observed in resting human skeletal muscle
(Mackey et al., 2009;Mikkelsen et al., 2009), although fairly
similar SC numbers also have been reported (Lindstrom et al.,
2010).
5.8.3 Gene expression analyses
In Study IV, VII and VIII total RNA was isolated (Kadi et al.,
2004b) in order to study the molecular regulation in muscle
size during disuse and subsequent re-training. Total RNA
(500 ng) was converted into cDNA in 20 μl using the OmniScript reverse transcriptase (Qiagen, CA, USA) according to
the manufacturer’s protocol. The mRNA expression of
FoxO1, FoxO3, FoxO4, PGC-1α, PGC-1β, IL-6, MGF, IGF-1Ea,
GAPDH and RPLP0 were analysed by quantitative real-time
RT-PCR. The amplification was monitored real-time using
the real-time PCR analysis (MX3000P; Stratagene, CA, USA).
The threshold cycle (Ct) values were related to a standard
curve made with the cloned PCR products and specificity
ensured by melting curves analysis and the quantities
were normalized to RPLP0. Furthermore, TaqMan based quantitative real-time RT-PCR of MuRF-1, Atrogin-1, NF-κΒ,
Bax, BCL2L1, p53, TNF-α, ATG4B, GABARAPL1, and RPLP0
mRNA were performed in the ABI Prism 7900HT Sequence
Detection System (Applied Biosystems) using ABI TaqMan
Low Density Arrays (Applied Biosystems). Each sample was
run in triplicates with 4 samples per card. Raw data were
extracted and analysed using the SDS 2.1 software
(Applied Biosystems), while qBasePlus (Biogazelle) was used
to quality-check Ct-values, asses triplicates, exclude runs for
difference among triplicates >0.5 Ct and finally to normalize
data to RPLP0 using the 2-ΔΔCt method (Livak & Schmittgen,
2001).
5.8.4 Protein quantification
In Study VII and IX mRNA expression data were supplemented
by protein quantification using Western Blotting analysis.
From each muscle biopsy 150 cryosections (10 µm) were homogenized in a micro vial containing 1 silicium carbide crystal,
5 steel beads (2.3 mm) and 250 µl ice-cold homogenization
buffer (Complete, Roche, Basel, Schwitzerland), using a FastPrep-24 (MP Biomedicals, Solon, OH, USA) homogenizer. Laemmli buffer was added and protein concentrations were determined with the EZQ Protein Quantitation Kit according to
the manufacturer’s protocol (Molecular Probes, Eugene, OR,
USA). After heating samples were separated by SDS-PAGE and
gels were blotted (Trans-blot cell, Bio-Rad, 400 mA, 2 h) to
polyvinylidene difluoride membranes (Amersham Hybond LFP,
GE Healthcare, Buckinghamshire,UK). Total and phosphorylated protein pairs were detected simultaneously on the same
membrane. Band intensities were quantified using densiometry analysis (ImageJ; National Institutes of Health, Bethesda,
MD, USA).
6. Results and Discussion
6.1 Effects of skeletal muscle disuse
Skeletal muscle mass and muscle strength are both known to
decline in response to disuse, and the effects of inactivity on
human skeletal muscle have been studied in a variety of different modes including bed-rest, unilateral lower limb suspension, immobilisation as well as actual and simulated microgravity (Appell, 1990;Booth & Gollnick, 1983;Hvid et al., 2010)
in order to gain knowledge about how muscle disuse affects
the human locomotor system. Yet, the effect of ageing on human skeletal muscle disuse has not previously been giving
much attention, although it seems important to enhance our
understanding of disuse-atrophy in bed-ridden patients and to
shed light on its contribution to sarcopenia in older individuals.
Based on such recent experiments, we here present and
discuss data from three different human muscle disuse interventions to focus on the effects of ageing on skeletal muscle
disuse-atrophy. At the outset, our population of elderly patients with hip-osteoarthritis were examined in order to enhance our knowledge about the effects of chronic muscle disuse on aging skeletal muscle (Study V). Further, in order to
investigate potential age-related differences to human skeletal muscle disuse, we studied two well-defined periods of immobilisation in able-bodied elderly individuals, compared to
young individuals with a comparable activity level (Study VIVIII).
6.1.1 The impact of chronic disuse on aged
human skeletal muscle
Chronic joint pain is a surprisingly frequent condition, which is
estimated to affect more than 33% of individuals above the
age of 45 years of age (Felson et al., 2000). Furthermore, osteoarthritis (OA) has been shown to be the most common
cause of inactivity and long-term disability in persons above
the age of 65 years (Felson et al., 2000). The impact of osteoarthritis on disability is therefore substantial and the risk of
disability due to osteoarthritis is greater than any other medical condition in elderly persons (Guccione et al., 1990). Moreover, the presence of concurrent chronic conditions further increases the likelihood of subsequent disability (Felson et al.,
2000). Based on this knowledge, we studied a mixed population of men and women with osteoarthritis of the hip on the
waiting list for a hip-replacement operation, to get deeper insights into how long-term (months to years) inactivity affects
muscle function in elderly individuals (Study V).
6.1.1.a Skeletal muscle size and architecture
Decreased loading in terms of immobilisation, bed-rest or spinal-cord injury is known to induce marked muscle atrophy in
younger human individuals (de Boer et al., 2007a;Hespel et al.,
2001;Hortobagyi et al., 2000;Jones et al., 2004;LeBlanc et al.,
1988;Wall et al., 2014). Notably, the relative loss in muscle
mass over time is not linear but tends to plateau over time,
with the highest atrophy rate observed within the first 7-10
days (de Boer et al., 2007a;Narici & de Boer, 2011;Suetta et al.,
2012a). Even though chronic disuse due to joint pain may not
be directly comparable to a standardised period of immobilisation, patients with chronic hip osteoarthritis in Study V showed
13
a ~10% reduced anatomical quadriceps muscle cross sectional
area (ACSA) on the affected side compared to the unaffected
side (Study V). Additional contributing factors to the decrement in muscle strength with ageing comprise changes in
structural components, such as increased intramuscular fat
and connective tissue (Lexell et al., 1988). Therefore, in addition to ACSA, lean tissue cross-sectional area (LCSA) as well as
inter- and intramuscular fat CSAs were measured using known
CT density limits for fat and lean tissue to discriminate between contractile and non-contractile tissue within the muscle
compartment area in Study V (Sipila & Suominen, 1995). Both
men and women showed an 8-10 % reduced lean quadriceps
muscle CSA (LCSA) on the affected compared to the unaffected
side (Study V), in line with findings by Rasch et al that observed
marked atrophy in all muscles around the hip and knee in a
similar group of patients (Rasch et al., 2007). These results
were further underlined by our findings of a reduced myofibre
area (type I and type IIA fibres) on the affected compared to
the non-affected side (Study III).
In addition to a reduction in muscle size, changes in muscle architecture also contribute to the decrease in muscle
force production with aging and/or disuse (Kawakami et al.,
2000;Narici & Cerretelli, 1998). Consequently, in sarcopenia as
well as skeletal muscle disuse-atrophy, it has been demonstrated that muscle fibre fascicles have a reduced pennation
angle compared to healthy young individuals (Morse et al.,
2005a;Narici et al., 2003). In agreement with these findings,
muscle fibre pennation angles on the osteoarthritic side in
Study III were significantly smaller (-15%) compared to the
healthy side, indicating that chronic disuse leads to significant
changes not only in muscle size but also muscle architecture.
6.1.1.b Neuromuscular function
Maximal contractile muscle strength and rapid force characteristics (RFD) are known to decrease with aging as well as in
response to disuse (Aagaard et al., 2010a;Vandervoort, 2002a).
Notably, isokinetic strength has been demonstrated to be an
important predictor of pain and disability in patients with
gonarthrosis (Madsen et al., 1995). Somewhat surprising, maximal isometric quadriceps strength (MVC) of the unaffected
leg was similar to that of healthy age-matched subjects in our
cohort of patients with unilateral hip-osteoarthritis, (Esmarck
et al., 2001;Lange et al., 2002;Suetta et al., 2006). In contrast,
MVC on the affected side was markedly reduced (~20 %), along
with a decline in muscle quality reflected by decreased specific
strength (MVC moment/CSA), underlining the severe consequences of chronic pain/disuse on mechanical muscle function
(Study V). Notably, the clinical consequences of muscle
strength asymmetry in the lower limbs are significant since a
close relation to postural balance problems, decreased walking speed, as well as increased risk of falling has been shown
(Portegijs et al., 2005;Portegijs et al., 2006).
In general, women demonstrate lower muscle mass and
maximal muscle strength than men throughout the adult life
span, and therefore the risk of frailty is increased with ageing
in women in particular (de Rekeneire N. et al., 2003).
Accordingly, women showed markedly lower MVC on both
sides (~40%) compared to male subjects (Study V). Notably, no
14 difference between genders was detected when maximal
muscle strength was normalised to lean cross sectional area
(MVC/LCSA) (Study V), in agreement with earlier investigations (Lindle et al., 1997;Tracy et al., 1999;Vandervoort &
McComas, 1986). Importantly, however, specific strength on
the affected side was reduced compared to the unaffected
side in both genders of about 12-14%, in line with earlier results demonstrating a lower specific strength in sedentary elderly subjects compared to young individuals, whereas elderly
subjects with a long-term history of strength or endurance
training typically show similar specific strength compared to
young individuals (Klitgaard et al., 1990). Furthermore, immobilisation leads to decreased specific force capacity in single
muscle fibres of the quadriceps muscle after immobilisation in
both young and old individuals (D’Antona et al., 2003;Hvid et
al., 2011), indicating a deterioration in cellular muscle quality
with skeletal muscle disuse.
In parallel with the decrease in maximal contractile muscle strength, the ability to develop force rapidly (i.e. contractile RFD) is substantially reduced in healthy elderly compared
to young individuals of both genders (Clarkson et al.,
1981;Vandervoort & McComas, 1986;Thelen et al., 1996;
Izquierdo et al., 1999), although not a universal finding (Thelen
et al., 1996;Clarkson et al., 1981). However, we found absolute contractile RFD significantly to be reduced on the affected
side compared to the unaffected side in both men and women
(Study V). Notably, the affected side remained reduced when
RFD was normalized to CSA in both genders, supporting the
finding of a decrease in muscle quality with prolonged disuse.
Along with changes in mechanical muscle function,
marked reductions in maximal EMG signal amplitude were observed during MVC testing on the affected side compared to
the unaffected side in both genders (Study V), in agreement
with earlier findings in young individuals after 4 weeks of unloading (Berg et al., 1991a), suggesting that the decreases in
contractile RFD on the affected limb at least partly was explained by changes in neuromuscular activation. In further
support hereof, using interpolated twitch analysis we observed a significant muscle activation deficit on the affected
compared to the non-affected side (Study V), in line with that
observed by Stevens et al. after 7 weeks of cast immobilization
in young subjects (Stevens et al., 2004).
In summary, the present data demonstrate that chronic
muscle disuse in the elderly is associated with marked quantitative as well as qualitative neuromuscular impairments. More
specifically, chronic muscle disuse leads to decreases in muscle strength, muscle size (ACSA, LCSA, and myofibre area of
type I and IIA fibres), accompanied by impairments in muscle
architecture (muscle fibre pennation angle), contractile properties (rapid muscle force characteristics) and neuromuscular
activation (maximal EMG amplitudes). Furthermore, large
side-to-side deficits were observed for specific strength (MVC/
LCSA) and normalised RFD (RFD/CSA), indicating that a major
part of the observed changes with disuse are explained by decreases in muscle quality.
6.1.2 The effect of ageing on skeletal muscle disuse
The plasticity in skeletal muscle mass homeostasis in response
to decreased activity is fairly well described in young adults
(Adams et al., 2003;Appell, 1990;Berg et al., 1991b). On the
other hand, almost no attention has been given to the combined effects of ageing and skeletal muscle disuse, although
muscle contractile function is known to be a crucial factor to
maintain an independent lifestyle with ageing. Notably, the
deterioration of mechanical muscle function with aging seems
to be a result of changes in both quantitative and qualitative
factors (Aagaard et al., 2010b;Doherty, 2003;Vandervoort,
2002b). Moreover, in addition to changes in intrinsic factors,
the level of physical activity is known to modify the age-related
loss in muscle size and function (Klitgaard et al., 1990;Rantanen et al., 2000;Aagaard et al., 2007;Pearson et al., 2002).
Hence, the fact that that our young and elder able-bodied participants reported comparable levels of activity in the two present immobilisation experiments (Study VI-IX) lead us to believe that the observed differences between young and old
prior to the intervention were mainly attributable to the effect
of aging per se.
6.1.2.a Changes in muscle size and muscle architecture
Muscle disuse in terms of immobilisation and bed-rest is known
to induce significant reductions in anatomical muscle cross sectional area, muscle fibre area and muscle fibre pennation angle
in young individuals (de Boer et al., 2008;Hespel et al.,
2001;Jones et al., 2004;Narici & Cerretelli, 1998). Data from
older human individuals are limited, but in the animal model
the majority of studies, find a higher magnitude of muscle atrophy in young compared to old animals (Alway et al., 2001;Brown
& Hasser, 1996;Carlson et al., 2002;Pistilli et al., 2007) although
not all agree (Deschenes et al., 2001;Siu et al., 2006). In agreement with earlier findings in young subjects, we found significant reductions in muscle size (anatomical muscle cross sectional area and quadriceps muscle volume) in young individuals
after 2 weeks of immobilisation (de Boer et al., 2007b;Hespel et
al., 2001;Jones et al., 2004, Study VI), and recently also demonstrated after 5 days of immobility (Wall et al., 2014). However,
in agreement with the majority of various animal models
(Alway et al., 2001;Brown & Hasser, 1996;Carlson et al., 2002;
Pistilli et al., 2007), the atrophy response was significantly
smaller in old compared to young individuals (Study VI).
In contrast, a larger muscle atrophy response has been reported in old compared to young adults, after 14 days of immobilisation of the human adductor pollicis muscle (Urso et
al., 2006). Part of the explanation may be due to the different
muscle groups investigated, as smaller muscle groups have
been suggested to respond differently to changes in loading
(Gandevia et al., 1990). Yet, a significantly larger muscle loss
has also been observed after 10 days bed-rest in able-bodied
older individuals (Kortebein et al., 2007b). In general, immobilisation and bed-rest induce similar atrophy responses of the
lower limbs (Adams et al., 2003;Convertino et al., 1997) which
makes the difference between the marked muscle loss (950 g
lean lower limb mass) shown by Kortebein et al. (Kortebein et
al., 2007b) and the more moderate atrophy response observed in our study (Study VI) somewhat puzzling. The difference may, however, be explained by the observation of a negative nitrogen balance before the intervention with a further
decline during bed rest in the bed-ridden participants
(Kortebein et al., 2007b), since a negative nitrogen balance is
known to aggravate the magnitude of skeletal muscle loss
with immobilisation (Paddon-Jones et al., 2006).
In addition, changes in muscle size were assessed by histological analyses of muscle fibre cross sectional area after 4 and
14 days of immobility. Prior to the immobilisation interventions, myofibre CSA of type II fibres were smaller (~25-30%) in
old compared to young muscle in both intervention studies,
whereas no difference was observed in type I fibre CSA.
Notably, decreases in mean myofibre area of approximately
10% were detected in both age groups, despite the brief period of muscle disuse (4 days) (Study VII). However, no difference was observed between the decline in type 1 and type 2
fibres at the 4 day time-point (Study IX), despite that the decline in type 2 fibres was significantly larger than in type 1 fibres in both young and old following 14 days of immobilisation
(Hvid et al., 2010). Yet, in line with our whole muscle assessments, the decrease in muscle fibre CSA following 14 days of
immobilisation was larger in young compared to older individuals ((Hvid et al., 2010), Study VII) and consequently elderly
individuals demonstrated less overall muscle loss with disuse
than their young counterparts after 14 days of immobility
(Study VI & VII).
Along with the reduction in muscle size, marked changes
in muscle architecture were observed following 14 days of immobilisation (Study VI). Accordingly, more marked decreases
in muscle fibre pennation angles of the VL fascicles were observed in young subjects compared to aged individuals (Study
VI), underpinning the importance of muscle architecture to
explain part of the discrepancy between the average relative
decrease in muscle strength, which was about twice as large
compared with the average relative decrease in muscle mass
(Aagaard et al., 2001;Narici, 1999;Rutherford & Jones, 1992).
Collectively our findings in Study VI, VII and IX, are in line
with previous findings obtained using various animal models,
indicating that skeletal muscle disuse leads to larger loss of
muscle mass (quadriceps volume, anatomical CSA, muscle fibre CSA and muscle fibre pennation angles) in young compared to older individuals, at least with more prolonged immobilisation (14 days). Interestingly, however, the muscle
atrophy response observed within the first 4 days of immobility did not seem to be affected by age, since similar reductions
in myofibre area were observed in young and old muscle.
6.1.2.b Changes in neuromuscular function
It is evident, that ageing as well as muscle disuse bring about
negative effects on the neuromuscular system, and although
there are indications of differential effects of muscle disuse in
young and old animals, data from human individuals are still
limited.
In Study VI and IX, various parameters of mechanical muscle function (dynamic & isometric knee extensor muscle
strength, specific force (MVC/CSA) and contractile rate of
force development (RFD)) were assessed prior to immobilisation. In agreement with previous data (Aagaard et al., 2001;de
Boer et al., 2007b;Deschenes et al., 2008;Hespel et al., 2001;
Hortobagyi et al., 2000;Jones et al., 2004) marked reductions
15
mechanisms underlying the apparent age-specific influence on disuse induced muscle loss that was
observed in the present line of experiments.
Figure 2. Schematic overview of selected molecular signalling pathways regulating skeletal muscle homeostasis (see further details in
Figure
2. Schematic overview of selected molecular signalling pathways regulating skeletal muscle homeostasis (see
the text). Dashed lines indicate pathways that still have to be completely defined.
further details in the text). Dashed lines indicate pathways that still have to be completely defined.
in contractile capacity were demonstrated following 4 days as shown to decline to a greater extent in old compared to young
following 7metabolism
days of immobilisation
(Deschenes
et
well as 14adays
of lower
limb disuse, independently
age individuals
Further,
marked
down-regulation
in genes of
involved
in mitochondrial
was observed
(Study
(Study VI & IX). Notably, the magnitude and time-course of al., 2008).
VII),
consistent with recent human gene array studies (Abadi et al., 2009;Chen et al., 2007). A rapid
In addition to mechanical muscle strength parameters,
changes were similar to earlier findings in young (Bamman et
decrease
in PGC-1α
mRNA Boer
and et
PGC-1β
mRNA geneetexpression
was observed
young but
not old muscle
the magnitude
of central in
activation
(neuromuscular
activa-in
al., 1998;Berg
& Tesch, 1996;de
al., 2007b;Labarque
the
most
initial
phase
of
immobilisation
(1
day),
where
the
response
in
old
muscle
was
slightly
slower
al., 2002) as well as old individuals (Deschenes et al., 2008; tion) (Merton, 1954;Strojnik & Komi, 1998) and resting twitch
characteristics were assessed in the present line of experiKortebein et al., 2008).
Of notice, maximal leg extension power and rapid muscle ments. Indicating changes in intrinsic (“qualitative”) mechaniforce capacity (RFD) have been shown to decline to a greater cal muscle function with ageing, older subjects demonstrated
relative extent than maximal muscle strength with aging (Klass lower resting twitch peak torque and resting twitch RFD prior
et al., 2008;Pearson et al., 2002;Skelton et al., 1994) and more 23to intervention compared to young individuals, followed by
importantly, has been advocated to be of greater importance comparable decreases in activation as a result of muscle disthan maximal muscle strength for the observed decline in use (Study VI). In contrast, both young and old adults showed
functional status and the ability to counteract a fall (Portegijs similar levels of central activation prior to immobilisation, in
et al., 2006;Skelton et al., 1999;Skelton et al., 2002). Notably, line with previous findings (Hakkinen et al., 1995;Kent-Braun
our data demonstrated rapid force capacity (RFD, impulse) & Ng, 1999;Roos et al., 1999) and further supporting the obwas affected to a greater extent in older individuals compared servation of comparable habitual activity levels between our
to young after 4 days and 14 days of disuse, especially during two age-groups. However, following immobilisation (14 days)
the very initial phase of muscle contraction (0–50 ms) (Study older individuals experienced a decline (Study VI), whereas
IX, (Hvid et al., 2010)). In support hereof, maximal dynamic young subjects in agreement with previous findings remained
muscle strength during fast contractions (120°/s) has been unaffected (de Boer et al., 2007a). Collectively, these observa16 tions suggest that disuse may enhance the age-related gap in
neuromuscular function, observed with natural ageing.
Taken together, our neuromuscular data demonstrate
that young and aged men experience similar declines in muscle contractile function following a brief period of muscle unloading at isometric and slow velocities of muscle contraction,
whereas at faster contraction speeds as well as in terms of
rapid force characteristics (RFD and Impulse), older individuals
may experience more marked declines than young. Moreover,
the present findings points toward an age-related difference
in the susceptibility of central activation parameters to shortterm disuse.
6.2.1.c Molecular regulation of muscle disuse-atrophy
Although, important insights have been made concerning the
molecular and genetic bases of skeletal muscle atrophy and aging in cell culture and animal models, only little is known about
the underlying molecular mechanisms of skeletal muscle atrophy with aging and disuse in humans. Certain controversy exists in the literature regarding whether muscle atrophy in human skeletal muscle is regulated primarily by increases in
myofibrillar protein degradation or a decrease in protein synthesis (Figure 2). In support of the latter, solid evidence in the
murine model, has pointed at protein degradation as the driving factor for skeletal muscle atrophy, with the ubiquitin-dependant proteolytic system being rapidly activated (Gomes et
al., 2001;Bodine et al., 2001a;Lecker et al., 2004) in relation to
unloading and various disease states (Bodine et al., 2001a;Lecker et al., 2004;Sacheck et al., 2007). In contrast, data from human in vivo studies have been less consistent (de Boer et al.,
2007b;Jones et al., 2004;Chen et al., 2007;Abadi et al., 2009;Leger et al., 2006). Our data revealed a 1-2 fold up-regulation in
MuRF-1 and Atrogin-1 mRNA expression in both young and old
muscle during the initial days of immobility (~2-4 days), supporting a role for the ubiquitin-proteasome pathway in the initiation of human skeletal muscle atrophy (Study VII). The fact
that we observed more modest changes compared to previous
animal reports may reflect that more drastic and hence more
systemic wasting models were used in these animal studies
(Lecker et al., 2004;Gomes et al., 2001;Bodine et al., 2001a)
compared to human immobilisation models. Notably, the present data revealed that the expression levels of both Atrogin-1
and MuRF-1 returned to basal levels after 14 days of immobility, indicating that in human skeletal muscle the ubiquitin-proteasome pathway may not be important to maintain a more
chronic atrophy response but rather plays a role in the very
initial atrophy response (~days). In support of this notion, a biphasic time-course has previously been shown to exist for the
mRNA expression profiles of selected atrogenes in the rodent
model (Sacheck et al., 2007), which may explain that early transcriptional changes have been overlooked in previous human
studies, which mainly have studied later time points of disuse.
A coordinated regulation of the ubiquitin-proteasome and the
autophagy-lysosome pathways has been shown to exist in the
murine model (Mammucari et al., 2007;Sandri, 2008;Zhao et
al., 2007), but somewhat surprisingly we did not observe any
change in the mRNA expression profiles of ATG4, GABARAPL or
FoxO3 (Study VII). However, we did see a trend towards an in-
crease in LC3B II/I protein ratio selectively in young muscle after 1 and 4 days of immobility, indicating that the autophagic
process (lipidation) was initiated at least in the young myofibres and thus, crosstalk between the ubiquitin-proteasome
and the autophagy-lysosome pathways may also exist in the
human model. The limited activation of the autophagy pathway could indicate that cross-talk between ubiquitin-proteasome and autophagy-lysosome pathways mainly occurs in
more systemic atrophy models, although species-specific differences between the rodent and human model have been
suggested to exist as well (Welle et al., 2001).
In addition to being a central regulator of muscle protein
synthesis and muscle hypertrophy the IGF-1/Akt signalling
pathway has been proposed to be a potent suppressor of myofibrillar proteolysis and atrophy related ubiquitin ligases, respectively (Bodine et al., 2001b). Importantly, our finding of an
age-specific decrease in P-Akt protein content indicates that
immobility leads to a rapid (2-4 days) as well as more sustained
(14 days) decrease in myofibrillar protein synthesis exclusively
in young muscle, which at least in part explains the observation of a larger muscle loss in young compared old individuals
(Study VII). In support of this notion, a diminished phosphorylation of Akt pathway components has been reported following 48h of immobility in young human subjects (Abadi et al.,
2009). In contrast, the present data point toward an up regulation of the muscle specific IGF1-pathway exclusively in old
subjects (Study IV), which in combination with a lack of change
in the Akt pathway may explain the attenuated atrophy response in old muscle. However, our current knowledge regarding the age-related differences in the regulation of this
pathway remain highly limited, and more studies clearly are
needed to uncover the mechanisms underlying the apparent
age-specific influence on disuse induced muscle loss that was
observed in the present line of experiments.
Further, a marked down-regulation in genes involved in
mitochondrial metabolism was observed (Study VII), consistent with recent human gene array studies (Abadi et al.,
2009;Chen et al., 2007). A rapid decrease in PGC-1α mRNA and
PGC-1β mRNA gene expression was observed in young but not
old muscle in the most initial phase of immobilisation (1 day),
where the response in old muscle was slightly slower (Study
VII), although reaching statistical significance within the first 4
days of immobilisation (Study VII). However, there was no difference between age groups at the 14 days’ time-point, in accordance with recent data from Gram et al. (Gram et al.,
2014). These findings support the hypothesis that down-regulation in PGC-1α and PGC-1β are important determinants for
the initiation of human skeletal muscle atrophy, as also observed in rodents (Sandri et al., 2006), although no indications
of FoxO3-dependant transcriptional changes were noted in
the present study in contrast to previous animal data obtained
using systemic muscle wasting (Sandri et al., 2004;Sandri et
al., 2006). It can be speculated, that one reason for the slower
and/or attenuated atrophy response to immobility in aged
compared to young human muscle could be a consequence of
the general decrease in oxidative metabolism observed with
aging. However, recent findings from Gram et al elegantly
have demonstrated that 14 days of inactivity and subsequent
17
re-training alter mitochondrial biogenesis to a similar extend
in young and elderly males (Gram et al., 2014).
Another topic of debate has been the role of the apoptotic
pathway in human skeletal muscle atrophy and sarcopenia.
Using animal models there are a significant amount of data indicating an important role for apoptosis in the development of
muscle atrophy observed with aging (Dirks & Leeuwenburgh,
2002;Marzetti et al., 2008;Marzetti et al., 2009;Phillips &
Leeuwenburgh, 2005;Pistilli et al., 2006;Siu et al., 2005), whereas human data have been more inconsistent (Malmgren et al.,
2001;Strasser et al., 2000;Whitman et al., 2009). In essence,
our data showed a marked and rapid increase in the expression
of apoptotic markers with immobilisation, with indications of a
more pronounced response in old muscle cells (Study VII).
Notably, despite that a general (i.e. non-specific) increase in
TUNEL-positive nuclei was observed primarily in muscle
biopsies from old individuals after immobilisation, specific myocellular TUNEL-positive myonuclei did not appear to increase
in neither young nor old adults, in contrast to previous find­ings in the murine model (Dupont-Versteegden et al., 2006).
Thus, in the present experiments an up-regulated number
of TUNEL-positive nuclei mainly were localized in the interstitiel
space, indicating that intrinsic myofibre apoptosis may not play
a key role for the mediation of human disuse-muscle atrophy.
In summary, our data point toward a number of intracellular signalling pathways for both muscle atrophy and hypertrophy being activated in the very initial phase of immobility,
in turn leading to a rapid initial atrophy response in both
young and aged muscle, followed by a decaying atrophy response at later time-points. Notably, our data showed a parallel activation of the ubiquitin-proteasome pathway along with
the IGF/Akt indicating that proteolyses may be an important
component in the initiation of human disuse atrophy in both
young and old muscle, whereas the myocellular regulation in
protein synthesis and mitochondrial function seems more agedependent. Although fundamental mechanistic questions still
remain to be answered, our data indicate that the orchestrating of human skeletal muscle atrophy is age-dependent, with a
number of cellular signalling pathways being modified interdependently of each other.
6.2 Re-growth of human skeletal muscle
Human skeletal muscle is a highly plastic tissue, which is reflected in its rapid ability to adapt to changes in loading intensity, at least in young individuals (Hvid et al., 2010;Wall et al.,
2014). In contrast, the ability of skeletal muscle to repair and
re-growth is known to diminish with aging (Brooks & Faulkner,
1990;Chakravarthy et al., 2000;Grounds, 1998;Zarzhevsky et
al., 2001). Yet, the mechanisms responsible for the diminished
ability of aged skeletal muscle to re-growth are largely unknown and the cellular and molecular mechanisms that contribute to the recovery in muscle mass after reduced mechanical loading are just beginning to become unravelled. However,
as muscle atrophy not only compromises physical functioning
but also is associated with increased frailty and mortality, it
seems important to expand our understanding of the mechanisms involved in muscle re-growth to develop methods to
maintain or improve muscle mass during or following periods
of disuse. Thus, in order to expand our knowledge regarding
the ability of aged human skeletal muscle to recover from
longer or shorter periods of disuse, we investigated the capacity for muscle re-growth and restoration of mechanical muscle
function in the three groups of patients/participants described
above who underwent skeletal muscle disuse of various
lengths (hip-replacement patients, as well as two groups of
healthy elderly and young individuals, respectively).
6.2.1 Effects of re-training in elderly post-operative patients
An infinite number of medical and surgical illness states lead to
the development of hospital associated deconditioning (Kortebein, 2009). Several common etiologic factors contribute to
this effect, including the specific medical or surgical illness necessitating hospitalisation, the adverse effects of treatment
(including surgical interventions), bed rest inactivity, as well as
the detrimental effects of aging per see (Appell, 1986;Hill &
Hill, 1998;Kortebein et al., 2007b;Vandervoort, 2002b).
Although much effort is done to minimize surgical intervention, effects of major surgery are still associated with an
increased risk of morbidity, convalescence and disability
(Kehlet, 2006;Kamel et al., 2003;Covinsky et al., 2003;Foss et
al., 2006). Major surgery is furthermore known to elicit a catabolic stress response that leads to a reduced protein synthesis
and a reduction of lean tissue mass (Convertino et al.,
1997;Kehlet & Wilmore, 2002). Consequently, a significant
number of elderly patients experience a decline in functional
performance after surgery, and more importantly a large proportion of these patients do not regain their functional level
without specific intervention programs (Magaziner et al.,
1990;Reardon et al., 2001a;Sashika et al., 1996;Shih et al.,
1994;Sicard-Rosenbaum et al., 2002;Trudelle-Jackson et al.,
2002;Visser et al., 2000;Walsh et al., 1998). To minimize de-
18 conditioning and enhance recovery the concept of “fast-track
surgery” has been introduced as a coordinated effort to combine uni-modal evidence-based principles of care into a multimodal effort, which has evolved as a valid concept to improve
post-operative outcome (Kehlet, 2006;Swanson et al., 1998).
Yet, loss of muscle mass is not completely counteracted by the
implementation of “fast-track regimes” (Kehlet & Wilmore,
2002) and growing evidence indicates that rehabilitation programmes have to be highly specific and of sufficient intensity
to counteract decreases in muscle strength and muscle mass
in postoperative elderly patients (Hauer et al., 2002;Sashika et
al., 1996; Study I & II. Trudelle-Jackson & Smith, 2004).
Notably, the use of resistance training is known to improve
muscle strength and functional performance both when initiated in the early post-operative phase (weeks to months)
(Hauer et al., 2002) as well as in the late post-operative phase
(months to years) (Trudelle-Jackson & Smith, 2004;Sashika et
al., 1996;Sherrington & Lord, 1997). Yet, knowing that the detrimental effects on muscle tissue properties are most dramatic during the first weeks of immobilisation (Appell, 1990;
Convertino et al., 1997, Study VII) it seems rational to initiate
specific training intervention as soon as possible after surgery.
We therefore set out to investigate the effect of various rehabilitation regimes initiated in the very early postoperative
phase (1-2 days post-surgery) in elderly individuals undergoing
elective hip-replacement surgery (Study I & II). Based on the
findings from earlier studies (Sashika et al., 1996;Sherrington
& Lord, 1997;Trudelle-Jackson & Smith, 2004) voluntary resistance training was compared to peripheral muscle stimulation
(NMES) and conventional rehabilitation activities in order to
evaluate the neuromuscular adaptations elicited by these
three different exercise modalities (Study I-IV).
6.2.1.a Skeletal muscle size and architecture
Despite resistance training is known to induce marked increases in anatomical muscle cross sectional area and muscle fibre
area, in aged (Hakkinen et al., 1996;Hakkinen et al., 1998a;
Morse et al., 2005b;Roth et al., 2001;Tracy et al., 1999;Welle
et al., 1996) as well as in very old individuals (Fiatarone et al.,
1990;Kryger & Andersen, 2007) the use of resistance training is
still not widely used to rehabilitate elderly patients following
major surgery. In fact, only few studies have tried to apply intensive strengthening exercises in the acute post-operative
phase (Study I, II) (Husby et al., 2009;Jakobsen et al., 2012). In
the light hereof, one of the most important findings of Study I
and II was the feasibility of applying resistance training and
electrical stimulation in the acute post-operative phase (1 day
after surgery). Moreover, there was marked differences between the three different rehabilitation regimes investigated
(resistance training, electrical muscle stimulation and functional exercises) on quadriceps muscle size and quadriceps
muscle architecture. Despite successful surgical outcome and
the use of early mobilisation strategies during hospitalisation,
we observed a further decrease in CSA at five as well as twelve
weeks post-surgery in the patients who received the conventional rehabilitation program based on functional exercises
with no external loads applied. In contrast, 1 hour/day of neuromuscular electrical stimulation (NMES) of the quadriceps
muscle, nearly counteracted a decline in muscle size (Study I &
II), in accordance with previous results from young patients
(Arvidsson et al., 1986;Gibson et al., 1988), and recently also in
intensive care unit patients (Dirks et al., 2015). Amplifying this
effect, resistive exercises not only prevented the surgery associated muscle atrophy at five weeks, but further increased
CSA after twelve weeks. As a result, a significant difference in
treatment outcome was observed between the resistancetraining group and the conventional rehabilitation group after
12 weeks of rehabilitation. Further, muscle fibre area increased
by 32% following 12 weeks of resistance training, and in line
with previous studies in young (Aagaard et al., 2001) and old
individuals (Kryger & Andersen, 2007) more marked gains
were observed for the type IIa and IIx) fibres compared to the
type I fibres (Study III). Consequently, side-to-side deficits in
anatomical CSA and muscle fibre CSA (type 1 and type 2a)
were fully eliminated after 12 weeks of resistance training,
while still persistent following NMES and conventional rehabilitation (Study III).
In addition to the muscular changes relating to muscle fibre size, ageing also leads to marked alterations in muscle architecture that potentially contribute to the loss in muscle
strength (Narici et al., 2003). A reduction in muscle fibre pennation angle in old compared to young individuals has previously been observed, suggesting that a significant part of the
decrease in muscle function with aging may be related to
changes in muscle architecture (Narici et al., 2003). Both in
sarcopenia and disuse atrophy, muscle fibre fascicles seem to
have a reduced pennation angle compared to healthy young
individuals, likely due to decreased amounts of contractile tissue (Morse et al., 2005a;Narici & Cerretelli, 1998). In agreement with these findings, muscle fibre pennation angles on
the osteoarthritic side were substantially reduced compared
to the unaffected side (Study III). However, after 12 weeks of
RT there was a significant increase in VL muscle fibre pennation angle, comparable to the changes typically reported following resistance training in able-bodied young and old individuals after comparable periods of resistance training
(Aagaard et al., 2001;Morse et al., 2006). In contrast, no improvements in muscle fibre pennation angle were observed
for patients subjected to electrical stimulation or functional
exercises.
6.2.1.b Neuromuscular function and functional capacity
Alongside the above morphological adaptations, marked changes in mechanical muscle strength parameters and functional
capacity were observed after 12 weeks of rehabilitation, however, the observed changes were highly dependent on the type
of rehabilitation regime (Study I & II). Notably, marked increases was observed maximal muscle strength (dynamic and isometric) in response to 12 weeks of resistance training, despite
patients being rather frail during the initial 4-6 weeks after surgery. Comparable gains in maximal muscle strength have been
demonstrated following resistance training in healthy elderly
individuals (Hakkinen et al., 1998b;Lexell et al., 1995; Reeves et
al., 2005), as well as in frail elderly (Beyer et al., 2007; Fiatarone
et al., 1990;Harridge et al., 1998;Harridge et al., 1999).
In contrast, no gains in maximal muscle strength parame 19
ters could be observed with electrical stimulation (Study II),
which is in agreement with earlier findings in young patients
after ACL-reconstruction and conventional rehabilitation
(Arvidsson et al., 1986), while also lacking to be demonstrated
in studies evaluating the effect of physiotherapy exercises
(with no external loads) after hip-surgery (Sicard-Rosenbaum
et al., 2002;Trudelle-Jackson et al., 2002). Consequently, the
muscle strength asymmetry observed in all patients prior to
the operation was fully reversed following twelve weeks of resistance training, while not affected by electrical stimulation
or conventional rehabilitation (Study I). This finding is potentially of high importance since asymmetry in lower limb muscle strength is related to fall prevalence in elderly adults
(Skelton et al., 2002;Portegijs et al., 2006). Moreover, the
elimination of muscle asymmetry is noteworthy, since the
non-operated side was equally strong compared to that of
able-bodied age-matched individuals (Esmarck et al., 2001),
resulting in a normalisation of neuromuscular performance after only 12 weeks of resistance training in patients subjected
to many years of chronic disuse and subsequent hip-replacement surgery. Of note, is also the fact that no training related
complications were observed in any of the three intervention
groups, despite all three training regimes were commenced in
the very early post-operative phase (1-2 days after surgery).
The ability to develop force rapidly (i.e., demonstrating
high contractile RFD) is an important performance characteristic, especially in older people, contributing to several tasks of
daily life such as climbing stairs, walking, and attempting to
avoid a fall (Bassey et al., 1992;Fleming et al., 1991). However,
significant increases in RFD and elevated neuromuscular
(EMG) activity have been demonstrated in healthy elderly individuals following 3-6 months of resistance training with special focus on increasing muscle power (Hakkinen et al.,
1985;Hakkinen et al., 2001). In order to avoid postoperative
injuries while still ensuring a sufficiently high loading intensity
to induce measurable gains in muscle size (de Vos et al.,
2005;Fiatarone et al., 1990) and neuromuscular performance
characteristics, as previously demonstrated in young individuals (Aagaard et al., 2002) we used a progressively adjusted exercise program known to be effective of inducing adaptive
muscular changes in able-bodied elderly individuals (Esmarck
et al., 2001). To our best knowledge, potential changes in RFD
characteristics have not previously been evaluated after NMES
or conventional rehabilitation.
In accordance with earlier findings in young individuals
(Aagaard et al., 2002;Hakkinen et al., 1998b;Kraemer et al.,
2001), resistance training lead to marked increases in rapid
force production, in the very initial phase (30–50 ms) as well
as the later part (100–200 ms) of the isometric force-time
curve, with similar gains in contractile impulse. Notably, the
increase in RFD was still present after normalising for muscle
size (RFD/CSA), indicating qualitative changes in muscle contraction characteristics may have occurred, such as increased
maximal motor unit firing frequency (Van et al., 1998) and/or
changes in myosin heavy chain isoform composition toward an
increase in type II fibre area percentage (Aagaard et al., 2001).
The importance of these positive adaptations in rapid muscle
force characteristics are underlined by the fact, that a positive
20 correlation was observed between the increase in maximal
gait speed and the increase in absolute RFD following 12
weeks of resistance training, which was even stronger when
related to normalized RFD (RFD/CSA) in the very initial phase
of muscle contraction (0– 30 ms). In contrast, no relationship
could be observed between the change in maximal walking
speed and changes in maximal muscle strength characteristics
and/or muscle size (Study II).
Apart from gains in muscle size and neuromuscular characteristics, resistance training and NMES produced marked
increases in functional performance parameters (walking
speed, chair rise performance and stair climbing), although
most present following resistance training (Study I). The enhancement in horizontal walking speed was particularly noticeable, since maximal and habitual walking speed are powerful predictors of future disability and dependency (Guralnik et
al., 1995;Sonn & Asberg, 1991). Moreover, it is thoughtful that
despite all resistance training exercise were performed unilaterally the marked changes in unilateral muscle strength and
muscle size were translated (nearly 1:1) into increases in functional tasks that comprise two-legged coordinated movement.
This finding underlines the importance of specifically focusing
on reducing observable deficits (muscle size and strength) between sides before both legs are trained simultaneously.
Another puzzling finding was the observed increase in functional performance with NMES that, although being more
modest than the changes observed with resistance training,
clearly were superior to those achieved by conventional rehabilitation (Study I). However, despite there was no measurable
gains in neither neuromuscular function nor muscle size with
NMES, a majority of the decline observed in the assessed parameters at 5 weeks post-operatively with conventional rehabilitation was largely prevented with NMES (Study I), underlining the importance of focused intervention to counteract the
decline in muscle mass and function during hospitalisation.
In summary, the marked increases in neuromuscular performance observed with resistance training were translated
into significant gains in activities of daily life (ADL) function,
manifested by increased walking speed, enhanced ability to rise
from a chair and improved stair climbing performance (Study
I-II). In contrast, despite producing no increases in neuromuscular performance characteristics (dynamic and isometric MVC,
RFD, EMG and contractile impulse) NMES led to moderate albeit statistically significant gains in functional performance,
while conventional rehabilitation did not result in any increases
in neuromuscular or functional performance (Study I-II).
6.2.1.c The effect of post-operative re-training on
the IGF-1 pathway
The IGF-I pathway is known to be an important stimulator of
anabolic signalling and one of the key factors responsible for
increasing rate of protein synthesis in skeletal muscle (Adams,
1998). However, based on the findings that senescent muscle
in the animal model demonstrates an attenuated recovery response after immobilisation and injury (Brooks & Faulkner,
1990;Chakravarthy et al., 2000;Grounds, 1998;Zarzhevsky et
al., 2001), it has been hypothesized that sarcopenia may in
part be due to a failure to generate IGF-I isoforms necessary to
initiate the remodelling of muscle by stimulating satellite cell
activation and proliferation (Goldspink & Harridge, 2004). In
order to describe the potential interaction between changes in
muscle morphology and IGF-I splice variants in elderly frail patients, changes in muscle fibre area and mRNA expression levels of IGF-IEa and the mechano sensitive IGF isoform IGF-IEc
(MGF) were assessed in our group of hip replacement patients
prior to surgery and subsequent to our three intervention regimes (Study IV). In human exercise studies, the expression of
IGF-I mRNA has been found to increase acutely after a single
bout of resistance exercise (Bamman et al., 2001), although no
total agreement exists (Hameed et al., 2003;Psilander et al.,
2003). However, more consistent increases in IGF-I have been
demonstrated at both the mRNA level (Hameed et al.,
2004;Kvorning et al., 2007;Petrella et al., 2006) and the protein level (Singh et al., 1999) following prolonged periods of
resistance training.
The activation of myogenic stem cells (satellite cells) and
their donation of new nuclei to the exercised myofibres seem
required for hypertrophied fibres to maintain an optimal DNA
to protein ratio (Kadi et al., 2000). Since MGF is suggested to
play an important role in the activation of satellite cells (Yang &
Goldspink, 2002), the possibility exists that IGF isoforms are involved in the promotion of muscle growth and repair during
the process of reloading subsequent to periods of disuse.
Known to be involved in muscle repair (Goldspink & Yang,
2001) it does not seem surprising that MGF mRNA levels were
elevated in all three intervention groups compared to the nonoperated-side at 48 h post-surgery (Study IV). However, in contrast to NMES and conventional rehabilitation, MGF mRNA expression levels did not decrease in the RT group, which could
support the hypothesis that MGF could be involved in both
muscle repair (1-2 days post-surgery) as well as in the robust
hypertrophy response observed with resistance training (5
weeks and 12 weeks). Moreover, increases in absolute levels of
IGF-IEa mRNA and MGF mRNA were only observed in response
to resistance training intervention, with no changes detected
following NMES or conventional rehabilitation (Study IV).
Importantly, albeit the response may be attenuated in old
human muscle as well as in old muscles of various animals,
older muscles appear capable of up-regulating the expression
of both IGF-IEa and MGF mRNAs in response to a period of
prolonged resistance training even after surgery and/or immobilisation.
Collectively, Study I-IV, demonstrates that elderly patients
who undergo elective hip-replacement surgery achieve significant muscular, neuronal and functional benefits from intensive physical training initiated in the very early the postoperative phase. Specifically, resistance training more effectively
increased muscle morphology (size and architecture), neuromuscular characteristics (muscle strength, RFD, impulse, EMG,
central activation) and functional performance (walking speed,
chair rise and stair climbing) compared to NMES or conventional rehabilitation.
6.2.2 The effect of aging on skeletal muscle re-growth
It is well known that the ability to produce muscle re-growth
after injury and immobilisation is impaired in animal senescent
muscle (Chakravarthy et al., 2000;Grounds, 1998;Zarzhevsky et
al., 2001). In human individuals however, it still remains largely
unknown, which factors and mechanisms promote or hinder the
recovery of muscle mass following short or longer periods of disuse. Based on the findings of an impaired ability for muscle regrowth in animal models and our findings of an age-specific
regulation and time-course of skeletal muscle disuse-atrophy,
we hypothesized that a similar age-specific regulation might exist in response to human skeletal muscle recovery after disuse
atrophy. In the light of a steadily increasing aging population
leading to an increasing number of persons recovering from
shorter or longer periods of muscle disuse, it seems rational to
expand our current understanding of the mechanisms involved
in human muscle re-growth in order to facilitate the development of approaches to maintain and regain muscle mass during
periods of skeletal muscle disuse. We therefore assessed the effect of recovery following 4 days and 14 days of immobilisation,
respectively. To optimize the conditions for complete muscle
recovery, supervised resistance training was applied in both age
groups. Following the 4 days disuse intervention participants
were admitted to a 7 days recovery regime (Study IX), whereas
participants exposed to 14 days disuse intervention were retrained for 4 weeks (Study VIII).
6.2.2.a Skeletal muscle size and muscle architecture
Reloading of disuse-induced skeletal muscle atrophy, by means
of resistive types of exercise, is known to fully restore muscle
mass through hypertrophy in young human individuals (Berg et
al., 1991b; Boesen et al., 2013;Hespel et al., 2001;Hortobagyi et
al., 2000;Jones et al., 2004), however, only few data exists on
the changes in skeletal muscle size following brief periods (less
than a week) of unloading followed by active exercise-based recovery (Study IX). Thus, our somewhat limited assessments of
changes in muscle size and architecture following 7 days of recovery subsequent to 4 days of disuse (Study IX) reflected that
we did not expect major changes following such a brief intervention period. Yet, 4 days of unloading induced substantial atrophy in both type I and type II myofibres of young and old individuals alike (Study VII & IX), which was reversed to predisuse
values in both age-groups following 7 days of recovery, except
for type I myofibre area in old individuals that remained suppressed compared to pre-levels (Study IX).
In comparison, despite a larger atrophy response following 14 days of immobilisation young individuals demonstrated
a greater increase in quadriceps muscle size (Qvol, ACSA and
PCSA) in response to 4 weeks of retraining leading to a full restoration in muscle mass. In contrast, despite a smaller atrophy
response, old individuals did not fully recover quadriceps muscle size after retraining. A similar pattern was observed for the
changes in muscle architecture, with a more modest decrease
in muscle fibre pennation angle seen in old compared to young
with no full reversal in old participants despite 4 weeks of intensive re-training (Study VI). This finding was further supported by our analyses of muscle fibre cross sectional area which
showed robust increases in type I and II myofibre area in young
subjects during the recovery phase, whereas aged individuals
showed no changes in neither type I nor type II myofibre area,
leading to an overall difference in the recovery response to re 21
training between young and old (Study VIII). Notably however,
apart from reflecting a significant age-related difference to reloading, the observed differences between young and old
adults may also reflect that a limited period of re-training was
used in the present experiments, as substantially longer intervention periods have demonstrated significant gains in quadriceps size (Boesen et al., 2014, Study I-II), muscle architecture
(Study III) and muscle fibre area (Study III) in older individuals
recovering from muscle disuse and/or surgery.
Altogether, the present data indicate that despite intensive rehabilitation efforts aging is accompanied by an impaired
ability to recover from short-term disuse muscle atrophy, and
consequently old individuals may need a longer time to recover from periods of disuse compared to young individuals.
6.2.2.b Neuromuscular function
Parameters of mechanical muscle output (contractile capacity)
and neuromuscular function are both strong predictors of general functional capacity, quality of life, and risk of mortality in
aged individuals (Buchman et al., 2007;Newman et al., 2006;
Wyszomierski et al., 2009), which underlines the importance
of gaining more insight to the time-course and potential agerelated differences in the recovery of neuromuscular function
in human individuals following periods of disuse. In young
adults, mechanical muscle function (isometric and dynamic
MVC) has been demonstrated to be fully reversed following
3-6 weeks of resistance training subsequent to 2 weeks of unloading/immobilisation (Boesen et al., 2013;Hespel et al.,
2001;Jones et al., 2004;Labarque et al., 2002) in agreement
with the present findings (Study VI, Hvid et al., 2010). Moreover, it is noteworthy that decreases in dynamic muscle strength
observed following 4 weeks of unloading in young individuals
were fully reversed after 7 weeks, despite no training
intervention(Berg et al., 1991b). However, almost no previous
studies have focused on disuse lasting less than 1 week, and
the subsequent recovery phase. Based on the present experiments, 7 days recovery (subsequent to 4 days immobilisation)
appeared effective of restoring knee extensor mechanical
muscle function in young subjects, while in contrast maximal
muscle strength characteristics remained suppressed in our
old subjects (Study IX). Similar trends were observed for rapid
force capacity (RFD, impulse) at the very initial phase of contraction (0–50 ms) that tended to remain reduced relative to
baseline levels after 4 weeks of re-training subsequent to 14
days of disuse (Hvid et al., 2010). The observed impairment in
restoring lower limb mechanical muscle function following
short-term disuse in old adults may in part reside from alterations in qualitative muscle factors, as contractile rate of force
development tended to remain reduced in old individuals following 7 days of recovery (Study IX), as well as following 4
weeks of re-training (Hvid et al., 2010), whereas maximal isometric strength capacity recovered to a more full extent. Yet,
our older individuals were able to reverse the deficit in central
activation with 4 weeks of resistance training (following 14
days of immobility), whereas young individuals reached values
above the baseline activation level (Study VI).
In summary, the findings of the present data suggest that
the magnitude and time-course of changes in mechanical
22 ­ uscle function during the recovery phase following short-term
m
disuse are compromised in old compared to young individuals.
6.2.2.c Myogenic stem cells
The regulation in muscle growth and maintenance of muscle
mass is known to be influenced by a unique population of muscle resident stem cells referred to as myogenic progenitor cells
or satellite cells (SCs) (Mauro, 1961). Satellite cells represent a
heterogeneous population of adult muscle stem cells that are
normally quiescent and were identified more than 50 years
ago as nuclei located in a niche between the sarcolemma and
the basement membrane of the muscle fibre, and known to
play a key role in the maintenance, growth and repair of myofibres (Heslop et al., 2001;Mauro, 1961;Moss & Leblond, 1970;
Moss & Leblond, 1971).
In humans, the pool of SCs seems to be maintained into
the sixth-to-seventh decade of life (Petrella et al., 2006;Roth
et al., 2000), with a decline in content and activation capabilities with progressive ageing (Kadi et al., 2004a;Verdijk et al.,
2007) leading to a reduced muscle regeneration capacity in
response to myofibre injury and disuse (Carlson et al., 2001;
Carlson & Conboy, 2007). However, despite the group of aged
individuals in the present experiments our old participants
(~67 years) demonstrated impaired SC proliferation capacity
compared to young individuals (~24 years), indicating that the
SC response to re-loading and exercise might be attenuated.
Interestingly, age-related differences in SC proliferative capacity were detectable in the acute (+ 3 days) as well as the prolonged (+ 4 weeks) phase of re-training, in line with reports by
Dreyer et al. (Dreyer et al., 2006) who reported a greater increase in SC content in young compared to aged human skeletal muscle within 24h following 92 eccentric contractions
(Dreyer et al., 2006).
The importance of SC number in relation to muscle size
has previously been reported by Petrella et al (Petrella et al.,
2008) that found a positive association between SC number at
baseline and gains in muscle fibre area after 16 weeks of resistance training in young and older human individuals
(Petrella et al., 2008), suggesting that the individual myogenic
potential may at least partially be pre-determined by the availability of satellite cells prior to training. Expanding those observations, we observed for the first time in human individuals
a positive relationship exists between SC number and mean
fibre area (MFA) following disuse-atrophy (2 weeks) as well as
moderate-to-strong associations the magnitude of muscle hypertrophy and gains in SC number in response to exercisebased reloading (4 weeks) (Study VIII).
As aging is associated with a preferential reduction in
muscle fibre type II size it may be speculated that SC content
would decrease more in type II fibres compared to type I fibres. In young human individuals SC content is similar between
type I and II muscle fibres (Kadi et al., 2006;Verdijk et al.,
2007). In contrast, age-related type II muscle fibre atrophy is
accompanied by a type II muscle fibre specific reduction in SC
content (Verdijk et al., 2007;Verney et al., 2008). Interestingly,
in the present line of experiments positive associations were
observed between the number of Pax7+ cells and the size of
both type I and II fibres, respectively. In further support of the
importance of SC proliferation for muscle re-growth, a relationship was observed between the relative change in MFA
and total number of Pax7+ cells, as well as the relative change
in fibre type I area and the change in number of type I associated Pax7+ cells subsequent to 4 weeks of re-training (Study
VIII). However, although muscle regenerative capacity appears
to decline at a more advanced age reflected by a decline in SC
number and/or activation (Gallegly et al., 2004;Renault et al.,
2002;Shefer et al., 2010), a reduced SC pool does not abolish
the myogenic potential for adaptive muscle hypertrophy if the
intervention period is sufficiently long (~12 weeks), even at old
age (Mackey et al., 2007;Shefer et al., 2010).
In summary, our data demonstrated substantial age-specific differences in the re-growth capacity of human skeletal
muscle following immobility-induced muscle atrophy. Spe­
cifically, aged individuals showed a reduced responsiveness to
the re-loading exercise paradigm, reflected by reduced gains
in myofibre area that were accompanied by an attenuated capacity for SC proliferation.
6.2.2.d Molecular regulation of skeletal muscle re-growth
The reduced capacity of aging skeletal muscle to recover after
disuse indicates that molecular signalling pathways regulating
muscle hypertrophy/re-growth are altered at increasing age
and/or that negative regulators of muscle mass become progressively more active with aging. We therefore set out to profile a range of positive and negative growth factors associated
with local skeletal muscle milieu that are known to stimulate
the proliferation of SCs (Gopinath & Rando, 2008). Among
those factors, Insulin-like growth factor (IGF-1Ea) and mechano-growth factor (MGF) mRNA expression levels and protein
content have been shown to correlate with the increase in
whole muscle DNA content in response to compensatory muscle overloading (Adams & Haddad, 1996). Further, MyoD and
myogenin mRNA expression levels were also assessed in the
present experiments since these factors are part of the family
of myogenic regulatory factors (Myf5, MyoD, Mrf4 and myogenin) that play a key factor in the myogenic specification and
differentiation of SCs in mature skeletal muscle (Goldspink,
1998;Olson et al., 1991). MyoD is primarily related to SC activation and proliferation, whereas myogenin reflects the phase
of terminal myoblast differentiation (Kuang et al., 2007;Olson
et al., 1991). Among the multiple growth factors associated
with the local skeletal muscle milieu that stimulate the proliferation of SCs, hepatocyte-growth factor (HGF) is considered
one of the most important parameters (Gopinath & Rando,
2008). Together with its trans-membrane receptor (c-met)
HGF is a vital link in the cascade of signalling events that lead
to activation of skeletal muscle SCs when myofibres are exposed to strain or injury (Wozniak & Anderson, 2007). Furthermore, a number of studies have identified various fibroblast
growth factors (FGFs) and their receptors (FGFRs) to be key
regulators of both senescence and self-renewal capacity in a
variety of stem cell types (Sheehan & Allen, 1999). Among
those, fibroblast growth factor 2 (FGF2) and its receptor FGFR1
are known to stimulate SC proliferation (Allen & Boxhorn,
1989;Mezzogiorno et al., 1993). In addition to these factors,
we also assessed the expression levels of myostatin mRNA, a
member of the transforming growth factor-β family, which exerts a strong negative regulation on skeletal muscle mass
(McPherron et al., 1997) partly by inducing a sustained satellite cell quiescence (Joulia et al., 2003;McCroskery et al., 2003).
Together, our experiments showed age-independent differences in the time-course of IGF-1Ea and MGF regulation, respectively, with an acute and sustained up-regulation of MGF
mRNA expression in response re-training, whereas IGF-1Ea expression was up-regulated only in the later phase of re-loading
(Study VIII). Notably, changes in myofibre area were positively
related to the corresponding changes in IGF-1Ea and MGF expression levels after 4 weeks of resistance training, strongly
suggesting an essential role of these IGF isoforms for the induction of human muscle hypertrophy with training/re-loading.
Moreover, MyoD and myogenin demonstrated markedly upregulated expression levels with immobilisation in both age
groups, whereas the subsequent recovery phase led to acute
and sustained decreases in both MyoD and myogenin mRNA in
young as well as aged skeletal muscle. While elevated mRNA
expression levels of myogenic regulatory factors have been reported following prolonged (months) resistance exercise in
both young and older adults (Kim et al., 2005;Kosek et al.,
2006;Raue et al., 2006), only a modest up-regulation in myogenin expression was observed following 4 weeks of resistance
training in the present experiments (Study VIII), which may indicate that short-term (days-weeks) re-training after disuseatrophy generate a different molecular signalling stimuli compared to that evoked by more prolonged exercise intervention.
Moreover, marked increases in HGF mRNA expression
were observed in response to immobilisation as well as early
and sustained re-training (+3d and +4wks) in line with the
overall increase in SCs at these time-points (Study VIII).
However, despite the age-dependent differences in SC proliferation no age-specific difference was found in the expression
profiles of HGF. These seemingly conflicting observations may
be due to a somewhat low number of subjects examined and/
or could be caused by the relative large variation seen especially in the elderly subjects. Further, there was no significant
change in the expression levels of FGF2 at any time-points, indicating that FGF may be of minor importance for SC proliferation in human skeletal muscle irrespectively of age.
Notably, we observed an age-specific influence on the
pattern of myostatin regulation, with a larger increase seen in
response to immobilisation followed by a smaller reduction
with re-loading in our aged individuals (Study VIII). In turn,
these observations may partly explain the impaired ability of
SC proliferation and myofibre re-growth observed with retraining in aged skeletal muscle (Study VIII). In line with these
findings, myostatin mRNA expression has previously been
shown to increase following disuse in young individuals, where
the elevation in myostatin expression was related to the magnitude of myofibre atrophy (Reardon et al., 2001b). Notably,
our data revealed that the change in myostatin expression
within the first days of re-loading (+3d) was negatively related
to the change in Pax7+ cells, underlining the negative effect of
myostatin on SC proliferation (Joulia et al., 2003;McCroskery
et al., 2003).
Collectively, our data demonstrate that important age 23
Rate of musle atrophy
Old
Young
Arbitrary units
Old
Protein synthesis
Young
Protein degradation
Young
Old
4
14 days
Figure 3. Schematic figure of muscle atrophy rates as well as changes in protein synthesis and protein degradation in response to
4 and 14 days of immobilisation in young (full line) and old individuals (dotted line), respectively. The schematic changes in protein
synthesis and protein degradation rates are based on our gene expression data (Study VII).
specific differences exist for the capacity of myofibrillar regrowth of human skeletal muscle following immobility-induced muscle atrophy. Specifically, aged individuals seemed
to respond less sensitively to the re-loading program, as reflected by significantly smaller gains in myofibre area, in parallel with a smaller increase in SC number despite that no agerelated differences were observed in local growth factors
known to promote skeletal muscle hypertrophy and satellite
cell proliferation (IGF-Ea, MGF, MyoD, myogenin, HGF). This
attenuated responsiveness of old adults to the re-loading
stimulus may partly be explained by a reduced sensitivity to
the above growth factors since basal MRF mRNA expression
appears to be generally up-regulated in senescent muscle
(Hameed et al., 2003;Kim et al., 2005;Kosek et al., 2006;Raue
et al., 2006). In addition, the present experiments also indicate
24 that myostatin may play an important role for the impaired regrowth response of aged human skeletal muscle, as the regulation in myostatin mRNA expression was influenced by age,
with old adults demonstrating greater increases with immobilisation followed by a less degree of down-regulation in response to subsequent re-loading. Notably, an association between the down-regulation in myostatin mRNA expression
and SC proliferation was observed in the acute phase of reloading, indicating a strong influence of myostatin signalling
on the myogenic potential of human skeletal muscle in vivo.
7. major conclusions
In summary, chronic muscle disuse in the elderly was associated with marked quantitative as well as qualitative neuromuscular impairments. More specifically, decreases were ob-
served in muscle strength, quadriceps muscle size and myofibre
area, muscle architecture, contractile properties and neuromuscular activation. Furthermore, substantial side-to-side differences in specific strength (MVC/LCSA) and normalised rapid
muscle force capacity (RFD/CSA) were observed, indicating
that a significant part of the observed changes in mechanical
muscle function with disuse were explained by impairments in
muscle quality.
Importantly, within the first 4 days of immobility the observed atrophy responses did not seem affected by age, as
manifested by comparable reductions in myofibre area in
young and old individuals. However, in line with previous observations using various animal models, we observed a larger
loss in muscle mass in young compared to older individuals after more prolonged immobilisation (14 days). Conversely, old
individuals were more negatively affected with respect to neural function and rapid force characteristics than their young
counterparts.
Moreover, we showed that the initiation and regulation of
human skeletal muscle atrophy with short-term disuse is agedependant. Based on the present experiments it can be concluded that a multitude of signalling pathways related to both
muscle atrophy and protein synthesis are activated in the initial phase of disuse, which in turn lead to a rapid initial atrophy
response (~1-4 days) in both young and old individuals followed by a gradually attenuated atrophy response at later
time-points (~2 weeks). Notably, during the first 1-2 days of
immobility a parallel activation of the ubiquitin-proteasome
pathway and the IGF1/Akt pathway seem to occur along with
a deactivation of PGC-1α and PGC-1β, suggesting that cellular
proteolysis plays an important role in the initiation of human
disuse atrophy in both young and old muscle, whereas the
concurrent regulation in protein synthesis signalling and proteolysis inhibition appears to affect young adults more pronouncedly compared to older adults.
Gaining a better understanding of the ability of human
skeletal muscle to recover from disuse-induced atrophy has
important implications for the development and implementation of effective countermeasures against physical frailty in
the increasing population of elderly. Importantly therefore,
the present experiments demonstrate that resistance training
is highly effective of increasing maximal muscle strength and
neuromuscular function in elderly post-operative patients.
Importantly, these increases in mechanical muscle function
were accompanied by gains in muscle size, architecture and in
the expression of IGF-I mRNA splice variants, resembling that
typically seen in young healthy individuals when exposed to
resistance training. In contrast, these positive adaptations
could not be achieved with the use of neuromuscular electrical stimulation or conventional rehabilitation efforts alone.
Collectively, these findings strongly underline the importance
of implementing resistive exercises in future rehabilitation
programs for elderly individuals.
In addition, comparing young and old able-bodied individuals, we observed that the magnitude and time-course of
changes in mechanical muscle function during the recovery
phase following short-term disuse were compromised in old
compared to young individuals. Likewise, aged individuals
demonstrated an impaired response to re-loading reflected by
attenuated gains in myofibre area, in parallel with smaller increases in satellite cell number despite no age-related differences were observed in factors known to promote skeletal
muscle hypertrophy and SC proliferation (IGF-Ea, MGF, MyoD,
myogenin, HGF). Moreover, an age-specific regulation in myostatin mRNA expression was observed, characterized by an
amplified increase in aging skeletal muscle with immobilisation that was followed by less down-regulation during the subsequent phase of re-loading. In combination with an association observed between the changes in myostatin expression
and satellite cell proliferation in the acute phase of re-loading,
these data indicates that myostatin play an important role in
the impaired ability of aged human skeletal muscle to recover
from immobility-induced muscle atrophy.
8. Perspectives
The present line of experiments revealed that the adaptive
plasticity in skeletal muscle mass and central nervous system
function associated with unloading and subsequent re-mobilisation, differ between young and older individuals (Study VIIX). Notably, this influence of aging on muscle mass homeostasis is well documented in various animal models (Brooks &
Faulkner, 1990;Chakravarthy et al., 2000;Grounds, 1998;Zarzhevsky et al., 2001). However, in human research there has
been a tendency to overlook the importance of investigating
the very early phase of disuse/unloading (1-5 days) where the
atrophy response is most strongly manifested and important
information regarding the regulation of human disuse atrophy
has therefore been left unnoticed. Yet, our findings (Study VII)
as well as others (Tesch et al., 2008; de Boer et al., 2007b;Abadi
et al., 2009) show evidence of an early rise in atrogenes during
human disuse with time-course patterns similar to what have
previously been demonstrated in the murine model (Sacheck
et al., 2007). Collectively, these findings indicate that the regulation of human muscle disuse is more complex and not merely driven by a decrease in myofibrillar protein synthesis, as previously suggested (Glover et al., 2008;Rennie et al., 2010). Despite, many links still remain to be elucidated in the
puzzle of human muscle plasticity, the observation that the
initiation and regulation of human skeletal muscle atrophy is
age dependant may be important for the identification of biomarkers and future therapeutic intervention paradigms, which
can be used to counteract human skeletal muscle atrophy in
relation to aging and disuse.
Moreover, our finding that aging is accompanied by an impaired ability to recover from disuse muscle atrophy despite
intensive re-training efforts, and, consequently, need a longer
time to recover from periods of disuse may also explain the
somewhat disappointing results from shorter rehabilitation
studies (Jakobsen et al., 2014).
Importantly, however, the findings from study I-IV clearly
demonstrate, in line with previous data (Fiatarone et al.,
1990;Kryger & Andersen, 2007) that elderly skeletal muscles
respond very well to prolonged intensive resistance training.
Consequently, this intervention modality should be more
clearly recognized as one of the key tools in the rehabilitation
of elderly individuals, including very old and frail patients. The
25
findings from Study I-IV showed that resistance training can be
successfully initiated during a hospital stay, including the acute
post-operative phase and in the initial days after discharge in
order to counteract the decline in muscle function and loss of
muscle mass normally associated with hospitalisation in elderly patients (Kortebein, 2009). Additionally, the observation
from Study II & IV that rapid muscle force capacity (RFD) and
neuromuscular function remain trainable in elderly recovering
from surgery has important implications for the design of future rehabilitation programs, especially when considering the
importance of rapid muscle force capacity on postural balance
control, maximal walking speed and other tasks of daily living
(Aagaard et al., 2010).
9. SUMMARY
In order to study the influence of disuse and aging on skeletal
muscle homeostasis, different human models were employed.
Effects of chronic disuse were investigated in elderly patients
suffering from uni-lateral hip-osteoarthritis, whereas the effect
of short-term disuse (4 and 14 days of unilateral lower limb immobilisation) was assessed in healthy young and old individuals.
In summary, chronic muscle disuse in the elderly was associated with marked quantitative as well as qualitative neuromuscular impairments. More specifically, decreases were
observed in muscle strength, quadriceps muscle size and myofibre area, muscle architecture, contractile properties and
neuromuscular activation. Furthermore, substantial side-toside differences in specific strength (MVC/LCSA) and normalised rapid muscle force capacity (RFD/CSA) were observed, indicating that a significant part of the observed changes in
mechanical muscle function with disuse were explained by
impairments in muscle quality.
Importantly, within the first 4 days of immobility the observed atrophy responses did not seem affected by age, as
manifested by comparable reductions in myofibre area in young
and old individuals. However, in line with previous observations
using various animal models, we observed a larger loss in muscle mass in young compared to older individuals after more prolonged immobilisation (14 days). Conversely, old individuals
were more negatively affected with respect to neural function
and rapid force characteristics than their young counterparts.
Moreover, we showed that the initiation and regulation of
human skeletal muscle atrophy with short-term disuse is agedependant. Based on the present experiments it can be concluded that a multitude of signalling pathways related to both
muscle atrophy and protein synthesis are activated in the initial
phase of disuse, which in turn lead to a rapid initial atrophy response (~1-4 days) in both young and old individuals followed
by a gradually attenuated atrophy response at later time-points
(~2 weeks). Notably, during the first 1-2 days of immobility a
parallel activation of the ubiquitin-proteasome pathway and
the IGF-1/Akt pathway seem to occur along with a deactivation
of PGC-1α and PGC-1β, suggesting that cellular proteolysis
plays an important role in the initiation of human disuse atrophy in both young and old muscle, whereas the concurrent
regulation in protein synthesis signalling and proteolysis inhibition appears to affect young adults more pronouncedly compared to older adults.
26 Gaining a better understanding of the ability of human
skeletal muscle to recover from disuse-induced atrophy has
important implications for the development and implementation of effective countermeasures against physical frailty in
the increasing population of elderly. Importantly therefore,
the present experiments demonstrate that resistance training
is highly effective of increasing maximal muscle strength and
neuromuscular function in elderly post-operative patients.
Importantly, these increases in mechanical muscle function
were accompanied by gains in muscle size, architecture and in
the expression of IGF-I mRNA splice variants, resembling that
typically seen in young healthy individuals when exposed to
resistance training. In contrast, these positive adaptations
could not be achieved with the use of neuromuscular electrical stimulation or conventional rehabilitation efforts alone.
Collectively, these findings strongly underline the importance
of implementing resistive exercises in future rehabilitation
programs for elderly individuals.
In addition, comparing young and old able-bodied individuals, we observed that the magnitude and time-course of
changes in mechanical muscle function during the recovery
phase following short-term disuse were compromised in old
compared to young individuals. Likewise, aged individuals
demonstrated an impaired response to re-loading reflected by
attenuated gains in myofibre area, in parallel with smaller increases in satellite cell number despite no age-related differences were observed in factors known to promote skeletal
muscle hypertrophy and myogenic stem cell proliferation (IGFEa, MGF, MyoD, myogenin, HGF). Moreover, an age-specific
regulation in myostatin mRNA expression was observed, characterized by an amplified increase in aging skeletal muscle with
immobilisation that was followed by less down-regulation during the subsequent phase of re-loading. In combination with an
association observed between the changes in myostatin expression and satellite cell proliferation in the acute phase of
re-loading, these data indicates that myostatin play an important role in the impaired ability of aged human skeletal muscle
to recover from immobility-induced muscle atrophy.
10. DANISH SUMMARY
Afhandlingen består af 9 tidligere publicerede artikler og en
sammenfattende redegørelse. Det eksperimentelle arbejde er
udført under min ansættelse på Institut for Idrætsmedicin, Ortopædkirurgisk Afdeling, Bispebjerg Hospital. Afhandlingen
belyser hvordan det humane skeletmuskelvæv påvirkes af
inaktivitet, rehabilitering og ikke mindst aldring. For at undersøge disse aspekter er der udført en række interventionsstudier på såvel patienter som raske unge og ældre personer.
Effekten af kronisk inaktivitet blev undersøgt hos ældre
patienter med hoftearthrose, der stod på venteliste til en total
hoftealloplastik operation (THA). Forud for operationen var
muskelstyrken, muskelmassen, muskelarkitekturen, de kontraktile egenskaber og den neuromuskulære aktivering nedsat
som følge af smerteinduceret kronisk inaktivitet på den side
med arthrose sammenlignet med den raske underekstremitet.
Desuden var der forskel i specifik styrke og normaliseret RFD
på de to sider, som udtryk for at en stor del af de observerede
ændringer kunne forklares af kvalitative ændringer.
For at få en bedre forståelse af den human skeletmuskels
evne til at komme sig efter længere tids inaktivitet og et operativt indgreb, undersøgte vi effekten af henholdsvis neuromuskulær elektrisk stimulation (NMES) eller styrketræning
som supplement til den konventionelle rehabilitering efter
total hoftealloplastik. Vores resultater viste med stor tyde­
lighed, at styrketræning er en effektiv måde at øge muskelstyrken og muskelfunktionen hos ældre postoperative patienter. Endvidere blev fremgangen i muskelfunktion ledsaget
af en betydelig øgning i muskelstørrelse og muskelarkitektur.
I modsætning hertil blev disse positive ændringer ikke
opnået med NMES eller konventionel rehabilitering, hvilket er
med til at understrege betydningen af ​​at implementere styrketræning i fremtidige rehabiliteringsprogrammer til ældre personer.
For at undersøge hvilken betydning alder har for effekten
af inaktivitet på skeletmuskulaturen, supplerede vi ovenstående studier med to interventionsstudier, hvor en gruppe af
raske aktive unge og ældre personer fik det ene ben immobiliseret (med gips eller Don-Joy skinne) i henholdsvis 14 og 4
dage. Efter blot 4 dages immobilisering observerede vi et signifikant fald i muskelfiberarealerne hos både unge og ældre,
uden at dette atrofi-respons var påvirket af alder. I modsætning hertil, observerede vi et større tab af muskelmasse hos
unge sammenlignet med ældre personer efter 14 dages immobilisering, hvorimod den centrale muskelaktivering og ev-
nen til at udvikle kraft hurtigt (RFD) var mere udtalt hos de
ældre personer.
Samlet set viste de to immobiliseringsstudier endvidere at
initieringen og reguleringen af den humane skeletmuskelatrofi
er aldersrelateret, og at en række signaleringsveje relateret til
både muskelatrofi og proteinsyntese aktiveres indenfor de
første dage af en immobiliseringsperiode.
I lighed med tidligere observationer i forskellige dyremodeller blev det endvidere vist, at det tager længere tid for ældre personer at genvinde deres muskelstyrke og muskelfunktion efter en immobiliseringsperiode sammenholdt med yngre
personer. Parallelt hermed observeredes en nedsat evne til at
genvinde muskelmassen og øge antallet af myogene stamceller (satellitceller) i forbindelse med re-træning hos de ældre
forsøgspersoner, på trods af at der ikke blev fundet aldersrelaterede forskelle i genekspressionen af faktorer der vides at
have betydning for muskelvækst (IGF-Ea, MGF, MyoD, myogenin, HGF). Derimod var reguleringen af myostatin, der vides at
hæmme aktiveringen af de myogene stamceller aldersbetinget, og der observeredes således en større øgning i myostatin
mRNA i relation til immobilisering og en mindre nedregulering
som reaktion på re-træning i den aldrende skeletmuskulatur.
Disse fund indikerer samlet set, at myostatin spiller en vigtig
rolle for den nedsatte evne til at genvinde et muskeltab efter
en kortere eller længerevarende immobiliseringsperiode, der
ses hos ældre personer.
11. REFERENCES
Aagaard P, Andersen JL, Dyhre-Poulsen P, Leffers AM, Wagner A, Magnusson SP,
Halkjaer-Kristensen J, & Simonsen EB (2001). A mechanism for increased con­
tractile strength of human pennate muscle in response to strength training:
changes in muscle architecture. Journal of Physiology-London 534, 613-623.
Aagaard P, Magnusson PS, Larsson B, Kjaer M, & Krustrup P (2007). Mechanical
muscle function, morphology, and fiber type in lifelong trained elderly. Med Sci
Sports Exerc 39, 1989-1996.
Aagaard P, Simonsen EB, Andersen JL, Magnusson P, & Dyhre-Poulsen P (2002).
Increased rate of force development and neural drive of human skeletal muscle
following resistance training. Journal of Applied Physiology 93, 1318-1326.
Aagaard P, Suetta C, Caserotti P, Magnusson SP, & Kjaer M (2010). Role of the
nervous system in sarcopenia and muscle atrophy with aging: strength training as a
countermeasure. Scand J Med Sci Sports 20, 49-64.
Abadi A, Glover EI, Isfort RJ, Raha S, Safdar A, Yasuda N, Kaczor JJ, Melov S,
Hubbard A, Qu X, Phillips SM, & Tarnopolsky M (2009). Limb immobilization
induces a coordinate down-regul­ation of mitochondrial and other metabolic
pathways in men and women. PLoS ONE 4, e6518.
Adams GR (1998). Role of insulin-like growth factor-I in the regulation of skeletal
muscle adaptation to increased loading. Exerc Sport Sci Rev 26, 31-60.
Adams GR, Caiozzo VJ, & Baldwin KM (2003). Skeletal muscle unweighting:
spaceflight and ground-based models. J Appl Physiol 95, 2185-2201.
Adams GR & Haddad F (1996). The relationships among IGF-1, DNA content, and
protein accumulation during skeletal muscle hypertrophy. J Appl Physiol 81, 25092516.
Aggeloussis N, Giannakou E, Albracht K, & Arampatzis A (2010). Reproducibility of
fascicle length and pennation angle of gastrocnemius medialis in human gait in
vivo. Gait Posture 31, 73-77.
Allen RE & Boxhorn LK (1989). Regulation of skeletal muscle satellite cell
proliferation and differentiation by transforming growth factor-beta, insulin-like
growth factor I, and fibroblast growth factor. J Cell Physiol 138, 311-315.
Alway SE, Degens H, Krishnamurthy G, & Chaudhrai A (2003). Denervation
stimulates apoptosis but not Id2 expression in hindlimb muscles of aged rats. J
Gerontol A Biol Sci Med Sci 58, 687-697.
Alway SE, Lowe DA, & Chen KD (2001). The effects of age and hindlimb supension
on the levels of expression of the myogenic regulatory factors MyoD and myogenin
in rat fast and slow skeletal muscles. Exp Physiol 86, 509-517.
Appell HJ (1986). Skeletal muscle atrophy during immobilization. Int J Sports Med
7, 1-5.
Appell HJ (1990). Muscular atrophy following immobilisation. A review. Sports Med
10, 42-58.
Arvidsson I, Arvidsson H, Eriksson E, & Jansson E (1986). Prevention of quadriceps
wasting after immobilization: an evaluation of the effect of electrical stimulation.
Orthopedics 9, 1519-1528.
Bamman MM, Clarke MS, Feeback DL, Talmadge RJ, Stevens BR, Lieberman SA,
& Greenisen MC (1998). Impact of resistance exercise during bed rest on skeletal muscle sarcopenia and myosin isoform distribution. J Appl Physiol 84,
157-163.
Bamman MM, Shipp JR, Jiang J, Gower BA, Hunter GR, Goodman A, McLafferty CL,
Jr., & Urban RJ (2001). Mechanical load increases muscle IGF-I and androgen
receptor mRNA concentrations in humans. Am J Physiol Endocrinol Metab 280,
E383-E390.
Bassey EJ, Fiatarone MA, O’Neill EF, Kelly M, Evans WJ, & Lipsitz LA (1992). Leg
extensor power and functional performance in very old men and women. Clin Sci
(Colch) 82, 321-327.
Beneke R, Neuerburg J, & Bohndorf K (1991). Muscle cross-section measurement
by magnetic resonance imaging. Eur J Appl Physiol Occup Physiol 63, 424-429.
Berg HE, Dudley GA, Haggmark T, Ohlsen H, & Tesch PA (1991). Effects of lower
limb unloading on skeletal muscle mass and function in humans. J Appl Physiol 70,
1882-1885.
Berg HE, Larsson L, & Tesch PA (1997). Lower limb skeletal muscle function after 6
wk of bed rest. J Appl Physiol 82, 182-188.
Berg HE & Tesch PA (1996). Changes in muscle function in response to 10 days of
lower limb unloading in humans. Acta Physiol Scand 157, 63-70.
Bergström J (1962). Muscle electrolytes in man. Scand J Clin Lab Invest 68(suppl),
1-110.
Beyer N, Simonsen L, Bülow J, Lorenzen T, Jensen DV, Larsen L, Rasmussen U,
Rennie M, & Kjær M. Old women with a recent fall history show improved muscle
strength and function sustained for six months after finishing training. Aging Clin
Exp Res . 2007.
Blazevich AJ, Gill ND, & Zhou S (2006). Intra- and intermuscular variation in human
quadriceps femoris architecture assessed in vivo. J Anat 209, 289-310.
27
Blomstrand E & Ekblom B (1982). The needle biopsy technique for fibre type
determination in human skeletal muscle--a methodological study. Acta Physiol
Scand 116, 437-442.
de Boer MD, Maganaris CN, Seynnes OR, Rennie MJ, & Narici MV (2007a). Time
course of muscular, neural and tendinous adaptations to 23 day unilateral lowerlimb suspension in young men. J Physiol 583, 1079-1091.
Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT,
Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN,
Yancopoulos GD, & Glass DJ (2001a). Identification of ubiquitin ligases required for
skeletal muscle atrophy. Science 294, 1704-1708.
de Boer MD, Selby A, Atherton P, Smith K, Seynnes OR, Maganaris CN, Maffulli N,
Movin T, Narici MV, & Rennie MJ (2007b). The temporal responses of protein
synthesis, gene expression and cell signalling in human quadriceps muscle and
patellar tendon to disuse. J Physiol 585, 241-251.
Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R, Zlotchenko E,
Scrimgeour A, Lawrence JC, Glass DJ, & Yancopoulos GD (2001b). Akt/mTOR
pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent
muscle atrophy in vivo. Nat Cell Biol 3, 1014-1019.
de Boer MD, Seynnes OR, di Prampero PE, Pisot R, Mekjavic IB, Biolo G, & Narici
MV (2008). Effect of 5 weeks horizontal bed rest on human muscle thickness and
architecture of weight bearing and non-weight bearing muscles. Eur J Appl Physiol.
Boesen AP, Dideriksen K, Couppe C, Magnusson SP, Schjerling P, Boesen M,
Aagaard P, Kjaer M, & Langberg H (2014). Effect of growth hormone on aging
connective tissue in muscle and tendon: gene expression, morphology, and
function following immobilization and rehabilitation. J Appl Physiol (1985 ) 116,
192-203.
Boesen AP, Dideriksen K, Couppe C, Magnusson SP, Schjerling P, Boesen M, Kjaer
M, & Langberg H (2013). Tendon and skeletal muscle matrix gene expression and
functional responses to immobilisation and rehabilitation in young males: effect of
growth hormone administration. J Physiol 591, 6039-6052.
Booth FW & Gollnick PD (1983). Effects of disuse on the structure and function of
skeletal muscle. Med Sci Sports Exerc 15, 415-420.
Booth FW & Seider MJ (1979). Early change in skeletal muscle protein synthesis
after limb immobilization of rats. J Appl Physiol 47, 974-977.
Brooke MH & Kaiser KK (1970). Muscle fiber types: How many and what kind? Arch
Neurol 23, 369-379.
Brooks SV & Faulkner JA (1990). Contraction-induced injury: recovery of skeletal
muscles in young and old mice. Am J Physiol 258, C436-C442.
Brown M & Hasser EM (1996). Differential effects of reduced muscle use (hindlimb
unweighting) on skeletal muscle with aging. Aging (Milano ) 8, 99-105.
Bruunsgaard H & Pedersen BK (2003). Age-related inflammatory cytokines and
disease. Immunol Allergy Clin North Am 23, 15-39.
Buchman AS, Wilson RS, Boyle PA, Bienias JL, & Bennett DA (2007). Change in
motor function and risk of mortality in older persons. J Am Geriatr Soc 55, 11-19.
Carlson BM, Borisov AB, Dedkov EI, Khalyfa A, Kostrominova TY, Macpherson PC,
Wang E, & Faulkner JA (2002). Effects of long-term denervation on skeletal muscle
in old rats. J Gerontol A Biol Sci Med Sci 57, B366-B374.
Carlson BM, Dedkov EI, Borisov AB, & Faulkner JA (2001). Skeletal muscle
regeneration in very old rats. J Gerontol A Biol Sci Med Sci 56, B224-B233.
Carlson ME & Conboy IM (2007). Loss of stem cell regenerative capacity within
aged niches. Aging Cell 6, 371-382.
Carlson ME, Suetta C, Conboy MJ, Aagaard P, Mackey A, Kjaer M, & Conboy I
(2009). Molecular aging and rejuvenation of human muscle stem cells. EMBO Mol
Med 1, 381-391.
Chakravarthy MV, Davis BS, & Booth FW (2000). IGF-I restores satellite cell
proliferative potential in immobilized old skeletal muscle. J Appl Physiol 89, 13651379.
Chen YW, Gregory CM, Scarborough MT, Shi R, Walter GA, & Vandenborne K
(2007). Transcriptional pathways associated with skeletal muscle disuse atrophy in
humans. Physiol Genomics 31, 510-520.
Clarkson PM, Kroll W, & Melchionda AM (1981). Age, Isometric Strength, Rate of
Tension Development and Fiber Type Composition. Journals of Gerontology 36,
648-653.
Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, & Rando TA (2005).
Rejuvenation of aged progenitor cells by exposure to a young systemic
environment. Nature 433, 760-764.
Convertino VA, Bloomfield SA, & Greenleaf JE (1997). An overview of the issues:
Physiological effects of bed rest and restricted physical activity. Medicine and
Science in Sports and Exercise 29, 187-190.
Covinsky KE, Palmer RM, Fortinsky RH, Counsell SR, Stewart AL, Kresevic D, Burant
CJ, & Landefeld CS (2003). Loss of independence in activities of daily living in older
adults hospitalized with medical illnesses: Increased vulnerability with age. Journal
of the American Geriatrics Society 51, 451-458.
Cuthbertson D, Smith K, Babraj J, Leese G, Waddell T, Atherton P, Wackerhage H,
Taylor PM, & Rennie MJ (2005). Anabolic signaling deficits underlie amino acid
resistance of wasting, aging muscle. FASEB J 19, 422-424.
D’Antona G, Pellegrino MA, Adami R, Rossi R, Carlizzi CN, Canepari M, Saltin B, &
Bottinelli R (2003). The effect of ageing and immobilization on structure and
function of human skeletal muscle fibres. J Physiol 552, 499-511.
Dargent-Molina P, Favier F, Grandjean H, Baudoin C, Schott AM, Hausherr E,
Meunier PJ, & Breart G (1996). Fall-related factors and risk of hip fracture: the
EPIDOS prospective study. [published erratum appears in Lancet 1996 Aug
10;348(9024):416]. Lancet 348, 145-149.
28 de Rekeneire N., Visser M, Peila R, Nevitt MC, Cauley JA, Tylavsky FA, Simonsick EM,
& Harris TB (2003). Is a fall just a fall: correlates of falling in healthy older persons.
The Health, Aging and Body Composition Study. J Am Geriatr Soc 51, 841-846.
de Vos NJ, Singh NA, Ross DA, Stavrinos TM, Orr R, & Fiatarone Singh MA (2005).
Optimal load for increasing muscle power during explosive resistance training in
older adults. J Gerontol A Biol Sci Med Sci 60, 638-647.
Deschenes MR, Britt AA, & Chandler WC (2001). A comparison of the effects of
unloading in young adult and aged skeletal muscle. Med Sci Sports Exerc 33, 14771483.
Deschenes MR, Holdren AN, & McCoy RW (2008). Adaptations to short-term
muscle unloading in young and aged men. Med Sci Sports Exerc 40, 856-863.
Deschenes MR, Will KM, Booth FW, & Gordon SE (2003). Unlike myofibers,
neuromuscular junctions remain stable during prolonged muscle unloading. J
Neurol Sci 210, 5-10.
Desplanches D, Mayet MH, Sempore B, & Flandrois R (1987). Structural and
functional responses to prolonged hindlimb suspension in rat muscle. J Appl
Physiol 63, 558-563.
Dirks A & Leeuwenburgh C (2002). Apoptosis in skeletal muscle with aging. Am J
Physiol Regul Integr Comp Physiol 282, R519-R527.
Dirks ML, Hansen D, Van AA, Dendale P, & van Loon LJ (2015). Neuromuscular
electrical stimulation prevents muscle wasting in critically ill comatose patients.
Clin Sci (Lond) 128, 357-365.
Doherty TJ (2003). Invited review: Aging and sarcopenia. J Appl Physiol 95, 17171727.
Dreyer HC, Blanco CE, Sattler FR, Schroeder ET, & Wiswell RA (2006). Satellite cell
numbers in young and older men 24 hours after eccentric exercise. Muscle Nerve
33, 242-253.
Dupont-Versteegden EE (2005). Apoptosis in muscle atrophy: relevance to
sarcopenia. Exp Gerontol 40, 473-481.
Dupont-Versteegden EE, Strotman BA, Gurley CM, Gaddy D, Knox M, Fluckey JD, &
Peterson CA (2006). Nuclear translocation of EndoG at the initiation of disuse
muscle atrophy and apoptosis is specific to myonuclei. Am J Physiol Regul Integr
Comp Physiol 291, R1730-R1740.
Esmarck B, Andersen JL, Olsen S, Richter EA, Mizuno M, & Kjaer M (2001). Timing
of postexercise protein intake is important for muscle hypertrophy with resistance
training in elderly humans. J Physiol 535, 301-311.
Farrell M & Richards JG (1986). Analysis of the Reliability and Validity of the Kinetic
Communicator Exercise Device. Medicine and Science in Sports and Exercise 18, 4449.
Felson DT, Lawrence RC, Dieppe PA, Hirsch R, Helmick CG, Jordan JM, Kington RS,
Lane NE, Nevitt MC, Zhang Y, Sowers M, McAlindon T, Spector TD, Poole AR,
Yanovski SZ, Ateshian G, Sharma L, Buckwalter JA, Brandt KD, & Fries JF (2000).
Osteoarthritis: new insights. Part 1: the disease and its risk factors. Ann Intern Med
133, 635-646.
Fiatarone MA, Marks EC, Ryan ND, Meredith CN, Lipsitz LA, & Evans WJ (1990).
High-intensity strength training in nonagenarians. Effects on skeletal muscle. JAMA
263, 3029-3034.
Fleming BE, Wilson DR, & Pendergast DR (1991). A portable, easily performed
muscle power test and its association with falls by elderly persoms. Arch Phys Med
Rehabil 72, 886-889.
Foss NB, Kristensen MT, & Kehlet H (2006). Prediction of postoperative morbidity,
mortality and rehabilitation in hip fracture patients: the cumulated ambulation
score. Clin Rehabil 20, 701-708.
Gallegly JC, Turesky NA, Strotman BA, Gurley CM, Peterson CA, & DupontVersteegden EE (2004). Satellite cell regulation of muscle mass is altered at old
age. J Appl Physiol 97, 1082-1090.
Gandevia SC, Macefield G, Burke D, & McKenzie DK (1990). Voluntary activation of
human motor axons in the absence of muscle afferent feedback. The control of the
deafferented hand. Brain 113 ( Pt 5), 1563-1581.
Gibson JN, Halliday D, Morrison WL, Stoward PJ, Hornsby GA, Watt PW, Murdoch
G, & Rennie MJ (1987). Decrease in human quadriceps muscle protein turnover
consequent upon leg immobilization. Clin Sci (Lond) 72, 503-509.
Gibson JN, Smith K, & Rennie MJ (1988). Prevention of disuse muscle atrophy by
means of electrical stimulation: maintenance of protein synthesis. Lancet 2, 767770.
Glover EI, Phillips SM, Oates BR, Tang JE, Tarnopolsky MA, Selby A, Smith K, &
Rennie MJ (2008). Immobilization induces anabolic resistance in human
myofibrillar protein synthesis with low and high dose amino acid infusion. J Physiol
586, 6049-6061.
Goldspink G (1998). Cellular and molecular aspects of muscle growth, adaptation
and ageing. Gerodontology 15, 35-43.
Goldspink G & Harridge SD (2004). Growth factors and muscle ageing. Exp Gerontol
39, 1433-1438.
Goldspink G & Yang SY (2001). Effects of activity on growth factor expression. Int J
Sport Nutr Exerc Metab 11 Suppl, S21-S27.
Gomes MD, Lecker SH, Jagoe RT, Navon A, & Goldberg AL (2001). Atrogin-1, a
muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl
Acad Sci U S A 98, 14440-14445.
Gopinath SD & Rando TA (2008). Stem cell review series: aging of the skeletal
muscle stem cell niche. Aging Cell 7, 590-598.
Gram M, Vigelso A, Yokota T, Hansen CN, Helge JW, Hey-Mogensen M, & Dela F
(2014). Two weeks of one-leg immobilization decreases skeletal muscle respiratory
capacity equally in young and elderly men. Exp Gerontol 58, 269-278.
Grounds MD (1998). Age-associated changes in the response of skeletal muscle
cells to exercise and regeneration. Ann N Y Acad Sci 854, 78-91.
Guccione AA, Felson DT, & Anderson JJ (1990). Defining arthritis and measuring
functional status in elders: methodological issues in the study of disease and
physical disability. Am J Public Health 80, 945-949.
Guerra B, Gomez-Cabrera MC, Ponce-Gonzalez JG, Martinez-Bello VE, GuadalupeGrau A, Santana A, Sebastia V, Vina J, & Calbet JA (2011). Repeated muscle biopsies
through a single skin incision do not elicit muscle signaling, but IL-6 mRNA and
STAT3 phosphorylation increase in injured muscle. J Appl Physiol (1985 ) 110, 17081715.
Guralnik JM, Ferrucci L, Simonsick EM, Salive ME, & Wallace RB (1995). LowerExtremity Function in Persons Over the Age of 70 Years As A Predictor of
Subsequent Disability. New England Journal of Medicine 332, 556-561.
Hakkinen K, Alen M, & Komi PV (1985). Changes in Isometric Force-Time and
Relaxation-Time, Electromyographic and Muscle-Fiber Characteristics of Human
Skeletal-Muscle During Strength Training and Detraining. Acta Physiologica
Scandinavica 125, 573-585.
Hakkinen K, Kraemer WJ, Kallinen M, Linnamo V, Pastinen UM, & Newton RU
(1996). Bilateral and unilateral neuromuscular function and muscle cross- sectional
area in middle-aged and elderly men and women. J Gerontol A Biol Sci Med Sci 51,
B21-B29.
Hakkinen K, Kraemer WJ, Newton RU, & Alen M (2001). Changes in
electromyographic activity, muscle fibre and force production characteristics
during heavy resistance/power strength training in middle-aged and older men
and women. Acta Physiologica Scandinavica 171, 51-62.
Hakkinen K, Newton RU, Gordon SE, McCormick M, Volek JS, Nindl BC, Gotshalk
LA, Campbell WW, Evans WJ, Hakkinen A, Humphries BJ, & Kraemer WJ (1998).
Changes in muscle morphology, electromyographic activity, and force production
characteristics during progressive strength training in young and older men. J
Gerontol A Biol Sci Med Sci 53, B415-B423.
Hakkinen K, Pastinen UM, Karsikas R, & Linnamo V (1995). Neuromuscular
performance in voluntary bilateral and unilateral contraction and during electrical
stimulation in men at different ages. Eur J Appl Physiol 70, 518-527.
Halkjaer-Kristensen J & Ingemann-Hansen T (1981). Variations in single fibre areas
and fibre composition in needle biopsies from the human quadriceps muscle.
Scand J Clin Lab Invest 41, 391-395.
Hameed M, Lange KH, Andersen JL, Schjerling P, Kjaer M, Harridge SD, & Goldspink
G (2004). The effect of recombinant human growth hormone and resistance
training on IGF-I mRNA expression in the muscles of elderly men. J Physiol 555,
231-240.
Hameed M, Orrell RW, Cobbold M, Goldspink G, & Harridge SD (2003). Expression
of IGF-I splice variants in young and old human skeletal muscle after high
resistance exercise. J Physiol 547, 247-254.
Harridge SDR, Bottinelli R, Canepari M, Pellegrino MA, Reggiani C, Esbjornsson M,
& Saltin B (1996). Whole-muscle and single-fibre contractile properties and myosin
heavy chain isoforms in humans. Pflugers Archiv-European Journal of Physiology
432, 913-920.
Haruna Y, Suzuki Y, Kawakubo K, Yanagibori R, & Gunji A (1994). Decremental reset
in basal metabolism during 20-days bed rest. Acta Physiol Scand Suppl 616, 43-49.
Hauer K, Specht N, Schuler M, Bartsch P, & Oster P (2002). Intensive physical
training in geriatric patients after severe falls and hip surgery. Age and Ageing 31,
49-57.
Herbert RD & Gandevia SC (1995). Changes in pennation with joint angle and
muscle torque: in vivo measurements in human brachialis muscle. J Physiol 484 (
Pt 2), 523-532.
Heslop L, Beauchamp JR, Tajbakhsh S, Buckingham ME, Partridge TA, & Zammit PS
(2001). Transplanted primary neonatal myoblasts can give rise to functional
satellite cells as identified using the Myf5nlacZl+ mouse. Gene Ther 8, 778-783.
Hespel P, Op’t EB, Van LM, Urso B, Greenhaff PL, Labarque V, Dymarkowski S, Van
HP, & Richter EA (2001). Oral creatine supplementation facilitates the rehabilitation
of disuse atrophy and alters the expression of muscle myogenic factors in humans.
J Physiol 536, 625-633.
Hill AG & Hill GL (1998). Metabolic response to severe injury. Br J Surg 85, 884-890.
Hirsch CH, Sommers L, Olsen A, Mullen L, & Winograd CH (1990). The natural
history of functional morbidity in hospitalized older patients. J Am Geriatr Soc 38,
1296-1303.
Holsgaard LA, Caserotti P, Puggaard L, & Aagaard P (2007). Reproducibility and
relationship of single-joint strength vs multi-joint strength and power in aging
individuals. Scand J Med Sci Sports 17, 43-53.
Hortobagyi T, Dempsey L, Fraser D, Zheng D, Hamilton G, Lambert J, & Dohm L
(2000). Changes in muscle strength, muscle fibre size and myofibrillar gene ex­
pression after immobilization and retraining in humans. J Physiol 524 Pt 1, 293-304.
Husby VS, Helgerud J, Bjorgen S, Husby OS, Benum P, & Hoff J (2009). Early
maximal strength training is an efficient treatment for patients operated with total
hip arthroplasty. Arch Phys Med Rehabil 90, 1658-1667.
Hvid L, Aagaard P, Justesen L, Bayer ML, Andersen JL, Ortenblad N, Kjaer M, &
Suetta C (2010). Effects of aging on muscle mechanical function and muscle fiber
morphology during short-term immobilization and subsequent retraining. J Appl
Physiol (1985 ) 109, 1628-1634.
Hvid LG, Ortenblad N, Aagaard P, Kjaer M, & Suetta C (2011). Effects of ageing on
single muscle fibre contractile function following short-term immobilisation. J
Physiol 589, 4745-4757.
Hvid LG, Suetta C, Aagaard P, Kjaer M, Frandsen U, & Ortenblad N (2013). Four days
of muscle disuse impairs single fiber contractile function in young and old healthy
men. Exp Gerontol 48, 154-161.
Izquierdo M, Ibanez J, Gorostiaga E, Garrues M, Zuniga A, Anton A, Larrion JL, &
Hakkinen K (1999). Maximal strength and power characteristics in isometric and
dynamic actions of the upper and lower extremities in middle-aged and older men.
Acta Physiol Scand 167, 57-68.
Jakobsen TL, Husted H, Kehlet H, & Bandholm T (2012). Progressive strength
training (10 RM) commenced immediately after fast-track total knee arthroplasty:
is it feasible? Disabil Rehabil 34, 1034-1040.
Jakobsen TL, Kehlet H, Husted H, Petersen J, & Bandholm T (2014). Early
progressive strength training to enhance recovery after fast-track total knee
arthroplasty: a randomized controlled trial. Arthritis Care Res (Hoboken ) 66, 18561866.
Janssen I, Heymsfield SB, & Ross R (2002). Low relative skeletal muscle mass
(sarcopenia) in older persons is associated with functional impairment and physical
disability. Journal of the American Geriatrics Society 50, 889-896.
Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N, & Greenhaff PL (2004). Disuse
atrophy and exercise rehabilitation in humans profoundly affects the expression of
genes associated with the regulation of skeletal muscle mass. FASEB J 18, 10251027.
Joulia D, Bernardi H, Garandel V, Rabenoelina F, Vernus B, & Cabello G (2003).
Mechanisms involved in the inhibition of myoblast proliferation and differentiation
by myostatin. Exp Cell Res 286, 263-275.
Kadi F, Bonnerud P, Eriksson A, & Thornell LE (2000). The expression of androgen
receptors in human neck and limb muscles: effects of training and selfadministration of androgenic-anabolic steroids. Histochem Cell Biol 113, 25-29.
Kadi F, Charifi N, Denis C, & Lexell J (2004a). Satellite cells and myonuclei in young
and elderly women and men. Muscle Nerve 29, 120-127.
Harridge SDR, Kryger A, & Stensgaard A (1998). The effects of strength training on
muscle size and force production in elderly people aged 85-97 years. Journal of
Physiology-London 509P, 42P-43P.
Kadi F, Charifi N, Denis C, Lexell J, Andersen JL, Schjerling P, Olsen S, & Kjaer M
(2005). The behaviour of satellite cells in response to exercise: what have we
learned from human studies? Pflugers Arch 451, 319-327.
Harridge SDR, Kryger A, & Stensgaard A (1999). Knee extensor strength, activation,
and size in very elderly people following strength training. Muscle & Nerve 22, 831839.
Kadi F, Charifi N, & Henriksson J (2006). The number of satellite cells in slow and
fast fibres from human vastus lateralis muscle. Histochem Cell Biol 126, 83-87.
Hartkopp A, Harridge SD, Mizuno M, Ratkevicius A, Quistorff B, Kjaer M, & BieringSorensen F (2003). Effect of training on contractile and metabolic properties of
wrist extensors in spinal cord-injured individuals. Muscle Nerve 27, 72-80.
Kadi F, Schjerling P, Andersen LL, Charifi N, Madsen JL, Christensen LR, & Andersen
JL (2004). The effects of heavy resistance training and detraining on satellite cells
in human skeletal muscles. J Physiol 558, 1005-1012.
Kamel HK, Iqbal MA, Mogallapu R, Maas D, & Hoffmann RG (2003). Time to
29
ambulation after hip fracture surgery: relation to hospitalization outcomes. J
Gerontol A Biol Sci Med Sci 58, 1042-1045.
Lexell J & Taylor CC (1991). Variability in muscle fibre areas in whole human
quadriceps muscle: effects of increasing age. J Anat 174, 239-249.
Kawakami Y, Muraoka Y, Kubo K, Suzuki Y, & Fukunaga T (2000). Changes in muscle
size and architecture following 20 days of bed rest. J Gravit Physiol 7, 53-59.
Lexell J, Taylor CC, & Sjostrom M (1988). What is the cause of the ageing atrophy?
Total number, size and proportion of different fiber types studied in whole vastus
lateralis muscle from 15- to 83-year-old men. J Neurol Sci 84, 275-294.
Kehlet H (2006). Future perspectives and research initiatives in fast-track surgery.
Langenbecks Arch Surg 391, 495-498.
Kehlet H & Wilmore DW (2002). Multimodal strategies to improve surgical
outcome. Am J Surg 183, 630-641.
Kellis E & Baltzopoulos V (1997). The effects of antagonist moment on the
resultant knee joint moment during isokinetic testing of the knee extensors.
European Journal of Applied Physiology and Occupational Physiology 76, 253-259.
Kent-Braun JA & Ng AV (1999). Specific strength and voluntary muscle activation in
young and elderly women and men. J Appl Physiol 87, 22-29.
Kim JS, Kosek DJ, Petrella JK, Cross JM, & Bamman MM (2005). Resting and loadinduced levels of myogenic gene transcripts differ between older adults with
demonstrable sarcopenia and young men and women. J Appl Physiol 99, 2149-2158.
Klass M, Baudry S, & Duchateau J (2008). Age-related decline in rate of torque
development is accompanied by lower maximal motor unit discharge frequency
during fast contractions. J Appl Physiol 104, 739-746.
Klitgaard H, Mantoni M, Schiaffino S, Ausoni S, Gorza L, Laurent-Winter C, Schnohr
P, & Saltin B (1990). Function, morphology and protein expression of ageing skeletal
muscle: a cross-sectional study of elderly men with different training backgrounds.
Acta Physiol Scand 140, 41-54.
Kortebein P (2008). RE: Effect of short-term hospitalization on functional capacity
in patients not restricted to bed. Am J Phys Med Rehabil 87, 425-426.
Kortebein P (2009). Rehabilitation for hospital-associated deconditioning. Am J
Phys Med Rehabil 88, 66-77.
Kortebein P, Ferrando A, Lombeida J, Wolfe R, & Evans WJ (2007). Effect of 10 days
of bed rest on skeletal muscle in healthy older adults. JAMA 297, 1772-1774.
Kortebein P, Symons TB, Ferrando A, Paddon-Jones D, Ronsen O, Protas E, Conger
S, Lombeida J, Wolfe R, & Evans WJ (2008). Functional impact of 10 days of bed
rest in healthy older adults. J Gerontol A Biol Sci Med Sci 63, 1076-1081.
Lindle RS, Metter EJ, Lynch NA, Fleg JL, Fozard JL, Tobin J, Roy TA, & Hurley BF
(1997). Age and gender comparisons of muscle strength in 654 women and men
aged 20-93 yr. J Appl Physiol 83, 1581-1587.
Lindstrom M, Pedrosa-Domellof F, & Thornell LE (2010). Satellite cell heterogeneity
with respect to expression of MyoD, myogenin, Dlk1 and c-Met in human skeletal
muscle: application to a cohort of power lifters and sedentary men. Histochem Cell
Biol 134, 371-385.
Livak KJ & Schmittgen TD (2001). Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
Mackey AL, Esmarck B, Kadi F, Koskinen SO, Kongsgaard M, Sylvestersen A, Hansen
JJ, Larsen G, & Kjaer M (2007). Enhanced satellite cell proliferation with resistance
training in elderly men and women. Scand J Med Sci Sports 17, 34-42.
Mackey AL, Kjaer M, Charifi N, Henriksson J, Bojsen-Moller J, Holm L, & Kadi F
(2009). Assessment of satellite cell number and activity status in human skeletal
muscle biopsies. Muscle Nerve 40, 455-465.
Madsen OR, Bliddal H, Egsmose C, & Sylvest J (1995). Isometric and isokinetic
quadriceps strength in gonarthrosis; inter- relations between quadriceps strength,
walking ability, radiology, subchondral bone density and pain. Clin Rheumatol 14,
308-314.
Madsen OR, Lauridsen UB, Hartkopp A, & Sorensen OH (1997). Muscle strength
and soft tissue composition as measured by dual energy x-ray absorptiometry in
women aged 18-87 years. Eur J Appl Physiol Occup Physiol 75, 239-245.
Magaziner J, Simonsick EM, Kashner TM, Hebel JR, & Kenzora JE (1990). Predictors
of functional recovery one year following hospital discharge for hip fracture: a
prospective study. J Gerontol 45, M101-M107.
Malmgren LT, Jones CE, & Bookman LM (2001). Muscle fiber and satellite cell
apoptosis in the aging human thyroarytenoid muscle: a stereological study with
confocal laser scanning microscopy. Otolaryngol Head Neck Surg 125, 34-39.
Kosek DJ, Kim JS, Petrella JK, Cross JM, & Bamman MM (2006). Efficacy of 3 days/
wk resistance training on myofiber hypertrophy and myogenic mechanisms in
young vs. older adults. J Appl Physiol 101, 531-544.
Mammucari C, Milan G, Romanello V, Masiero E, Rudolf R, Del PP, Burden SJ, Di LR,
Sandri C, Zhao J, Goldberg AL, Schiaffino S, & Sandri M (2007). FoxO3 controls
autophagy in skeletal muscle in vivo. Cell Metab 6, 458-471.
Kraemer WJ, Mazzetti SA, Nindl BC, Gotshalk LA, Volek JS, Bush JA, Marx JO, Dohi
K, Gomez AL, Miles M, Fleck SJ, Newton RU, & Hakkinen K (2001). Effect of
resistance training on women’s strength/power and occupational performances.
Medicine and Science in Sports and Exercise 33, 1011-1025.
Marcinek DJ, Schenkman KA, Ciesielski WA, Lee D, & Conley KE (2005). Reduced
mitochondrial coupling in vivo alters cellular energetics in aged mouse skeletal
muscle. J Physiol 569, 467-473.
Kryger AI & Andersen JL (2007). Resistance training in the oldest old: consequences
for muscle strength, fiber types, fiber size, and MHC isoforms. Scand J Med Sci
Sports 17, 422-430.
Kuang S, Kuroda K, Le GF, & Rudnicki MA (2007). Asymmetric self-renewal and
commitment of satellite stem cells in muscle. Cell 129, 999-1010.
Kvorning T, Andersen M, Brixen K, Schjerling P, Suetta C, & Madsen K (2007).
Suppression of testosterone does not blunt mRNA expression of myoD, myogenin,
IGF, myostatin or androgen receptor post strength training in humans. J Physiol
578, 579-593.
Labarque VL, Eijnde BO, & Van LM (2002). Effect of immobilization and retraining on
torque-velocity relationship of human knee flexor and extensor muscles. Eur J Appl
Physiol 86, 251-257.
Lange KH, Andersen JL, Beyer N, Isaksson F, Larsson B, Rasmussen MH, Juul A,
Bulow J, & Kjaer M (2002). GH administration changes myosin heavy chain
isoforms in skeletal muscle but does not augment muscle strength or hypertrophy,
either alone or combined with resistance exercise training in healthy elderly men. J
Clin Endocrinol Metab 87, 513-523.
LeBlanc A, Gogia P, Schneider V, Krebs J, Schonfeld E, & Evans H (1988). Calf muscle
area and strength changes after five weeks of horizontal bed rest. Am J Sports Med
16, 624-629.
LeBlanc A, Rowe R, Evans H, West S, Shackelford L, & Schneider V (1997). Muscle
atrophy during long duration bed rest. Int J Sports Med 18 Suppl 4, S283-S285.
Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, &
Goldberg AL (2004). Multiple types of skeletal muscle atrophy involve a common
program of changes in gene expression. FASEB J 18, 39-51.
Leger B, Cartoni R, Praz M, Lamon S, Deriaz O, Crettenand A, Gobelet C, Rohmer P,
Konzelmann M, Luthi F, & Russell AP (2006). Akt signalling through GSK-3beta,
mTOR and Foxo1 is involved in human skeletal muscle hypertrophy and atrophy. J
Physiol 576, 923-933.
Lexell J, Downham DY, Larsson Y, Bruhn E, & Morsing B (1995). Heavy-resistance
training in older Scandinavian men and women: short- and long-term effects on
arm and leg muscles. Scand J Med Sci Sports 5, 329-341.
Lexell J & Taylor CC (1989). Variability in muscle fibre areas in whole human
quadriceps muscle: how to reduce sampling errors in biopsy techniques. Clin
Physiol 9, 333-343.
30 Marzetti E, Carter CS, Wohlgemuth SE, Lees HA, Giovannini S, Anderson B, Quinn
LS, & Leeuwenburgh C (2009). Changes in IL-15 expression and death-receptor
apoptotic signaling in rat gastrocnemius muscle with aging and life-long calorie
restriction. Mech Ageing Dev 130, 272-280.
Marzetti E, Wohlgemuth SE, Lees HA, Chung HY, Giovannini S, & Leeuwenburgh C
(2008). Age-related activation of mitochondrial caspase-independent apoptotic
signaling in rat gastrocnemius muscle. Mech Ageing Dev 129, 542-549.
Mauro A (1961). Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9,
493-495.
McCroskery S, Thomas M, Maxwell L, Sharma M, & Kambadur R (2003). Myostatin
negatively regulates satellite cell activation and self-renewal. J Cell Biol 162, 11351147.
McPherron AC, Lawler AM, & Lee SJ (1997). Regulation of skeletal muscle mass in
mice by a new TGF-beta superfamily member. Nature 387, 83-90.
Merton PA (1954). Voluntary strength and fatigue. J Physiol 123, 553-564.
Metter EJ, Talbot LA, Schrager M, & Conwit R (2002). Skeletal muscle strength as a
predictor of all-cause mortality in healthy men. J Gerontol A Biol Sci Med Sci 57,
B359-B365.
Mezzogiorno A, Coletta M, Zani BM, Cossu G, & Molinaro M (1993). Paracrine
stimulation of senescent satellite cell proliferation by factors released by muscle or
myotubes from young mice. Mech Ageing Dev 70, 35-44.
Mikkelsen UR, Langberg H, Helmark IC, Skovgaard D, Andersen LL, Kjaer M, &
Mackey AL (2009). Local NSAID infusion inhibits satellite cell proliferation in human
skeletal muscle after eccentric exercise. J Appl Physiol (1985 ) 107, 1600-1611.
Mitsiopoulos N, Baumgartner RN, Heymsfield SB, Lyons W, Gallagher D, & Ross R
(1998). Cadaver validation of skeletal muscle measurement by magnetic resonance
imaging and computerized tomography. J Appl Physiol (1985 ) 85, 115-122.
Moritani T & deVries HA (1979). Neural factors versus hypertrophy in the time
course of muscle strength gain. Am J Phys Med 58, 115-130.
Morse CI, Thom JM, Birch KM, & Narici MV (2005a). Changes in triceps surae
muscle architecture with sarcopenia. Acta Physiol Scand 183, 291-298.
Morse CI, Thom JM, Mian OS, Birch KM, & Narici MV (2006). Gastrocnemius specific
force is increased in elderly males following a 12-month physical training
programme. Eur J Appl Physiol.
Morse CI, Thom JM, Mian OS, Muirhead A, Birch KM, & Narici MV (2005b). Muscle
strength, volume and activation following 12-month resistance training in 70-yearold males. Eur J Appl Physiol 95, 197-204.
Moss FP & Leblond CP (1970). Nature of dividing nuclei in skeletal muscle of
growing rats. J Cell Biol 44, 459-462.
Moss FP & Leblond CP (1971). Satellite cells as the source of nuclei in muscles of
growing rats. Anat Rec 170, 421-435.
Narici M (1999). Human skeletal muscle architecture studied in vivo by noninvasive imaging techniques: functional significance and applications. J
Electromyogr Kinesiol 9, 97-103.
Narici M & Cerretelli P (1998). Changes in human muscle architecture in disuseatrophy evaluated by ultrasound imaging. J Gravit Physiol 5, 73-74.
Narici MV & de Boer MD (2011). Disuse of the musculo-skeletal system in space
and on earth. Eur J Appl Physiol 111, 403-420.
Reeves ND, Maganaris CN, & Narici MV (2004). Ultrasonographic assessment of
human skeletal muscle size. Eur J Appl Physiol 91, 116-118.
Reeves ND, Maganaris CN, & Narici MV (2005). Plasticity of dynamic muscle
performance with strength training in elderly humans. Muscle Nerve 31, 355-364.
Reeves ND, Narici MV, & Maganaris CN (2006). Myotendinous plasticity to ageing
and resistance exercise in humans. Exp Physiol 91, 483-498.
Renault V, Thornell LE, Eriksson PO, Butler-Browne G, & Mouly V (2002). Re­
generative potential of human skeletal muscle during aging. Aging Cell 1, 132-139.
Rennie MJ, Selby A, Atherton P, Smith K, Kumar V, Glover EL, & Philips SM (2010).
Facts, noise and wishful thinking: muscle protein turnover in aging and human
disuse atrophy. Scand J Med Sci Sports 20, 5-9.
Rennie MJ, Wackerhage H, Spangenburg EE, & Booth FW (2004). Control of the size
of the human muscle mass. Annu Rev Physiol 66, 799-828.
Narici MV, Maganaris CN, Reeves ND, & Capodaglio P (2003). Effect of aging on
human muscle architecture. J Appl Physiol (1985 ) 95, 2229-2234.
Roos MR, Rice CL, Connelly DM, & Vandervoort AA (1999). Quadriceps muscle
strength, contractile properties, and motor unit firing rates in young and old men.
Muscle Nerve 22, 1094-1103.
Newman AB, Kupelian V, Visser M, Simonsick EM, Goodpaster BH, Kritchevsky SB,
Tylavsky FA, Rubin SM, & Harris TB (2006). Strength, but not muscle mass, is
associated with mortality in the health, aging and body composition study cohort.
J Gerontol A Biol Sci Med Sci 61, 72-77.
Roth SM, Ivey FM, Martel GF, Lemmer JT, Hurlbut DE, Siegel EL, Metter EJ, Fleg JL,
Fozard JL, Kostek MC, Wernick DM, & Hurley BF (2001). Muscle size responses to
strength training in young and older men and women. J Am Geriatr Soc 49, 14281433.
Olson EN, Brennan TJ, Chakraborty T, Cheng TC, Cserjesi P, Edmondson D, James G,
& Li L (1991). Molecular control of myogenesis: antagonism between growth and
differentiation. Mol Cell Biochem 104, 7-13.
Roth SM, Martel GF, Ivey FM, Lemmer JT, Metter EJ, Hurley BF, & Rogers MA
(2000). Skeletal muscle satellite cell populations in healthy young and older men
and women. Anat Rec 260, 351-358.
Paddon-Jones D, Sheffield-Moore M, Cree MG, Hewlings SJ, Aarsland A, Wolfe RR,
& Ferrando AA (2006). Atrophy and impaired muscle protein synthesis during
prolonged inactivity and stress. J Clin Endocrinol Metab.
Rutherford OM & Jones DA (1992). Measurement of fibre pennation using ultra­
sound in the human quadriceps in vivo. Eur J Appl Physiol Occup Physiol 65, 433-437.
Pearson SJ, Young A, Macaluso A, Devito G, Nimmo MA, Cobbold M, & Harridge SD
(2002). Muscle function in elite master weightlifters. Med Sci Sports Exerc 34,
1199-1206.
Petrella JK, Kim JS, Cross JM, Kosek DJ, & Bamman MM (2006). Efficacy of
myonuclear addition may explain differential myofiber growth among resistancetrained young and older men and women. Am J Physiol Endocrinol Metab 291,
E937-E946.
Petrella JK, Kim JS, Mayhew DL, Cross JM, & Bamman MM (2008). Potent Myofiber
Hypertrophy During Resistance Training in Humans is Associated with Satellite CellMediated Myonuclear Addition: A Cluster Analysis. J Appl Physiol.
Phillips T & Leeuwenburgh C (2005). Muscle fiber specific apoptosis and TNF-alpha
signaling in sarcopenia are attenuated by life-long calorie restriction. FASEB J 19,
668-670.
Pistilli EE, Jackson JR, & Alway SE (2006). Death receptor-associated pro-apoptotic
signaling in aged skeletal muscle. Apoptosis 11, 2115-2126.
Pistilli EE, Siu PM, & Alway SE (2007). Interleukin-15 responses to aging and
unloading-induced skeletal muscle atrophy. Am J Physiol Cell Physiol 292,
C1298-C1304.
Portegijs E, Sipila S, Alen M, Kaprio J, Koskenvuo M, Tiainen K, & Rantanen T
(2005). Leg extension power asymmetry and mobility limitation in healthy older
women. Arch Phys Med Rehabil 86, 1838-1842.
Portegijs E, Sipila S, Pajala S, Lamb SE, Alen M, Kaprio J, Kosekenvuo M, & Rantanen
T (2006). Asymmetrical lower extremity power deficit as a risk factor for injurious
falls in healthy older women. J Am Geriatr Soc 54, 551-553.
Psilander N, Damsgaard R, & Pilegaard H (2003). Resistance exercise alters MRF
and IGF-I mRNA content in human skeletal muscle. J Appl Physiol 95, 1038-1044.
Raj IS, Bird SR, & Shield AJ (2012). Reliability of ultrasonographic measurement of
the architecture of the vastus lateralis and gastrocnemius medialis muscles in older
adults. Clin Physiol Funct Imaging 32, 65-70.
Rantanen T, Harris T, Leveille SG, Visser M, Foley D, Masaki K, & Guralnik JM (2000).
Muscle strength and body mass index as long-term predictors of mortality in
initially healthy men. J Gerontol A Biol Sci Med Sci 55, M168-M173.
Rantanen T, Volpato S, Ferrucci L, Heikkinen E, Fried LP, & Guralnik JM (2003).
Handgrip strength and cause-specific and total mortality in older disabled women:
exploring the mechanism. J Am Geriatr Soc 51, 636-641.
Rasch A, Bystrom AH, Dalen N, & Berg HE (2007). Reduced muscle radiological
density, cross-sectional area, and strength of major hip and knee muscles in 22
patients with hip osteoarthritis. Acta Orthop 78, 505-510.
Raue U, Slivka D, Jemiolo B, Hollon C, & Trappe SW (2006). Myogenic Gene
Expression at Rest and Following a Bout of Resistance Exercise in Young (18-30 y)
and Old (80-89 y) Women. J Appl Physiol.
Reardon K, Galea M, Dennett X, Choong P, & Byrne E (2001a). Quadriceps muscle
wasting persists 5 months after total hip arthroplasty for osteoarthritis of the hip:
a pilot study. Internal Medicine Journal 31, 7-14.
Reardon KA, Davis J, Kapsa RM, Choong P, & Byrne E (2001b). Myostatin, insulinlike growth factor-1, and leukemia inhibitory factor mRNAs are upregulated in
chronic human disuse muscle atrophy. Muscle Nerve 24, 893-899.
Sacheck JM, Hyatt JP, Raffaello A, Jagoe RT, Roy RR, Edgerton VR, Lecker SH, &
Goldberg AL (2007). Rapid disuse and denervation atrophy involve transcriptional
changes similar to those of muscle wasting during systemic diseases. FASEB J 21,
140-155.
Sager MA, Franke T, Inouye SK, Landefeld CS, Morgan TM, Rudberg MA, Sebens H,
& Winograd CH (1996). Functional outcomes of acute medical illness and
hospitalization in older persons. Arch Intern Med 156, 645-652.
Sandri M (2008). Signaling in muscle atrophy and hypertrophy. Physiology
(Bethesda ) 23, 160-170.
Sandri M, Lin J, Handschin C, Yang W, Arany ZP, Lecker SH, Goldberg AL, &
Spiegelman BM (2006). PGC-1alpha protects skeletal muscle from atrophy by
suppressing FoxO3 action and atrophy-specific gene transcription. Proc Natl Acad
Sci U S A 103, 16260-16265.
Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S,
Lecker SH, & Goldberg AL (2004). Foxo transcription factors induce the atrophyrelated ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117, 399412.
Sashika H, Matsuba Y, & Watanabe Y (1996). Home program of physical therapy:
Effect on disabilities patients with total hip arthroplasty. Archives of Physical
Medicine and Rehabilitation 77, 273-277.
Sheehan SM & Allen RE (1999). Skeletal muscle satellite cell proliferation in
response to members of the fibroblast growth factor family and hepatocyte
growth factor. J Cell Physiol 181, 499-506.
Shefer G, Rauner G, Yablonka-Reuveni Z, & Benayahu D (2010). Reduced satellite
cell numbers and myogenic capacity in aging can be alleviated by endurance
exercise. PLoS ONE 5, e13307.
Sherrington C & Lord SR (1997). Home exercise to improve strength and walking
velocity after hip fracture: A randomized controlled trial. Archives of Physical
Medicine and Rehabilitation 78, 208-212.
Shih CH, Du YK, Lin YH, & Wu CC (1994). Muscular recovery around the hip joint
after total hip arthroplasty. Clin Orthop 115-120.
Sicard-Rosenbaum L, Light KE, & Behrman AL (2002). Gait, lower extremity
strength, and self-assessed mobility after hip arthroplasty. Journals of Gerontology
Series A-Biological Sciences and Medical Sciences 57, M47-M51.
Simoneau JA, Lortie G, Boulay MR, Thibault MC, & Bouchard C (1986).
Repeatability of fibre type and enzyme activity measurements in human skeletal
muscle. Clin Physiol 6, 347-356.
Singh MA, Ding W, Manfredi TJ, Solares GS, O’Neill EF, Clements KM, Ryan ND,
Kehayias JJ, Fielding RA, & Evans WJ (1999). Insulin-like growth factor I in skeletal muscle after weight-lifting exercise in frail elders. Am J Physiol 277, E135E143.
Sipila S & Suominen H (1995). Effects of strength and endurance training on thigh
and leg muscle mass and composition in elderly women. J Appl Physiol 78, 334-340.
Siu PM, Pistilli EE, Butler DC, & Alway SE (2005). Aging influences cellular and
molecular responses of apoptosis to skeletal muscle unloading. Am J Physiol Cell
Physiol 288, C338-C349.
Siu PM, Pistilli EE, Murlasits Z, & Alway SE (2006). Hindlimb unloading increases
muscle content of cytosolic but not nuclear Id2 and p53 proteins in young adult
and aged rats. J Appl Physiol 100, 907-916.
31
Skelton DA, Greig CA, Davies JM, & Young A (1994). Strength, power and related
functional ability of healthy people aged 65-89 years. Age Ageing 23, 371-377.
Welle S, Totterman S, & Thornton C (1996). Effect of age on muscle hypertrophy
induced by resistance training. J Gerontol A Biol Sci Med Sci 51, M270-M275.
Skelton DA, Kennedy J, & Rutherford OM (1999). Lower limb muscle power in
frequently falling community-dwelling women aged 65 and over. Journal of Aging
and Physical Activity 7, 281-282.
Wennerberg D (1991). Reliability of an isokinetic dorsiflexion and plantar flexion
apparatus. Am J Sports Med 19, 519-522.
Skelton DA, Kennedy J, & Rutherford OM (2002). Explosive power and asymmetry
in leg muscle function in frequent fallers and non-fallers aged over 65. Age and
Ageing 31, 119-125.
Sleivert GG & Wenger HA (1994). Reliability of measuring isometric and isokinetic
peak torque, rate of torque development, integrated electromyography, and tibial
nerve conduction velocity. Arch Phys Med Rehabil 75, 1315-1321.
Sonn U & Asberg KH (1991). Assessment of activities of daily living in the elderly. A
study of a population of 76-year-olds in Gothenburg, Sweden. Scand J Rehabil Med
23, 193-202.
Stevens JE, Walter GA, Okereke E, Scarborough MT, Esterhai JL, George SZ, Kelley
MJ, Tillman SM, Gibbs JD, Elliott MA, Frimel TN, Gibbs CP, & Vandenborne K (2004).
Muscle adaptations with immobilization and rehabilitation after ankle fracture.
Med Sci Sports Exerc 36, 1695-1701.
Strasser H, Tiefenthaler M, Steinlechner M, Eder I, Bartsch G, & Konwalinka G
(2000). Age dependent apoptosis and loss of rhabdosphincter cells. J Urol 164,
1781-1785.
Strojnik V & Komi PV (1998). Neuromuscular fatigue after maximal stretchshortening cycle exercise. J Appl Physiol 84, 344-350.
Swanson CE, Day GA, Yelland CE, Broome JR, Massey L, Richardson HR, Dimitri K, &
Marsh A (1998). The management of elderly patients with femoral fractures. A
randomised controlled trial of early intervention versus standard care. Med J Aust
169, 515-518.
Tesch PA, von WF, Gustafsson T, Linnehan RM, & Trappe TA (2008). Skeletal muscle
proteolysis in response to short-term unloading in humans. J Appl Physiol (1985 )
105, 902-906.
Thelen DG, Schultz AB, Alexander NB, & AshtonMiller JA (1996). Effects of age on
rapid ankle torque development. Journals of Gerontology Series A-Biological
Sciences and Medical Sciences 51, M226-M232.
Tracy BL, Ivey FM, Hurlbut D, Martel GF, Lemmer JT, Siegel EL, Metter EJ, Fozard JL,
Fleg JL, & Hurley BF (1999). Muscle quality. II. Effects Of strength training in 65- to
75-yr-old men and women. J Appl Physiol 86, 195-201.
Trudelle-Jackson E, Emerson R, & Smith S (2002). Outcomes of total hip
arthroplasty: A study of patients one year postsurgery. Journal of Orthopaedic &
Sports Physical Therapy 32, 260-267.
Trudelle-Jackson E & Smith SS (2004). Effects of a late-phase exercise program after
total hip arthroplasty: a randomized controlled trial. Arch Phys Med Rehabil 85,
1056-1062.
Urso ML, Clarkson PM, & Price TB (2006). Immobilization effects in young and
older adults. Eur J Appl Physiol 96, 564-571.
Van CM, Duchateau J, & Hainaut K (1998). Changes in single motor unit behaviour
contribute to the increase in contraction speed after dynamic training in humans. J
Physiol 513 ( Pt 1), 295-305.
Vandervoort AA (2002). Aging of the human neuromuscular system. Muscle Nerve
25, 17-25.
Vandervoort AA & McComas AJ (1986). Contractile changes in opposing muscles of
the human ankle joint with aging. J Appl Physiol 61, 361-367.
Verdijk LB, Koopman R, Schaart G, Meijer K, Savelberg HH, & van Loon LJ (2007).
Satellite cell content is specifically reduced in type II skeletal muscle fibers in the
elderly. Am J Physiol Endocrinol Metab 292, E151-E157.
Verney J, Kadi F, Charifi N, Feasson L, Saafi MA, Castells J, Piehl-Aulin K, & Denis C
(2008). Effects of combined lower body endurance and upper body resistance
training on the satellite cell pool in elderly subjects. Muscle Nerve 38, 1147-1154.
Viitasalo JT, Saukkonen S, & Komi PV (1980). Reproducibility of measurements of
selected neuromuscular performance variables in man. Electromyogr Clin
Neurophysiol 20, 487-501.
Visser M, Harris TB, Fox KM, Hawkes W, Hebel JR, Yahiro JY, Michael R, Zimmerman
SI, & Magaziner J (2000). Change in muscle mass and muscle strength after a hip
fracture: relationship to mobility recovery. J Gerontol A Biol Sci Med Sci 55,
M434-M440.
Wall BT, Dirks ML, Snijders T, Senden JM, Dolmans J, & van Loon LJ (2014).
Substantial skeletal muscle loss occurs during only 5 days of disuse. Acta Physiol
(Oxf) 210, 600-611.
Walsh M, Woodhouse LJ, Thomas SG, & Finch E (1998). Physical impairments and
functional limitations: a comparison of individuals 1 year after total knee
arthroplasty with control subjects. Phys Ther 78, 248-258.
Welle S, Brooks A, & Thornton CA (2001). Senescence-related changes in gene
expression in muscle: similarities and differences between mice and men. Physiol
Genomics 5, 67-73.
32 Whitman SA, Wacker MJ, Richmond SR, & Godard MP (2009). Contributions of the
ubiquitin-proteasome pathway and apoptosis to human skeletal muscle wasting
with age. Pflugers Arch 450, 437-446.
Wozniak AC & Anderson JE (2007). Nitric oxide-dependence of satellite stem cell
activation and quiescence on normal skeletal muscle fibers. Dev Dyn 236, 240-250.
Wyszomierski SA, Chambers AJ, & Cham R (2009). Knee strength capabilities and
slip severity. J Appl Biomech 25, 140-148.
Yang SY & Goldspink G (2002). Different roles of the IGF-I Ec peptide (MGF) and
mature IGF-I in myoblast proliferation and differentiation. FEBS Lett 522, 156-160.
Zarzhevsky N, Carmeli E, Fuchs D, Coleman R, Stein H, & Reznick AZ (2001).
Recovery of muscles of old rats after hindlimb immobilisation by external fixation
is impaired compared with those of young rats. Exp Gerontol 36, 125-140.
Zhao J, Brault JJ, Schild A, Cao P, Sandri M, Schiaffino S, Lecker SH, & Goldberg AL
(2007). FoxO3 coordinately activates protein degradation by the autophagic/
lysosomal and proteasomal pathways in atrophying muscle cells. Cell Metab 6,
472-483.
Resistance Training in the Early Postoperative Phase
Reduces Hospitalization and Leads to Muscle Hypertrophy
in Elderly Hip Surgery PatientsFA Controlled,
Randomized Study
Charlotte Suetta, MD, S. Peter Magnusson, DMSc, Anna Rosted, MD, z Per Aagaard, PhD, Prof, w
Ane K. Jakobsen, Lone H. Larsen, PT,§ Benn Duus, MD, k and Michael Kjaer, DMSc, Prof
OBJECTIVES: To better understand how immobilization
and surgery affect muscle size and function in the elderly
and to identify effective training regimes.
DESIGN: A prospective randomized, controlled study.
SETTING: Bispebjerg University Hospital, Copenhagen,
Denmark.
PARTICIPANTS: Thirty-six patients (aged 60–86) scheduled for unilateral hip replacement due to primary hip osteoarthrosis.
INTERVENTION: Patients were randomized to standard
home-based rehabilitation (1 h/d � 12 weeks), unilateral
neuromuscular electrical stimulation of the operated side
(1 h/d � 12 weeks), or unilateral resistance training of the
operated side (3/wk � 12 weeks).
MEASUREMENTS: Hospital length of stay (LOS), quadriceps muscle cross-sectional area (CSA), isokinetic muscle
strength, and functional performance. Patients were tested
presurgery and 5 and 12 weeks postsurgery
RESULTS: Mean � standard error LOS was shorter for the
resistance training group (10.0 � 2.4 days, Po.05) than for
the standard rehabilitation group (16.0 � 7.2 days). Resistance training, but not electrical stimulation or standard
rehabilitation, resulted in increased CSA (12%, Po.05) and
muscle strength (22–28%, Po.05). Functional muscle performance increased after resistance training (30%,
Po.001) and electrical stimulation (15%, Po.05) but not
after standard rehabilitation.
CONCLUSION: Postoperative resistance training effectively increased maximal muscle strength, muscle mass, and
muscle function more than a standard rehabilitation regime.
Furthermore, it markedly reduced LOS in elderly postoperative patients. J Am Geriatr Soc 52:2016–2022, 2004.
From the Sports Medicine Research Unit, wTeam Danmark Testcenter,
z
Department of Radiology, §Department of Physiotherapy and kDepartment
of Orthopedics, Bispebjerg Hospital, University of Copenhagen,
Copenhagen, Denmark.
Address correspondence to Charlotte Suetta, MD, Sports Medicine Research
Unit, Bispebjerg Hospital, Bispebjerg Bakke 23, 2400 NVFCopenhagen,
Denmark. E-mail: [email protected]
JAGS 52:2016–2022, 2004
r 2004 by the American Geriatrics Society
Key words: immobilization; rehabilitation; resistance
training; sarcopenia
I
mmobilization due to major surgery and hospitalization can
cause a severe decline in muscle mass,1,2 muscle strength,3
and muscle function.4 Frail elderly persons with sarcopenia
often undergo musculoskeletal-related surgery, and the hospitalization-associated immobilization further compromises
the musculoskeletal system, with potentially grave consequences. Many elderly patients fail to regain their preoperative level of function and self-care.5–7 However, knowledge
concerning optimal postoperative rehabilitation in the elderly
is surprisingly scarce. Studies have examined the effect of
conventional rehabilitation programs, including conditioning,
ambulatory training, transfer and balance training8,9 and inpatient multidisciplinary programs.10–12 Yet the model and
magnitude of muscle activation required to effectively
counteract the immobilization-associated decline in muscle
mass and function have not been adequately addressed.
Physical training can improve strength and functional
performance in healthy elderly13,14 and frail nursing home
residents.15,16 Strength training initiated 6 to 8 weeks17 or
more than 6 months after hip surgery5 significantly increases muscle strength, but because muscle strength declines approximately 4% per day during the first week of
immobilization,3 it is important to start physical training as
soon as possible after surgery.
Percutaneous neuromuscular electrical stimulation
(NMES) to restore muscular function after immobilization
has been investigated in young persons,18,19 although studies
on elderly patients are limited.20,21 Because muscle contraction
caused by NMES precludes afferent information from the
central nervous system, it may be hypothesized that a rehabilitation program that involves volitional resistance exercise
more effectively improves neuromuscular function. The
present study prospectively compared the effect of progressive
resistance training or NMES of the quadriceps muscle with a
0002-8614/04/$15.00
JAGS
DECEMBER 2004–VOL. 52, NO. 12
conventional home-based rehabilitation program in a group of
elderly patients scheduled for elective hip-replacement surgery.
METHODS
Study Design
The study was designed as a prospective randomized, controlled study and included patients scheduled for primary
unilateral hip replacement at Bispebjerg University Hospital,
Copenhagen, Denmark. The patient group was chosen in
part because it permitted familiarization and baseline tests
before the operation. These tests were conducted approximately 2 and 1 week preoperatively, and patients were subsequently randomly allocated to one of the following groups:
home-based standard rehabilitation (SR), SR plus unilateral
lower-limb resistance training (RT), or SR plus unilateral
NMES. The randomization procedure was performed with
the aid of a computer program (Minimize version 2.1, C. V.
Jensen, Rigshospitalet; Copenhagen, Denmark), and patients
were stratified by age and sex. The RT and electrical stimulation (ES) groups performed the additional training or received ES on the operated leg, so the nonoperated side could
serve as a within-subject control. Patients were retested 5
weeks and 12 weeks postsurgery. Measurement outcomes
included hospital length of stay (LOS), functional performance, muscle cross-sectional area (CSA), and maximal quadriceps strength. The ethics committee of Copenhagen
approved the study in accordance with the Declaration of
Helsinki, and written informed consent was obtained.
Study Population
Medical records of 168 patients on a waiting list for a hip
replacement operation were reviewed to identify eligible subjects from May 2000 to May 2002. Eligibility criteria included
age of 60 and older and unilateral primary hip replacement
due to primary hip osteoarthrosis in patients without cardiopulmonary, neurological, or cognitive problems. To avoid
differences in comorbidity between groups, only patients with
an American Society of Anesthesiologists (ASA) score of I to II
(I 5 no comorbidity, II 5 comorbidity but no systemic affection) were included. Sixty-eight persons that met the inclusion
criteria were contacted, of whom 36 gave written informed
consent to participate. The most common reasons for refusal
to participate in the study were the time-consuming test sessions before the operation and the randomization of the postoperative intervention. Excluded patients did not significantly
differ from included patients with respect to age, sex, comorbidity, or degree of hip osteoarthrosis.
RESISTANCE TRAINING AFTER HIP SURGERY
2017
ing22,23 were measured. Maximal gait speed over a 10-meter
course was measured to the nearest 0.1 seconds, and stairclimbing performance was measured as the time to ascend 10
steps (height 20 cm). Both tests were initiated from a standing
position and stopped when both feet were at the predefined
finish position. The ability to rise from a chair (sit-to-stand
test; five repetitions) was measured to the nearest 0.1 seconds.
Strength Assessment
Muscle strength was measured as the maximal voluntary
isokinetic knee extension moment (peak moment, Nm)
during concentric quadriceps contraction at slow (601/s)
and fast (1801/s) knee joint angular velocities. All moment
values were corrected for the effect of gravity of the lower
limb, as has been described in detail elsewhere.24 Measurements were performed on both thighs and were preceded by
a familiarization trial conducted on a separate day. The
nonaffected side was tested first to increase the subject’s
comfort with the procedure. Strict care was taken to ensure
identical test protocols for all subjects, which included
standardized verbal encouragement and visual feedback
provided by a real-time display of the force output.25 Successive trials were performed until peak moment could not
be improved any further,24 which typically included seven
to nine attempts at each velocity. Although pain will clearly
influence any measure of muscle strength, it is noteworthy
that pain has not been addressed in previous training studies
on patients.5,17 In the present study, the subjects were requested to indicate pain level during the test on a standard
visual analog scale. The strength data were discarded if the
visual analog scale score exceeded three. Peak moment of
the operated side divided by that of the nonoperated side
was defined as the quadriceps strength index.
Muscle CSA
Computed tomography (Picker 5000, Picker, Inc., Cleveland, OH) with an image matrix of 512 by 512 pixels was
used to obtain muscle CSA of the quadriceps femoris muscle. Slice thickness was 8 mm, and scanning time was 5
seconds. The scan of the quadriceps muscle was obtained at
the midpoint between the great trochanter and lateral joint
line of the knee. An experienced radiologist who was blinded to intervention and time evaluated the scans three times.
The mean value was recorded as the result. The CSA was
calculated using Picker VOXEL-Q CT/MR Software Package for real-time analysis. The coefficient of variation between two consecutive measurements was less than 2%.
INTERVENTION
LOS in the Hospital
LOS in the hospital was defined as the day of admission to
the day of discharge. Patients were considered ready for
discharge when they were independent in activities of daily
living and able to walk minor indoor distances (o10 m)
with crutches. Personnel in the orthopedic department, including those involved in discharge planning, were blinded
to the training intervention.
Functional Performance
Three functional parameters that have been shown to correlate with physical disability, dependence, and the risk for fall-
Home-Based Standard Rehabilitation
All three groups were provided the same standard rehabilitation procedure for hip-replacement patients at Bispebjerg
Hospital. The standard rehabilitation program consisted of
15 exercises divided in two parts. The first part consisted of
six bed exercises: ankle dorsiflexion and plantarflexion and
isometric exercises for the glutei, pelvic, and thigh muscles.
The second part consisted of knee extensions in a seated
position and hip abduction, knee flexion, step training, and
calf stretching while standing. No additional weights or resistance bands were used. During the hospital stay, a trained
physical therapist who was blinded to the intervention
2018
DECEMBER 2004–VOL. 52, NO. 12
SUETTA ET AL.
trained all patients in transfer situations and ambulation, as
well as the above exercises. Patients received a pamphlet
with the 15 exercises to be continued at home. The SR
group was instructed to perform the exercises twice a day
and attend weekly control sessions in the physical therapy
department, during which an experienced physical therapist
guided them through all the exercises to ensure they were
performed correctly. Identical instructions were given to the
two other treatment groups.
Neuromuscular Electrical Stimulation
The group that received additional unilateral NMES began
the stimulation program on the affected leg 1 day after the
operation. Patients were carefully instructed in the use of the
stimulator and the placement of the electrodes. The stimulator was a pocket-sized battery-operated unit (Elpha 2000,
Biofina, Denmark) that delivered a constant biphasic current
(0–60 mA). After careful preparation of the skin, two
electrodes (Bio-Flex, 50 89 mm, Biofina A/S; Odense,
Denmark) were placed over the quadriceps muscle 5 cm below the inguinal ligament and 5 cm above the patella. The
pulse rate was 40 Hz, with a pulse width of 250 microseconds, and each stimulation lasted for 10 seconds, followed by 20 seconds of rest. The amplitude increased and
decreased gradually during the first and last 2 seconds. The
intensity of the stimulation was adjusted according to patient
tolerance. The total stimulation time was 1 h/d for 12 weeks,
and all patients registered total stimulation time and intensity. After discharge from the hospital, the stimulator was
used at home, and weekly controls were conducted.
Resistance Training
Resistance training was unilateral progressive training for
the quadriceps muscle of the operated leg. During hospitalization, the patients performed daily knee extension exercises (3 10 repetitions) in a seated position with
sandbags strapped to the ankle. Training was performed
using adjustable leg-press and knee-extension machines
(TechnoGym International, Gambettola, Italy) three times
per week as soon as possible ( Day 7). After a 10-minute
warm-up on a stationary bicycle, seated knee extensions
and leg presses were performed in a supine position (o901
of hip flexion to avoid hip luxation). A trained physical
therapist carefully supervised all training sessions. Training
intensity was progressively increased in intensity from 20repetition maximum (RM) ( 50% of 1RM) the first week
to 15RM ( 65% of 1RM) during Weeks 2 to 4 to 12RM
( 70% of 1RM) during Weeks 5 to 6 and finally to 8RM
(80% of 1RM) the last 6 weeks. Progressive increases and
fairly low intensity during the first 6 weeks were used to
avoid training-associated injuries. During each training session, patients performed three to five sets of 10 repetitions
during Weeks 1 to 6 and three to five sets of eight repetitions
during Weeks 6 to 12. The training load was carefully adjusted weekly to ensure that all patients trained at the appropriate intensity. The load was measured using multipleRM testing based on goal repetitions.
Statistical Analysis
Nonparametric statistics were used for the analysis, because
not all data were normally distributed. Friedman tests with
JAGS
Wilcoxon post hoc tests were used to evaluate the effect of
intervention over time. The Kruskal-Wallis tests with
Mann-Whitney U post hoc tests were used to analyze for
intergroup differences. Data are presented as mean values standard error. Po.05 was considered significant.
RESULTS
Thirty of the 36 patients completed the study. Two from the
SR group withdrew immediately because of dissatisfaction
with the randomization outcome. Two became ill (1ES; 1
RT) for reasons unrelated to the study, and two withdrew
because of personal problems (1SR; 1ET) (Figure 1). There
were no differences between the three groups at the start of
the study with respect to anthropometric data (Table 1),
comorbidity, muscle strength, or functional performance
parameters (Table 2). There were no training-related complications observed in any of the three groups.
LOS differed significantly between the treatment
groups (Figure 2A); mean LOS was 37% shorter for the
RT group (10 2.4 days, range 8–14) than for the SR
group (16 7.2 days, range 9–35) (Po.05). This difference
remained when the patients with the longest LOS in the SR
group were excluded (Po.05). A tendency (P 5.07) toward
a shorter LOS was seen for the ES group (12 2.8 days,
range 8–16) than for the SR group.
All three functional skills improved in the RT and ES
groups after 3 months of training (Table 2). RT increased
maximal gait speed 30% (Po.001), and ES increased maximal gait speed 19% (Po.05). Stair-climbing performance
improved 28% (Po.005) in RT and 21% (Po.001) in ES.
The sit-to-stand test improved 30% (Po.001) in RT and
21% (Po.001) in ES. No improvements were seen in SR
from baseline values to 12 weeks after surgery. RT and ES
improved to a greater extent than SR in the sit-to-stand test
from 0 to12 weeks (RT 4SR, P 5.002 and ES 4SR, P 5
.03), whereas no between-group difference could be observed for maximal gait speed (P 5.11 to .20) or stairclimbing performance (P 5.33 to.55).
Quadriceps muscle CSA in the SR group decreased 13%
(Po.05) on the operated side 5 weeks postsurgery and remained 9% below baseline values (Po.05) 12 weeks postsurgery (Figure 2B). In the RT group, CSA of the operated leg
was unaltered 5 weeks postsurgery and increased 12% over
Eligible patients
n = 68
Refused participation
n = 32
Randomized
n = 36
Standard rehabilitation group
n = 12
Electrical stimulation group
n = 11
Withdrawn
n=3
Completed trial
n=9
Withdrawn
n=1
Completed trial
n = 10
Resistance training group
n = 13
Withdrawn
n=2
Completed trial
n = 11
Figure 1. Trial profile. Patients who completed the trial were
included for further analysis.
JAGS
DECEMBER 2004–VOL. 52, NO. 12
RESISTANCE TRAINING AFTER HIP SURGERY
2019
Table 1. Baseline Patient Characteristics
Characteristic
Standard Rehabilitation
(n 5 12)
Electrical Stimulation
(n 5 11)
Resistance Training
(n 5 13)
Age, mean (range)
Sex
Body weight (kg), mean � SE
Height, cm, mean � SE
Body mass index, mean � SE
68 (62–78)
7F/5M
81.3 � 5.8
169.8 � 2.1
28.2 � 1.7
69 (60–75)
6F/5M
79.0 � 4.2
167.7 � 2.8
27.9 � 0.9
69 (60–86)
6F/7M
77.8 � 4.5
168.0 � 2.0
27.4 � 1.4
P
NS
NS
NS
NS
NS
NS 5 nonsignificant; SE 5 standard error. F 5 female; M 5 male.
baseline (Po.05) 12 weeks postsurgery. In the ES group,
CSA decreased 4% on the operated side 5 weeks postsurgery (Po.05) and increased 7% from 5 to 12 weeks
postsurgery (Po.05). The nonoperated side was unaffected
in all three groups. A significant between-group difference
was observed from baseline to 5 weeks and from baseline
to 12 weeks. Changes in muscle CSA for RT were greater
than for ES (5 weeks P 5.04, 12 weeks Po.0001) and SR
(5 weeks P 5.002, 12 weeks Po.001).
Peak torque did not differ between the groups at baseline. Peak torque was greater on the nonoperated than the
operated side in all three groups at baseline (Po.05) (Table
3). Peak torque increased on the operated side in RT 28% at
601/s (Po.001) and 22% at 1801/s (Po.05) 12 weeks postsurgery. Muscle strength was unchanged on the operated
side in the SR group and the ES group (Table 3), and no
change in peak torque was observed in the nonoperated leg
in any of the groups. Consequently, the quadriceps strength
index (operated leg/nonoperated leg) rose from 78% to
100% at 601/s and from 80% to 99% at 1801/s in the RT
group. In contrast, the corresponding quadriceps strength
index remained at 73% and 75% (601/s and 1801/s, respectively) in the SR group 12 weeks after surgery and at
87% and 83% in the ES group. The improvement in peak
torque at 601/s was significantly greater in the RT group
than in the SR group from baseline to 5 weeks (P 5.02) and
than in the SR group (P 5.001) and the ES group (P 5.001)
from baseline to 12 weeks. The RT group improved significantly more than the SR group from baseline to 12 weeks
(P 5.033) at 1801/s but not than the ES group. There was
no difference in the change in peak torque between the ES
group and the SR group at any time.
DISCUSSION
The present study investigated whether elderly patients who
undergo hip-replacement surgery could benefit from additional training in the early postoperative phase and more
specifically what training modality would be the most effective. The data indicate that RT is an effective and safe
way to increase muscle mass, maximal muscle strength, and
functional performance. In addition, RT reduced the hospitalization period more than a conventional rehabilitation
regimen or NMES. Furthermore, it was shown that, although the conventional rehabilitation program included
early mobilization, quadriceps CSA on the operated side
decreased 9%, whereas the RT program augmented CSA
12% 12 weeks after surgery.
Previous studies have demonstrated that major surgery
elicits a catabolic stress response that leads to general weight
loss and a reduction of lean tissue mass,26,27 but the combined effect of surgery and physical training on muscle CSA
in elderly patients has not yet been investigated. Maximal
muscle strength is directly related to muscle mass and CSA,28
Table 2. Changes in Functional Performance at Baseline and 5 and 12 Weeks Postsurgery
Standard Rehabilitation
Performance
Walking-speed, m/s
Baseline
5 weeks
12 weeks
Stair-climbing, seconds
Baseline
5 weeks
12 weeks
Sit-to-stand � 5, seconds
Baseline
5 weeks
12 weeks
Electrical Stimulation
Resistance Training
Mean � Standard Error
0.90 � 0.2
0.90 � 0.1
1.10 � 0.3
1.26 � 0.4
1.22 � 0.4
1.50 � 0.5w
1.10 � 0.5
1.11 � 0.4
1.43 � 0.6w
8.3 � 2.5
9.4 � 3.1
7.0 � 2.1
7.1 � 2.6
8.0 � 3.2
5.6 � 2.4
8.1 � 4.2
8.7 � 3.5
5.8 � 2.8w
14.3 � 3.1
13.1 � 1.6
13.3 � 3.2
13.4 � 5.1
13.6 � 4.5
10.3 � 3.4z
12.7 � 4.0
10.4 � 2.4
8.8 � 2.6z
Significantly different from baseline values: Po.05; w Po.001.
z
Resistance training and electrical stimulation significantly different from standard rehabilitation; Po.05.
2020
DECEMBER 2004–VOL. 52, NO. 12
SUETTA ET AL.
JAGS
Table 3. Changes in Isokinetic Muscle Strength at Baseline and 5 and 12 Weeks Postsurgery
Standard Rehabilitation
Operated
Side
Nonoperated
Side
Electrical Stimulation
Operated
Side
Peak Torque
601/s Nm
Baseline
5 weeks
12 weeks
1801/s Nm
Baseline
5 weeks
12 weeks
Nonoperated
Side
Resistance Training
Operated
Side
Nonoperated
Side
Mean � Standard Error
99.4 � 15.1
83.6 � 12.1
99.4 � 13.7
138.6 � 18.3
119.5 � 14.8
133.9 � 18.7
104.6 � 13.8
94.4 � 14.3
104.4 � 14.2
122.7 � 12.9
117.9 � 12.5
120.5 � 13.7
102.2 � 13.2
106.2 � 13.5z
131.1 � 15.7z
130.1 � 13.5
131.0 � 14.2
131.9 � 14.6
70.8 � 12.7
59.4 � 8.3
70.5 � 10.5
92.4 � 12.8
88.7 � 13.3
92.7 � 12.8
70.8 � 10.3
67.6 � 10.2
74.6 � 10.6
122.7 � 12.9
117.9 � 12.5
120.5 � 13.7
71.0 � 9.6
70.1 � 8.3
86.4 � 10.2z
86.5 � 9.0
87.2 � 10.0
89.1 � 10.7
Note: Results from the isokinetic quadriceps strength measurements (601/s and 1801/s) and quadriceps cross-sectional area on the operated and the nonoperated leg
from all three intervention groups at three time points.
Significantly different from baseline; Po.05.
w
Peak torque was greater on the nonoperated than operated side in all 3 groups at baseline (Po0.05).
z
Po.05 refers to intergroup differences, resistance training being significantly different from standard rehabilitation and electrical stimulation.
Nm 5 Newton meter.
and reduced lower-limb muscle strength has been correlated
with functional impairments.29,30 Therefore, attempts to
ameliorate hospitalization-associated muscle atrophy in the
elderly is of the utmost importance. In the present study,
body weight and muscle CSA on the nonoperated side remained unchanged 5 and 12 weeks after surgery. It is possible
that the present study sample, which consisted of relatively
healthy patients, experienced minor surgery-related catabolism and that the loss of muscle mass represented disuse atrophy, which is possible to prevent, in part, with physical
training. The data may suggest that weight loss was regained
after 5 weeks or that the perioperative interventions effectively prevented weight loss, but this was contrasted by the
decline in muscle CSA on the operated side in the SR group at
5 ( � 13%) and 12 weeks ( � 9%) postsurgery, which may
reflect that the conventional rehabilitation program produced insufficient muscle contractile activation. The decline
in CSA in the ES group ( � 4%) was less than in the SR group
( � 13%) 5 weeks after surgery, and there was no decrease in
the ES group 12 weeks after surgery, which is in accordance
with studies in young patients.18,19 The increase in CSA from
5 to 12 weeks in the ES group without any accompanying
increase in isokinetic strength is in accordance with studies
that demonstrate that NMES may influence muscle mass but
not voluntary strength.18,19 In addition, it cannot be excluded that the knee position during the ES or during isokinetic
testing may have contributed to the apparent disparity in
CSA and isokinetic muscle strength. Notably, RT not only
prevented postsurgery muscle atrophy, but also augmented
CSA after 12 weeks, which represented a substantial numerical difference (�21%) relative to the observed atrophy in
the SR group. The relative gain in muscle strength in the RT
group was comparable with that observed in other studies
using isokinetic strength assessment in healthy elderly after
RT intervention31,32 and was likely a function of the augmented muscle mass, but because RT has consistently been
shown to induce neural adaptations in healthy elderly individuals33,34 and most recently also in patients recovering
from hip replacement surgery (unpublished data), it is also
plausible that a portion of the observed strength gain can be
attributed to changes in neural function.33
Studies of the effects of physical intervention introduced several months to years after hip replacement surgery
show that, despite a successful operation and uncomplicated conventional postoperative rehabilitation, a significant
deficit in muscle strength persists in the operated limb relative to the nonoperated side.5,7 In contrast, the present
data demonstrate that the preoperative side-to-side difference in muscle strength was eliminated after 12 weeks of
unilateral RT. This elimination of the strength deficit was
not accomplished in the two other groups that used conventional rehabilitation or NMES.
An important clinical finding in the present study was
the marked increase in functional performance in the RT
(30%) and ES groups (15–20%). Because RT and ES were
performed unilaterally, there is no intuitive link between the
changes in unilateral muscle strength/CSA and the increases
in function that requires two-legged coordinated movement, but because the increase in strength/CSA only occurred on the weak and trained side, it is plausible that the
unilateral increase in strength/CSA may have helped to reduce any deficit between legs and thereby have improved
function. The amelioration in walking speed with RT and
NMES in the present study was particularly noticeable, because maximal and habitual walking speed are powerful
predictors of future disability and dependency.35,36 The
augmented muscle strength on the operated side as a result
of the RT likely explains the increase. Because the training
in this study was performed with only one leg, it is not
possible to fully predict whether any additional improvement would have been achieved by bilateral training.
The 37% reduction in LOS with RT has, to the authors’
knowledge, not previously been shown with physical intervention as the sole intervention parameter, because previous
randomized, controlled studies on hip-fracture patients that
have demonstrated a reduced LOS have included combinations of interventions.12,37 It should be mentioned that, in
the present study, LOS represents a sum of the acute surgical
JAGS
A
DECEMBER 2004–VOL. 52, NO. 12
RESISTANCE TRAINING AFTER HIP SURGERY
REFERENCES
20
Time (days)
15
10
5
0
SR
ES
RT
B
CSA (mm2)
6000
5000
4000
3000
0
2021
Pre 5w 12w
Pre 5w 12w
Pre 5w 12w
SR
ES
RT
Figure 2. Length of stay in hospital and change in muscle crosssectional area (CSA). A. Difference in hospitalization length between the three intervention groups. B. Quadriceps muscle crosssectional area of the operated leg in all three intervention groups
at three points. Data are presented as means � standard error
(SE). Po.05 significantly different from baseline (Pre); wPo.05
significantly different from 5 weeks after the operation (5w);
z
Po.05 resistance training (RT) significantly different from
standard rehabilitation (SR).
ES 5 electrical stimulation; 12w 5 12 weeks after the operation.
LOS and the rehabilitative LOS, and thus any specific effect
on the separate components cannot be ascertained. Furthermore, the present study included a limited number of
patients, and it can therefore not be excluded that a few of
the parameters have not been studied with a sufficiently
high power. However, the randomization and lack of difference at baseline, as well as the blinding of the department
staff, strengthens the findings and supports the notion that
specific muscle training is an effective intervention tool to
attain improved function that also permits earlier hospital
discharge.
In summary, the present study demonstrates that elderly patients who undergo hip-replacement surgery can,
without any side effects, benefit from intensive physical
training that is initiated early in the postoperative phase.
Moreover, RT more effectively increased muscle mass,
maximal muscle strength, and functional performance and
decreased LOS than ES or conventional rehabilitation.
1. Bloomfield SA. Changes in musculoskeletal structure and function with prolonged bed rest. Med Sci Sports Exerc 1997;29:197–206.
2. Hill GL, Douglas RG, Schroeder D. Metabolic basis for the management of
patients undergoing major surgery. World J Surg 1993;17:146–153.
3. Wigerstad-Lossing I, Grimby G, Jonsson T et al. Effects of electrical muscle
stimulation combined with voluntary contractions after knee ligament surgery.
Med Sci Sports Exerc 1988;20:93–98.
4. Covinsky KE, Palmer RM, Fortinsky RH et al. Loss of independence in
activities of daily living in older adults hospitalized with medical illnesses:
Increased vulnerability with age. J Am Geriatr Soc 2003;51:451–458.
5. Sashika H, Matsuba Y, Watanabe Y. Home program of physical therapy: Effect
on disabilities patients with total hip arthroplasty. Arch Phys Med Rehab
1996;77:273–277.
6. Sicard-Rosenbaum L, Light KE, Behrman AL. Gait, lower extremity strength,
and self-assessed mobility after hip arthroplasty. J Gerontol A Biol Sci Med Sci
2002;57A:M47–M51.
7. Trudelle-Jackson E, Emerson R, Smith S. Outcomes of total hip arthroplasty: A
study of patients one year postsurgery. J Ortho Sports Physl Ther 2002;32:
260–267.
8. Munin MC, Rudy TE, Glynn NW et al. Early inpatient rehabilitation after
elective hip and knee arthroplasty [see comments]. JAMA 1998;279:847–852.
9. Roach KE, Ally D, Finnerty B et al. The relationship between duration of
physical therapy services in the acute care setting and change in functional
status in patients with lower-extremity orthopedic problems [see comments].
Phys Ther 1998;78:19–24.
10. Cameron I, Finnegan T, Madhok R et al. Co-ordinated multidisciplinary
approaches for inpatient rehabilitation of older patients with proximal femoral fractures. Cochrane Database Syst Rev 2000;(2):CD000106.
11. Galvard H, Samuelsson SM. Orthopedic or geriatric rehabilitation of hip
fracture patients: A prospective, randomized, clinically controlled study in
Malmo, Sweden. Aging (Milano) 1995;7:11–16.
12. Kennie DC, Reid J, Richardson IR et al. Effectiveness of geriatric rehabilitative
care after fractures of the proximal femur in elderly women: A randomised
clinical trial. BMJ 1988;297:1083–1086.
13. Lexell J, Downham DY, Larsson Y et al. Heavy-resistance training in older
Scandinavian men and women: Short- and long-term effects on arm and leg
muscles. Scand J Med Sci Sports 1995;5:329–341.
14. Skelton DA, Young A, Greig CA et al. Effects of resistance training on strength,
power, and selected functional abilities of women aged 75 and older. J Am
Geriatr Soc 1995;43:1081–1087.
15. Fiatarone MA, O’Neill EF, Doyle N et al. The Boston FICSIT study: The effects
of resistance training and nutritional supplementation on physical frailty in the
oldest old. J Am Geriatr Soc 1993;41:333–337.
16. Harridge SDR, Kryger A, Stensgaard A. Knee extensor strength, activation,
and size in very elderly people following strength training. Muscle Nerve
1999;22:831–839.
17. Hauer K, Specht N, Schuler M et al. Intensive physical training in geriatric
patients after severe falls and hip surgery. Age Ageing 2002;31:49–57.
18. Arvidsson I, Arvidsson H, Eriksson E et al. Prevention of quadriceps wasting
after immobilization: An evaluation of the effect of electrical stimulation. Orthopedics 1986;9:1519–1528.
19. Gibson JN, Smith K, Rennie MJ. Prevention of disuse muscle atrophy by
means of electrical stimulation: Maintenance of protein synthesis. Lancet
1988;2:767–770.
20. Lamb SE, Oldham JA, Morse RE et al. Neuromuscular stimulation of the
quadriceps muscle after hip fracture: A randomized controlled trial. Arch Phys
Med Rehab 2002;83:1087–1092.
21. Quittan M, Nuhr MJ, Hulsmann M et al. Chronic low frequency electrical
stimulation of thigh muscles increases aerobic capacity in patients with severe
chronic heart failure. Circulation 2001;104:452.
22. Dargent-Molina P, Favier F, Grandjean H et al. Fall-related factors and risk of
hip fracture: the FUIDOS prospective study. Lancet 1996;348:145–149.
23. Janssen I, Heymsfield SB, Ross R. Low relative skeletal muscle mass (sarcopenia) in older persons is associated with functional impairment and physical disability. J Am Geriatr Soc 2002;50:889–896.
24. Aagaard P, Simonsen EB, Andersen JL et al. Neural inhibition during maximal
eccentric and concentric quadriceps contraction: Effects of resistance training.
J Appl Physiol 2000;89:2249–2257.
25. Kellis E, Baltzopoulos V. The effects of antagonist moment on the resultant
knee joint moment during isokinetic testing of the knee extensors. Euro J Appl
Physiol Occup Physiol 1997;76:253–259.
26. Hill AA, Plank LD, Finn PJ et al. Massive nitrogen loss in critical surgical
illness: Effect on cardiac mass and function. Ann Surg 1997;226:191–197.
27. Okeefe SJD, Sender PM, James WPT. Catabolic loss of body nitrogen in
response to surgery. Lancet 1974;2:1035–1038.
2022
SUETTA ET AL.
28. Wickiewicz TL, Roy RR, Powell PL et al. Muscle architecture and forcevelocity relationships in humans. J Appl Physiol 1984;57:435–443.
29. Rantanen T, Guralnik JM, Izmirlian G et al. Association of muscle strength
with maximum walking speed in disabled older women. Am J Phys Med Rehab
1998;77:299–305.
30. Skelton DA, Greig CA, Davies JM et al. Strength, power and related functional ability of healthy people aged 65 to 89 years. Age Ageing 1994;23:
371–377.
31. Frontera WR, Meredith CN, O’Reilly KP et al. Strength training
and determinants of VO2max in older men. J Appl Physiol 1990;68:
329–333.
32. Grimby G, Aniansson A, Hedberg M et al. Training can improve muscle
strength and endurance in 78- to 84-year-old men. J Appl Physiol 1992;73:
2517–2523.
DECEMBER 2004–VOL. 52, NO. 12
JAGS
33. Hakkinen K, Hakkinen A. Neuromuscular adaptations during intensive
strength training in middle-aged and elderly males and females. Electromyogr
Clin Neurophysiol 1995;35:137–147.
34. Hakkinen K, Newton RU, Gordon SE et al. Changes in muscle morphology,
electromyographic activity, and force production characteristics during
progressive strength training in young and older men. J Gerontol A Biol Sci
Med Sci 1998;53A:B415–B423.
35. Guralnik JM, Ferrucci L, Simonsick EM et al. Lower-extremity function in
persons over the age of 70 years as a predictor of subsequent disability. N Engl
J Med 1995;332:556–561.
36. Sonn U. Longitudinal studies of dependence in daily life activities among
elderly persons. Scand J Rehabil Med Suppl 1996;34:1–35.
37. Gilchrist WJ, Newman RJ, Hamblen DL et al. Prospective randomised study of
an orthopaedic geriatric inpatient service. BMJ 1988;297:1116–1118.
Training-induced changes in muscle CSA, muscle
strength, EMG, and rate of force development in
elderly subjects after long-term unilateral disuse
Charlotte Suetta, Per Aagaard, Anna Rosted, Ane K. Jakobsen, Benn Duus,
Michael Kjaer and S. Peter Magnusson
J Appl Physiol 97:1954-1961, 2004. First published 9 July 2004; doi:10.1152/japplphysiol.01307.2003
You might find this additional info useful...
This article cites 54 articles, 15 of which can be accessed free at:
/content/97/5/1954.full.html#ref-list-1
This article has been cited by 18 other HighWire hosted articles, the first 5 are:
Comparative Effects of Light or Heavy Resistance Power Training for Improving Lower
Extremity Power and Physical Performance in Mobility-Limited Older Adults
Kieran F. Reid, Kimberly I. Martin, Gheorghe Doros, David J. Clark, Cynthia Hau, Carolynn
Patten, Edward M. Phillips, Walter R. Frontera and Roger A. Fielding
J Gerontol A Biol Sci Med Sci, September 8, 2014; .
[Abstract] [Full Text] [PDF]
Tennis in hot and cool conditions decreases the rapid muscle torque production capacity of
the knee extensors but not of the plantar flexors
Olivier Girard, Sébastien Racinais and Julien D Périard
Br J Sports Med, April , 2014; 48 (Suppl 1): i52-i58.
[Abstract] [Full Text] [PDF]
Ageing is associated with diminished muscle re-growth and myogenic precursor cell
expansion early after immobility-induced atrophy in human skeletal muscle
C. Suetta, U. Frandsen, A. L. Mackey, L. Jensen, L. G. Hvid, M. L. Bayer, S. J. Petersson, H. D.
Schrøder, J. L. Andersen, P. Aagaard, P. Schjerling and M. Kjaer
J Physiol, August 1, 2013; 591 (15): 3789-3804.
[Abstract] [Full Text] [PDF]
Updated information and services including high resolution figures, can be found at:
/content/97/5/1954.full.html
Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl
This information is current as of November 3, 2014.
Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2004 by the American Physiological Society.
ISSN: 0363-6143, ESSN: 1522-1563. Visit our website at http://www.the-aps.org/.
Downloaded from on November 3, 2014
Progressive resistance training before and after total hip and knee arthroplasty: a
systematic review
Birgit Skoffer, Ulrik Dalgas and Inger Mechlenburg
Clin Rehabil, July 3, 2014; .
[Abstract] [Full Text] [PDF]
J Appl Physiol 97: 1954 –1961, 2004.
First published July 9, 2004; doi:10.1152/japplphysiol.01307.2003.
Training-induced changes in muscle CSA, muscle strength, EMG, and rate
of force development in elderly subjects after long-term unilateral disuse
Charlotte Suetta,1 Per Aagaard,1,2 Anna Rosted,3 Ane K. Jakobsen,1
Benn Duus,4 Michael Kjaer,1 and S. Peter Magnusson1
Institute of Sports Medicine, 2Team Denmark Testcenter, 3Departments of Radiology,
and 4Orthopaedics, Bispebjerg Hospital, University of Copenhagen, 2400 NV Copenhagen, Denmark
1
Submitted 5 December 2003; accepted in final form 5 July 2004
THE DEBILITATING EFFECTS of disuse on maximal muscle strength
(4, 40), muscle mass (13, 21, 35), and muscle activation (44)
are well documented and occur already during the first week of
immobilization. Most of the current knowledge concerning the
effect of immobilization on skeletal muscle is based on studies
in healthy young individuals during bed rest (35), limb unloading (9), and spaceflight (13, 36) or in young patients recovering
from anterior cruciate ligament reconstruction (5, 19, 55).
However, because elderly persons in particularly are prone to
periods of immobilization and disuse either due to joint pain or
hospitalization (11), it appears paramount to gain a better
understanding of how immobilization affects muscle size and
neural function in this population, as well as to identify training
regimes that ensure an effective rehabilitation.
It is well known that, with increasing age, muscle strength
and muscle power decrease for both sexes, especially beyond
the sixth decade (10, 22, 42, 48, 53, 56). Interestingly, it has
been shown that the ability to develop high muscle power
declines more rapidly and relates more to functional performance than to maximal muscle strength (7, 48, 53). In daily
life, however, many types of movements, such as preventing a
fall, are characterized by a limited time to develop force
(0 –200 ms), which is considerably less time than it takes to
achieve maximal contraction force (400 – 600 ms) (2, 51).
Consequently, during such time-restricted contraction conditions (200 ms), the ability to develop a rapid rise in muscle
force [i.e., a high rate of force development (RFD) force/
time] may become more important than maximal muscle force
and power. Despite this, limited information is available on
training-induced neuromuscular adaptations in elderly subjects
after a period of immobilization.
Previously, RFD has been investigated in young, healthy
individuals (2, 46, 51) and has been demonstrated to increase
in response to heavy strength training (2, 46, 51) and combined
strength/power training (26), whereas low strength training
seems to have no effects (46). In elderly individuals, RFD is
reduced compared with young individuals of both genders (12,
30, 33, 50, 54); however, combined power/strength training has
been shown to induce marked increases in RFD and muscle
activation [electromyogram (EMG) amplitude] in healthy, elderly individuals of both genders (24, 25, 27). The effect of
strength training on RFD has not previously been investigated
in elderly subjects who recover from a period of immobilization.
Another method to restore muscular function after immobilization is by the application of percutaneus neuromuscular
electrical stimulation (NMES), which has been used primarily
in young patients rehabilitating from anterior cruciate ligament
reconstruction (5, 19), whereas studies on elderly subjects are
scarce (41, 43). None of the aforementioned studies have
evaluated the effect of NMES on muscle activation and rapid
muscle strength properties. Because muscle contraction induced by NMES partly bypasses the central nervous system
(CNS), it could be hypothesized that training involving volitional strength exercise more effectively improves neuromuscular function and RFD. On the other hand, NMES might be a
more tolerable training modality for frail, elderly individuals.
Address for reprint requests and other correspondence: C. Suetta, Institute of
Sports Medicine, Copenhagen Bispebjerg Hospital, Bispebjerg Bakke 23, 2400
NV Copenhagen, Denmark (E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
ageing; atrophy; rehabilitation; electromyogram
1954
8750-7587/04 $5.00 Copyright © 2004 the American Physiological Society
http://www. jap.org
Downloaded from on November 3, 2014
Suetta, Charlotte, Per Aagaard, Anna Rosted, Ane K. Jakobsen, Benn Duus, Michael Kjaer, and S. Peter Magnusson. Training-induced changes in muscle CSA, muscle strength, EMG, and rate
of force development in elderly subjects after long-term unilateral
disuse. J Appl Physiol 97: 1954 –1961, 2004. First published July 9,
2004; doi:10.1152/japplphysiol.01307.2003.—The ability to develop
muscle force rapidly may be a very important factor to prevent a fall
and to perform other tasks of daily life. However, information is still
lacking on the range of training-induced neuromuscular adaptations in
elderly humans recovering from a period of disuse. Therefore, the
present study examined the effect of three types of training regimes
after unilateral prolonged disuse and subsequent hip-replacement
surgery on maximal muscle strength, rapid muscle force [rate of force
development (RFD)], muscle activation, and muscle size. Thirty-six
subjects (60 – 86 yr) were randomized to a 12-wk rehabilitation
program consisting of either 1) strength training (3 times/wk for 12
wk), 2) electrical muscle stimulation (1 h/day for 12 wk), or 3)
standard rehabilitation (1 h/day for 12 wk). The nonoperated side did
not receive any intervention and thereby served as a within-subject
control. Thirty subjects completed the trial. In the strength-training
group, significant increases were observed in maximal isometric
muscle strength (24%, P 0.01), contractile RFD (26 – 45%, P 0.05), and contractile impulse (27–32%, P 0.05). No significant
changes were seen in the two other training groups or in the nontrained legs of all three groups. Mean electromyogram signal amplitude of vastus lateralis was larger in the strength-training than in the
standard-rehabilitation group at 5 and 12 wk (P 0.05). In contrast
to traditional physiotherapy and electrical stimulation, strength training increased muscle mass, maximal isometric strength, RFD, and
muscle activation in elderly men and women recovering from longterm muscle disuse and subsequent hip surgery. The improvement in
both muscle mass and neural function is likely to have important
functional implications for elderly individuals.
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
Therefore, the purpose of the present study was to compare
the effect of additional unilateral strength training or electrical
muscle stimulation with conventional physiotherapy on neuromuscular adaptation in a group of elderly individuals rehabilitating from unilateral, long-term disuse and immobilization.
Measurements were focused on the type and magnitude of
neuromuscular adaptation in the very early phase of muscle
contraction (0 –200 ms), with respect to RFD and muscle
activation. Furthermore, the study evaluated the effect of
strength training vs. electrical muscle stimulation to compare
the neuromuscular adaptation to training involving either the
functioning nervous system or training using peripheral muscle
stimulation, which bypasses efferent motor output of the CNS.
METHODS
J Appl Physiol • VOL
that was conducted on a separate day. The nonaffected side was tested
first to increase subjects’ comfort with the procedure, as described in
detail elsewhere (2). Contractile RFD was derived as the average
slope of the initial phase of the force-time curve (change in force/
change in time) at 30, 50, 100, and 200 ms relative to the onset of
contraction. Onset of contraction was defined as the instant where
force increased 3.5 N m above the rising baseline level, corresponding to 2% of the peak moment. Contractile impulse was determined
as the area under the force-time curve (force dt) in the same time
intervals. By incorporating the aspect of contraction time, contractile
impulse provide important information to rapid muscle strength characteristics, although this parameter is only rarely reported (2, 6).
Normalized RFD was calculated as the slope of the force-time curve
normalized relative to CSA. The measurement procedure has been
described in more detail elsewhere (2).
EMG recordings. After careful preparation of the skin by shaving
and cleaning with alcohol, pairs of surface electrodes (Medicotest
Q-10-A, 20-mm interelectrode distance) were placed over the belly of
VL, VM, and rectus femoris. All electrode positions were carefully
measured in each subject to ensure identical recording sites throughout all tests. The EMG electrodes were connected directly to small
custom-built preamplifiers, and the EMG signals were led through
shielded wires to custom-built amplifiers with a frequency response of
10 –10,000 Hz and common mode rejection ratio exceeding 100 dB.
EMG and dynamometer strain gauge signals were synchronously
sampled at a 1,000-Hz analog-to-digital conversion rate using an
external analog-to-digital converter (dt 2801-A, Data Translation,
Marlboro, MA). During later offline analysis, EMG signals were
digitally high-pass filtered with a fourth-order, zero-lag Butterworth
filter with a 5-Hz cutoff frequency, followed by a moving root mean
square filter with a time constant of 50 ms. To reflect neural adaptations in the early phase of contraction, integrated EMG of the root
mean square-filtered signal was calculated in time intervals of 0 –30,
50, 100, and 200 ms relative to the onset of EMG integration, which
was initiated 70 ms before force onset to account for electromechanical delay (2). To yield mean average voltage (MAV), integrated
EMG was divided by integration time (MAV integrated EMG/
integration time).
Muscle CSA. CSA of the quadriceps femoris muscle was obtained
by computed tomography (Picker 5000) with an image matrix of
512 512 pixels, slice thickness of 8 mm, and scanning time of 5 s.
The scans of the quadriceps muscle were obtained at the midpoint
between the great trochanter and lateral joint line of the knee. Each
scan was blinded, CSA was measured three times by a radiologist, and
the mean value was recorded as the result. The coefficient of variation
between two consecutive measurements was 2%.
Strength training. Strength training was performed as unilateral
progressive training of the leg muscles with the focus on the quadriceps muscle of the affected limb. During hospitalization, patients
performed daily unilateral knee extension exercises (3 10 repititions) in a sitting position with sandbags strapped to the ankle of the
operated leg. As soon as possible (approximately day 7), training was
performed in adjustable leg-press and knee-extension machines
(Technogym International) three times per week. After a 10-min
warm-up on a stationary bicycle, sitting knee-extension and leg-press
exercises in a supine position were performed. Training intensity was
decreased from 20 to 12 repetition maximum (RM; 3–5 sets 10
repititions) from weeks 0 to 6 to avoid injuries and was thereafter
maintained at 8 RM (3–5 sets 8 repititions). The training load was
adjusted on a weekly basis, and in the final 6 – 8 wk, when the subjects
were familiar with the training, they were supervised to perform the
exercises as rapidly as possible in the concentric phase and keep a
slow speed in the eccentric phase (8).
NMES. The ES group began the stimulation program on the
affected side the first day after surgery. Subjects were carefully
instructed in the use of the stimulator and placement of the electrodes.
The stimulator was a pocket-size, battery-operated device (Elpha
97 • NOVEMBER 2004 •
www.jap.org
Downloaded from on November 3, 2014
Subjects. The study was designed as a prospective randomized
controlled study and included 36 elderly individuals with long-term
unilateral disuse due to osteoarthritis of the hip. Subjects were
scheduled for primary unilateral hip-replacement operation at Bispebjerg University Hospital, Copenhagen, Denmark. Eligibility criteria
included age over 60 yr and radiological and clinical primary hip
osteoarthritis. All subjects were carefully examined by a blinded
physician to exclude subjects with cardiopulmonary, neurological, or
cognitive problems. Also, lower limb problems other from the hip
osteoarthritis and/or pain during testing or training measured on a
visual analog scale (3) were exclusion criteria.
Subjects were randomly allocated to one of the following groups
after baseline tests: 1) standard rehabilitation (SR), 2) SR plus unilateral strength training (ST), or 3) SR plus unilateral NMES (ES).
The ST and ES groups only performed the additional training on the
operated leg so that the nonoperated side could serve as a withinsubject control; the SR group served as a control group.
Subjects were retested 5 and 12 wk after surgery. Measurement
outcomes were quadriceps muscle cross-sectional area (CSA), maximal voluntary isometric quadriceps strength, rapid muscle force defined as the contractile RFD (change in force/change in time), normalized RFD, and contractile impulse (force dt). EMG recordings
were obtained in vastus lateralis (VL), vastus medialis (VM), and
rectus femoris during maximal isometric quadriceps contraction (2) to
evaluate the change in muscle activation induced by the different
training regimes. The ethics committee of Copenhagen approved the
study in accordance with the Helsinki Declaration, and written,
informed consent was obtained from all participants.
Maximal isometric muscle strength and RFD. Muscle strength was
measured as the maximal voluntary isometric knee extension torque
exerted in an isokinetic dynamometer (KinCom; Kinetic Communicator, Chattecx, Chattanooga, TN). The reliability and validity of this
dynamometer have been verified in detail elsewhere (14). Subjects
were seated 10° reclined and firmly strapped at the hip and thigh. The
axis of rotation of the dynamometer lever arm was visually aligned to
the axis of the lateral femur condyle of the subject, and the lower leg
was attached to the lever arm of the dynamometer just above the
medial malleolus. Individual setting of the seat, backrest, dynamometer head, and lever arm length was registered, so identical positioning
was secured at all time points. To correct for the effect of gravity, the
passive mass of the lower leg was measured by the dynamometer at a
knee joint angle of 45° (3). Subjects were carefully instructed to
contract as fast and hard as possible. Visual feedback was provided to
the subjects as a real-time display of the dynamometer force output on
a computer screen (34). After careful warm-up with several dynamic
and submaximal isometric contractions, subjects performed three
maximal isometric contractions at a knee joint angle of 60° (0° full
knee extension). The trial with the highest maximal voluntary contraction was selected for further analyses (2). All measurements were
performed on both thighs and were preceded by a familiarization trial
1955
1956
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
RESULTS
Thirty of the 36 subjects completed the study. Two subjects
from the SR group withdrew immediately because of dissatisfaction with the randomization outcome, two subjects became
ill for reasons unrelated to the study, and two withdrew
because of personal problems. There was no difference between the three groups with respect to anthropometric data
(Table 1), maximal isometric muscle strength, or muscle CSA
(mCSA; Table 2) at the inclusion of the study. No trainingrelated complications were seen in any of the three groups.
Maximal isometric strength. Maximal isometric quadriceps
strength increased by 24% in the ST group on the operated side
12 wk postsurgery compared with baseline (P 0.05),
whereas there was no increase in quadriceps strength in the two
other training groups when 12-wk values were compared with
baseline (Table 2). In the SR group, there was a decrease in
peak torque from presurgery to 5 wk postsurgery (22%, P Table 1. Anthropometric data
n
Age, yr
Gender
Body weight, kg
Height, cm
BMI
ST
ES
SR
P Value
11
71 (61–86)
6 F/5 M
76.75.7
167.72.6
26.91.7
10
69 (60–75)
5 F/5 M
79.94.6
168.33.1
28.01.0
9
69 (62–78)
4 F/5 M
86.16.0
170.52.4
29.41.6
NS
NS
NS
NS
NS
NS
Values are means SE (range). No significant differences were observed
between groups at inclusion time (NS). ST, strength training; ES, electrical
stimulation; SR, standard rehabilitation; F, female subjects; M, male subjects;
BMI, body mass index.
J Appl Physiol • VOL
0.05), with a subsequent increase from 5 to 12 wk (27%, P 0.05). A similar decrease in peak torque at 5 wk postsurgery
was not observed in the two other groups. There was no change
on the nonoperated side in any of the three groups (Table 2).
Although there was no difference in peak torque between
groups at inclusion time, a significant difference in the relative
change between the ST group and the SR group was observed
at 5 (P 0.005) and 12 wk (P 0.001), and between the ST
group and the ES group at 12 wk (P 0.005). There were no
statistically significant differences in the change in peak torque
between the ES group and the SR group at any time point.
Quadriceps CSA. Quadriceps mCSA in the SR group decreased 13% on the operated side at 5 wk (P 0.05) and
remained 9% below baseline values at 12 wk (P 0.05, Table
2). In the ST group, mCSA of the operated leg was unchanged
at 5 wk and increased 12% compared with baseline at 12 wk
(P 0.05). In ES, there was a 4% decrease in CSA on the
operated side from baseline to 5 wk (P 0.05) and a 7%
increase from 5 to 12 wk (P 0.05). There was no change on
the nonoperated side in any of the three groups (Table 2).
There were no differences in CSA between groups at inclusion
but a significant difference in the relative change between the
ST group and SR group after 12 wk of training (P 0.05).
Contractile RFD and impulse. In the ST group, a steeper
slope of the moment-time curve of the affected leg was
observed after 12 wk of strength training (Fig. 2). Specifically,
contractile RFD increased for peak RFD (21%, P 0.005),
and at time intervals of 0 –30 ms (45%, P 0.05), 0 –50 ms
(31%, P 0.05), 0 –100 ms (26%, P 0.05), and 0 –200 ms
(30%, P 0.005) of the affected side at the end of the 12-wk
training period (Fig. 3A). When RFD was normalized to mCSA
(RFD/CSA), there was a 25% increase (from 11.27 to 14.12
Nm s1 cm2, P 0.05) in the very initial part of the
contraction phase (0 –30 ms). In contrast, RFD/CSA remained
unchanged in the intervals of 0 –50 ms (15.28 vs. 17.33
Nm s1 cm2), 0 –100 ms (12.84 vs. 14.20 N m s1 cm2),
and 0 –200 ms (8.96 vs. 10.22 Nms1 cm2). RFD did not
change in the two other training groups from preexercise to 12
wk (Fig. 3, B and C) or in the nonaffected side in any of the
three groups (data not shown). Contractile impulse increased in
the time intervals of 0 –30 ms (32%, P 0.05), 0 –50 ms (32%,
P 0.05), 0 –100 ms (28%, P 0.05), and 0 –200 ms (27%,
P 0.005) on the trained leg in the ST group (Fig. 4A). There
were no change in impulse in the ES or SR group on the
affected side (Fig. 4, B and C), and there were no changes on
the nonaffected side in any of the three groups (data not
shown).
Quadriceps muscle EMG. In the ST group, MAV increased
significantly for VL on the affected leg in the time intervals of
0 –30 ms (36%, P 0.05), 0 –50 ms (40%, P 0.05), 0 –100
ms (38%, P 0.05), and 0 –200 ms (41%, P 0.05), and for
VM at 0 –200 ms (21%, P 0.05) from 5 to 12 wk of training
(Fig. 5). In contrast, there were significant decreases in VL of
the affected leg in the SR group from pretraining to 5 wk of
training in the time intervals of 0 –100 ms (45%, P 0.05) and
0 –200 ms (43%, P 0.05) and a strong trend toward a
decrease was observed in VM (0 –200 ms) from pretraining to
5 wk of training (43%, P 0.06) (Table 3). A subsequent
increase in MAV (0 –200 ms) was observed in VL (57%, P 0.05) and VM (37%, P 0.05) from 5 to 12 wks. In the ES
group, there was no change in MAV on the affected side as
97 • NOVEMBER 2004 •
www.jap.org
Downloaded from on November 3, 2014
2000, Biofina) that delivered a constant biphasic current (0 – 60 mA).
After careful preparation of the skin, two electrodes (Bio-Flex, 50 89 mm) were placed over the quadriceps muscle 5 cm below the
inguinal ligament and 5 cm above the patella. The pulse rate was 40
Hz with a pulse width of 250 s, and each stimulation lasted for 10 s
followed by 20 s of rest. The amplitude increased and decreased
gradually the first and last 2 s. The intensity of the stimulation was
adjusted according to individual subject tolerance. The stimulation
regime was applied for 1 h per day on the affected leg for 12 wk. All
subjects registered daily the total stimulation time and intensity. After
discharge from hospital, the stimulator was used at home, and weekly
controls were conducted in the physiotherapy department to ensure
the stimulation was performed correctly.
SR. The SR group, as well as the two other subject groups, were
provided the same rehabilitation procedure for hip-replacement patients at Bispebjerg Hospital. The rehabilitation program consisted of
a home-based training program that included 15 physiotherapy exercises aimed at improving function, range of motion, and muscle
strength around the hip. No external loads or rubber bands were used
in the program. During the hospital stay, all subjects were trained in
all 15 exercises by an experienced physiotherapist, who was blinded
to the intervention. All subjects received a pamphlet with the 15
exercises to be continued at home. The SR group who served as a
control group was instructed to perform the exercises twice a day and
to come to weekly controls in the physiotherapy department.
Statistical analysis. Nonparametric statistics were used for the
analyses, since not all data met the criterion of normality. To evaluate
the effect of intervention over time, a Friedman test was used with
post hoc Wilcoxon test. Any between-group differences were analysed with Kruskall-Wallis tests and subsequently the Mann-Whitney
U-test. Data are presented as means SE. A P value of 0.05 was
considered significant.
1957
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
Table 2. Isokinetic muscle strength and quadriceps muscle CSA
ST
ES
Op-leg
Quadriceps CSA, m
Pre
5 wk
12 wk
Isometric strength, N m
Pre
5 wk
12 wk
SR
Con-leg
Op-leg
Con-leg
Op-leg
Con-leg
4,964451
5,215409
5,550456*§
5,479415
5,6241457
5,736440
4,772509
4,553484†
4,969476‡
5,009496
5,020444
5,159469
5,475417
4,808343†
4,995346*
5,765569
5,624525
5,825483
122.917.2
130.817.2§
151.917.8*§a
156.320.9
152.020.9
157.819.1
125.213.9
121.115.1
132.915.8
147.915.7
147.615.3
148.716.3
119.215.9
92.712.7†
117.413.8‡
147.017.4
137.320.2
143.218.3
2
Values are means SE. Maximal isometric quadriceps strength measurements (60°) and quadriceps cross-sectional area (CSA) from the operated side
(Op-leg) and the nonoperated side (Con-leg) in the 3 training groups (ST, ES, SR) at 3 time points [baseline (Pre), at 5 wk (5 wk) and at 12 wk (12 wk) of
training]. *P 0.05, 12 wk significantly different from baseline. †P 0.05, baseline significantly different from 5 wk. ‡P 0.05 12 wk significantly different
from 5 wk. §P 0.05, ST significantly different from SR (ST SR). aP 0.05, ST signficantly different from ES (ST ES).
DISCUSSION
The present study examined specific neural adaptations to
training, involving the CNS and peripheral muscle stimulation
partly bypassing the CNS, by comparing the effects of 12 wk
of strength training to electrical muscle stimulation (NMES)
and conventional physiotherapy after unilateral hip replacement surgery.
For the first time, it was demonstrated that strength training
is an effective way to increase muscle mass, muscle activation,
and rapid muscle force characteristics (RFD) in elderly individuals rehabilitating after long-term disuse and surgery-related hospitalization. Importantly, the data show that strength
training resulted in marked increases both in RFD and in
contractile impulse in the time intervals of 0 –30, 0 –50, 0 –100,
and 0 –200 ms, and in normalized RFD in the initial phase of
muscle contraction (0 –30 and 0 –50 ms). In contrast, NMES
and conventional rehabilitation did not produce such increases
in these outcome measures.
Previous studies have demonstrated positive effects of
strength training on mCSA and muscle strength in healthy
elderly individuals (18, 37) and in very old subjects (16, 31).
However, the use of strength training is seldomly used in
elderly subjects rehabilitating from surgery, and the number of
studies in this area are scarce. Only a few previous studies have
investigated the effect of resistive exercises after hip surgery
(32, 38, 45, 47) and reported significant increases in muscle
strength, but none of these studies have reported results on
muscle size or neuromuscular adaptations with training. In
contrast to the above-mentioned studies, the baseline measures
of the present study were obtained before the time of surgery,
which enabled us to evaluate the effect of limb immobilization
Table 3. EMG signal amplitudes
ST
0–30 ms, V
Pre
5 wk
12 wk
0–50 ms, V
Pre
5 wk
12 wk
0–100 ms, V
Pre
5 wk
12 wk
0–200 ms, V
Pre
5 wk
12 wk
ES
SR
VL
VM
RF
VL
VM
RF
VL
VM
RF
72.811.3
47.85.8
65.39.1*
73.419.6
67.716.2
68.013.1
38.78.1
43.15.3
28.34.5
70.722.0
55.418.8
41.17.9
41.77.8
44.310.3
46.97.7
29.43.4
44.922.5
24.13.8
76.120.5
47.111.1
50.57.2
49.312.6
48.89.6
49.39.0
30.54.1
31.85.4
28.76.1
109.026.0
63.15.4
88.311.0*
98.827.8
86.517.9
88.316.8
51.511.0
58.36.7
41.76.0
91.225.2
80.222.7
68.412.9
61.613.4
70.818.2
69.711.2
39.55.4
54.321.0
35.93.5
95.719.0
55.411.1
70.110.0
69.914.2
54.59.7
64.912.7
39.25.2
39.15.7
43.812.2
127.431.8
91.67.3
126.214.1*
117.834.3
107.219.7
124.121.8
77.413.9
84.110.0
83.18.1
134.131.7
123.535.3
109.419.0
103.832.7
116.132.4
103.614.4
64.510.9
85.420.2
63.37.2
123.223.0
68.213.3†
100.614.5
86.018.2
67.414.9
90.518.3
53.57.8
49.37.1
60.815.9
132.722.7
111.410.2
157.017.5*
123.231.1
112.919.6
137.119.0*
99.716.7
104.513.0
112.112.2
161.535.2
144.828.9
128.821.2
126.838.5
126.928.6
117.315.8
92.014.5
99.618.2
84.810.3
122.622.5
70.213.8†
110.613.3*
85.521.0
71.914.6
98.324.0*
62.39.1
57.38.9
75.016.9
Values are means SE. Mean integrated electromyogram (EMG) signal amplitudes from vastus lateralis (VL), vastus medialis (VM), and rectus femoris (RF)
from the trained leg in the 3 training groups (ST, ES, SR) at 3 time points (Pre, 5 wk, 12 wk). *P 0.05, 12 wk significantly different from 5 wk. †P 0.05
5 wk significantly different from baseline.
J Appl Physiol • VOL
97 • NOVEMBER 2004 •
www.jap.org
Downloaded from on November 3, 2014
well as on the nonaffected side in any of the three groups
(Table 3). At the inclusion time, there was no difference in
MAV between the three training groups; however, the abovementioned changes led to significant differences between VL
MAV (0 –200 ms) in the ST and SR group at 5 wk (ST SR,
P 0.05) and at 12 wk (ST SR, P 0.05), and a difference
between ES and SR was observed at 5 wk (ES SR, P 0.05)
(Fig. 5). For VM MAV (0 –200 ms), there was only a tendency
toward a difference between ST and SR (ST SR, P 0.09),
whereas there were significant differences for the rectus femoris muscle at 5 wk (ST SR, P 0.05) and at 12 wk (ST SR, P 0.05) in the time intervals of 0 –100 and 0 –200 ms.
1958
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
gery, which was fully prevented with strength training and partly
with electrical stimulation. Albeit not statistically significant, it
appears that the muscle loss was less pronounced in the ES group
(4%) compared with the SR group (13%) 5 wk after surgery.
Downloaded from on November 3, 2014
Fig. 1. Computer tomography images taken from the midthigh region of a
female subject in the strength training (ST) group before and after training. The
2 images are shown at the same scale. Quadriceps muscle cross-sectional area
of the operated side (op-leg) increased 32% in this subject; the nonoperated
side (con-leg) did not change from pretraining to posttraining.
due to surgery 5 and 12 wk after the operation. Surprisingly,
although the affected limb clearly had disuse-associated muscle
atrophy, a further decline in muscle size (Table 2) was observed
with conventional rehabilitation (SR group, 13%) 5 wk postsur-
Fig. 2. Average moment-time curves obtained for the ST group (n 11)
before (pre; solid line) and after 12 wk (post; dashed line) of training. Onset of
contraction is denoted by a solid circle, and vertical lines indicate time
intervals of 30, 50, 100, and 200 ms relative to the onset of contraction.
Posttraining peak isometric torque increased significantly from 122.9 17.2 to
151.9 17.8 N m in parallel with a steeper slope of the moment-time curve.
The increase in slope was reflected by a significant increase in contractile rate
of force development both in the initial (30 and 50 ms) and later (100 and 200
ms) phases of rising force.
J Appl Physiol • VOL
Fig. 3. Contractile rate of force development (RFD) at baseline and 5 and 12
wk posttraining in the trained leg of all 3 intervention groups [ST, electrical
stimulation (ES), and standard rehabilitation (SR)]. Contractile RFD was
derived as the average slope of the initial phase of the force-time curve (change
in force/change in time) at 30, 50, 100, and 200 ms relative to the onset of
contraction. In addition, peak RFD was determined in the time interval of
0 –200 ms. Values are means SE. *Significant difference between 12-wk and
baseline values (P 0.05).
97 • NOVEMBER 2004 •
www.jap.org
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
1959
postsurgery, which was prevented in the ES and ST groups.
Furthermore, maximal muscle strength increased 24% in the
ST group from baseline to after 12 wk of training in contrast to
the ES and SR groups. The observed improvements in the ST
group corresponds to previous findings in elderly individuals
Downloaded from on November 3, 2014
Fig. 4. Contractile impulse at baseline and 5 and 12 wk posttraining in the
trained leg of all 3 intervention groups (ST, ES, and SR). Contractile impulse,
defined as the area covered by the moment-time curve (moment dt), was
calculated in time intervals of 0 –30, 50, 100, and 200 ms relative to the onset
of contraction. In addition, peak RFD was determined in the time interval of
0 –200 ms. Values are means SE. *Significant difference between 12-wk and
baseline values (P 0.05).
Moreover, there was no decrease in mCSA in the ES group 12 wk
after surgery, in accordance with earlier studies in young anterior
cruciate ligament patients (5, 19). However, it was not possible to
detect any overall statistical difference in treatment outcome
between these two intervention groups (SR and ES groups). In
contrast, strength training not only prevented the postsurgery
muscle atrophy at 5 wk but also augmented mCSA after 12 wk
(12%), which resulted in a significant difference in treatment
outcome between the ST group and the two other groups
(Table 2).
With respect to isometric strength, similar changes were
observed (Table 2) with a 22% decrease in the SR group 5 wk
J Appl Physiol • VOL
Fig. 5. Electromyogram (EMG) signal amplitudes at baseline (0), 5 wk (5), and
12 wk (12) posttraining in the trained leg of all 3 intervention groups (ST, ES, and
SR). Data presented were calculated as the mean integrated EMG divided by the
integration time (200 ms) relative to onset of EMG integration for vastus lateralis
(VL), vastus medialis (VM), and rectus femoris (RF). Values are means SE.
MAV, mean average voltage. #Significant difference between 12-wk and 5-wk
values (P 0.05). §Significant difference between 5-wk and baseline values (P 0.05). *ST significantly different from SR (P 0.05).
97 • NOVEMBER 2004 •
www.jap.org
1960
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
J Appl Physiol • VOL
The fact that marked increases (36 – 41%) were observed in
EMG signal amplitude, especially for VL, during the early
(30 –50 ms) and later (100 –200 ms) phase of rising muscle
force indicates that the increases in RFD and impulse at least
partly was explained by adaptive changes in neural function.
The lack of increased EMG with strength training in the early
phase of training was somewhat surprising comparing with
results from earlier studies (23, 39); however, it should be
noted that the observed adaptations from preexercise to 5 wk of
exercise reflect not only the training intervention but also the
immobilization period due to surgery. Thus marked decreases
in muscle activation (43– 45%) were observed in the SR group
from preexercise to 5 wk of exercise (Fig. 5), which seemed to
be prevented in both the ST the ES groups.
In summary, the present study demonstrates that strength training is an effective way to induce marked increases in maximal
muscle strength and enhanced rapid muscle force characteristics
in elderly subjects after long-term unilateral limb disuse compared
with rehabilitation regimes using electrical muscle stimulation or
conventional physiotherapy. Furthermore, the gains in maximal
muscle strength and rapid muscle force characteristics were accompanied by significant increases in EMG amplitudes and increased mCSA of the quadriceps muscles. Although the relative
contribution to the observed changes in rapid muscle strength
from neural vs. morphological adaptations could not be determined in the present study, the results underline the importance of
training both aspects in elderly individuals. Furthermore, the
observation that rapid muscle force capacity of the neuromuscular
system remains trainable in elderly patients recovering from
prolonged limb disuse may have important implications for future
rehabilitation programs, especially when the importance of rapid
muscle force capacity on postural balance, maximal walking
speed, and other tasks of daily life actions are considered.
REFERENCES
1. Aagaard P and Andersen JL. Correlation between contractile strength
and myosin heavy chain isoform composition in human skeletal muscle.
Med Sci Sports Exerc 30: 1217–1222, 1998.
2. Aagaard P, Simonsen EB, Andersen JL, Magnusson P, and DyhrePoulsen P. Increased rate of force development and neural drive of human
skeletal muscle following resistance training. J Appl Physiol 93: 1318 –
1326, 2002.
3. Aagaard P, Simonsen EB, Andersen JL, Magnusson SP, BojsenMoller F, and Dyhre-Poulsen P. Antagonist muscle coactivation during
isokinetic knee extension. Scand J Med Sci Sports 10: 58 – 67, 2000.
4. Appell HJ. Muscular atrophy following immobilisation. A review. Sports
Med 10: 42–58, 1990.
5. Arvidsson I, Arvidsson H, Eriksson E, and Jansson E. Prevention of
quadriceps wasting after immobilization: an evaluation of the effect of
electrical stimulation. Orthopedics 9: 1519 –1528, 1986.
6. Baker D, Wilson G, and Carlyon B. Generality vs. specificity—a
comparison of dynamic and isometric measures of strength and speedstrength. Eur J Appl Physiol Occup Physiol 68: 350 –355, 1994.
7. Bassey EJ, Fiatarone MA, O’Neill EF, Kelly M, Evans WJ, and
Lipsitz LA. Leg extensor power and functional performance in very old
men and women. Clin Sci (Colch) 82: 321–327, 1992.
8. Behm DG and Sale DG. Velocity specificity of resistance training. Sports
Med 15: 374 –388, 1993.
9. Berg HE, Dudley GA, Haggmark T, Ohlsen H, and Tesch PA. Effects
of lower limb unloading on skeletal muscle mass and function in humans.
J Appl Physiol 70: 1882–1885, 1991.
10. Bosco C and Komi PV. Influence of aging on the mechanical behavior of
leg extensor muscles. Eur J Appl Physiol Occup Physiol 45: 209 –219,
1980.
11. Chrischilles E, Shireman T, and Wallace R. Costs and health effects of
osteoporotic fractures. Bone 15: 377–386, 1994.
97 • NOVEMBER 2004 •
www.jap.org
Downloaded from on November 3, 2014
after prolonged strength training intervention regardless of age
and gender (18, 20, 49).
Although the loading intensity of the three different training
regimes was not directly comparable in the present study, the
fact that neither electrical stimulation nor conventional rehabilitation induced increases in maximal muscle strength or
muscle mass may reflect inadequate muscle activation with
these training modalities and emphasizes the importance of
loading intensity in rehabilitation programs.
The ability to develop force rapidly (i.e., contractile RFD) is
an important performance characteristic, especially in older
people, contributing to several tasks of daily life such as
climbing stairs, walking, and attempting to avoid a fall (7, 17).
At the same time, reduced muscle strength in older people, e.g.,
after a period of immobilization or disuse, may be associated
with muscle atrophy, a lowered ability to produce force rapidly, and thereby an increased risk of falling (17). In healthy
elderly individuals, it has been demonstrated that RFD is
reduced compared with young individuals of both genders (12,
33, 50, 54), although when RFD is normalized to maximal
voluntary contraction the results are conflicting (12, 50). Likewise, in healthy elderly individuals, Häkkinen and coworkers
demonstrated significant increases in RFD and elevated EMG
as a result of combined power/strength training performed for
12 wk (23), 21 wk (29), and 6 mo (24), whereas no effects on
RFD could be demonstrated with a 10-wk mixed-methods
training program in healthy elderly men (28). The strength
training program used in the present study was designed as a
progressively adjusted program. The aim was to avoid postoperative injuries while still ensuring a sufficiently high loading
intensity (8 RM) to induce adaptive changes in muscle size
(15, 18) and muscle activation, as previously demonstrated in
young individuals (2, 14, 46). In accordance with these studies,
the present strength training regime resulted in marked increases in rapid force production, both in the very initial phase
(30 –50 ms, 31– 45%) as well as the later part (100 –200 ms,
26 –30%) of the isometric force-time curve (Fig. 2). Similar
changes occurred with respect to contractile impulse, which
was determined as the integrated area under the force-time
curve, both in the initial phase of contraction (30 –50 ms, 32%)
and in the later part (100 –200 ms, 27%) (Fig. 4). Importantly,
the present data are the first to demonstrate a 25% increase in
the very initial phase of muscle contraction (30 ms) for RFD
normalized to mCSA. This increase indicates that qualitative
changes may have occurred in muscle contraction characteristics, such as increased maximal motor unit firing frequency
(52) or changes in myosin heavy chain isoform composition
toward an increased type II dominance (1). The importance of
these rapid muscle force characteristics is stressed by the fact
that a positive correlation was observed between RFD (0 –
30-50 ms) and maximal walking speed (data not presented) at
baseline (r 0.51– 0.55, P 0.005) but not between walking
speed and maximal isometric muscle strength. Correspondingly, after 12 wk of strength training, maximal gait speed
increased by 30% (P 0.001) and correlated to the increase in
absolute RFD (r 0.79, P 0.004) and normalized RFD (r 0.86, P 0.001) in the very initial phase of muscle contraction
(0 –30 ms). In contrast, the change in maximal walking speed
did not correlate to the adaptative change in maximal muscle
strength or mCSA.
TRAINING-INDUCED MUSCLE CHANGES IN ELDERLY AFTER LONG-TERM DISEASE
J Appl Physiol • VOL
33. Izquierdo M, Ibanez J, Gorostiaga E, Garrues M, Zuniga A, Anton A,
Larrion JL, and Hakkinen K. Maximal strength and power characteristics in isometric and dynamic actions of the upper and lower extremities
in middle-aged and older men. Acta Physiol Scand 167: 57– 68, 1999.
34. Kellis E and Baltzopoulos V. The effects of antagonist moment on the
resultant knee joint moment during isokinetic testing of the knee extensors. Eur J Appl Physiol Occup Physiol 76: 253–259, 1997.
35. LeBlanc A, Rowe R, Evans H, West S, Shackelford L, and Schneider
V. Muscle atrophy during long duration bed rest. Int J Sports Med 18,
Suppl 4: S283–S285, 1997.
36. LeBlanc A, Rowe R, Schneider V, Evans H, and Hedrick T. Regional
muscle loss after short-duration spaceflight. Aviat Space Environ Med 66:
1151–1154, 1995.
37. Lexell J, Downham DY, Larsson Y, Bruhn E, and Morsing B. Heavyresistance training in older Scandinavian men and women: short- and
long-term effects on arm and leg muscles. Scand J Med Sci Sports 5:
329 –341, 1995.
38. Mitchell SL, Stott DJ, Martin BJ, and Grant SJ. Randomized controlled trial of quadriceps training after proximal femoral fracture. Clin
Rehabil 15: 282–290, 2001.
39. Moritani T and deVries HA. Neural factors versus hypertrophy in the
time course of muscle strength gain. Am J Phys Med 58: 115–130, 1979.
40. Muller EA. Influence of training and of inactivity on muscle strength.
Arch Phys Med Rehabil 51: 449 – 462, 1970.
41. Neder JA, Sword D, Ward SA, Mackay E, Cochrane LM, and Clark
CJ. Home based neuromuscular electrical stimulation as a new rehabilitative strategy for severely disabled patients with chronic obstructive
pulmonary disease (COPD). Thorax 57: 333–337, 2002.
42. Porter MM, Vandervoort AA, and Lexell J. Aging of human muscle:
structure, function and adaptability [see comments]. Scand J Med Sci
Sports 5: 129 –142, 1995.
43. Quittan M, Nuhr MJ, Hulsmann M, Crevenna R, and Pacher R.
Chronic low frequency electrical stimulation of thigh muscles increases
aerobic capacity in patients with severe chronic heart failure. Circulation
104: 452, 2001.
44. Rosemeyer B and Sturz H. Quadriceps femoris muscle during immobilisation and remobilisation. Z Orthop Ihre Grenzgeb 115: 182–188, 1977.
45. Sashika H, Matsuba Y, and Watanabe Y. Home program of physical
therapy: Effect on disabilities patients with total hip arthroplasty. Arch
Phys Med Rehabil 77: 273–277, 1996.
46. Schmidtbleicher D and Haralambie G. Changes in contractile properties
of muscle after strength training in man. Eur J Appl Physiol Occup Physiol
46: 221–228, 1981.
47. Sherrington C and Lord SR. Home exercise to improve strength and
walking velocity after hip fracture: a randomized controlled trial. Arch
Phys Med Rehabil 78: 208 –212, 1997.
48. Skelton DA, Greig CA, Davies JM, and Young A. Strength, power and
related functional ability of healthy people aged 65– 89 years. Age Ageing
23: 371–377, 1994.
49. Skelton DA, Young A, Greig CA, and Malbut KE. Effects of resistance
training on strength, power, and selected functional abilities of women
aged 75 and older. J Am Geriatr Soc 43: 1081–1087, 1995.
50. Thelen DG, Schultz AB, Alexander NB, and Ashton-Miller JA. Effects
of age on rapid ankle torque development. J Gerontol A Biol Sci Med Sci
51: 226 –232, 1996.
51. Thorstensson A, Grimby G, and Karlsson J. Force-velocity relations
and fiber composition in human knee extensor muscles. J Appl Physiol 40:
12–16, 1976.
52. Van Cutsem M, Duchateau J, and Hainaut K. Changes in single motor
unit behaviour contribute to the increase in contraction speed after dynamic training in humans. J Physiol 513: 295–305, 1998.
53. Vandervoort AA and Hayes KC. Plantarflexor muscle function in young
and elderly women. Eur J Appl Physiol 58: 389 –394, 1989.
54. Vandervoort AA and McComas AJ. Contractile changes in opposing
muscles of the human ankle joint with aging. J Appl Physiol 61: 361–367,
1986.
55. Wigerstad-Lossing I, Grimby G, Jonsson T, Morelli B, Peterson L,
and Renstrom P. Effects of electrical muscle stimulation combined with
voluntary contractions after knee ligament surgery. Med Sci Sports Exerc
20: 93–98, 1988.
56. Young A and Skelton DA. Applied physiology of strength and power in
old-age. Int J Sports Med 15: 149 –151, 1994.
97 • NOVEMBER 2004 •
www.jap.org
Downloaded from on November 3, 2014
12. Clarkson PM, Kroll W, and Melchionda AM. Age, isometric strength,
rate of tension development and fiber type composition. J Gerontol 36:
648 – 653, 1981.
13. Edgerton VR, Zhou MY, Ohira Y, Klitgaard H, Jiang B, Bell G,
Harris B, Saltin B, Gollnick PD, and Roy RR. Human fiber size and
enzymatic properties after 5 and 11 days of spaceflight. J Appl Physiol 78:
1733–1739, 1995.
14. Farrell M and Richards JG. Analysis of the reliability and validity of the
kinetic communicator exercise device. Med Sci Sports Exerc 18: 44 – 49,
1986.
15. Fiatarone MA, Marks EC, Ryan ND, Meredith CN, Lipsitz LA, and
Evans WJ. High-intensity strength training in nonagenarians. Effects on
skeletal muscle. JAMA 263: 3029 –3034, 1990.
16. Fiatarone MA, O’Neill EF, Doyle N, Clements KM, Roberts SB,
Kehayias JJ, Lipsitz LA, and Evans WJ. The Boston FICSIT study: the
effects of resistance training and nutritional supplementation on physical
frailty in the oldest old. J Am Geriatr Soc 41: 333–337, 1993.
17. Fleming BE, Wilson DR, and Pendergast DR. A portable, easily
performed muscle power test and its association with falls by elderly
persoms. Arch Phys Med Rehabil 72: 886 – 889, 1991.
18. Frontera WR, Meredith CN, Oreilly KP, Knuttgen HG, and Evans
WJ. Strength conditioning in older men—skeletal muscle hypertrophy and
improved function. J Appl Physiol 64: 1038 –1044, 1988.
19. Gibson JN, Smith K, and Rennie MJ. Prevention of disuse muscle
atrophy by means of electrical stimulation: maintenance of protein synthesis. Lancet 2: 767–770, 1988.
20. Grimby G, Aniansson A, Hedberg M, Henning GB, Grangard U, and
Kvist H. Training can improve muscle strength and endurance in 78- to
84-yr-old men. J Appl Physiol 73: 2517–2523, 1992.
21. Haggmark T, Jansson E, and Eriksson E. Fiber type area and metabolic
potential of the thigh muscle in man after knee surgery and immobilization. Int J Sports Med 2: 12–17, 1981.
22. Hakkinen K and Hakkinen A. Muscle cross-sectional area, force production and relaxation characteristics in women at different ages. Eur
J Appl Physiol Occup Physiol 62: 410 – 414, 1991.
23. Hakkinen K and Hakkinen A. Neuromuscular adaptations during intensive strength training in middle-aged and elderly males and females.
Electromyogr Clin Neurophysiol 35: 137–147, 1995.
24. Hakkinen K, Kallinen M, Izquierdo M, Jokelainen K, Lassila H,
Malkia E, Kraemer WJ, Newton RU, and Alen M. Changes in agonistantagonist EMG, muscle CSA, and force during strength training in
middle-aged and older people. J Appl Physiol 84: 1341–1349, 1998.
25. Hakkinen K, Kallinen M, Linnamo V, Pastinen UM, Newton RU, and
Kraemer WJ. Neuromuscular adaptations during bilateral versus unilateral strength training in middle-aged and elderly men and women. Acta
Physiol Scand 158: 77– 88, 1996.
26. Hakkinen K, Komi PV, and Alen M. Effect of rapid type strength
training on isometric force-time and relaxation-time, electromyographic
and muscle-fiber characteristics of leg extensor muscles. Acta Physiol
Scand 125: 587– 600, 1985.
27. Hakkinen K, Kraemer WJ, Newton RU, and Alen M. Changes in
electromyographic activity, muscle fibre and force production characteristics during heavy resistance/power strength training in middle-aged and
older men and women. Acta Physiol Scand 171: 51– 62, 2001.
28. Hakkinen K, Newton RU, Gordon SE, McCormick M, Volek JS,
Nindl BC, Gotshalk LA, Campbell WW, Evans WJ, Hakkinen A,
Humphries BJ, and Kraemer WJ. Changes in muscle morphology,
electromyographic activity, and force production characteristics during
progressive strength training in young and older men. J Gerontol A Biol
Sci Med Sci 53: 415– 423, 1998.
29. Hakkinen K, Pakarinen A, Kraemer WJ, Hakkinen A, Valkeinen H,
and Alen M. Selective muscle hypertrophy, changes in EMG and force,
and serum hormones during strength training in older women. J Appl
Physiol 91: 569 –580, 2001.
30. Hakkinen K, Pastinen UM, Karsikas R, and Linnamo V. Neuromuscular performance in voluntary bilateral and unilateral contraction and
during electrical stimulation in men at different ages. Eur J Appl Physiol
70: 518 –527, 1995.
31. Harridge SDR, Kryger A, and Stensgaard A. Knee extensor strength,
activation, and size in very elderly people following strength training.
Muscle Nerve 22: 831– 839, 1999.
32. Hauer K, Specht N, Schuler M, Bartsch P, and Oster P. Intensive
physical training in geriatric patients after severe falls and hip surgery. Age
Ageing 31: 49 –57, 2002.
1961
Charlotte Suetta, Jesper L. Andersen, Ulrik Dalgas, Jakob Berget, Satu Koskinen,
Per Aagaard, S. Peter Magnusson and Michael Kjaer
J Appl Physiol 105:180-186, 2008. First published Apr 17, 2008; doi:10.1152/japplphysiol.01354.2007
You might find this additional information useful...
This article cites 46 articles, 17 of which you can access free at:
http://jap.physiology.org/cgi/content/full/105/1/180#BIBL
Updated information and services including high-resolution figures, can be found at:
http://jap.physiology.org/cgi/content/full/105/1/180
Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl
This information is current as of October 15, 2008 .
Downloaded from jap.physiology.org on October 15, 2008
Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society.
ISSN: 8750-7587, ESSN: 1522-1601. Visit our website at http://www.the-aps.org/.
J Appl Physiol 105: 180 –186, 2008.
First published April 17, 2008; doi:10.1152/japplphysiol.01354.2007.
Resistance training induces qualitative changes in muscle morphology, muscle
architecture, and muscle function in elderly postoperative patients
Charlotte Suetta,1 Jesper L. Andersen,1 Ulrik Dalgas,1 Jakob Berget,1 Satu Koskinen,1 Per Aagaard,2
S. Peter Magnusson,1 and Michael Kjaer1
1
Institute of Sports Medicine, Bispebjerg Hospital, University of Copenhagen; and 2Institute of Sports Sciences and Clinical
Biomechanics, University of Southern Denmark, Odense, Denmark
Submitted 20 December 2007; accepted in final form 10 April 2008
SARCOPENIA HAS LONG BEEN RECOGNIZED as a major cause of loss
in muscle strength with old age. In fact, aging and disuse are
two of the main conditions leading to skeletal muscle atrophy
in humans. In both conditions, the loss of muscle mass leads to
a decrease in muscle force production, and recent evidence
suggests that a significant additional contribution might come
from changes in muscle architecture (38, 39). However, only a
few studies have examined changes in muscle architecture and
muscle fiber morphology in response to aging and physical
training, and although the results suggest that a significant
plasticity exists, there is generally a lack of data as to what
extent different conditioning stimuli may affect muscle architecture in elderly individuals recovering from hospitalization.
The loss of muscle mass with aging accelerates from the
sixth decade onword, partly owing to a decreased number of
muscle fibers and also as the result of general muscle fiber
atrophy (32, 33). Although several cross-sectional studies indicate that type II fibers are more vulnerable to the aging
process than type I fibers (4, 27, 29, 32), some find a more
marked type I atrophy (13). In essence, the loss of muscle mass
with aging is profound and has been estimated to decrease
30% during the life span (30, 33). Considering these morphological changes, it is not surprising that maximal muscle
strength is reduced as a result of aging by 1.5% per year from
the sixth decade (45).
In addition to the muscular changes pertaining to muscle fiber
area, aging also leads to marked alterations in muscle architecture
that potentially contribute to the loss of muscle strength (39). A
reduction of 10 –13% in muscle fiber pennation angle in old
compared with young individuals has been demonstrated by
Narici et al. (39), suggesting that a significant part of the decrease
in muscle function with aging may be related to changes in muscle
architecture. However, there is a paucity of data describing architectural adaptations to different types of loading, although understanding the impact of different training stimuli on muscle architecture in the elderly seems important to determine effective
intervention programs to improve muscle function after chronic
disuse and/or illness.
The most commonly used rehabilitation regimes for elderly
individuals are based on functional types of exercises without
external loading, although it has been demonstrated that this type
of intervention cannot prevent further muscle atrophy (40) or
restore muscle strength and functional performance in elderly
postoperative patients (43, 44). Percutaneous neuromuscular electrical stimulation is another method used to restore muscular
function after immobilization, although primarily investigated in
young individuals (5, 16). During the last decades, resistance
training has emerged as an effective method to induce muscle
hypertrophy and increase muscle strength and functional performance in frail elderly (12, 21) and in patients with chronic
diseases (10, 23, 26). Furthermore there is increasing evidence
that resistance training used in the late postoperative phase is an
effective method to restore muscle function in elderly patients (22,
34, 42). Despite this, resistance training is still rarely used in the
rehabilitation of elderly patients and especially in the elderly who
have been hospitalized.
Address for reprint requests and other correspondence: C. Suetta, Institute of
Sports Medicine, Bispebjerg Hospital, Bispebjerg Bakke 23, 2400 NV, Copenhagen, Denmark (e-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
aging; muscle power; exercise
180
8750-7587/08 $8.00 Copyright © 2008 the American Physiological Society
http://www. jap.org
Downloaded from jap.physiology.org on October 15, 2008
Suetta C, Andersen JL, Dalgas U, Berget J, Koskinen S, Aagaard
P, Magnusson SP, Kjaer M. Resistance training induces qualitative
changes in muscle morphology, muscle architecture, and muscle function
in elderly postoperative patients. J Appl Physiol 105: 180 –186, 2008.
First published April 17, 2008; doi:10.1152/japplphysiol.01354.2007.—
Although the negative effects of bed rest on muscle strength and
muscle mass are well established, it still remains a challenge to
identify effective methods to restore physical capacity of elderly
patients recovering from hospitalization. The present study compared
different training regimes with respect to muscle strength, muscle
fiber size, muscle architecture, and stair walking power in elderly
postoperative patients. Thirty-six patients (60 – 86 yr) scheduled for
unilateral hip replacement surgery due to hip osteoarthritis were
randomized to either 1) resistance training (RT: 3/wk 12 wk), 2)
electrical stimulation (ES: 1 h/day 12 wk), or 3) standard rehabilitation (SR: 1 h/day 12 wk). All measurements were performed at
baseline, at 5 wk and 12 wk postsurgery. After 12 wk of resistance
training, maximal dynamic muscle strength increased by 30% at 60°/s
(P 0.05) and by 29% at 180°/s (P 0.05); muscle fiber area
increased for type I (17%, P 0.05), type IIa (37%, P 0.05),
and type IIx muscle fibers (51%, P 0.05); and muscle fiber
pennation angle increased by 22% and muscle thickness increased by
15% (P 0.05). Furthermore, stair walking power increased by 35%
(P 0.05) and was related to the increase in type II fiber area (r 0.729, P 0.05). In contrast, there was no increase in any measurement outcomes with electrical stimulation and standard rehabilitation.
The present study is the first to demonstrate the effectiveness of
resistance training to induce beneficial qualitative changes in muscle
fiber morphology and muscle architecture in elderly postoperative
patients. In contrast, rehabilitation regimes based on functional exercises and neuromuscular electrical stimulation had no effect. The
present data emphasize the importance of resistance training in future
rehabilitation programs for elderly individuals.
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
METHODS
Subjects and study design. Thirty-six elderly individuals, 18
women (age range 60 – 86 yr) and 18 men (age range 60 –79 yr)
volunteered to participate in the study. The subjects were scheduled
for unilateral hip replacement surgery at Bispebjerg University Hospital, Copenhagen, Denmark due to hip osteoarthritis. Before the
operation all subjects were randomized to one of three groups:
1) unilateral resistance training (RT; n 13), 2) unilateral electrical
stimulation of the quadriceps muscle (ES; n 11), 3) standard
rehabilitation (SR; n 12). Randomization was performed by a
computer program (Minimize version 2.1), and patients were stratified
by age and sex. All three training regimes have been described in
detail elsewhere (47). In brief, RT consisted of a 12-wk (3/wk)
unilateral progressive training program [weeks 1–2: 3 10 (20 RM,
where RM is repetition maximum); weeks 3– 4: 3 12 (15 RM);
weeks 5– 6: 4 10 (12 RM); weeks 7– 8: 5 8 (8 RM); weeks 9 –10:
4 8 (8 RM); weeks 11–12: 3 8 (8 RM)] with focus on knee
extension and leg press exercises. The ES group performed neuromuscular electrical stimulation of the quadriceps muscle of the operated limb 1 h/day (40 Hz). The SR group performed a rehabilitation
program consisting of functional exercises with focus on improving
mobility and strength without external loading. Measurements were
performed 1 wk (2–3 days) before the operation, 5 and 12 wk
postsurgery, and the muscle biopsies were taken 2 days after surgery.
The local Ethics Committee approved the conditions of the study, the
experimental procedures were performed in accordance with the
Declaration of Helsinki, and written informed consent was obtained.
Maximal quadriceps muscle strength. Muscle strength was measured as the maximal voluntary knee extension (peak moment, N m)
during concentric quadriceps contraction in an isokinetic dynamometer (KinCom) at 60°/s and 180°/s (46). Moment values were corJ Appl Physiol • VOL
rected for gravity of the lower limb and normalized to body weight.
Measurements were performed bilaterally and were preceded by a
familiarization trial conducted on a separate day. The nonaffected side
was tested first to increase the subject’s comfort with the procedure.
Strict care was taken to ensure identical test protocols for all subjects,
which included standardized verbal encouragement and visual feedback provided by a real-time display of the force output (25). Successive trials were performed until peak moment could not be improved any further, which typically included seven to nine attempts at
each velocity (2).
Muscle biopsy sampling and analyses. Bilateral muscle samples
were obtained from the middle portion of the VL utilizing the
percutaneous needle biopsy technique of Bergström (7) by the same
investigator. Following intervention, efforts were made to extract
tissue from the same depth and location (within 1–2 cm). After
being dissected of all visible blood, adipose, and connective tissue, the
muscle samples were oriented in embedding medium (Tissue-Tek)
frozen in isopentane cooled with liquid nitrogen and stored at 80°C.
Subsequently, serial transverse sections (10 m) were cut in a cryotome at 20°C and stained for myofibrillar ATPase at pH 9.4 after
both alkaline (pH 10.3) and acid (pH 4.3 and 4.6) preincubations (9).
All samples of each individual person were stained in the same batch
to avoid interassay variation. Muscle fiber-type and cross-sectional
area (CSA) analyses were conducted in a blinded fashion and an
average of 397 22 fibers were analyzed in each biopsy. On the basis
of the ATPase staining pattern, muscle fibers were characterized as
type I, I/IIa, IIa, IIax, and IIx (3). Because of a low number of type
I/IIa and IIax fibers in some individuals, the individual analyses were
collapsed into three fiber types, type I, type IIa, and type IIx, before
the final statistical analyses were performed (3). The reduction in fiber
type was based on the following equations: type I I I/IIa; type
IIa I/IIa IIa IIax; and type IIx IIax IIx. For the
determination of muscle fiber size, only truly horizontally fibers were used;
thus a restricted number of fibers (minimum of 50 fibers) were
included for this analysis. A videoscope consisting of a microscope
(Olympus BX 50) and color video camera (Sanyo high-resolution
charge-coupled device) in combination with Tema Image-analysis
System (Scanbeam Denmark) were used to calculate the mean fiber
area values of each fiber type.
Muscle fiber pennation angle and muscle thickness. Sagittal ultrasound (UL) images of the quadriceps femoris muscle were recorded
with a Siemens real-time scanner with a 7.5-MHz linear array transducer. Images were obtained in the seated position (90° flexion in the
hip and knee joint) at 50% of femur length over the midbelly of the
VL (1). To ensure the same scan position, traces were drawn on
acetate paper, which was aligned relative to skin marks and
anatomic landmarks. VL fiber pennation angle was measured as the
angle between VL muscle fiber fascicles and the deep aponeurosis
of the insertion (1) (Fig. 1). VL muscle thickness was obtained
with the UL-transducer in the same position and measured as the
distance between the deep and superficial aponeurosis of the VL
muscle. Two images from each limb were obtained from each
subject. Each image was evaluated three times and the mean value
was recorded. The coefficient of variation between two consecutive
measurements was 5%.
Stair walking power. Maximum stair walking power per kilogram
body mass (W/kg) was calculated as the distance of vertical displacement of the body center mass times g (9.81 m/s2), i.e., the change in
potential energy, divided by the fastest time of stair ascent. Each
subject performed three trials, and the stairs consisted of 10 steps each
with a height of 16.5 cm for a total vertical displacement of 1.65 m.
Statistical analysis. Nonparametric statistics were used for the
analyses, since not all data were normally distributed. To evaluate the
effect of intervention over time, a Friedman test was used with post
hoc Wilcoxon’s test. Any between-group differences were analyzed
with Kruskal-Wallis tests and subsequent Mann-Whitney U-test.
Spearman’s Rho was used for the correlation analysis on a limited
105 • JULY 2008 •
www.jap.org
Downloaded from jap.physiology.org on October 15, 2008
Previously, we have studied the neuromuscular and functional changes, before and after unilateral resistance training,
neuromuscular electrical stimulation, and a standard rehabilitation program in elderly patients recovering from hip replacement surgery (46, 47). These results indicated that resistance
training is more effective to restore muscle mass, contractile
rate of force development, and functional performance than
rehabilitation regimes based on functional exercises and electrical stimulation (46, 47). However, although muscle architecture has been shown to be an important factor for muscle
function in young individuals (1), no studies have previously
investigated the changes in muscle fiber morphology and
muscle architecture with different types of intervention in the
elderly.
To describe more closely the potential interaction between
muscle morphology, muscle architecture, and contractile capacity, the aim of the present study was therefore, in the same
group of patients, to examine the relationship between muscle
fiber area and muscle fiber pennation angle of the vastus
lateralis (VL) muscle before and after the three intervention
regimes: resistance training, electrical stimulation, and standard rehabilitation. It was hypothesized that resistance training
would be more effective to increase muscle fiber pennation
angle and muscle fiber area than standard rehabilitation and
electrical stimulation and furthermore that these changes might
be related to the potential gains in maximal voluntary contraction capacity and stair-climbing power. The present study is the
first in which measurements of muscle fiber pennation angle,
muscle fiber area, maximal dynamic strength, and stair-climbing power were combined to examine the specific adaptations
to different training regimes in elderly individuals.
181
182
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
number of data. Analysis were performed on collapsed data for all
three groups, except for the relation between the delta change in type
II muscle fiber area and stair walking power after 12 wk of RT. Data
are presented as mean values SE. A P value of less than 0.05 were
considered significant.
RESULTS
Twenty-eight of the thirty-six included patients completed
the study; two withdrew immediately from the SR group
because they were unsatisfied with the randomization, two
became ill for reasons unrelated to the study, two persons
refused to have muscle biopsies taken, and two withdrew
because of personal problems. There was no difference between the three groups with respect to anthropometric data
(Table 1), maximal muscle strength (Table 2), or muscle fiber
CSA (Fig. 2) at baseline. No training-related complications
were seen in any of the three groups.
Changes in maximal muscle strength. Muscle strength remained unchanged on the operated side in SR and ES, as well
as in the nonoperated control leg in all three intervention
groups (Table 2). Knee extensor peak torque increased by 30%
at 60°/s (P 0.05) and by 29% at 180°/s (P 0.05) after 12
wk of RT. Furthermore, the increase in peak torque at 60°/s
with RT was significantly different compared with SR at 5 wk
(P 0.05) and compared with SR (P 0.05) and ES (P 0.05) at 12 wk. At the faster contraction velocity (180°/s), the
increase with RT was significantly greater compared with SR
at 12 wk (P 0.05), but not compared with ES.
Changes in muscle fiber area. All three fiber types increased
following the 12 wk of RT (Fig. 2). Type I muscle fiber area
increased by 17% (P 0.05), type IIa fibers increased by 37%
(P 0.05), and type IIx fibers increased by 51% (P 0.05)
after 12 wk of RT (Fig. 2). The corresponding increase in total
mean fiber area was 32% (P 0.05). In contrast, there was no
increase in the mean fiber area for any of the examined fiber
types with ES and SR. In addition, there was a significant
difference in myofiber CSA (type I and type IIa but not type
IIx) at baseline (Pre) in all three groups; however, after 12 wk
J Appl Physiol • VOL
DISCUSSION
Although immobilization and hospitalization are more frequent in old age and lead to an increased risk of disability (24),
Table 1. Anthropometric data
n
Age, yr
Sex
Body weight, kg
Height, cm
BMI, kg/m2
RT
ES
SR
P
10
71 (61–86)
6 W/4 M
76.75.7
167.72.6
26.91.7
10
69 (60–75)
5 W/5 M
79.94.6
168.33.1
28.01.0
8
69 (62–78)
4 W/4 M
86.86.0
170.52.4
29.41.6
ns
ns
ns
ns
ns
ns
Values are means SE (range); n, no. of subjects. No significant differences
were observed between groups at inclusion time (ns). RT, resistance training;
ES, electrical stimulation; SR, standard rehabilitation; W, women; M, men;
BMI, body mass index.
105 • JULY 2008 •
www.jap.org
Downloaded from jap.physiology.org on October 15, 2008
Fig. 1. Measurement of muscle fiber pennation angle (p) and muscle thickness. Sagittal ultrasound image obtained in the quadriceps femoris muscle at
50% femur length. Muscle fiber pennation angle of the vastus lateralis (VL)
muscle was determined as the angle between VL muscle fiber fascicles and the
deep aponeurosis separating VL and vastus intermedius. Muscle thickness
(vertical dotted line) was measured as the distance between the superficial and
deep aponeurosis of the VL muscle.
of RT this asymmetry was eliminated, in contrast to SR and
ES. Muscle fiber CSA in the control leg did not change in any
of the intervention groups (P 0.05). At baseline, there was
no difference between groups; however, the delta changes in
type I muscle fiber CSA observed with 12 wk of RT and ES
were greater than after 12 wk of SR (RT SR and ES SR,
P 0.05), and the increases in type IIa muscle fiber CSA with
12 wk of RTs were greater than after 12 wk of ES and SR
(RT ES and RT SR, P 0.05).
Changes in muscle fiber pennation angles and muscle thickness. Muscle architecture was altered following 12 wk of RT
training as reflected by a 22% increase in VL muscle fiber
pennation angle (7.2 0.5 to 8.6 0.6°, P 0.05), which was
contrasted by a 11% decrease following SR (7.6 0.3 to 6.7 0.2°, P 0.05). No change was observed with ES (Fig. 3). At
baseline, there was no difference between groups; however, the
delta changes with RT were greater than those observed with
SR and ES both at 5 wk (RT ES, P 0.05 and RT SR,
P 0.05) and at 12 wk (RT ES and RT SR, P 0.05).
Muscle thickness of the VL muscle increased by 14.8% after
12 wk of RT (15.3 1.3 to 17.5 1.6 mm, P 0.05), whereas
there was no increase with ES or SR (Fig. 4). Moreover, the delta
changes with 12 wk of RT was greater than those observed
with SR (RT SR, P 0.05).
Stair walking power. Maximum stair walking power (W/kg)
increased after 12 wk of RT (2.6 0.4 W/kg to 3.5 0.4
W/kg, P 0.05) and 12 wk of ES (2.6 0.3 W/kg to 3.4 0.4 W/kg, P 0.05) but not after 12 wk of SR (2.2 0.3 W/kg
to 2.5 0.2 w/kg). Furthermore, the delta changes with RT
were greater than those observed with SR at 12 wk (RT SR,
P 0.05), but there was no difference between ES and SR
(P 0.495).
Correlation analyses. The relative change in VL muscle
fiber pennation angle was related to the individual change in
dynamic torque at both contraction velocities (60°/s: r 0.619, 180°/s: r 0.530, P 0.05), to the change in total
mean fiber area (r 0.429, P 0.05), and to the change in VL
muscle thickness (r 0.479, P 0.05). The individual delta
change in type II muscle fiber area after 12 wk of RT was
related to the delta change in stair walking power (r 0.729,
P 0.05). Furthermore, the increase in muscle fiber pennation
angle after 12 wk of RT was strongly related to the increase in
muscle thickness (r 0.733, P 0.05).
183
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
Table 2. Changes in dynamic muscle strength normalized to body weight
RT
OP
Peak torque
Pre, 60°/s
5 wk,
N m kg1
12 wk,
N m kg1
Peak torque
Pre, 180°/s
5 wk,
N m kg1
12 wk,
N m kg1
ES
SR
CO
OP
CO
OP
CO
1.310.15
1.640.11
1.280.12
1.480.10
1.220.11
1.700.13
1.340.14†
1.670.12
1.160.13
1.420.10
1.080.08
1.530.12
1.640.15*†
1.640.12
1.250.13
1.420.11
1.160.10
1.660.13
0.880.10
1.080.09
0.840.09
0.980.08
0.960.07
1.140.09
0.890.08
1.090.09
0.830.10
0.980.08
0.850.06
1.150.10
1.070.09*†
1.080.09
0.880.10
0.970.08
0.930.07
1.160.09
Isokinetic quadriceps strength measurements normalized to body weight. Data are presented from both sides, the operated side (OP) and the control side (CO),
from all three intervention groups at baseline (Pre), 5 wk after the operation (5 wk), and 12 wk after the operation (12 wk). The 3 intervention groups are RT,
ES, and SR. Values are means SE. *P 0.05 significantly different from baseline. †P 0.05 refers to intergroup differences, RT being significantly different
from SR and ES.
J Appl Physiol • VOL
previous studies in young (1) and old individuals (27), although not consistently shown (17, 31). Furthermore, the
pronounced increase in type II fiber CSA seen with RT compensated for the preoperative difference in type I and II fiber
CSA (II I), which disappeared following RT. In contrast,
muscle fiber area remained unaffected by ES or SR. Importantly, the present data demonstrates that changes in type II
fiber CSA with RT translated into an improved stair walking
power, which is an important functional adaptation (6, 28).
Interestingly, the delta changes in type I muscle fiber CSA
were significantly larger after both RT and ES than after SR
(RT SR and ES SR, P 0.05), whereas RT was the most
effective intervention to induce changes in type IIa muscle
fiber CSA (RT ES and RT SR, P 0.05). These findings
are in line with previous studies indicating that ES mainly leads
to hypertrophy of type I fibers (15, 20) whereas RT effectively
induce hypertrophy of type II fibers (1, 27). Furthermore, the
present data demonstrate that the preoperative side-to-side
difference in muscle fiber CSA (type I and type IIa) was
eliminated after 12 wk of RT, in contrast to ES and SR.
In both sarcopenia and disuse atrophy, muscle fiber fascicles
seem to have a reduced pennation angle compared with healthy
young individuals, likely because of decreased amounts of
contractile tissue (35, 37). In agreement with these findings,
muscle fiber pennation angles on the osteoarthritic side were
significantly smaller compared with the healthy side (control
leg) in the present study. However, the muscle tissue of old
individuals also shows a remarkable plasticity with resistance
training. After 12 wk of RT there was a 22% increase in VL
muscle fiber pennation angle (Fig. 3), which was comparable to
that seen in both young and old individuals after a period of
resistance training (1, 36). That is contrasted by the lack of
change in muscle fiber pennation angle for the elderly individuals subjected to ES training or SR. Interestingly, there was a
positive relationship between the training-induced change in
VL muscle fiber pennation angle and the corresponding
changes in dynamic torque at slow-to-fast contraction velocities (60°/s: r 0.619, 180°/s: r 0.530, P 0.05), emphasizing the importance of muscle architecture for the contractile
function of the muscle. Moreover, the individual delta changes
in muscle fiber pennation angle was positive related to the
105 • JULY 2008 •
www.jap.org
Downloaded from jap.physiology.org on October 15, 2008
the effects of different types of loading on qualitative changes
in muscle architecture and muscle morphology has not previously been investigated in elderly postoperative patients. The
present study is the first to simultaneous measure maximal
dynamic muscle strength, muscle fiber size, muscle fiber pennation angle, and stair walking power to address the change in
muscle contractile function, muscle fiber morphology, muscle
architecture, and functional performance with different training
modalities (resistance training, electrical stimulation, or standard rehabilitation) in elderly individuals recovering from hip
surgery. The main finding was that 12 wk of resistance training
led to substantial increases in maximal contractile muscle
strength that were accompanied by gains in both type I and II
single muscle fiber CSA and gains in VL muscle fiber pennation angle and stair walking power. Notably, in contrast to
resistance training, no changes occurred in these parameters
following the most commonly employed types of training to
elderly patients, i.e., a rehabilitation program based on functional exercises (standard rehabilitation) or neuromuscular
electrical stimulation.
Although the subjects in the present study were rather frail,
especially the first 4 – 6 wk after surgery, maximal dynamic
muscle strength increased by 30% (Table 2) in response to 12
wk of resistance training. Similar gains in muscle strength have
been demonstrated following resistance training in healthy
elderly individuals (18, 31, 41) and recently in frail elderly (8,
27). In contrast, electrical stimulation maintained the preoperative level of muscle strength, which is in line with previous
findings in young patients after anterior cruciate ligament
reconstruction (5, 16). Notably, the standard rehabilitation
regime did not result in any increases in maximal dynamic
muscle strength, which is in accordance with studies that have
evaluated the effect of physiotherapy exercises after hip surgery (44, 48). Importantly, although all three regimes were
commenced already 1–2 days after surgery, there were no
training-related complications in any of the groups.
Although average muscle fiber area increased by 32% following 12 wk of RT, more pronounced gains in fiber CSA were
seen for the type IIa (37%) and IIx (51%) fibers compared
with that of the type I fibers (17%), indicating a more marked
hypertrophy of the type II fibers. This is in agreement with
184
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
changes in VL muscle thickness (r 0.479, P 0.05), which
was further emphasized looking separately at the RT group
(r 0.733, P 0.05). Notably, there was no relation between
the changes in muscle thickness and the anatomic CSA
(ACSA) measured by computed tomography scan (P 0.05),
yet, the changes in ACSA was positively related to the delta
changes in muscle fiber pennation angle (r 0.600, P 0.05).
In line with previous data in young individuals a positive
relationship was observed between the changes in ACSA
and the individual changes in type I muscle fiber CSA (r Fig. 2. Changes in VL muscle fiber cross-sectional area (CSA). Muscle fiber
CSA of type I, type IIa, and type IIx fibers from both limbs (OP, operated leg;
CO, control leg) in all 3 intervention groups [standard rehabilitation (SR);
electrical stimulation (ES); and resistance training (RT)] at 3 time points (Pre,
baseline values; 5 wk, after 5 wk of training; 12 wk, after 12 wk of training).
Data are presented as means SE, *P 0.05 significantly different from
baseline, #P 0.05 RT significantly different from SR. CO was significant
different from OP in all 3 intervention before surgery. After 12 wk of RT there
was no side difference, in contrast to SR and ES.
J Appl Physiol • VOL
Fig. 4. Changes in VL muscle thickness. Muscle thickness of VL from both
limbs in all 3 intervention groups (SR, ES, and RT) at 3 time points (Pre, 5 wk,
and 12 wk). Data are presented as means SE, *P 0.05 significantly
different from baseline, #P 0.05 RT significantly different from SR. CO was
significant different from OP in all 3 intervention before surgery. After 12 wk
of RT there was no side difference, in contrast to SR and ES.
105 • JULY 2008 •
www.jap.org
Downloaded from jap.physiology.org on October 15, 2008
Fig. 3. Changes in muscle fiber pennation angles. Muscle fiber pennation
angles of VL from both limbs in all 3 intervention groups (SR, ES, and RT) at
3 time points (Pre, 5 wk, and 12 wk). Data are presented as means SE, *P 0.05 significantly different from baseline, #P 0.05 RT significantly different
from SR and ES. CO was significant different from OP in all 3 intervention
before surgery. After 12 wk of RT there was no side difference, in contrast to
SR and ES.
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
ACKNOWLEDGMENTS
We greatly acknowledge the patients who volunteered to participate in this
study. The study was supported by the IMK Foundation, The Danish Rheumatology Association and the Maersk McKinney Moller Foundation.
REFERENCES
1. Aagaard P, Andersen JL, Dyhre-Poulsen P, Leffers AM, Wagner A,
Magnusson SP, Halkjaer-Kristensen J, Simonsen EB. A mechanism for
increased contractile strength of human pennate muscle in response to
strength training: changes in muscle architecture. J Physiol 534: 613– 623,
2001.
2. Aagaard P, Simonsen EB, Andersen JL, Magnusson SP, HalkjaerKristensen J, Dyhre-Poulsen P. Neural inhibition during maximal eccentric and concentric quadriceps contraction: effects of resistance training. J Appl Physiol 89: 2249 –2257, 2000.
3. Andersen JL, Aagaard P. Myosin heavy chain IIX overshoot in human
skeletal muscle. Muscle Nerve 23: 1095–1104, 2000.
4. Aniansson A, Grimby G, Hedberg M. Compensatory muscle fiber
hypertrophy in elderly men. J Appl Physiol 73: 812– 816, 1992.
5. Arvidsson I, Arvidsson H, Eriksson E, Jansson E. Prevention of
quadriceps wasting after immobilization: an evaluation of the effect of
electrical stimulation. Orthopedics 9: 1519 –1528, 1986.
6. Bean JF, Kiely DK, LaRose S, Alian J, Frontera WR. Is stair climb
power a clinically relevant measure of leg power impairments in at-risk
older adults? Arch Phys Med Rehabil 88: 604 – 609, 2007.
7. Bergström J. Muscle electrolytes in man. Scand J Clin Lab Invest 68,
Suppl: 1–110, 1962.
8. Beyer N, Simonsen L, Bülow J, Lorenzen T, Jensen DV, Larsen L,
Rasmussen U, Rennie M, Kjær M. Old women with a recent fall history
show improved muscle strength and function sustained for six months
after finishing training. Aging Clin Exp Res 19: 300 –309, 2007.
9. Brooke MH, Kaiser KK. Muscle fiber types: how many and what kind?
Arch Neurol 23: 369 –379, 1970.
10. Dunstan DW, Daly RM, Owen N, Jolley D, de Courten M, Shaw J,
Zimmet P. High-intensity resistance training improves glycemic control
in older patients with type 2 diabetes. Diabetes Care 25: 1729 –1736,
2002.
J Appl Physiol • VOL
11. Esmarck B, Andersen JL, Olsen S, Richter EA, Mizuno M, Kjaer M.
Timing of postexercise protein intake is important for muscle hypertrophy
with resistance training in elderly humans. J Physiol 535: 301–311, 2001.
12. Fiatarone MA, Marks EC, Ryan ND, Meredith CN, Lipsitz LA, Evans
WJ. High-intensity strength training in nonagenarians. Effects on skeletal
muscle. JAMA 263: 3029 –3034, 1990.
13. Frontera WR, Hughes VA, Fielding RA, Fiatarone MA, Evans WJ,
Roubenoff R. Aging of skeletal muscle: a 12-yr longitudinal study. J Appl
Physiol 88: 1321–1326, 2000.
14. Frontera WR, Meredith CN, O’Reilly KP, Knuttgen HG, Evans WJ.
Strength conditioning in older men: skeletal muscle hypertrophy and
improved function. J Appl Physiol 64: 1038 –1044, 1988.
15. Gibson JN, Morrison WL, Scrimgeour CM, Smith K, Stoward PJ,
Rennie MJ. Effects of therapeutic percutaneous electrical stimulation of
atrophic human quadriceps on muscle composition, protein synthesis and
contractile properties. Eur J Clin Invest 19: 206 –212, 1989.
16. Gibson JN, Smith K, Rennie MJ. Prevention of disuse muscle atrophy
by means of electrical stimulation: maintenance of protein synthesis.
Lancet 2: 767–770, 1988.
17. Grimby G, Aniansson A, Hedberg M, Henning GB, Grangard U,
Kvist H. Training can improve muscle strength and endurance in 78- to
84-yr-old men. J Appl Physiol 73: 2517–2523, 1992.
18. Hakkinen K, Kallinen M, Izquierdo M, Jokelainen K, Lassila H,
Malkia E, Kraemer WJ, Newton RU, Alen M. Changes in agonistantagonist EMG, muscle CSA, and force during strength training in
middle-aged and older people. J Appl Physiol 84: 1341–1349, 1998.
19. Hakkinen K, Newton RU, Gordon SE, McCormick M, Volek JS,
Nindl BC, Gotshalk LA, Campbell WW, Evans WJ, Hakkinen A,
Humphries BJ, Kraemer WJ. Changes in muscle morphology, electromyographic activity, and force production characteristics during progressive strength training in young and older men. J Gerontol A Biol Sci Med
Sci 53: B415–B423, 1998.
20. Harridge SD, Andersen JL, Hartkopp A, Zhou S, Biering-Sorensen F,
Sandri C, Kjaer M. Training by low-frequency stimulation of tibialis
anterior in spinal cord-injured men. Muscle Nerve 25: 685– 694, 2002.
21. Harridge SDR, Kryger A, Stensgaard A. The effects of strength training
on muscle size and force production in elderly people aged 85–97 years.
J Physiol 509P: 42P– 43P, 1998.
22. Hauer K, Specht N, Schuler M, Bartsch P, Oster P. Intensive physical
training in geriatric patients after severe falls and hip surgery. Age Ageing
31: 49 –57, 2002.
23. Johansen KL. Exercise and chronic kidney disease: current recommendations. Sports Med 35: 485– 499, 2005.
24. Kehlet H, Wilmore DW. Multimodal strategies to improve surgical
outcome. Am J Surg 183: 630 – 641, 2002.
25. Kellis E, Baltzopoulos V. The effects of antagonist moment on the
resultant knee joint moment during isokinetic testing of the knee extensors. Eur J Appl Physiol 76: 253–259, 1997.
26. Kongsgaard M, Backer V, Jorgensen K, Kjaer M, Beyer N. Heavy
resistance training increases muscle size, strength and physical function in
elderly male COPD-patients—a pilot study. Respir Med 98: 1000 –1007,
2004.
27. Kryger AI, Andersen JL. Resistance training in the oldest old: consequences for muscle strength, fiber types, fiber size, and MHC isoforms.
Scand J Med Sci Sports 17: 422– 430, 2007.
28. Larsen AH, Puggaard L, Hamalainen U, Aagaard P. Comparison of
ground reaction forces and antagonist muscle coactivation during stair
walking with ageing. J Electromyogr Kinesiol 2007 Mar 13 [Epub ahead
of print].
29. Larsson L. Histochemical characteristics of human skeletal muscle during
aging. Acta Physiol Scand 117: 469 – 471, 1983.
30. Lexell J. Human aging, muscle mass, and fiber type composition. J
Gerontol A Biol Sci Med Sci 50 Spec No: 11–16, 1995.
31. Lexell J, Downham DY, Larsson Y, Bruhn E, Morsing B. Heavyresistance training in older Scandinavian men and women: short- and
long-term effects on arm and leg muscles. Scand J Med Sci Sports 5:
329 –341, 1995.
32. Lexell J, Taylor CC. Variability in muscle fibre areas in whole human
quadriceps muscle: effects of increasing age. J Anat 174: 239 –249, 1991.
33. Lexell J, Taylor CC, Sjostrom M. What is the cause of the ageing
atrophy? Total number, size and proportion of different fiber types studied
in whole vastus lateralis muscle from 15- to 83-year-old men. J Neurol Sci
84: 275–294, 1988.
105 • JULY 2008 •
www.jap.org
Downloaded from jap.physiology.org on October 15, 2008
0.528, P 0.05) and type II muscle fiber CSA (r 0.476,
P 0.05) (1).
In the present study, we found a mismatch between the
increase in muscle fiber CSA (32%) and the gain in muscle
thickness (14%) or as previously reported in ACSA (12%)
after 12 wk of resistance training (47). Similar findings of a
mismatch between the gains in ACSA and muscle fiber CSA
after a period of resistance training has previously been found
in both young (1) and old individuals (11, 14, 19). The
observed increase in muscle fiber pennation angle (22%) in
the present study indicates the importance of muscle architecture to explain for some of this mismatch, since a steeper
muscle fiber pennation angle allows for a larger physiological
fiber area for a given muscle volume and it should therefore be
recognized that ACSA may not be a very representative measure of changes in the physiological CSA (1).
In conclusion, the present study demonstrated that resistance
training offers an effective way of increasing maximal muscle
strength in elderly postoperative patients. Importantly, the
increase in muscle function was accompanied by gains in
muscle fiber size and pennation angle that resemble that typically seen in young healthy individuals. In contrast, these
positive adaptations were not achieved by daily neuromuscular
electrical stimulation (ES) or standard physiotherapy exercises
(SR). Thus the present data emphasize the importance of using
resistive exercises in future rehabilitation programs for elderly
individuals.
185
186
MUSCLE ARCHITECTURE AND MORPHOLOGY IN THE ELDERLY
34. Mitchell SL, Stott DJ, Martin BJ, Grant SJ. Randomized controlled
trial of quadriceps training after proximal femoral fracture. Clin Rehabil
15: 282–290, 2001.
35. Morse CI, Thom JM, Birch KM, Narici MV. Changes in triceps surae
muscle architecture with sarcopenia. Acta Physiol Scand 183: 291–298,
2005.
36. Morse CI, Thom JM, Mian OS, Birch KM, Narici MV. Gastrocnemius
specific force is increased in elderly males following a 12-month physical
training programme. Eur J Appl Physiol 100: 563–570, 2007.
37. Narici M, Cerretelli P. Changes in human muscle architecture in disuseatrophy evaluated by ultrasound imaging. J Gravit Physiol 5: 73–74, 1998.
38. Narici MV, Maganaris C, Reeves N. Myotendinous alterations and
effects of resistive loading in old age. Scand J Med Sci Sports 15:
392– 401, 2005.
39. Narici MV, Maganaris CN, Reeves ND, Capodaglio P. Effect of aging
on human muscle architecture. J Appl Physiol 95: 2229 –2234, 2003.
40. Reardon K, Galea M, Dennett X, Choong P, Byrne E. Quadriceps
muscle wasting persists 5 months after total hip arthroplasty for osteoarthritis of the hip: a pilot study. Intern Med J 31: 7–14, 2001.
41. Reeves ND, Maganaris CN, Narici MV. Plasticity of dynamic muscle
performance with strength training in elderly humans. Muscle Nerve 31:
355–364, 2005.
42. Sashika H, Matsuba Y, Watanabe Y. Home program of physical
therapy: effect on disabilities patients with total hip arthroplasty. Arch
Phys Med Rehabil 77: 273–277, 1996.
43. Shih CH, Du YK, Lin YH, Wu CC. Muscular recovery around the hip joint
after total hip arthroplasty. Clin Orthop Relat Res 302: 115–120, 1994.
44. Sicard-Rosenbaum L, Light KE, Behrman AL. Gait, lower extremity
strength, and self-assessed mobility after hip arthroplasty. J Gerontol A
Biol Sci Med Sci 57: M47–M51, 2002.
45. Skelton DA, Greig CA, Davies JM, Young A. Strength, power and
related functional ability of healthy people aged 65– 89 years. Age Ageing
23: 371–377, 1994.
46. Suetta C, Aagaard P, Rosted A, Jakobsen AK, Duus B, Kjaer M,
Magnusson SP. Training-induced changes in muscle CSA, muscle
strength, EMG, and rate of force development in elderly subjects after
long-term unilateral disuse. J Appl Physiol 97: 1954 –1961, 2004.
47. Suetta C, Magnusson SP, Rosted A, Aagaard P, Jakobsen AK, Larsen
LH, Duus B, Kjaer M. Resistance training in the early postoperative
phase reduces hospitalization and leads to muscle hypertrophy in elderly
hip surgery patients—a controlled, randomized study. J Am Geriatr Soc
52: 2016 –2022, 2004.
48. Trudelle-Jackson E, Emerson R, Smith S. Outcomes of total hip
arthroplasty: a study of patients one year postsurgery. J Orthop Sports
Phys Ther 32: 260 –267, 2002.
Downloaded from jap.physiology.org on October 15, 2008
J Appl Physiol • VOL
105 • JULY 2008 •
www.jap.org
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Growth Hormone & IGF Research 20 (2010) 134–140
Contents lists available at ScienceDirect
Growth Hormone & IGF Research
journal homepage: www.elsevier.com/locate/ghir
Coordinated increase in skeletal muscle fiber area and expression of IGF-I
with resistance exercise in elderly post-operative patients
Charlotte Suetta a,b,c,*, Christoffer Clemmensen d, Jesper L. Andersen a,b, S. Peter Magnusson a,b,
Peter Schjerling a,b,d, Michael Kjaer a,b
a
Institute of Sports Medicine, Bispebjerg Hospital, University of Copenhagen, Denmark
Center of Healthy Aging, Faculty of Health Science, University of Copenhagen, Denmark
Department of Clinical Physiology and Nuclear Medicine, Bispebjerg Hospital, Denmark
d
Copenhagen Muscle Research Center, Rigshospitalet, University of Copenhagen, Denmark
b
c
a r t i c l e
i n f o
Article history:
Received 26 February 2009
Revised 19 November 2009
Accepted 23 November 2009
Available online 23 December 2009
Keywords:
Aging
Insulin-like growth factor-I
Growth hormone
Exercise
Strength training
a b s t r a c t
Hypertrophy of developing skeletal muscle involves stimulation by insulin-like growth factor-I (IGF-I),
however, the role of IGF-I in adult muscle is less clarified. In the present study, the mRNA splice variants
of IGF-I (IGF-IEa and MGF) and the changes in muscle fiber cross sectional area after 12 weeks of training
were studied in elderly post-operative patients. About 28 subjects, 14 men and 14 women (age 69, range
60–86 years) were randomized to unilateral resistance training (RT: 3/week), electrical stimulation
(ES: 1 h/day) or functional exercises (FE: 1 h/day). The non-operated-side served as a within subject
control. Muscle biopsies were obtained from the vastus lateralis of both limbs at +2d post-operative
(baseline), at 5 weeks and 12 weeks post-surgery to analyze for changes in type 1 and type 2 muscle fiber
area. Changes in expression levels of IGF-I mRNA isoforms were determined using real-time RT-PCR, normalized to the ribosomal protein large protein 0 (RPLP0) mRNA and presented relative to the controlside. At baseline there was no difference between the three groups in muscle fiber area or resting levels
of IGF-IEa and MGF. RT resulted in a significant increase in muscle fiber area of type 1 (+17%, p < 0.05) and
type 2 (+36%, p < 0.05) parallel to an increase in the expression of IGF-IEa and MGF, in contrast to ES and
FE. The present study demonstrates that resistance training initiated in the acute post-operative phase is
highly effective in increasing mean fiber area and in addition induces marked increases in the expression
of IGF-I splice variants, supporting the idea that IGF-I is involved in regulating muscle hypertrophy.
2009 Elsevier Ltd. All rights reserved.
1. Introduction
The consequences of the age-related loss of muscle mass (sarcopenia) are potentially grave and have been related to loss of muscle
function and an increased risk of disability and mortality [1,2].
Although several conditions have been linked to this syndrome,
the underlying mechanisms and the potential reversibility is still
far from clear.
A part from the mechanical properties, the muscle tissue has
another important role, in that it represents the largest protein
store in the body which is required in catabolic situations such
as critical illness or surgery [3]. Importantly, there are indications,
that the muscle tissue of old animals demonstrates an attenuated
response to recover after immobilization and injury [4,5]. Thus, it
has been suggested that sarcopenia may in part be due to failure
to generate an isoform of IGF-I that is necessary to initiate the
* Corresponding author. Address: Institute of Sports Medicine, Bispebjerg Hospital, University of Copenhagen, Denmark. Tel.: +45 3531 6089; fax: +45 3531 2733.
E-mail address: [email protected] (C. Suetta).
1096-6374/$ - see front matter 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ghir.2009.11.005
remodeling of muscle by stimulating satellite cell activation and
proliferation [6]. This knowledge becomes very important considering the vast amount of elderly individuals who undergo a period
of critical illness or surgery and it therefore seems paramount to
gain knowledge about which type of muscle overload is the most
effective to restore muscle mass in these elderly individuals.
The GH-IGF-I axis is regarded to play a key role in the regulation
of postnatal muscle growth and development [7] and there is good
evidence that IGF-I is an important factor in the hypertrophic adaptation of muscle to resistance exercise especially in developing
muscles of animals [8,9]. Two isoforms of the IGF-I mRNA are expressed by skeletal muscle cells when subjected to mechanical
stimulation, although the two splice variants seems to be affected
in different ways by mechanical loading [10,11]. One of them,
IGF-IEa, is similar to the isoforms produced by the liver and is
thought to have an endocrine function being expressed both in resting and working muscle [10]. Interestingly, it has been shown that
muscles from transgenic mice that over-express this isoform have a
marked muscle hypertrophy and further, in old mice signs of protection against development of sarcopenia was demonstrated
Author's personal copy
C. Suetta et al. / Growth Hormone & IGF Research 20 (2010) 134–140
[12]. The other expression form is termed MGF, (mechano-growthfactor, IGF-IEc in humans and IGF-IEb in rats), which has a shorter
half-life, is more muscle specific and mainly expressed in working
muscle. MGF is thus likely to act in an autocrine and paracrine mode
of action more than a systemic one [6]. Furthermore, there are indications that MGF may be more involved in muscle repair and in the
initiating phase of muscle hypertrophy by kick-starting the satellite
cells to proliferate, whereas IGF-IEa seems to be more involved in
the later phase of muscle hypertrophy by stimulating myoblast fusion and myofiber hypertrophy [11,13,14].
In human exercise studies, the expression of IGF-I mRNA has
been found to increase after a single bout of resistance exercise
in young individuals [15–17], but not in all [18]. Notably, Hameed
et al. found an attenuated response in elderly individuals
compared to young individuals after an acute bout of exercise
[16]. After prolonged periods of resistance training the increase
in IGF-I has been more consistent at both the mRNA level [19]
and the protein level [20]. However, the number of studies evaluating the effect of prolonged resistance training on IGF-I mRNA
expression and protein levels are sparse, especially in elderly individuals [19,20]. This is contrasted by the fact that elderly individuals are more often hospitalized and it therefore seems
paramount to gain more knowledge about the cellular responses
to different types of exercises, in order to provide optimal rehabilitation regimes to elderly individuals. Previously, we have studied
the neuromuscular and functional adaptations to three different
training regimes based on functional exercises, electrical muscle
stimulation and resistance training in elderly post-operative individuals and these results indicated that resistance training is more
effective to restore muscle function and muscle mass than rehabilitation regimes based on functional exercises or muscle stimulation [21,22]. However, to our knowledge, no study has previously
investigated the expression level of IGF-IEa and MGF in combination with changes in muscle fiber CSA as a result of different types
of muscle over-loading in old individuals.
The aim of the present study was therefore, in order to describe
the potential interaction between changes in muscle morphology
and IGF-I splice variants in elderly frail patients, to examine
changes in muscle fiber area and expression levels of IGF-IEa and
MGF mRNA in the same group of patients before and after the three
intervention regimes. We put out the hypothesis that potential increases in the expression of IGF-I splice variants would be related
to changes in muscle morphology and that resistance training
would be a more potent stimulus to increase the expression levels
of IGF-IEa and MGF mRNA than exercise regimes based on functional exercises or electrical muscle stimulation in post-operative
elderly individuals.
135
3 12 [15RM], week 5–6: 4 10 [12RM], week 7–8: 5 8
[8RM], week 9–10: 4 8 [8RM], week 11–12: 3 8 [8RM]) with
focus on knee-extension and leg-press exercises. The ES group
was subjected to neuromuscular electrical stimulation (NMES) of
the quadriceps muscle of the operated limb 1 h/day (40 Hz). The
aim was stimulate as much of the muscle as possible by placing
the electrodes with as much distance as possible (from right below
the groin to 2 cm above patella). The FE group performed a rehabilitation program consisting of functional exercises with focus on
improving mobility and strength without external loading. Muscle
biopsies were obtained from vastus lateralis of both legs, in order
for the non-operated-side to serve as an internal control. Biopsies
were obtained at three time points, at 48 h post-surgery (baseline),
at 5 weeks and 12 weeks post-surgery (48 h after the last training
bout). The 48 h post-surgery time-point was chosen in order to
have a ‘‘baseline” measure from the beginning of the training intervention. Biopsies were analyzed for changes in muscle fiber area of
types 1 and 2 fibers, and expression levels of IGF-IEa and MGF
mRNA. The local Ethics Committee approved the conditions of
the study and the experimental procedures were performed in
accordance with the Declaration of Helsinki.
2.2. Muscle biopsy sampling and analyses
Bilateral muscle samples were obtained from the middle portion of M. vastus lateralis utilizing the percutaneous needle biopsy
technique of Bergström [24] by a single investigator. Following
intervention, efforts were made to extract tissue from the same
depth and location (within 1–2 cm). After dissecting the muscle
samples of all visible blood, adipose and connective tissue, the
muscle samples were oriented in embedding medium (Tissue
Tec) frozen in isopentane cooled with liquid nitrogen and stored
at 80 C. Subsequently serial transverse sections (10 lm) were
cut in a cryotome at 20 C and stained for myofibrillar ATPase
at pH 9.4 after both alkaline (pH 10.3) and acid (pH 4.3 and 4.6)
preincubations [25]. All samples of each individual person were
stained in the same batch to avoid interassay variation. Based on
the ATPase staining pattern muscle fibers were characterized as
types I and II and an average of 397 ± 22 fibers were analyzed in
each biopsy. For the determination of muscle fiber size only truly
horizontally fibers were used, with a minimum of 50 fibers included for the analysis. A videoscope consisting of a microscope
(Olympus BX 50) and color video camera (Sanyo high resolution
CCD) in combination with Tema Image-analyses System
(Scanbeam, Denmark) were used to calculate the mean fiber area
of the muscle fibers.
2.3. RNA purification
2. Methods
2.1. Subjects and study design
Subjects were scheduled for unilateral hip-replacement surgery
at Bispebjerg University Hospital, Copenhagen, Denmark due to hip
osteoarthritis. The study was part of a larger study and a subpopulation of these subjects, 14 women (W: age 70, range 60–86
years) and 14 men (M: age 69, range 60–79 years) volunteered
to undergo the muscle biopsy procedure. Before the operation subjects were randomized (stratified for age and gender) to one of
three groups: (1) unilateral resistance training (RT, n = 10), (2) unilateral electrical stimulation of the quadriceps muscle (ES, n = 10),
(3) functional exercises (FE, n = 8). All three training regimes have
been described in detail elsewhere [21,23]. In brief, resistance
training (RT) consisted of a 12 week (3/week) unilateral progressive training-program (week 1–2: 3 10 [20RM], week 3–4:
Total RNA was isolated from muscle biopsies by phenol extraction (TriReagent; Molecular Research Center, OH, USA) as previously described [26]. Intact RNA was confirmed by denaturing
agarose gel electrophoresis.
2.4. Real-time RT-PCR
The mRNA expression of IGF-IEa, MGF, and GADPH was analyzed by real-time RT-PCR. Total RNA (500 ng) was converted into
cDNA in 20 ll using the OmniScript reverse transcriptase (Qiagen,
CA, USA) according to the manufacturer’s protocol. For each target
mRNA, 0.25 ll cDNA was amplified in a 25 ll SYBR Green PCR reaction containing 1 Quantitect SYBR Green Master Mix (Qiagen)
and 100 nm of each primer (Table 1). The amplification was monitored real-time using the MX3000P real-time PCR machine
(Stratagene, CA, USA). The threshold cycle (Ct) values were related
to a standard curve made with the cloned PCR products and
Author's personal copy
136
C. Suetta et al. / Growth Hormone & IGF Research 20 (2010) 134–140
mally distributed. To evaluate the effect of intervention over time
a Friedman test was used with post hoc Wilcoxon test. Any between group differences were analyzed with Kruskall–Wallis tests
and subsequent Mann–Whitney U test. Data are presented as mean
values ± SEM. A p-value of less than 0.05 was considered
significant.
Table 1
Primers for real-time RT-PCR.
mRNA
Sense primer
Anti-sense primer
IGF-IEa
MGF
RPLP0
GAPDH
GACATGCCCAAGACCCAGAAGGA
GCCCCCATCTACCAACAAGAACAC
GGAAACTCTGCATTCTCGCTTCCT
CCTCCTGCACCACCAACTGCTT
CGGTGGCATGTCACTCTTCACTC
CGGTGGCATGTCACTCTTCACTC
CCAGGACTCGTTTGTACCCGTTG
GAGGGGCCATCCACAGTCTTCT
IGF-IEa, insulin-like growth factor-I isoform Ea; MGF, mechano-growth-factor.
RPLP0, large ribosomal protein P0; GAPDH.
3. Results
3.1. Normalization of mRNA data
specificity ensured by melting curves analysis. The quantities were
normalized to the RPLP0 mRNA [27]. To test the stability of the
‘‘housekeeping” gene (RPLP0), another ‘‘housekeeping” gene GAPDH was measured and normalized to RPLP0 (Fig. 1). Data are presented in absolute levels normalized to RPLP0 (Figs. 2 and 3) as
well as in fold changes relative to the CO-side (Figs. 4 and 5).
To validate the use of RPLP0 as internal reference for the mRNA,
data were normalized to GADPH, which proved to be constitutively
expressed. There were no difference in GADPH resting levels between the three groups and there were no changes with any of
the interventions (Fig. 1).
2.5. Statistics
3.2. IGF-IEa
All data from the mRNA analyses were log-transformed before
statistical analyses and are presented as geometric means ± backtransformed SEM. A two-way ANOVA on intervention time was
performed using SAS procedure mixed with autoregressive modeling. Non-parametric statistics were used for the analyses of
changes in muscle fiber CSA, since not all of these data were nor-
At baseline, there was no difference in the resting levels of IGFIEa between the three groups or between the two sides (CO vs. OP)
expressed in absolute values (Fig. 2) or when OP was expressed relative to CO (Fig. 3). RT resulted in a significant increase in absolute
levels of IGF-IEa after 5 and 12 weeks (Fig. 2) and relative to the
CO-side after 12 weeks (Fig. 3). In contrast, 12 weeks of ES and
GADPH mRNA/RPLP0 mRNA
10.0
FE
ES
1.0
0.1
RT
+2d
+5w
+12w
IGF-IEa mRNA/ RPLP0 mRNA
Fig. 1. GAPDH mRNA expression was normalized to RPLP0 mRNA expression to validate the use of RPLP0 as internal reference for the mRNA. There were no difference in
GADPH resting levels between the three groups and there were no changes with any of the interventions.
10.0
FE - CON
#
∗
∗
ES - CON
ES - OP
RT - CO
RT - OP
1.0
0.1
FE - OP
+2d
+5w
+12w
Fig. 2. Insulin-like growth factor-I isoform Ea (IGF-IEa) mRNA normalized to RPLP0 mRNA and presented in absolute values. At baseline, there was no difference in the resting
levels of IGF-IEa between the three interventions (functional exercises, FE; electrical simulation, ES; and resistance training, RT) or between the two sides (CO vs. OP). RT
resulted in a significant increase in IGF-IEa after 5 weeks (5w) and 12 weeks (12w). * denotes significantly different from baseline, # denotes RT-OP significantly different
from FE-OP.
Author's personal copy
137
C. Suetta et al. / Growth Hormone & IGF Research 20 (2010) 134–140
IGF-IEa mRNA/RPLP0 mRNA
10.0
*
#
FE
ES
1.0
RT
0.1
+2d
+5w
+12w
MGF mRNA/ RPLP0 mRNA
Fig. 3. Insulin-like growth factor-I isoform Ea mRNA expression normalized to RPLP0 mRNA expression and presented as fold changes relative to the non-operated controlside (CO). The expression of MGF mRNA after 12 weeks of RT was significantly increased compared to FE and ES (p < 0.05). * denotes significantly different from baseline, #
denotes RT significantly different from FE.
10.0
#
FE - CON
∗
FE - OP
ES - CON
ES - OP
RT - CO
1.0
0.1
RT - OP
+2d
+5w
+12w
Fig. 4. Mechano growth factor (MGF) mRNA expression normalized to RPLP0 mRNA expression and presented in absolute values. At baseline, there was no difference in the
resting levels of IGF-IEa between the three interventions (functional exercises, FE; electrical simulation, ES; and resistance training, RT) or between the two sides (CO vs. OP).
RT resulted in a significant increase in IGF-IEa after 12 weeks (12w). * denotes significantly different from baseline, # denotes RT significantly different from FE.
MGF mRNA/ RPLP0 mRNA
10.0
#
$
¤
FE
ES
1.0
* *
0.1
+2d
+5w
RT
*
+12w
Fig. 5. Mechano growth factor (MGF) mRNA normalized to RPLP0 mRNA and presented as fold changes relative to the non-operated control-side (CON). At baseline there was
a significant up-regulation of MGF mRNA levels in all three groups (functional exercises, FE; electrical simulation, ES; and resistance training, RT) relative to the non-operated
control-side CO. At 5 weeks (5w) and 12 weeks (12w) there was a significant down-regulation of MGF mRNA levels with ES and FE. MGF mRNA levels did not decrease with
RT, and the expression of MGF mRNA after 12 weeks of RT was significantly increased compared to FE and ES (p < 0.05). * denotes significantly different from baseline, #
denotes RT significantly different from ES, $ denotes OP-leg significantly different from CON-leg.
denotes RT significantly different from FE,
FE did not induce any change in the expression of IGF-IEa mRNA
levels (Figs. 2 and 3).
3.3. Mgf
The regulation pattern for MGF mRNA was somewhat different
from that of IGF-IEa. At baseline (day 2 post-operative) there was
no difference between the three intervention groups or the two
sides (Figs. 4 and 5). However, after 5 and 12 weeks there
was a significant down-regulation of MGF mRNA levels with ES
and FE (Fig. 5). In contrast, MGF mRNA levels did not decrease with
RT, and the expression of MGF mRNA after 12 weeks of RT was
significantly increased compared to FE and ES (p < 0.05, Figs. 4
and 5).
Author's personal copy
138
C. Suetta et al. / Growth Hormone & IGF Research 20 (2010) 134–140
used as an analog to resistance training [38,39], the stimulation
intensity is, however, not comparable to the intensity that can be
logistically applied to humans, which might explain the sparse effects on muscle fiber CSA and IGF-I expression with this method in
the present study.
It is known that IGF-I has an anabolic action and increases rates
of protein synthesis in muscle [40]. In human exercise studies, the
expression of IGF-I mRNA has been found to increase after a single
bout of resistance exercise [15,16], but not in all studies [16,18].
After prolonged periods of resistance training the results have been
more consistent demonstrating an increase for IGF-I at both the
mRNA level [19,27,41] and the protein level [20]. However, the
activation of satellite cells is also required for hypertrophied fibers
to maintain their DNA to protein ratios [42] and it seems that MGF
may play a role in the activation of satellite cells [11], thus the two
isoforms act in tandem to promote muscle growth and repair.
Being involved in muscle repair it therefore does not seem surprising that MGF mRNA levels in all three groups are elevated compared to the non-operated-side 48 h post-surgery. However, in
contrast to ES and FE MGF mRNA expression levels do not decrease
in the RT group, which could support the hypothesis that MGF is
involved in both muscle repair (baseline) and hypertrophy (5 and
12 weeks).
Furthermore, the suggestion that the two isoforms are regulated differently, with IGF-IEa being GH responsive and MGF
appearing relatively insensitive to GH would make sense as these
isoforms have been reported to play different roles for the satellite
cells [11]. In the present study, absolute levels of IGF-IEa mRNA
were low in all three groups with no side-to-side difference at
baseline (Fig. 3) and interestingly, there was only observed an increase in the OP-leg that performed RT at 5 and 12 weeks. This
finding was in contrast to FE and ES as well as the control legs in
all three groups (Figs. 2 and 3). In line with these results, absolute
levels of MGF mRNA were also significantly higher with RT at
12 weeks, which was not observed with FE and ES (Fig. 5).
Further, changes in MGF mRNA expressed as fold changes relative to baseline (CON) demonstrated an up-regulation at baseline
(48 h post-operative) in all three groups, which in contrast to FE
and ES remained up-regulated with RT. The up-regulation of
MGF mRNA 48 h after surgery in all three groups supports the
hypothesis that MGF is involved in muscle repair and in the initiating phase of muscle hypertrophy by kick-starting the satellite
cells to proliferate [11,13,14]. In contrast to the expression level
of MGF there was no increase in the IGF-IEa mRNA expression level
at baseline, however, after 5 and 12 weeks of resistance exercise
there was a marked increase in the expression of IGF-IEa mRNA,
supporting the idea that the IGF-IEa splice variant seems to be
more involved in the later phase of muscle hypertrophy by
3.4. Muscle fiber cross sectional area
There was no difference in muscle fiber cross sectional area between the three intervention groups at baseline (Table 2). However, after 12 weeks of RT there was a significant increase in the
cross sectional area of type 1 muscle fibers (+17%, p < 0.05) and
type 2 fibers (+17%, p < 0.05). In contrast, there was no change in
FE or ES after 12 weeks (Table 2). Further, there was a significantly
difference between RT and FE in the relative changes in both fiber
types after 12 weeks of intervention (p < 0.05).
4. Discussion
The present study is, to our knowledge, the first to obtain simultaneous measurements of muscle fiber size and the mRNA expression of the IGF-I splice variants IGF-IEa and MGF in order to address
the IGF-I and muscle fiber morphology coupling with different
training modalities (resistance training (RT), electrical stimulation
(ES), or functional exercises (FE)) in elderly individuals recovering
from surgery. The main findings were that prolonged resistance
training after surgery led to a substantial hypertrophy in both
types 1 and 2 muscle fibers (Table 2) and that these adaptations
were accompanied by gains in mRNA expression of the IGF-I splice
variants IGF-IEa and MGF, supporting the idea that IGF-I is playing
an important role in regulating muscle hypertrophy in elderly humans. Notably, in contrast to RT, no changes occurred in these
parameters following the most commonly employed types of training to elderly patients, i.e. a standard rehabilitation program based
on functional exercises (FE) or neuromuscular electrical stimulation (ES).
Although, there is a potential impairment in growth factors
with aging, resistive types of exercise has emerged as an effective
method to induce muscle hypertrophy and increase muscle
strength and functional performance in frail elderly [28,29] as well
as in patients with chronic diseases [30–32]. Furthermore, it has
been demonstrated that resistance training is an effective method
to restore muscle function in elderly post-operative patients
[21,23,33,34]. However, the most commonly used rehabilitation
regimes for elderly individuals are still based on functional types
of exercises without external loading, although it has been demonstrated that this type of quite moderate intervention cannot prevent further muscle atrophy [21,35] or fully restore muscle
strength and functional performance in elderly post-operative patients [36,37]. These results are further supported by data from the
present study demonstrating that 12 weeks of rehabilitation based
on functional exercises, in contrast to resistance exercises, do not
lead to an increase in myofiber CSA or in the expression of IGF-I
mRNA. In animal studies, electrical muscle stimulation is often
Table 2
Changes in mean muscle fiber area of fiber type 1 and fiber type 2 with three types of training intervention in elderly post-operative patients.
FE
ES
RT
OP
CO
OP
CO
OP
CO
pre
5w
12w
4221 ± 610
3613 ± 354
4099 ± 438
4846 ± 501
4294 ± 432
4207 ± 334
3688 ± 575
3210 ± 155
3577 ± 199
3944 ± 586
3747 ± 320
4163 ± 369
3464 ± 244
4146 ± 291*
4048 ± 409*
3956 ± 246
3928 ± 326
4008 ± 327
pre
5w
12w
3505 ± 654
3054 ± 546
3315 ± 612
3424 ± 612
3684 ± 470
3891 ± 443
2784 ± 538
2352 ± 347
2655 ± 364
3491 ± 590
3146 ± 457
3179 ± 463
2672 ± 357
3054 ± 328
4026 ± 646*§
3270 ± 407
3318 ± 473
3270 ± 496
Type 1 (lm2)
Type 2 (lm2)
Measurements of single muscle fiber area from all three intervention groups, functional exercises (FE), electrical muscle stimulation (ES) and resistance training (RT). Data are
presented from both sides, the operated-side (OP) and the control-side (CON) from at baseline (pre), at 5 weeks after the operation (5w) and 12 weeks after the operation
(12w). Data are presented as means ± SEM, * p < 0.05 significantly different from baseline. § p < 0.05 refers to intergroup differences, RT being significantly different from FE
and ES.
Author's personal copy
C. Suetta et al. / Growth Hormone & IGF Research 20 (2010) 134–140
stimulating myoblast fusion and myofiber hypertrophy [11,13,14].
However, despite the corresponding increase in IGF-I splice variants expression levels and muscle fiber hypertrophy in the present
study, we were not able to detect any individual correlation between these factors. This finding could reflect that other signals
are at play in the complex regulation of muscle protein synthesis
and/or as a consequence of the fairly small sample size in the present study.
As both frail older people and elderly recovering from surgery
retain their ability to muscle hypertrophy after a period of resistance exercise, indicates that the triggering mechanisms for muscle
hypertrophy are maintained in these individuals. However, it has
also been demonstrated in different animal models that the hypertrophy response is attenuated in the muscles of old animals compared to that of young [4,5]. Notably, although the response may
be attenuated in old human muscle as well as in old muscles of
various animals, it seems important that older muscles after surgery and immobilization are still capable of up-regulating the
expression of both IGF-IEa and MGF mRNAs in response to a period
of prolonged resistance training. However, it has to be emphasized
that the present data are only supporting, but clearly not any definitive proof for the idea, that IGF-I is playing an important role in
regulating muscle hypertrophy in elderly humans.
In summary, this study demonstrates that elderly individuals
are able to up-regulate the expression of IGF-I mRNA splice variants as a result of a prolonged period of resistance overload, in contrast to functional types of exercise or electrical muscle
stimulation. Further, data support the hypothesis that MGF and
IGF-IEa mRNA expression isoforms are associated with increased
mechanical activity as provided by high-resistance exercises.
Acknowledgements
We greatly acknowledge the patients who volunteered to participate in this study. The study was supported by grants from
the Danish Medical Research Council, The Nordea Foundation,
IMK Foundation, The Danish Rheumatism Association and the
Maersk McKinney Moller Foundation.
References
[1] H.J. Appell, Skeletal muscle atrophy during immobilization, Int J Sports Med 7
(1) (1986) 1–5.
[2] A.A. Vandervoort, Aging of the human neuromuscular system, Muscle Nerve 25
(1) (2002) 17–25.
[3] A.A. Hill, L.D. Plank, P.J. Finn, G.A. Whalley, N. Sharpe, M.A. Clark, et al., Massive
nitrogen loss in critical surgical illness: effect on cardiac mass and function,
Ann Surg 226 (2) (1997) 191–197.
[4] P.M. Siu, S.E. Alway, Aging alters the reduction of pro-apoptotic signaling in
response to loading-induced hypertrophy, Exp Gerontol 41 (2) (2006) 175–
188.
[5] H. Degens, S.E. Alway, Skeletal muscle function and hypertrophy are
diminished in old age, Muscle Nerve 27 (3) (2003) 339–347.
[6] G. Goldspink, S.D. Harridge, Growth factors and muscle ageing, Exp Gerontol
39 (10) (2004) 1433–1438.
[7] S.D. Harridge, Plasticity of human skeletal muscle: gene expression to in vivo
function, Exp Physiol 92 (5) (2007) 783–797.
[8] J.R. Florini, D.Z. Ewton, S.A. Coolican, Growth hormone and the insulin-like
growth factor system in myogenesis, Endocr Rev 17 (5) (1996) 481–517.
[9] M. Hameed, S.D. Harridge, G. Goldspink, Sarcopenia and hypertrophy: a role for
insulin-like growth factor-I in aged muscle?, Exerc Sport Sci Rev 30 (1) (2002)
15–19
[10] G. Mckoy, W. Ashley, J. Mander, S.Y. Yang, N. Williams, B. Russell, et al.,
Expression of insulin growth factor-I splice variants and structural genes in
rabbit skeletal muscle induced by stretch and stimulation, J Physiol 516 (Pt 2)
(1999) 583–592.
[11] S.Y. Yang, G. Goldspink, Different roles of the IGF-I Ec peptide (MGF) and
mature IGF-I in myoblast proliferation and differentiation, FEBS Lett 522 (1–3)
(2002) 156–160.
[12] E.R. Barton-Davis, D.I. Shoturma, A. Musaro, N. Rosenthal, H.L. Sweeney, Viral
mediated expression of insulin-like growth factor I blocks the aging-related
loss of skeletal muscle function, Proc Natl Acad Sci USA 95 (26) (1998) 15603–
15607.
139
[13] G.R. Adams, Role of insulin-like growth factor-I in the regulation of skeletal
muscle adaptation to increased loading, Exerc Sport Sci Rev 26 (1998) 31–60.
[14] G. Goldspink, S.Y. Yang, The splicing of the IGF-I gene to yield different muscle
growth factors, Adv Genet 52 (2004) 23–49.
[15] M.M. Bamman, J.R. Shipp, J. Jiang, B.A. Gower, G.R. Hunter, A. Goodman, et al.,
Mechanical load increases muscle IGF-I and androgen receptor mRNA
concentrations in humans, Am J Physiol Endocrinol Metab 280 (3) (2001)
E383–E390.
[16] M. Hameed, R.W. Orrell, M. Cobbold, G. Goldspink, S.D. Harridge, Expression of
IGF-I splice variants in young and old human skeletal muscle after high
resistance exercise, J Physiol 547 (Pt 1) (2003) 247–254.
[17] J.S. Kim, D.J. Kosek, J.K. Petrella, J.M. Cross, M.M. Bamman, Resting and loadinduced levels of myogenic gene transcripts differ between older adults with
demonstrable sarcopenia and young men and women, J Appl Physiol 99 (6)
(2005) 2149–2158.
[18] N. Psilander, R. Damsgaard, H. Pilegaard, Resistance exercise alters MRF and
IGF-I mRNA content in human skeletal muscle, J Appl Physiol 95 (3) (2003)
1038–1044.
[19] M. Hameed, K.H. Lange, J.L. Andersen, P. Schjerling, M. Kjaer, S.D. Harridge,
et al., The effect of recombinant human growth hormone and resistance
training on IGF-I mRNA expression in the muscles of elderly men, J Physiol 555
(Pt 1) (2004) 231–240.
[20] M.A. Singh, W. Ding, T.J. Manfredi, G.S. Solares, E.F. O’Neill, K.M. Clements,
et al., Insulin-like growth factor I in skeletal muscle after weight-lifting
exercise in frail elders, Am J Physiol 277 (1 Pt 1) (1999) E135–E143.
[21] C. Suetta, S.P. Magnusson, A. Rosted, P. Aagaard, A.K. Jakobsen, L.H. Larsen,
et al., Resistance training in the early postoperative phase reduces
hospitalization and leads to muscle hypertrophy in elderly hip surgery
patients – a controlled, randomized study, J Am Geriatr Soc 52 (12) (2004)
2016–2022.
[22] C. Suetta, J.L. Andersen, U. Dalgas, J. Berget, S.O. Koskinen, P. Aagaard, et al.,
Resistance training induces qualitative changes in muscle morphology, muscle
architecture and muscle function in elderly postoperative patients, J Appl
Physiol (2008).
[23] C. Suetta, P. Aagaard, A. Rosted, A.K. Jakobsen, B. Duus, M. Kjaer, et al.,
Training-induced changes in muscle CSA, muscle strength, EMG, and rate of
force development in elderly subjects after long-term unilateral disuse, J Appl
Physiol 97 (5) (2004) 1954–1961.
[24] J. Bergström, Muscle electrolytes in man, Scand J Clin Lab Invest 68 (Suppl)
(1962) 1–110.
[25] M.H. Brooke, K.K. Kaiser, Muscle fiber types: how many and what kind?, Arch
Neurol 23 (1970) 369–379
[26] F. Kadi, P. Schjerling, L.L. Andersen, N. Charifi, J.L. Madsen, L.R. Christensen,
et al., The effects of heavy resistance training and detraining on satellite cells
in human skeletal muscles, J Physiol 558 (Pt 3) (2004) 1005–1012.
[27] T. Kvorning, M. Andersen, K. Brixen, P. Schjerling, C. Suetta, K. Madsen,
Suppression of testosterone does not blunt mRNA expression of myoD,
myogenin, IGF, myostatin or androgen receptor post strength training in
humans, J Physiol 578 (Pt 2) (2007) 579–593.
[28] M.A. Fiatarone, E.C. Marks, N.D. Ryan, C.N. Meredith, L.A. Lipsitz, W.J. Evans,
High-intensity strength training in nonagenarians. Effects on skeletal muscle,
JAMA 263 (22) (1990) 3029–3034.
[29] S.D.R. Harridge, A. Kryger, A. Stensgaard, The effects of strength training on
muscle size and force production in elderly people aged 85–97 years, J PhysiolLondon 509P (1998) 42P–43P.
[30] D.W. Dunstan, R.M. Daly, N. Owen, D. Jolley, M. de Court, J. Shaw, et al., Highintensity resistance training improves glycemic control in older patients with
type 2 diabetes, Diabetes Care 25 (10) (2002) 1729–1736.
[31] M. Kongsgaard, V. Backer, K. Jorgensen, M. Kjaer, N. Beyer, Heavy resistance
training increases muscle size, strength and physical function in elderly male
COPD-patients – a pilot study, Respir Med 98 (10) (2004) 1000–1007.
[32] K.L. Johansen, Exercise and chronic kidney disease: current recommendations,
Sports Med 35 (6) (2005) 485–499.
[33] S.L. Mitchell, D.J. Stott, B.J. Martin, S.J. Grant, Randomized controlled trial of
quadriceps training after proximal femoral fracture, Clin Rehabil 15 (3) (2001)
282–290.
[34] K. Hauer, N. Specht, M. Schuler, P. Bartsch, P. Oster, Intensive physical training
in geriatric patients after severe falls and hip surgery, Age and Ageing 31 (1)
(2002) 49–57.
[35] K. Reardon, M. Galea, X. Dennett, P. Choong, E. Byrne, Quadriceps muscle
wasting persists 5 months after total hip arthroplasty for osteoarthritis of the
hip: a pilot study, Int Med J 31 (1) (2001) 7–14.
[36] L. Sicard-Rosenbaum, K.E. Light, A.L. Behrman, Gait, lower extremity strength,
and self-assessed mobility after hip arthroplasty, J Gerontol Series A – Biol Sci
Med Sci 57 (1) (2002) M47–M51.
[37] C.H. Shih, Y.K. Du, Y.H. Lin, C.C. Wu, Muscular recovery around the hip joint
after total hip arthroplasty, Clin Orthop (302) (1994) 115–120.
[38] K.M. Heinemeier, J.L. Olesen, F. Haddad, H. Langberg, M. Kjaer, K.M. Baldwin,
et al., Expression of collagen and related growth factors in rat tendon and
skeletal muscle in response to specific contraction types, J Physiol 582 (Pt 3)
(2007) 1303–1316.
[39] F. Haddad, G.R. Adams, Selected contribution: acute cellular and
molecular responses to resistance exercise, J Appl Physiol 93 (1) (2002) 394–
403.
[40] G.R. Adams, S.A. McCue, Localized infusion of IGF-I results in skeletal muscle
hypertrophy in rats, J Appl Physiol 84 (5) (1998) 1716–1722.
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Muscle size, neuromuscular activation, and rapid force
characteristics in elderly men and women: effects of
unilateral long-term disuse due to hip-osteoarthritis
C. Suetta, P. Aagaard, S. P. Magnusson, L. L. Andersen, S. Sipilä, A. Rosted, A. K.
Jakobsen, B. Duus and M. Kjaer
J Appl Physiol 102:942-948, 2007. First published Nov 22, 2006; doi:10.1152/japplphysiol.00067.2006
You might find this additional information useful...
This article cites 41 articles, 23 of which you can access free at:
http://jap.physiology.org/cgi/content/full/102/3/942#BIBL
Updated information and services including high-resolution figures, can be found at:
http://jap.physiology.org/cgi/content/full/102/3/942
Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl
Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society.
ISSN: 8750-7587, ESSN: 1522-1601. Visit our website at http://www.the-aps.org/.
Downloaded from jap.physiology.org on April 11, 2007
This information is current as of April 11, 2007 .
J Appl Physiol 102: 942–948, 2007.
First published November 22, 2006; doi:10.1152/japplphysiol.00067.2006.
Muscle size, neuromuscular activation, and rapid force characteristics in
elderly men and women: effects of unilateral long-term disuse due
to hip-osteoarthritis
C. Suetta,1 P. Aagaard,1,2 S. P. Magnusson,1 L. L. Andersen,3
S. Sipilä,4 A. Rosted,5 A. K. Jakobsen,1 B. Duus,6 and M. Kjaer1
1
Institute of Sports Medicine, Bispebjerg Hospital, University of Copenhagen, 2Institute of Sports Science and Clinical
Biomechanics, University of Southern Denmark, and 3National Institute of Occupational Health, Copenhagen,
Denmark; 4Department of Health Sciences, University of Jyväskylä, Jyväskylä, Finland; and Departments of
5
Radiology and 6Orthopedics, Bispebjerg Hospital, University of Copenhagen, Copenhagen, Denmark
Submitted 19 January 2006; accepted in final form 10 November 2006
IT IS WELL KNOWN FROM ANIMAL and human studies that a chronic
reduction in neuromuscular activity results in marked muscle
atrophy (4, 28), reduced muscle strength (2, 33), and diminished neural drive to muscle fibers (9). For people older than 45
yr of age, 33% suffer from joint pain, and osteoarthritis (OA)
has been shown to be the most common cause of inactivity and
long-term disability in people aged 65 yr (12). However,
most of the current knowledge with respect to the effects of
inactivity and immobilization on neuromuscular function is
based on animal data (2, 8) or on studies performed on healthy
young individuals (4, 28). This is contrasted by the fact that the
elderly population more often undergoes periods of immobilization and disuse, not only due to joint pain, but also due to a
higher degree of comorbidity and hospitalization (32). Studies
in healthy young adults have demonstrated that immobilization
leads to rapid decreases in maximal muscle strength, muscle
mass, and neural activation (4, 19); however, recent studies
indicate that skeletal muscle in aged animals and humans is
more vulnerable to muscle unloading than that in young individuals (8, 41). Furthermore, recent data from Yasuda et al.
(43) show that there might be a gender-specific response to
unloading, as evidenced by a more pronounced decrease in
specific strength in young women compared with young men
after 14 days of unilateral limb immobilization. Yet the lack of
investigations into the effect of unloading or disuse in elderly
humans makes it difficult to distinguish the extent with which
reductions in muscle mass or reduced physical activity level
are responsible for the observed decrease in muscle force
production with aging.
With increasing age, human skeletal muscle morphology
and function decay, which is dramatically evident by the sixth
decade and onward (20, 27). This deterioration is known to be
caused to a great extent by morphological changes, like decreased muscle mass, both due to a loss of muscle fibers and a
decrease in the individual muscle fiber size (29). However,
studies comparing groups of young and old human subjects
indicate that the loss in muscle force cannot be entirely explained by these quantitative changes (35, 42). Accordingly, it
has been suggested that the loss of muscle strength in aging
may exceed that of the morphological changes, resulting in a
decreased muscle quality in the elderly (7, 42), although it has
not been a universal finding (17). In addition, aging is also
associated with neurological changes, which affects maximum
voluntary force production (34), as well as the capacity for
rapid muscle force production; i.e., contractile rate of force
development (RFD) (42). The ability to develop force rapidly
(i.e., RFD) seems to be an important muscle mechanical
performance parameter in aging subjects in several tasks of
Address for reprint requests and other correspondence: C. Suetta, Institute of
Sports Medicine, Copenhagen, Bispebjerg Hospital, Bispebjerg Bakke 23,
2400 NV Copenhagen, Denmark (e-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
aging; rate of force development; neural activity; muscle activation
942
8750-7587/07 $8.00 Copyright © 2007 the American Physiological Society
http://www. jap.org
Downloaded from jap.physiology.org on April 11, 2007
Suetta C, Aagaard P, Magnusson SP, Andersen LL, Sipilä S,
Rosted A, Jakobsen AK, Duus B, Kjaer M. Muscle size, neuromuscular activation, and rapid force characteristics in elderly men and
women: effects of unilateral long-term disuse due to hip-osteoarthritis.
J Appl Physiol 102: 942–948, 2007. First published November 22,
2006; doi:10.1152/japplphysiol.00067.2006.—Substantial evidence
exists for the age-related decline in muscle strength and neural
function, but the effect of long-term disuse in the elderly is largely
unexplored. The present study examined the effect of unilateral
long-term limb disuse on maximal voluntary quadriceps contraction
(MVC), lean quadriceps muscle cross-sectional area (LCSA), contractile rate of force development (RFD, force/time), impulse (force
dt), muscle activation deficit (interpolated twitch technique), maximal
neuromuscular activity [electromyogram (EMG)], and antagonist
muscle coactivation in elderly men (M: 60 – 86 yr; n 19) and
women (W: 60 – 86 yr; n 20) with unilateral chronic hip-osteoarthritis. Both sides were examined to compare the effect of long-term
decreased activity on the affected (AF) leg with the unaffected (UN)
side. AF had a significant lower MVC (W: 20%; M: 20%), LCSA (W:
8%; M: 10%), contractile RFD (W: 17–26%; M: 15–24%), impulse
(W: 10 –19%, M: 19 –20%), maximal EMG amplitude (W: 22–25%,
M: 22–28%), and an increased muscle activation deficit (18%)
compared with UN. Furthermore, women were less strong (AF: 40%;
UN: 39%), had less muscle mass (AF: 33%; UN: 34%), and had a
lower RFD (AF: 38 –50%; UN: 41– 48%) compared with men. Similarly, maximum EMG amplitude was smaller for both agonists (AF:
51– 63%; UN: 35– 61%) and antagonist (AF: 49 – 64%; UN: 36 –56%)
muscles in women compared with men. However, when MVC and
RFD were normalized to LCSA, there were no differences between
genders. The present data demonstrate that disuse leads to a marked
loss of muscle strength and muscle mass in elderly individuals.
Furthermore, the data indicate that neuromuscular activation and
contractile RFD are more affected by long-term disuse than maximal
muscle strength, which may increase the future risk for falls.
DISUSE AND CHANGES IN RFD IN THE ELDERLY
METHODS
Subjects. Thirty-nine elderly individuals, 20 women (W; age range
60 – 86 yr) and 19 men (M; age range 60 –79 yr), volunteered to
participate in the study. Eligibility criteria included age 60 yr and
primary unilateral hip-OA clinical and radiological, verified according
to Kellgren and Lawrence grade 2 (36). All subjects had symptoms
lasting 1 yr and were scheduled for primary unilateral hip-replacement surgery at Bispebjerg University Hospital, Copenhagen, Denmark. A careful physical examination was obtained by a physician to
exclude subjects with cardiopulmonary, neurological, or cognitive
problems. All subjects ambulated with a walking aid; however, lower
limb problems other than hip-OA and/or pain during testing, as
measured on a visual analog scale (VAS, 0 –10), was considered an
exclusion criteria (VAS 3). The study was approved by the ethics
committee of Copenhagen and Frederiksberg, in accordance with the
Helsinki declaration, and written, informed consent was obtained
from all participants.
Maximal isometric muscle strength and RFD. Maximal muscle
strength was measured as the maximum voluntary isometric knee
extension torque [maximum voluntary contraction (MVC)] exerted in
an isokinetic dynamometer (KinCom; Kinetic Communicator, Chattecx, Chattanooga, TN), according to procedures described in detail
elsewhere (39). Individual setting of the seat, backrest, dynamometer
head, and lever arm length was registered, so identical subject positioning was ensured throughout the study. All torque values were
corrected for the effect of gravity (1). Subjects were carefully instructed to contract as fast and hard as possible. Visual feedback was
provided to the subjects as real-time display of the dynamometer force
output on a computer screen (22). After a standardized warm-up,
including dynamic and submaximal isometric contractions, subjects
performed three maximal isometric knee extensions of 3-s duration,
J Appl Physiol • VOL
each separated by a 45-s pause, and after 3-min rest three maximal
isometric knee flexions were performed in a similar manner. All
MVCs were performed at a knee joint angle of 60° (0° full knee
extension). The trial with the highest maximal knee joint torque for
each direction was selected for further analyses (1, 39). All measurements were performed for both legs separately and were preceded by
a familiarization session (2– 4 days before test 1). On all test occasions, UN was tested first to minimize subjects’ discomfort with the
procedure. Contractile RFD was defined as the average slope of the
torque-time curve in the initial contraction phase (force/time) at
0 –30, 0 –50, 0 –100, and 0 –200 ms relative to the onset of
contraction (1, 39). Onset of contraction was defined as the instant
where torque increased 3.5 Nm above the resting baseline level
(corresponding to 2% of the peak torque). Contractile impulse was
determined as the area under the torque-time curve (torque dt) in the
same time intervals (1). Normalized RFD was calculated as RFD
divided by CSA.
Estimation of muscle activation. To evaluate the ability to activate
the quadriceps muscle of AF as well as the UN, an electrically evoked
muscle twitch was superimposed onto a maximal voluntary muscle
contraction. The subjects were seated in an upright position with the
thigh placed horizontally and knee flexed at a right angle. A steel cuff
was strapped around the lower leg, 1 in. above the malleoli. The cuff
was connected via a rigid steel bar to a strain-gauge load cell (Bofors
KRG-4, Bofors), which was connected to a preamplifier (BK15,
Nobel Elektronik) and an amplifier (Gould 5900, Gould, Valley View,
OH). The strain-gauge force signal was sampled at 1,000 Hz. Each
test procedure began with the determination of the maximal twitch
response. For evoking twitch responses from the knee extensors,
percutaneous surface stimulation electrodes (Bioflex, model PE3590)
were placed over the distal and proximal muscle belly of the quadriceps femoris. Contractions were evoked using single square-wave
pulses of 0.1-ms duration delivered by a direct current stimulator
(Digitimer Electronics, model DS7). Before the MVC, a maximal
baseline twitch (Pt) was defined where a stepwise increment in current
delivered every 30 s resulted in no further increases in force. Following a short rest, three voluntary contractions (with 2-min rest between
each contraction) were performed with the addition of supramaximal
single pulses. The subject was asked to push as hard and fast as
possible and maintain the contraction for 3–5 s. The force recording
of each contraction was viewed on a computer screen in real time,
which enabled stimuli to be triggered manually on top of a MVC. The
height of the superimposed twitch during this peak portion was
measured, and an estimate of muscle activation was then calculated as
follows: activation (%) [1 (Pts/Pt)] 100, where Pts is the force
from the superimposed twitch, and Pt is the force from the resting
twitch.
Electromyogram recordings. After careful preparation of the skin
by shaving and cleaning with alcohol, pairs of surface electrodes
(Medicotest Q-10-A, 20-mm interelectrode distance) were placed over
the belly of vastus lateralis (VL), vastus medialis (VM), rectus
femoris (RF), biceps femoris (BF), and semitendinosus (ST). The
electromyogram (EMG) electrodes were connected directly to small
custom-built preamplifiers, and the EMG signals were led through
shielded wires to custom-built amplifiers with a frequency response of
10 –10,000 Hz and common mode rejection ratio exceeding 100 dB
(1). EMG and dynamometer strain-gauge signals were synchronously
sampled at a 1,000-Hz analog-to-digital conversion rate using an
external analog-to-digital converter (dt 2801-A, Data Translation,
Marlboro, MA). Subsequently, during later offline analysis, EMG
signals were digitally high-pass filtered with a fourth-order, zero-lag
Butterworth filter with a 5-Hz cut-off frequency, followed by a
moving symmetric root-mean-square filter with a time constant of 50
ms (1). Maximum EMG amplitude of the root-mean-square-filtered
signal was identified within the entire contraction phase, which
included a 70-ms time period prior (1, 39). The magnitude of antagonist muscle cocontraction was calculated by dividing maximal an-
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
daily life, such as walking and attempting to avoid falls (13,
39). At the same time, reduced muscle strength in older people,
for example after a period of immobilization or disuse, may be
associated with muscle atrophy (6), a lowered ability to produce force rapidly, and thereby an increased risk of falling
(13).
Reduced contractile RFD has been demonstrated in elderly
compared with young individuals of both genders (5, 42).
However, to what extent reductions in muscle mass or size,
suppression in voluntary muscle activation, elevated coactivation of antagonist muscles, or a general reduction in the
physical activity level is responsible for the decrease in muscle
strength in the elderly remains unclear. It, therefore, appears of
paramount importance to gain a better understanding of how
prolonged disuse affects mechanical muscle characteristics and
neuromuscular activation in the elderly and, furthermore, try to
ascertain what effects can be attributed to activity level and the
aging process, respectively. In the present study, individuals
who suffered from diagnosed hip OA, with symptoms lasting
1 yr, were studied. The fact that OA was unilateral allowed
for a comparison between the affected (AF) lower limb and the
contralateral unaffected (UN) side.
The aim of the present study was to investigate the side-toside difference in maximal muscle strength, muscle size, rapid
force characteristics, and neuromuscular activation in elderly
individuals with long-term unilateral OA. It was hypothesized
that maximal muscle strength and muscle mass would be
reduced on the AF side compared with the UN side, and
furthermore that rapid force characteristics and neuromuscular
activation parameters would be affected by the chronic disuse
to a greater extent than muscle mass and strength.
943
944
DISUSE AND CHANGES IN RFD IN THE ELDERLY
RESULTS
Subjects. Men and women were similar in age (M: 69 1
yr, W: 70 1 yr) and body mass index (M: 29 1 kg/m2 vs.
W: 27 1 kg/m2), and men were significant taller (M: 173 2 cm, W: 163 1 cm) and had a greater body mass than
women (M: 85.8 3.6 kg, W: 71.5 3.6 kg).
Quadriceps muscle composition. Total quadriceps muscle
CSA (TCSA), quadriceps muscle LCSA, and mean HU were
significant smaller on AF compared with UN, both for men
(TCSA: 7.5%, LCSA: 9.5%, HU: 7.0%) and women
(TCSA: 6.0%, LCSA: 7.9%, HU: 8.7%) (Table 1). Furthermore, women showed lower CSA compared with men,
both in AF (TCSA: 32.0%, LCSA: 33.3%) and UN
(TCSA: 33.0%, LCSA: 34.1%). However, there was no
gender difference with respect to muscle density expressed in
HU on either of the two sides (Table 1).
Maximal isometric strength. Maximal voluntary muscle
strength was lower on AF compared with UN in both men (AF:
149.6 8.8 Nm, UN: 186.5 9.1 N m, reduced 19.8%) and
women (AF: 90.6 4.8 N m, UN: 113.4 6.2 Nm, reduced
Fig. 1. Maximal isometric strength. Maximal isometric strength is shown for
the affected (AF) vs. the unaffected (UN) leg for women and men. Data are
presented as means SE. *P 0.05, AF significantly different from UN.
#P 0.05, women significantly different from men. Solid bars: AF leg; shaded
bars: UN leg.
20.3%) (Fig. 1). Compared with men, the elderly women had
39.5% less maximal isometric strength on AF and 39.2% on
UN (Fig. 1). The self-reported pain score (VAS) obtained
during the strength measurements was 1.2 0.3 for men and
1.1 0.2 for women for AF. None of the subjects reported any
pain during testing of UN.
Force per unit LCSA. When MVC was expressed relative to
LCSA (MVC/LCSA), there was a difference between AF and
UN for both men (AF: 2.58 0.14 Nm cm2, UN: 2.96 0.13 Nm cm2, reduced 12.8%, P 0.05) and women (AF:
2.34 0.14 Nmcm2, UN: 2.73 0.12 Nmcm2, reduced
14.3%, P 0.05) (Fig. 2). There was no gender difference for
specific strength on either side.
Contractile RFD and impulse. In men, contractile RFD was
reduced (P 0.05) on AF compared with UN for peak RFD
(15%), and at 0 –50 ms (24%), 0 –100 ms (19%), and 0 –200 ms
(18%) (Fig. 3). In women, contractile RFD was lower on AF
compared with UN for peak RFD (26%) and at 0 –50 ms (18%)
and 0 –100 ms (17%) (Fig. 3). When RFD was normalized to
LCSA (RFD/LCSA), AF of the men showed reduced RFD
compared with UN at 0 –100 ms (13%) and 200 ms (18%),
and for the women, normalized peak RFD (15%) AF remained
reduced (Table 2). Similarly, contractile impulse was reduced
on AF compared with UN in both men and women at 0 –50 ms
(M: 19% vs. W: 18%), 0 –100 ms (M: 20% vs. W: 19%), and
0 –200 ms (M: 19% vs. W: 10%) (Table 2).
Table 1. Quadriceps muscle composition
Women
AF
Men
UN
AF
UN
Total CSA, mm2 4,150261*† 4,407280† 6,108243* 6,604217
Lean CSA, mm2 3,809239*† 4,137267† 5,684221* 6,281221
Muscle density,
HU
46.011.45* 50.381.07 48.871.64* 52.451.39
Values are means SE. Total muscle cross sectional area (CSA), lean
quadriceps muscle CSA, and quadriceps muscle density of the affected (AF)
vs. the unaffected (UN) leg in men and women is shown. HU, Hounsfeld units.
*P 0.05, AF significantly different from UN. †P 0.05, women significantly different from men.
J Appl Physiol • VOL
Fig. 2. Force per unit lean muscle cross-sectional area (LCSA) [maximum
voluntary contraction (MVC)/LCSA]. Force per unit LCSA is shown for the
AF leg vs. the UN leg for women and men. Data are presented as means SE.
*P 0.05, AF leg significantly different from UN leg. No difference was
observed between women and men. Solid bars: AF leg; shaded bars: UN leg.
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
tagonist hamstring EMG by maximal agonist hamstring EMG measured during maximal knee flexion.
Quadriceps muscle composition. Cross-sectional area (CSA) of the
quadriceps femoris muscle was obtained by computed tomography
(CT; Picker 5000) with an image matrix of 512 512 pixels, slice
thickness of 8 mm, and scanning time of 5 s. All CSA scans were
obtained at the midpoint between the great trochanter and lateral joint
line of the knee. CT scans were analyzed using software developed for
cross-sectional CT image analysis (Geanie 2.1, BonAlyse Oy, Jyväskylä, Finland). Quadriceps muscles were encircled manually to exclude subcutaneous fat and other muscles from the region of interest.
Lean tissue cross-sectional area (LCSA) and inter- and intramuscular
fat CSAs were measured using CT density limits for fat and lean
tissue (37). Mean attenuation [Hounsfield unit (HU)] of the lean tissue
area was also recorded. Each scan was blinded for both leg and
gender, and the coefficient of variation between two consecutive
measurements is 1% for lean tissue HU and 1–2% for LCSA (37).
Statistical analysis. Statistical analyses were performed by using
GraphPad Prism 4.0 (GraphPad Software, San Diego, CA, 2003).
Data from maximal muscle strength measurements (MVC), quadriceps muscle composition (total CSA, LCSA, muscle density), MVC/
LCSA, muscle activation (interpolated twitch technique), neural activity (EMG), and hamstring cocontraction were analyzed by a twofactor ANOVA, with gender and side as factors. Data on contractile
RFD, contractile impulse, normalized RFD, and muscle activation
(interpolated twitch technique) were analyzed with paired Student’s
t-test. Data are presented as mean values SE, and a P value of
0.05 was considered significant.
945
DISUSE AND CHANGES IN RFD IN THE ELDERLY
Fig. 3. Contractile rate of force development (RFD). Contractile RFD of the AF leg vs. the UN leg for men and women is
shown. RFD (force/time) was calculated in time intervals of
0 –30, 50, 100, and 200 ms. Data are presented as means SE.
*P 0.05, AF leg significantly different from UN leg. Notice
the difference in absolute values between men and women,
which was statistically significant for all parameters, P 0.05.
flexion, the maximum EMG amplitude of the BF (AF: 49%;
UN: 36%) and ST (AF: 64%; UN: 58%) muscles was lower in
women compared with men (Table 3). During isometric knee
extension, men showed lower antagonist cocontraction in the
ST muscle of AF compared with women (M: 0.13 0.03 vs.
W: 0.25 0.04), whereas there was no difference in magnitude of cocontraction in ST (M: 0.15 0.02 vs. W: 0.19 0.02) on UN or in BF on AF (M: 0.37 0.07 vs. W: 0.44 0.05) or UN (M: 0.27 0.03 vs. W: 0.35 0.04) (Fig. 4).
Muscle activation. In a subgroup of 17 subjects (12 men and
5 women), the magnitude of muscle activation was estimated
by the superimposed twitch technique. Due to the limited
number of subjects, it was not possible to make gender comparisons. There was a remarkable, insufficient muscle activation on both sides (AF: 57.6 5.0%, UN: 70.7 3.6%),
although this deficit was more pronounced on AF (18.5%,
P 0.01).
DISCUSSION
The present study investigated maximal muscle strength,
muscle size, neural activation, and rapid muscle force characteristics in elderly individuals with unilateral hip-OA. The data
demonstrate a marked side-to-side difference with decreased
muscle mass, maximal muscle strength, neuromuscular activation, and rapid muscle force characteristics (RFD, impulse) on
the arthritic side compared with the healthy side.
Table 2. Contractile rate of force development and impulse
Women
RFD, N m s1
Peak
0–30 ms
0–50 ms
0–100 ms
0–200 ms
RFD/MCSA, N m s1 cm2
Peak
0–30 ms
0–50 ms
0–100 ms
0–200 ms
Impulse, N m s
0–30 ms
0–50 ms
0–100 ms
0–200 ms
Men
AF
UN
AF
UN
83675*†
41537†
53651*†
48437*†
34325†
1,129101†
49763†
65574†
58353†
39628†
1,681147*
718109
968105*
83065*
55238*
1,970183
953109
1,268138
1,02080
67645
0.220.02*
0.110.01
0.140.01
0.130.01
0.090.01
0.260.01
0.130.01
0.160.01
0.140.01
0.090.01
0.290.02
0.120.02
0.170.02
0.140.01*
0.090.01*
0.310.03
0.150.02
0.200.02
0.160.01
0.110.01
0.290.01†
0.740.05*†
2.890.22*†
9.030.65*†
0.330.02†
0.900.08†
3.580.32†
10.890.85†
0.410.04
1.230.13*
4.970.42*
14.891.03*
0.480.04
1.520.14
6.200.52
18.371.31
Values are means SE. Normalized rate of force development (RFD) [RFD/lean tissue CSA (LCSA)] and contractile impulse (force dt) of the AF vs. the
UN leg for men and women are shown. *P 0.05, AF significantly different from UN. †P 0.01, women significantly different from men.
J Appl Physiol • VOL
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
In addition, significant differences emerged between genders
(Table 2). Thus, compared with men, the women demonstrated
smaller absolute RFD values for peak RFD (AF: 50%; UN:
43%) and at 0 –30 ms (AF: 42%; UN: 48%), 0 –50 ms (AF:
45%; UN: 48%), 0 –100 ms (AF: 42%; UN: 43%), and 0 –200
ms (AF: 38%; UN: 41%) (Table 2). However, no statistically
significant differences between genders were found when RFD
was normalized to LCSA. Furthermore, contractile impulse
was reduced in women compared with men at 0 –30 ms (AF:
29%; UN: 32%), at 0 –50 ms (AF: 40%; UN: 41%), at 0 –100
ms (AF: 42%; UN: 42%), and at 0 –200 ms (AF: 39%; UN:
41%) (Table 2).
Neuromuscular activity (EMG). During maximal voluntary
knee extension contraction, maximum EMG amplitude of the
VL and VM muscle was lower on AF compared with UN in
men (VL: 28%; VM: 22%), while there was no side difference
for RF (Table 3). Similarly, there was no side difference for the
ST or BF muscles during knee flexor MVC (Table 3). In
women, maximum EMG amplitude of the RF was lower (RF:
22%) on AF compared with UN, while there was no side
difference for VL and VM (Table 3). During maximal voluntary knee flexion, BF was lower on AF compared with UN
(BF: 25%). There was no side difference in the magnitude of
hamstring antagonist cocontraction for men or women (Fig. 4).
Compared with male subjects, maximum EMG amplitude
during MVC in women was significantly smaller for VL (AF:
58%; UN: 61%), VM (AF: 51%; UN: 35%), and RF (AF: 63%;
UN: 50%) (Table 3). Correspondingly, during isometric knee
946
DISUSE AND CHANGES IN RFD IN THE ELDERLY
Table 3. Maximum EMG amplitude of the quadriceps and hamstring muscles
Women
EMG, V
Vastus lateralis
Vastus medialis
Rectus femoris
Biceps femoris
Semitendinosus
Men
AF
UN
AF
UN
181.117.1†
153.623.1†
124.710.7*†
138.622.6*†
143.917.9†
232.230.3†
255.755.2†
194.819.5†
209.629.5†
191.421.8†
431.945.3*
310.248.2*
334.951.7
271.944.5
401.957.2
599.158.5
395.630.9
388.554.8
329.621.0
432.632.9
Values are means SE. Maximum electromyogram (EMG) amplitude recorded during maximal isometric quadriceps and hamstring contraction in the AF
and the UN leg for men and women, respectively, is shown. *P 0.05 indicates AF leg significantly different from UN leg. †P 0.05 indicates that maximum
EMG amplitude was significantly lower in women compared with men.
specific strength (MVC/LCSA) in elderly compared with
young individuals (31, 42), although not all studies have been
able to detect such a difference (23). While women in the
present study had a lower MVC on both sides (AF: 39.5%,
UN: 39.2%) compared with men, no gender difference could
be detected when corrected for lean muscle tissue (MVC/
LCSA), which is in agreement with earlier investigations (30,
42). However, MVC/LCSA on AF was lower compared with
UN in both genders (M: 13.7%, W: 11.6%), in line with
D’Antona et al. (6), who demonstrated decreased specific force
in single muscle fibers of the quadriceps muscle in immobilized elderly individuals, indicating a disuse-related decrease in
muscle quality on the immobilized side. These results are
supported by Klitgaard et al. (25), who demonstrated that
sedentary elderly subjects showed a decline in specific
strength, whereas elderly subjects with a long-term history of
strength or endurance training demonstrated specific strength
that was equal to those of young subjects. Compared with the
side-to-side difference in MVC (M: 19.8%, W: 20.3%), the
decline in specific strength (M: 12.8%, W: 14.3%) with
inactivity and disuse suggests that 60 –70% (M: 12.8/19.8 65%, W: 14.3/20.3 70%) of this difference may be explained
by qualitative changes within the muscle tissue; i.e., changes in
neuromuscular activation, fiber type or muscle architectural
components, and/or increased ratio of noncontractile to contractile tissue (6, 31).
To the best of the author’s knowledge, no other study has
investigated rapid muscle force characteristics in the elderly
after a period of disuse or immobilization. In healthy elderly
individuals, it has been demonstrated that the ability to develop
force rapidly (i.e., contractile RFD) is reduced compared with
that in young individuals of both genders (5, 42), likely due to
the decreased number and size of type II muscle fibers in the
elderly (29) and an increased amount of noncontractile intramuscular tissue (29). However, when RFD is normalized
Fig. 4. Hamstring cocontraction. Hamstring antagonist cocontraction during quadriceps MVC in the AF
leg and the UN leg for men and women, respectively,
is shown. Data are presented as means SE. #P 0.05, men significantly different from women. Solid
bars: AF leg; shaded bars: UN leg.
J Appl Physiol • VOL
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
Despite the fact that elderly persons are particularly exposed
to periods of immobilization and disuse, either due to joint pain
or hospitalization (12), most of the current knowledge concerning the effect of immobilization on skeletal muscle is based on
studies in healthy young individuals (4, 28). Furthermore,
comparisons between young and old subjects per se make it
difficult to ascertain what effects can be attributed to activity
level and the aging process, respectively. The model of disuse
in the present study clearly presents some limitations; however,
we believe that comparing two legs with a different activity
level in the same person can provide new information as to
how decreased activity affects muscle function in elderly
individuals. One of the limitations of the study was that the
exact activity level was not obtained. It could be speculated
that subjects with unilateral hip-OA would favor the healthy
limb and thereby spare the AF side. Another possibility could
be that the overall activity level of these persons would
decrease because of joint pain; however, since both MVC and
CSA of UN side in these subjects were similar to those of
healthy age-matched subjects measured in our laboratory (10,
26) and in other studies (14, 17), we were probably observing
a combination of increased loading on the UN side and an
overall decreased activity level. Furthermore, supporting our
hypothesis that long-term disuse has a similar effect on muscle
mass as a standardized period of limb immobilization, both
men and women had smaller quadriceps muscle CSA (LCSA)
on AF compared with UN (M: 9.5%, W: 7.9%), which is
comparable to 4 wk of bed rest in young healthy individuals
(28).
Although muscle mass is an important determinant of
strength loss with age and immobilization, it is clearly not the
sole factor involved in this process. In addition, changes in
structural components, such as increased intramuscular fat and
connective tissue (29), likely contributes to the strength loss
with aging. Previous studies have demonstrated a reduced
DISUSE AND CHANGES IN RFD IN THE ELDERLY
J Appl Physiol • VOL
was observed in specific strength (MVC/LCSA) and normalized RFD (RFD/LCSA), which indicate that 40 –70% of the
observed changes with disuse may be explained by qualitative
changes. The present results underline the need of effective
neuromuscular rehabilitation regimes for the elderly after a
period of immobilization. This need becomes particular important when considering the importance of restoring symmetry of
lower limb strength and rapid muscle force capacity to avoid
decremental impairments in postural balance, maximal walking speed, and other functional tasks of daily life.
REFERENCES
1. Aagaard P, Simonsen EB, Andersen JL, Magnusson P, and DyhrePoulsen P. Increased rate of force development and neural drive of human
skeletal muscle following resistance training. J Appl Physiol 93: 1318 –
1326, 2002.
2. Appell HJ. Muscular atrophy following immobilisation. A review. Sports
Med 10: 42–58, 1990.
3. Behm DG, St. Pierre DM, Perez D. Muscle inactivation: assessment of
interpolated twitch technique. J Appl Physiol 81: 2267–2273, 1996.
4. Berg HE, Larsson L, Tesch PA. Lower limb skeletal muscle function
after 6 wk of bed rest. J Appl Physiol 82: 182–188, 1997.
5. Clarkson PM, Kroll W, Melchionda AM. Age, isometric strength, rate
of tension development and fiber type composition. J Gerontol 36:
648 – 653, 1981.
6. D’Antona G, Pellegrino MA, Adami R, Rossi R, Carlizzi CN, Canepari M, Saltin B, Bottinelli R. The effect of ageing and immobilization
on structure and function of human skeletal muscle fibres. J Physiol 552:
499 –511, 2003.
7. Davies CT, White MJ. Contractile properties of elderly human triceps
surae. Gerontology 29: 19 –25, 1983.
8. Deschenes MR, Britt AA, Chandler WC. A comparison of the effects of
unloading in young adult and aged skeletal muscle. Med Sci Sports Exerc
33: 1477–1483, 2001.
9. Duchateau J, Hainaut K. Effects of immobilization on contractile properties, recruitment and firing rates of human motor units. J Physiol 422:
55– 65, 1990.
10. Esmarck B, Andersen JL, Olsen S, Richter EA, Mizuno M, Kjaer M.
Timing of postexercise protein intake is important for muscle hypertrophy
with resistance training in elderly humans. J Physiol 535: 301–311, 2001.
11. Farina D, Merletti R, Enoka RM. The extraction of neural strategies
from the surface EMG. J Appl Physiol 96: 1486 –1495, 2004.
12. Felson DT, Zhang Y. An update on the epidemiology of knee and hip
osteoarthritis with a view to prevention. Arthritis Rheum 41: 1343–1355,
1998.
13. Fleming BE, Wilson DR, Pendergast DR. A portable, easily performed
muscle power test and its association with falls by elderly persons. Arch
Phys Med Rehabil 72: 886 – 889, 1991.
14. Frontera WR, Meredith CN, Oreilly KP, Knuttgen HG, Evans WJ.
Strength conditioning in older men–skeletal-muscle hypertrophy and improved function. J Appl Physiol 64: 1038 –1044, 1988.
15. Gandevia SC. Spinal and supraspinal factors in human muscle fatigue.
Physiol Rev 81: 1725–1789, 2001.
16. Graven-Nielsen T, Svensson P, Rendt-Nielsen L. Effects of experimental muscle pain on muscle activity and co-ordination during static and
dynamic motor function. Electroencephalogr Clin Neurophysiol 105:
156 –164, 1997.
17. Hakkinen K, Hakkinen A. Muscle cross-sectional area, force production
and relaxation characteristics in women at different ages. Eur J Appl
Physiol Occup Physiol 62: 410 – 414, 1991.
18. Hamada T, Sale DG, MacDougall JD, Tarnopolsky MA. Postactivation
potentiation, fiber type, and twitch contraction time in human knee
extensor muscles. J Appl Physiol 88: 2131–2137, 2000.
19. Hortobagyi T, Dempsey L, Fraser D, Zheng D, Hamilton G, Lambert
J, Dohm L. Changes in muscle strength, muscle fibre size and myofibrillar
gene expression after immobilization and retraining in humans. J Physiol
524: 293–304, 2000.
20. Janssen I, Heymsfield SB, Ross R. Low relative skeletal muscle mass
(sarcopenia) in older persons is associated with functional impairment and
physical disability. J Am Geriatr Soc 50: 889 – 896, 2002.
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
relative to MVC, a difference between young and old subjects
is not a universal finding (5, 40). In the present study, absolute
contractile RFD was lower on AF compared with UN in both
men (18%) and women (25%). Notably, AF remained
reduced compared with UN when RFD was normalized to
LCSA in women (W: 17.6%), indicating qualitative changes
with prolonged disuse. Although only rarely reported in the
literature (1, 39), contractile impulse is an important strength
parameter, since it reflects the specific time history of contraction by providing a measure of the accumulated area covered
by the moment-time curve (1). In the present study, contractile
impulse was reduced in the female subjects compared with
male subjects on both the AF (28 – 41%) and UN (31– 42%).
Furthermore, contractile impulse was reduced on the AF compared with the UN in both men (19%) and women (10 –19%).
In agreement with Berg et al. (4), who investigated the effect
of bed rest on lower limb muscle function in young healthy
individuals, there was reduced EMG response during maximal
voluntary knee extensor MVC in the quadriceps muscle of AF
compared with UN, in both men (VL, VM) and women (RF).
These data suggest a general suppression in neuromuscular
activity during maximum quadriceps contraction for men and
women, indicating that the decreases in maximal isometric
strength (MVC) and rapid force capacity (RFD, impulse)
observed in AF were at least partially explained by changes in
neuromuscular activation. However, it should be recognized
that a multitude of confounding factors exist that may compromise the information that can be extracted from surface
EMG data (11, 21). Thus side-to-side differences in EMG
signal amplitude could also have been caused by a variety of
nonneural factors, such as differences in limb fat distribution,
muscle fiber size, and muscle fiber pennation angle. The
amount of hamstring antagonist cocontraction was comparable
to that previously reported for elderly individuals (24, 31).
Notably, no difference was found in the magnitude of hamstring cocontraction between AF and UN, which suggests that
the subjects were well familiarized with the test procedure.
More importantly, this finding supports that the subjects did
not experience pain on AF during the recording of maximal
voluntary contraction strength and neuromuscular activity,
since antagonist muscle coactivation is known to increase in
the presence of muscle and/or joint pain (16). Notably, there
was a pronounced muscle activation deficit on both sides (AF:
42.4%; UN: 29.3%), although more severe on AF
(18.5%) compared with UN. It should be noted, however,
that single-twitch muscle stimulation, as used in the present
study, is more susceptible to muscle fatigue than stimulation
using paired twitches (15) and, furthermore, that the present
resting twitches were recorded in an unpotentiated state (before
contraction). Both of these factors are known to result in
smaller resting twitches and thereby larger activation deficits
(3, 15, 18). This does not, however, explain the difference in
muscle activation observed between the AF and contralateral
UN limb. Moreover, the observed AF activation deficit is very
much in line with that observed by Stevens et al. (38) after 7
wk of cast immobilization in young subjects. In summary, the
present study indicates that long-term limb disuse in the elderly
is associated with marked decreases in maximal muscle
strength, anatomical CSA of the quadriceps femoris muscle,
maximal EMG amplitudes, and rapid muscle force characteristics (RFD, impulse). Furthermore, a side-to-side difference
947
948
DISUSE AND CHANGES IN RFD IN THE ELDERLY
J Appl Physiol • VOL
32. Manton KG, Corder LS, Stallard E. Estimates of change in chronic
disability and institutional incidence and prevalence rates in the US elderly
population from the 1982, 1984, and 1989. National Long Term Care
Survey. J Gerontol 48: S153–S166, 1993.
33. Muller EA. Influence of training and of inactivity on muscle strength.
Arch Phys Med Rehabil 51: 449 – 462, 1970.
34. Narici MV, Bordini M, Cerretelli P. Effect of aging on human adductor
pollicis muscle function. J Appl Physiol 71: 1277–1281, 1991.
35. Overend TJ, Cunningham DA, Paterson DH, Lefcoe MS. Thigh composition in young and elderly men determined by computed tomography.
Clin Physiol 12: 629 – 640, 1992.
36. Reijman M, Hazes JM, Koes BW, Verhagen AP, Bierma-Zeinstra SM.
Validity, reliability, and applicability of seven definitions of hip osteoarthritis used in epidemiological studies: a systematic appraisal. Ann Rheum
Dis 63: 226 –232, 2004.
37. Sipila S, Suominen H. Effects of strength and endurance training on thigh
and leg muscle mass and composition in elderly women. J Appl Physiol
78: 334 –340, 1995.
38. Stevens JE, Pathare NC, Tillman SM, Scarborough MT, Gibbs CP,
Shah P, Jayaraman A, Walter GA, Vandenborne K. Relative contributions of muscle activation and muscle size to plantarflexor torque during
rehabilitation after immobilization. J Orthop Res 24: 1729 –1736, 2006.
39. Suetta C, Aagaard P, Rosted A, Jakobsen AK, Duus B, Kjaer M,
Magnusson SP. Training-induced changes in muscle CSA, muscle
strength, EMG, and rate of force development in elderly subjects after
long-term unilateral disuse. J Appl Physiol 97: 1954 –1961, 2004.
40. Thelen DG, Schultz AB, Alexander NB, Ashton Miller JA. Effects of
age on rapid ankle torque development. J Gerontol A Biol Sci Med Sci 51:
M226 –M232, 1996.
41. Urso ML, Clarkson PM, Price TB. Immobilization effects in young and
older adults. Eur J Appl Physiol 96: 564 –571, 2006.
42. Vandervoort AA, McComas AJ. Contractile changes in opposing muscles of the human ankle joint with aging. J Appl Physiol 61: 361–367,
1986.
43. Yasuda N, Glover EI, Phillips SM, Isfort RJ, Tarnopolsky MA.
Sex-based differences in skeletal muscle function and morphology with
short-term limb immobilization. J Appl Physiol 99: 1085–1092, 2005.
102 • MARCH 2007 •
www.jap.org
Downloaded from jap.physiology.org on April 11, 2007
21. Keenan KG, Farina D, Maluf KS, Merletti R, Enoka RM. Influence of
amplitude cancellation on the simulated surface electromyogram. J Appl
Physiol 98: 120 –131, 2005.
22. Kellis E, Baltzopoulos V. The effects of antagonist moment on the
resultant knee joint moment during isokinetic testing of the knee extensors. Eur J Appl Physiol Occup Physiol 76: 253–259, 1997.
23. Kent-Braun JA, Ng AV. Specific strength and voluntary muscle activation in young and elderly women and men. J Appl Physiol 87: 22–29,
1999.
24. Klein CS, Rice CL, Marsh GD. Normalized force, activation, and
coactivation in the arm muscles of young and old men. J Appl Physiol 91:
1341–1349, 2001.
25. Klitgaard H, Mantoni M, Schiaffino S, Ausoni S, Gorza L, LaurentWinter C, Schnohr P, Saltin B. Function, morphology and protein
expression of ageing skeletal muscle: a cross-sectional study of elderly
men with different training backgrounds. Acta Physiol Scand 140: 41–54,
1990.
26. Lange KH, Andersen JL, Beyer N, Isaksson F, Larsson B, Rasmussen
MH, Juul A, Bulow J, Kjaer M. GH administration changes myosin
heavy chain isoforms in skeletal muscle but does not augment muscle
strength or hypertrophy, either alone or combined with resistance exercise
training in healthy elderly men. J Clin Endocrinol Metab 87: 513–523,
2002.
27. Larsson L. Histochemical characteristics of human skeletal muscle during
aging. Acta Physiol Scand 117: 469 – 471, 1983.
28. LeBlanc A, Rowe R, Evans H, West S, Shackelford L, Schneider V.
Muscle atrophy during long duration bed rest. Int J Sports Med 18, Suppl
4: S283–S285, 1997.
29. Lexell J, Taylor CC, Sjostrom M. What is the cause of the ageing
atrophy? Total number, size and proportion of different fiber types studied
in whole vastus lateralis muscle from 15- to 83-year-old men. J Neurol Sci
84: 275–294, 1988.
30. Lindle RS, Metter EJ, Lynch NA, Fleg JL, Fozard JL, Tobin J, Roy
TA, Hurley BF. Age and gender comparisons of muscle strength in 654
women and men aged 20 –93 yr. J Appl Physiol 83: 1581–1587, 1997.
31. Macaluso A, Nimmo MA, Foster JE, Cockburn M, McMillan NC, De
VG. Contractile muscle volume and agonist-antagonist coactivation account for differences in torque between young and older women. Muscle
Nerve 25: 858 – 863, 2002.
C. Suetta, L. G. Hvid, L. Justesen, U. Christensen, K. Neergaard, L. Simonsen, N.
Ortenblad, S. P. Magnusson, M. Kjaer and P. Aagaard
J Appl Physiol 107:1172-1180, 2009. First published Aug 6, 2009; doi:10.1152/japplphysiol.00290.2009
You might find this additional information useful...
This article cites 77 articles, 40 of which you can access free at:
http://jap.physiology.org/cgi/content/full/107/4/1172#BIBL
Updated information and services including high-resolution figures, can be found at:
http://jap.physiology.org/cgi/content/full/107/4/1172
Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl
This information is current as of November 5, 2009 .
Downloaded from jap.physiology.org on November 5, 2009
Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society.
ISSN: 8750-7587, ESSN: 1522-1601. Visit our website at http://www.the-aps.org/.
J Appl Physiol 107: 1172–1180, 2009.
First published August 6, 2009; doi:10.1152/japplphysiol.00290.2009.
Effects of aging on human skeletal muscle after immobilization and retraining
C. Suetta,1,4 L. G. Hvid,1,2 L. Justesen,1 U. Christensen,1,2 K. Neergaard,3 L. Simonsen,4 N. Ortenblad,2
S. P. Magnusson,1 M. Kjaer,1 and P. Aagaard2
1
Institute of Sports Medicine and Centre of Healthy Aging, Faculty of Health Science, University of Copenhagen, Bispebjerg
Hospital; 2Institute of Sports Sciences and Clinical Biomechanics, University of Southern Denmark; and Departments
of 3Radiology and 4Clinical Physiology and Nuclear Medicine, Bispebjerg Hospital, University of Copenhagen,
Copenhagen, Denmark
Submitted 18 March 2009; accepted in final form 31 July 2009
unloading; disuse; recovery; sarcopenia
aging, i.e., sarcopenia, and the
concomitant decline in muscle strength are associated with
increased disability and mortality (36, 50). In addition, elderly
individuals are more prone to periods of bed rest due to a
higher degree of comorbidity and hospitalization (47), which,
per se, result in a rapid and accelerated loss of skeletal muscle
mass (34, 55). Despite this, very little is known about the
physiological consequences of unloading on muscle mass and
neuromuscular function in the elderly, while even less is
known about the regenerative capacity of skeletal muscle in the
elderly human being.
The negative effects of unloading on skeletal muscle in
young individuals are well elucidated (8, 18, 45). Furthermore,
chronic disuse in old individuals seems to accelerate the
age-related decrease in the contractile capacity of the quadri-
THE LOSS OF MUSCLE MASS WITH
Address for reprint requests and other correspondence: C. Suetta, Institute of
Sports Medicine, Bispebjerg Hospital, Bispebjerg Bakke 23, 2400 NV Copenhagen, Denmark (e-mail: [email protected]).
1172
ceps muscle (69), as well as in single muscle fibers (17).
However, only very few studies have investigated the effects of
immobilization in old compared with young humans (21, 72),
and, so far, none have addressed the atrophy response to
unloading of weight-bearing muscles in aging individuals.
Thus the present knowledge is primarily based on animal data,
where hindlimb suspension (HS) has been used as a model of
muscle unloading to investigate the underlying mechanisms
associated with disuse muscle atrophy in aging (3, 4, 9 –11, 13,
19, 20, 22). However, the data obtained by HS in young vs. old
animals are somewhat inconsistent. The majority of studies
have reported young animals to be more affected by HS (13,
59), while others find a similar degree of muscle atrophy
between young and old animals (67) or even greater magnitude
of muscle atrophy in old animals following HS (20). Further,
there are substantial indications that the muscle tissue of old
animals demonstrates an attenuated recovery response after
immobilization and injury (12, 19, 66). Although it is evident
that aging leads to a multitude of changes in the neuromuscular
system that are similar to those evoked by unloading (73), the
lack of research into the effect of unloading in elderly humans
makes it difficult to ascertain what effects can be attributed to
a decreased physical activity per se and which to the aging
process, as such.
The purpose of the present study was to investigate the
effects of unilateral lower limb immobilization and subsequent
retraining on muscle mass, muscle architecture, neuromuscular
activation, and resting twitch characteristics in young and aged
human individuals. By assessing these changes, we also aimed
to study the potential interaction between changes in muscle
contractile properties, specific force (Spforce), and muscle mass
characteristics after immobilization, and also to examine the
regenerative capacity of old compared with young individuals.
Based on the literature, it was difficult to hypothesize if aging
would affect the response to disuse muscle atrophy; however,
due to the more consistent data regarding the capacity for
regrowth in aging muscle, we hypothesized that old individuals
would display an attenuated response to subsequent retraining.
METHODS
Subjects and Study Design
Twenty healthy men, 9 old (OM: 67.3 yr, range 61–74 yr) and 11
young (YM: 24.4 yr, range 21–27 yr), volunteered to participate in the
study. Before inclusion, subjects were screened by a physician to
exclude subjects with cardiovascular disease, diabetes, neural- or
musculoskeletal disease, inflammatory or pulmonary disorders, and
any known predisposition to deep venous thrombosis. Only healthy,
nonmedicated individuals were included in the study. Physical activity
during work and leisure time was graded in four levels based on
8750-7587/09 $8.00 Copyright © 2009 the American Physiological Society
http://www. jap.org
Downloaded from jap.physiology.org on November 5, 2009
Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K,
Simonsen L, Ortenblad N, Magnusson SP, Kjaer M, Aagaard P.
Effects of aging on human skeletal muscle after immobilization and
retraining. J Appl Physiol 107: 1172–1180, 2009. First published
August 6, 2009; doi:10.1152/japplphysiol.00290.2009.—Inactivity is
a recognized compounding factor in sarcopenia and muscle weakness
in old age. However, while the negative effects of unloading on
skeletal muscle in young individuals are well elucidated, only little is
known about the consequence of immobilization and the regenerative
capacity in elderly individuals. Thus the aim of this study was to
examine the effect of aging on changes in muscle contractile properties, specific force, and muscle mass characteristics in 9 old (61–74 yr)
and 11 young men (21–27 yr) after 2 wk of immobilization and 4 wk
of retraining. Both young and old experienced decreases in maximal
muscle strength, resting twitch peak torque and twitch rate of force
development, quadriceps muscle volume, pennation angle, and specific force after 2 wk of immobilization (P 0.05). The decline in
quadriceps volume and pennation angle was smaller in old compared
with young (P 0.05). In contrast, only old men experienced a
decrease in quadriceps activation. After retraining, both young and old
regained their initial muscle strength, but old had smaller gains in
quadriceps volume compared with young, and pennation angle increased in young only (P 0.05). The present study is the first to
demonstrate that aging alters the neuromuscular response to shortterm disuse and recovery in humans. Notably, immobilization had a
greater impact on neuronal motor function in old individuals, while
young individuals were more affected at the muscle level. In addition,
old individuals showed an attenuated response to retraining after
immobilization compared with young individuals.
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
questionnaire assessment (65). All subjects were moderately active
(OM: 5.2 1.4 h/wk, YM: 5.0 0.9 h/wk) with no difference
between groups, and none of the subjects had previously participated
in systematic strength training. The local Ethics Committee approved
the conditions of the study (KF01–322606), and all experimental
procedures were performed in accordance with the Declaration of
Helsinki. Written, informed consent was obtained from all participants before inclusion in the study. After separate familiarization trials
and baseline test procedures, all subjects were subjected to unilateral
(randomly selected limb) lower limb casting from the hip to the ankle
for 2 wk. All measurements were conducted at baseline previous to
the immobilization procedure (Pre), after 2 wk of immobilization, and
again after 4 wk of heavy resistance training (6 wk). All measurements were performed on both sides, with the nonimmobilized side
serving as within-subject control.
Immobilization Protocol
Resting muscle twitches. Each test procedure began with the determination of the maximal twitch response in the resting muscle
(Fig. 1A). Percutaneous surface stimulation electrodes (Bioflex, model
PE3590) were placed over the distal and proximal parts of the
quadriceps femoris muscle, 10 cm above the patella and 15 cm
below the anterior superior iliac spine, respectively. The exact electrode position, including interelectrode distance, was registered in
relation to anatomic landmarks by use of ink markings, transparent
sheet, and vertical height measurements during upright standing to
ensure identical electrode positioning throughout the study period.
The stimulation protocol and data sampling were controlled from a
personal computer by predesigned algorithms written in Spike 2
(version 6.02, Cambridge Electronic Design, Cambridge, UK) using
an external analog-to-digital converter (CED Micron 1401 II, 16 bit,
Cambridge, CED), and all force signals were sampled and subsequently filtered with a 20-Hz Butterworth low-pass filter (3-dB
gain) (52). Twitch contractions were evoked in the passive muscle
using electrical stimulation consisting of single square-wave pulses of
0.1-ms duration delivered by a direct current stimulator (Digitimer
Downloaded from jap.physiology.org on November 5, 2009
Immobilization was accomplished by 2 wk of randomized, unilateral, whole leg casting using a lightweight fiber cast applied from just
above the malleoli to just below the groin, which previously has
proven to induce substantial muscle atrophy in short-term immobilization studies in young individuals (33, 35, 37). The cast was
positioned in 30° of knee joint flexion to circumvent walking ability
of the casted limb, and the subjects were carefully instructed to
perform all ambulatory activities on crutches and abstain from ground
contact, as well as performing isometric contractions of quadriceps of
the immobilized leg. During the 2-wk immobilization period, the
subjects were contacted on a regular basis and carefully instructed to
contract the muscles around the ankle joint (venous pump exercises)
several times a day to prevent potential formation of deep venous
thrombosis.
1173
Retraining Procedure
After removal of the whole leg cast, the subjects received manual
mobilization of their immobilized leg by a trained physiotherapist.
This was carried out to ensure that minimal pain was present and that
normal range of motion could be obtained at the knee joint. The
retraining protocol was accomplished by 4 wk of surveyed and
supervised unilateral strength training on the immobilized leg, with
three sessions each week, and has previously proven to elicit increases
in muscle size and maximal muscle strength in elderly individuals (27,
71). After a 5-min warm-up on a stationary bike, the subjects performed knee extension, leg press, and knee flexion, with all of the
machines being adjustable (Technogym International). To induce a
sufficient response in the thigh musculature, the training intensity was
3– 4 sets 12 repetitions [15 repetitions maximum (RM)] in week 1,
5 sets 10 repetitions (12 RM) in weeks 2 and 3, and 4 10
repetitions (12 RM) in week 4. Training load was adjusted on a weekly
basis by the use of 5-RM tests.
Body Composition
Dual-energy X-ray absorptiometry (Lunar DPX, version 3.6Z software) was used to estimate whole body composition and percent body
fat.
Maximal Muscle Strength and Neuromuscular Activation
Maximal voluntary and evoked muscle force was measured in a
custom-made setup, where the subjects were seated in an upright
position with back support and the hip and knee joint were flexed at
90° (69). A steel cuff was strapped around the lower leg, 2 cm above
the medial malleoli, and was connected via a rigid steel bar to a
strain-gauge load cell (Bofors KRG-4, Bofors, Sweden), which was
connected to an instrumentation amplifier (Gould 5900, Gould, Valley
View, OH).
J Appl Physiol • VOL
Fig. 1. Examples of single twitch and superimposed twitch recordings.
A: representative examples of resting single-twitch torque-time curves from
one young and one old subject at baseline (Pre), postimmobilization (Post), and
after retraining (Train). Note the differences in peak twitch torque (vertical
axis) and rate of force development calculated as the slope of the torque-time
curves (torque/time) between old men (OM) and young men (YM).
B: torque-time curves, displaying representative examples of applying the
superimposed twitch technique to determine quadriceps neural activation. A
doublet stimuli (arrow) was imposed at the highest attained torque plateau
(superimposed doublet) and 2 s after (potentiated doublet). Note the difference
in torque (vertical axis) between OM (solid line) and YM (thin line), both
exerted voluntarily (maximal voluntary contraction) and induced by the doublet stimulations during and after maximal voluntary contraction.
107 • OCTOBER 2009 •
www.jap.org
1174
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
CA(%) 100[(D * Tb/T max)/T DTW) * 100]
where D is the difference between Tb and the maximum torque
attained during the superimposed doublet stimulation; Tb is the torque
recorded just before the instant of doublet stimulation; Tmax is the
maximal attained torque measured during the preceding MVC trials;
and TDTW is the torque recorded during the potentiated resting doublet
twitch. D is indicative of additional activity from motor units not fully
activated at the time of stimulus. Correction of D (Tb/Tmax) was
included in the equation, since the manually controlled doublet twitch
stimulation was not always perfectly timed at Tmax (49, 68).
Quadriceps Muscle Volume
position at each time point, the specific scan position was marked with
traces drawn on acetate paper, which was aligned relative to individual skin marks and anatomic landmarks. The pennation angle (p) of
the VL fascicles was measured as the angle between the VL muscle
fascicles and the deep aponeurosis of the insertion, i.e., the fascia
separating VL and the vastus intermedius muscle (70). Two images
from each limb were obtained from each subject. Each image was
evaluated three times, and the mean value was recorded as the average
fiber p. The coefficient of variation between consecutive measurements was 5%.
Spforce
To quantify the relative contributions to changes in muscle mass
and muscle architecture with immobilization in old and young individuals, Spforce of the quadriceps muscle was calculated by dividing
fascicle force (Ff) by the physiological cross-sectional area (PCSA) of
the quadriceps muscle (46, 63):
Sp force Ff/PCSA
(1)
PCSA of the quadriceps muscle was calculated as the product of
muscle volume times the cosine of (p) divided by the fascicle length
(Fl) (60):
PCSA Q vol cos( p)/F1
(2)
As previously described (1), quadriceps contraction force (FQ) was
estimated from measurements of the maximal voluntary isometric
knee extension torque (MVC), assuming that patella tendon moment
arm length (MPa) was 4.0 cm (53, 54), and that the ratio of patella
tendon force to quadriceps tendon force was 0.7 (53, 54).
F Q (MVC/M pa)/0.7
(3)
Ff was then calculated as the FQ divided by cosine to the p of the VL
fascicles:
Ff F Q/cos( p)
(4)
Correlation Analyses
Correlation analysis between premuscle volume and the relative
decrease after immobilization was performed to investigate the importance of habitual muscle mass on the individual responses to
immobilization. Furthermore, to investigate the association between
the individual responsiveness to immobilization and subsequent retraining, correlation analysis was performed on the individual (relative) decreases in muscle size after immobilization and the subsequent
individual (relative) increase after retraining.
Muscle volume of the quadriceps muscle (Qvol) was obtained by
use of axial magnetic resonance imaging measurements (1). Imaging
was performed in a body array coil with the subject in a supine
position with both limbs extended and relaxed. Before the first scan,
a localizing scan centered midfemur was conducted to ensure the knee
joint was included in the field (field of view 48). The following first
scan was centered just below the femur condyles to ensure the same scan
position at all time points. Dependent on the femur length of the subject,
seven to eight transverse scans were carried out with a slice thickness
of 10 mm and an interslice gap of 50 mm. The scans were T1weighted with a field of view 42 and matrix 512 512. The anatomic
cross-sectional area of each scan was measured three times by a
blinded trained person using a Web1000 imaging software. The mean
value of the three measurements was recorded as the result, and the
coefficient of variation between consecutive measurements was 5%.
Qvol was calculated by the summation of six successive anatomic
cross-sectional area values (scans 2–7), each multiplied by the sum of
the slice thickness and interslice gap.
Changes in muscle strength, neuromuscular activation, muscle
volume, p of the VL fascicles, and Spforce were evaluated by using
the Friedmann two-way analysis of variance by ranks of related
samples with subsequent analysis using the Wilcoxon signed rank test
for paired samples and presented as group means SE. Intergroup
differences were evaluated using Kruskal-Wallis signed-rank test.
Spearman’s rho (rs) was used to determine the presence of any
rank-order association. A 0.05 level of statistical significance (twotailed) was used.
Muscle Architecture
RESULTS
Sagittal ultrasound images of the quadriceps femoris muscle were
recorded with the use of a Siemens real-time scanner with a 7.5-MHz
linear array transducer. Images were obtained with the subject in a
seated position (90° flexion in the hip and knee joint) at 50% of femur
length over the midbelly of the vastus lateralis (VL) muscle, according
to the procedures described previously (70). To ensure identical scan
Subjects
J Appl Physiol • VOL
Statistics
At baseline, there was no difference in body mass (OM:
84.8 3.4 kg, YM: 72.2 2.3 kg) or height (OM: 178.7 2.6
cm, YM: 181.4 1.8 cm), whereas OM had a larger percentage of body fat (OM: 26.0 3.9%, YM: 14.7 5.7%) and a
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
Electronics, model DS7). Stepwise increments in the current were
delivered until no further increase in twitch amplitude was seen (32).
The following twitch characteristics were determined: 1) peak torque
(PT); 2) twitch time to peak torque (TPT), defined as the time elapsed
from onset (2% of twitch amplitude) to PT; and 3) rate of force
(torque) development (RFD) in time intervals of 0 –30 ms and 0 –50
ms, which was determined as the mean slope of the torque-time curve
in time intervals of 0 –30 ms and 0 –50 ms, respectively (time 0
denotes onset of twitch force).
Superimposed twitches. To evaluate the ability to activate the quadriceps muscle, i.e., to assess the magnitude of central activation (neuromuscular activation), electrically evoked muscle doublet twitches were
superimposed onto maximal voluntary muscle contraction (MVC) (49,
68). Contractions were evoked using doublet square-wave pulses of
0.1-ms duration, and a minimum of two trials were performed with a
requirement to reach within 5% of the peak MVC force measured in
preceding trials. Supramaximal doublet stimulation (100-ms pulse
duration, 10-ms interpulse interval) was manually delivered 5 s before
(nonpotentiated resting doublet), at the highest attained force plateau
(superimposed doublet), and 2 s after (potentiated resting doublet),
with the latter being used as the resting reference twitch (Fig. 1B). The
force recording of each contraction was displayed online on a computer screen, which enabled stimuli to be triggered manually on top of
a MVC. The height of the superimposed and resting doublet twitches
were measured, and central activation (CA) (i.e., neuromuscular
activation) was calculated as (49, 68):
1175
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
2
higher body mass index (OM: 26.3 0.5 kg/m , YM: 22.1 0.5 kg/m2) than their young counterparts.
Maximal Muscle Strength and Central Activation
Resting Twitch Characteristics
Before intervention, peak twitch torque (PTT: 42.6%, P 0.05) and twitch RFD at 0 –30 ms (46.3%, P 0.05) and
0 –50 ms (44.9%, P 0.05) were reduced in OM compared
with YM (Fig. 1 and Table 2). In contrast, there was no
Quadriceps Muscle Volume
Before intervention, quadriceps muscle volume (Qvol) was
11% reduced in OM compared with YM (P 0.05, Table 1).
After immobilization, muscle volume decreased more in young
than old (YM: 8.9%, OM: 5.2%, P 0.05). Moreover,
YM showed greater increases in Qvol in response to retraining
(YM: 8.2%, OM: 3.8%, P 0.05) and reached the initial
baseline level (Fig. 2). In contrast, OM did not fully recover
their Qvol after retraining (P 0.05) (Fig. 2). No change was
observed in the Con leg. Moreover, correlations emerged
Table 1. Effects of immobilization and retraining on muscle contractile properties, specific force, and muscle
mass characteristics
Young Men
Immobilized
MVC, N m
Pre
2 wk immobilization
4 wk Retraining
Muscle activation, %
Pre
2 wk immobilization
4 wk Retraining
Quadriceps volume, cm3
Pre
2 wk immobilization
4 wk Retraining
PCSA, cm2
Pre
2 wk immobilization
4 wk Retraining
Pennation angle, °
Pre
2 wk immobilization
4 wk Retraining
Fascicle length, mm
Pre
2 wk immobilization
4 wk Retraining
Specific force, N/cm2
Pre
2 wk immobilization
4 wk Retraining
Old Men
Control
Immobilized
Control
21427
17123†
22630*
21244
21839
22930
13921‡
11824†‡
14531*‡
14230‡
13511‡
15230‡
91.61.6
90.62.8
95.21.5*†
92.31.5
89.62.9
92.41.7
88.61.6
80.22.8†
90.62.8‡
86.93.2
83.22.5
90.82.8
1,841.362.2
1,676.947.3†
1,813.761.6*
1,829.572.4
1,824.378.5
1,814.773.0
1,633.146.3‡
11,545.039.7†‡
1,605.545.3*‡
1,580.161.3‡
1,577.165.1‡
1,558.761.1‡
164.47.1
157.57.0
173.17.1*
160.37.2
158.18.5
161.26.8
135.86.8‡
139.78.6‡
143.08.3‡
145.57.8‡
149.49.6‡
146.58.9‡
10.40.4
9.40.4†
10.51.5*
9.80.3
10.00.2
10.10.4
11.70.3
10.50.4†
11.00.3
11.90.3
11.60.5
11.70.5
11.90.5
11.10.5
11.40.5
11.70.8
11.40.7
11.30.5
47.91.8
40.12.4†
48.42.64*
48.73.5
51.33.9
51.42.4
33.01.9‡
25.32.0†‡
32.23.3*‡
34.52.0‡
32.41.2‡
34.01.4‡
9.00.5‡
8.40.5†‡
8.60.4‡
9.00.5‡
8.70.4‡
8.90.5‡
Values are means SE. Changes are shown for maximal muscle strength, quadriceps muscle volume, quadriceps activation, muscle architecture, and specific
force with unloading and retraining in old and young men. Measurements were conducted at baseline (Pre), after 2 wk of unilateral immobilization, and following
4 wk of retraining on both limbs, immobilized and control. MVC, maximal voluntary contraction; PCSA, physiological cross-sectional area. †Significant different
from Pre, *significant different from 2-wk immobilization, ‡old men significant different from young men: P 0.05.
J Appl Physiol • VOL
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
At baseline, maximal quadriceps strength was 31% (P 0.05) lower in OM compared with YM (Table 1). After 2 wk
of immobilization, OM and YM lost 15.7% and 19.8% of the
maximal quadriceps strength, respectively (P 0.05); however, after 4 wk of retraining, both OM and YM had regained
their baseline MVC (Table 1). No changes were observed in
the control leg (Con) in either OM or YM. Before immobilization, OM and YM showed similar levels of central activation
(OM, Pre: 88.6 1.6%; YM, Pre: 91.6 1.6%, nonsignificant, Table 1). However, while the activation level of YM
remained unchanged, OM experienced a 9.9% (P 0.05)
decline after immobilization. After 4 wk of subsequent strength
training, OM returned to the initial activation level, whereas
YM reached values above the baseline activation level (P 0.05). There was no change in the activation level of the Con
leg in any of the two groups.
difference between young and old in the TPT. After immobilization, peak twitch torque decreased in both young and old
(OM: 27.7%, YM: 22.2%, P 0.05) with subsequent
increases after retraining (OM: 30.7%, YM: 21.5%, P 0.05). Furthermore, twitch RFD decreased after immobilization in time intervals of 0 –30 ms (OM: 30.7%, YM:
21.7%, P 0.05) and 0 –50 ms (OM: 30.4%, YM:
21.5%, P 0.05), while subsequently increasing after retraining at 0 –30 ms (OM: 38.3%, YM: 16.8%, P 0.05)
and 0 –50 ms (OM: 36.5%, YM: 17.8%, P 0.05),
respectively. Moreover, there was no change in TPT in either
old or young individuals in response to immobilization or
retraining (Table 2). No changes were observed in the Con leg.
All relative changes reported above did not differ between OM
and YM.
1176
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
Table 2. Effects of immobilization and retraining on resting twitch characteristics
Young Men
Peak torque, N m
Pre
2-wk immobilization
4-wks Retraining
Time to peak tension, ms
Pre
2-wk immobilization
4-wk Retraining
RFD 0–30 ms, N m s1
Pre
2-wk immobilization
4-wk Retraining
RFD 0–50 ms, N m s1
Pre
2-wk immobilization
4-wk Retraining
Old Men
Immobilized
Control
Immobilized
Control
47.723.81
35.792.07†
43.323.11*
44.993.77
45.383.70
45.243.03
27.401.95‡
19.803.65†‡
25.871.64*‡
26.421.54‡
22.842.56‡
26.291.80‡
882
882
892
882
892
882
1,37599
1,05372†
1,22686*
1,286102
1,301105
1,32896
73848‡
54697†‡
75665*‡
1,778126
1,36190†
1,598110*
1,673132
1,692136
1,705121
98066‡
734131†‡
1,00186*‡
892
902
872
893
882
861
78468‡
678103‡
78870‡
1,03387‡
896136‡
1,04793‡
between the individual Qvol at baseline and the resultant
individual decrease after immobilization in young (r 0.669, P 0.05) but not old subjects (r 0.429, NS)
(Fig. 3). Furthermore, the relative decrease in muscle volume after immobilization was correlated to the corresponding increase after retraining in both young (r 0.702, P 0.05) and old subjects (r 0.778, P 0.05) (Fig. 4).
Muscle Architecture
Physiological CSA and Specific Force
Physiological CSA (PCSA) and specific force (Spforce) were
reduced by 17 and 31% in OM compared with YM (P 0.05),
respectively, before immobilization. PCSA remained unaltered
in both OM and YM after immobilization; however, the retraining regime led to a 10.6% increase in PCSA in YM (P 0.05), whereas no change was observed in OM. Moreover,
there was a marked decrease in Spforce after immobilization in
both groups (OM: 23.1%, YM: 16.6%, P 0.05), where
YM tended to decrease more than OM (P 0.09). After 4 wk
of retraining, Spforce returned to baseline level in both old and
young individuals (OM: 34.4%, YM: 23.7%, P 0.05).
There were no changes in PCSA or Spforce in the Con leg in
either of the two groups.
Qvol
Before immobilization, OM had smaller p than YM (Table
1) and a tendency toward smaller fascicle lengths (P 0.08).
However, after immobilization, the p decreased to a larger
extend in YM than in OM (OM: 6.5%, YM: 9.3%, P 0.05). In both young and old, there was a tendency toward a
decrease in fascicle length after immobilization (OM: 6.1%,
P 0.08; YM: 9.7%, P 0.06, both groups collapsed: P 0.05). After retraining, p increased in YM by 12.0% (P 0.05), whereas the 4.5% increase observed in OM did not reach
statistical significance. No change was observed for the Con
leg in YM or OM.
Fig. 2. Relative changes in quadriceps muscle volume after 2 wk of immobilization (Immob) and subsequent 4 wk of retraining. Qvol, quadriceps muscle
volume.
J Appl Physiol • VOL
Fig. 3. Correlation analysis between premuscle volume and the relative
decrease after immobilization. Qvol, quadriceps muscle volume; ns, nonsignificant.
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
Values are means SE. Changes are shown for peak twitch torque, time to peak tension, and twitch rate of force development in 0 –30 ms (RFD 0 –30) and
in 0 –50 ms (RFD 0 –50) with unloading and retraining in old and young men. Measurements were conducted at Pre, after 2 wk of unilateral immobilization,
and following 4 wk of retraining on both limbs, immobilized and control. †Significant different from Pre, *significant different from 2-wk immobilization, ‡old
men significant different from young men: P 0.05.
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
DISCUSSION
In the present study, concurrent data were obtained on the
change in muscle contractile function, muscle size, central
activation, and muscle architecture induced by unloading and
retraining in old vs. young human individuals, respectively. It
was the purpose to address the effect of aging on 1) the
magnitude of acute muscle disuse atrophy, and 2) the adaptive
plasticity of subsequent exercise rehabilitation. The main and
novel findings were 1) that young subjects showed a greater
magnitude of muscle atrophy and more marked changes in VL
fascicle pennation angle after immobilization compared with
old subjects; 2) old subjects demonstrated a diminished capacity to restore muscle size and muscle architecture during
subsequent retraining; and 3) immobilization led to reduced
muscle activation in old but not young subjects. Thus the
present data suggest that the adaptive plasticity in skeletal
muscle mass and central nervous system function associated
with unloading and subsequent remobilization, respectively,
may differ substantially between old and young individuals.
Multiple interrelated factors appear to contribute to the
deterioration of muscle mechanical function with aging as a
result of changes in both quantitative and qualitative factors
(23, 25, 73, 75). In addition to these changes in intrinsic
factors, the level of physical activity has been shown to modify
the age-related loss in muscle size and function (2, 43, 57, 61).
However, as there was no difference in the activity level
between old and young individuals examined in the present
study, we believe the observed differences were mainly attributable to the effect of aging per se.
Effects of Immobilization
It is evident that aging and disuse bring about analogous
impairments in the neuromuscular system, and, although there
are indications of different strategies to muscle disuse in young
and old animals, these aspects remain to be elucidated in
humans. In the present study, the average decrease in maximal
muscle strength after 2 wk of immobilization did not differ
between the two age groups, which is in line with previous
results reported by Deschenes et al., who examined the effects
J Appl Physiol • VOL
of 7 days of limb immobilization in young and old men (21),
and by Urso et al. (72), who examined the effects of 2-wk
immobilization of the adductor pollicis muscle in young and
old human individuals, respectively. Furthermore, immobilization led to significant reductions in Qvol, comparable to previous data obtained in young individuals after 2 wk of immobilization (18, 33, 37). Interestingly, the observed decrease
in muscle volume in old subjects was significantly smaller
than the decrease observed in young subjects, in contrast to
earlier findings obtained in the human adductor pollicis muscle
(72). This discrepancy could, however, be due to the different
muscle groups investigated, as different adaptation strategies
have been suggested for small muscle groups compared with
that of bigger muscle groups (29). Animal data are somewhat
inconsistent as well. Some studies report old animals to be
more affected by hindlimb suspension (20), some find a similar
degree of muscle atrophy between young and old animals (67),
while others, in line with findings from the present study, find
a higher magnitude of muscle atrophy in young compared with
old animals (13, 59). The attenuated decline in muscle size in
OM following immobilization could hypothetically be related
to a reduced muscle protein breakdown rate with aging concurrent with the observed decrease in muscle protein synthesis
rate (6, 74). In some support of this notion, MuRFbx and
atrogin-1 that drive ubiquitin-proteasome-mediated myofibrillar proteolysis were downregulated in skeletal muscle of old
rats (26), although not consistently shown to differ between
young and old humans, comparable to the age of the present
subjects (76). Furthermore, the observed correlation between
baseline muscle volume and relative decrease after immobilization in young but not old subjects in the present study
suggests that the habitual muscle volume predicts the individual response to muscle disuse in young but not aged individuals. This finding indicates qualitative differences in the myogenic response to immobilization between young and old
individuals, with old subjects being more affected on the
efferent neuronal function, while young individuals were more
affected at the muscle protein level.
In accordance with the changes in muscle volume, the
present decrease in pennation angle of the VL fascicles observed in young subjects after immobilization was larger than
that observed in old subjects, underlining the importance of
muscle architecture to explain part of the discrepancy between
the average relative decrease in muscle strength (OM:
15.7%, YM: 19.8%, P 0.05), being about twice as large
compared with the average relative decrease in muscle mass
(YM: 8.9%, OM: 5.2%, P 0.05).
Although Spforce of the old individuals was markedly reduced compared with young subjects before immobilization,
the relative decrease in Spforce was similar in old and young
subjects following immobilization. Similarly, the present study
demonstrated comparable decreases in resting twitch PT and
twitch rate of force development between young and old
individuals after immobilization, which indicates that the
change in intrinsic (“qualitative”) mechanical muscle function
(including muscle phenotype expression and/or tendon stiffness) did not differ between old and young individuals. The
age-related differences in twitch PT and twitch RFD observed
before immobilization may be due to potential changes in
muscle fiber composition (5) and/or tendon stiffness (51) with
aging, whereas the effect of immobilization in both young and
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
Fig. 4. Correlation analysis between the individual (relative) decreases in
muscle size after immobilization and the subsequent individual (relative)
increase after retraining.
1177
1178
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
old individuals may have included changes in sarcoplasmic
Ca2 kinetics (44).
Importantly, old subjects demonstrated an impaired ability
to activate the quadriceps muscle after immobilization (OM:
9.9%, P 0.05), whereas young subjects, latter in line with
recent findings, remained unaffected (18). This finding could
partly be explained by a potential age-related decline in somatosensory afferent inflow on motor unit activation (30) and
a reduced maximal motor unit firing rate at MVC (39, 41, 56)
that occasionally is accompanied by reduced levels of muscle
activation (42). It is possible that immobilization leads to an
amplified age-related gap in these parameters that could, at
least in part, explain the present findings, which should be
examined in future experiments.
Effects of Retraining
J Appl Physiol • VOL
ACKNOWLEDGMENTS
We are indebted to the subjects who participated in this study for effort and
invaluable contribution to this work.
GRANTS
The study was supported by grants from the Danish National Research
Council, the Danish Rheumatology Association, Faculty of Health Sciences,
University of Copenhagen, and the Danish Ministry of Culture.
REFERENCES
1. Aagaard P, Andersen JL, Dyhre-Poulsen P, Leffers AM, Wagner A,
Magnusson SP, Halkjaer-Kristensen J, Simonsen EB. A mechanism for
increased contractile strength of human pennate muscle in response to
strength training: changes in muscle architecture. J Physiol 534: 613– 623,
2001.
2. Aagaard P, Magnusson PS, Larsson B, Kjaer M, Krustrup P. Mechanical muscle function, morphology, and fiber type in lifelong trained
elderly. Med Sci Sports Exerc 39: 1989 –1996, 2007.
3. Alway SE, Degens H, Krishnamurthy G, Chaudhrai A. Denervation
stimulates apoptosis but not Id2 expression in hindlimb muscles of aged
rats. J Gerontol A Biol Sci Med Sci 58: 687– 697, 2003.
4. Alway SE, Lowe DA, Chen KD. The effects of age and hindlimb
supension on the levels of expression of the myogenic regulatory factors
MyoD and myogenin in rat fast and slow skeletal muscles. Exp Physiol 86:
509 –517, 2001.
5. Andersen JL. Muscle fibre type adaptation in the elderly human muscle.
Scand J Med Sci Sports 13: 40 – 47, 2003.
6. Balagopal P, Rooyackers OE, Adey DB, Ades PA, Sreekumaran Nair
K. Effects of aging on in vivo synthesis of skeletal muscle myosin
heavy-chain and sarcoplasmic protein in humans. Am J Physiol Endocrinol Metab 273: E790 –E800, 1997.
7. Behm DG, Sale DG. Velocity specificity of resistance training. Sports
Med 15: 374 –388, 1993.
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
The capacity for muscle regrowth in elderly human individuals after immobilization has not previously been investigated,
despite the obvious clinical importance of such knowledge.
Importantly, the present data demonstrate that old subjects, in
contrast to young, did not fully recover from the decrease in
muscle volume and pennation angle, despite 4 wk of intensive
resistive exercises. These findings corresponds well with previous animal data, indicating an attenuated response to reloading in old animals (12, 48, 77), and, although the knowledge
about the molecular processes involved in muscle regrowth is
limited, there are indications that aging impairs the activation
of satellite cells (28). Furthermore, animal data from the
Conboy group indicate that the impaired regenerative capacity
in old skeletal muscle is due to a diminished activation of the
Notch signaling pathway with aging (16). Moreover, it has
been put forward that the satellite cell pool, and thereby the
myogenic potential, is reduced with aging (31, 38), although
this is not a universal finding (15, 64). The attenuated rate of
muscle size gain in old compared with young during the period
of subsequent retraining could also be due to a lesser or
delayed rise in protein synthesis rate, and/or an increased
protein breakdown rate during the acute training sessions in
OM. Furthermore, attenuated exercise-induced changes in
myogenic regulatory factor expression may have been involved
in the smaller gain in muscle size in OM observed after the
period of retraining (40, 48).
Even though the present data suggest that the rate and
magnitude of change in muscle mass is attenuated in old
compared with that of young individuals after 4 wk of resistance training, more prolonged regimes of resistance training
have revealed marked increases in muscle size and muscle
architecture in old individuals (62, 70), comparable to that of
young individuals (1). These data are further supported by
recent data from Carey and colleagues (14), who have elegantly demonstrated that the expression of Notch genes is
reduced in aged human skeletal muscle compared with that of
the young; however, after 12 wk of resistance training, there
was no difference in basal Notch gene expression between
young and old subjects.
While long-term resistance training may lead to changes in
resting twitch TPT (7, 24), no longitudinal changes were
observed in the present study, suggesting that the present 2 wk
of immobilization followed by 4 wk of retraining were too
short in duration to elicit any major change in muscle fiber-type
composition and/or tendon stiffness properties. Consequently,
the differential age-related changes in muscle size and muscle
activation likely were the major factors to explain the present
changes in mechanical muscle function induced by immobilization and subsequent retraining. On the other hand, the correlations observed in the present study between the individual
relative decrease in muscle volume after immobilization and
the subsequent individual relative gain after retraining (YM:
r 0.702, OM: r 0.778, P 0.05) indicate that, besides
aging per se, genetic factors are also likely to play an important
role for the myogenic potential, in line with recent findings by
Petrella et al. (58).
In conclusion, the present data shows that aging is accompanied by an attenuated rate of muscle atrophy in response to
immobilization compared with that of young individuals, and
importantly that old subjects demonstrate a diminished capacity to restore muscle size and muscle architecture during
subsequent retraining. Moreover, immobilization led to reduced muscle activation in old but not young subjects. Thus the
present data suggest that the adaptive plasticity in skeletal
muscle mass and central nervous system function associated
with unloading and subsequent remobilization, respectively,
may differ between old and young individuals. Collectively,
these findings suggest that old individuals may be more affected with respect to neural function, and young individuals
more affected in terms of muscle size, in response to short-term
immobilization. Furthermore, the present data indicate that
aging is accompanied by an impaired ability to recover from
disuse muscle atrophy, and, consequently, old individuals may
need a longer time to recover from periods of disuse compared
with young individuals.
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
J Appl Physiol • VOL
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
facilitates the rehabilitation of disuse atrophy and alters the expression of
muscle myogenic factors in humans. J Physiol 536: 625– 633, 2001.
Hill AA, Plank LD, Finn PJ, Whalley GA, Sharpe N, Clark MA, Hill
GL. Massive nitrogen loss in critical surgical illness: effect on cardiac
mass and function. Ann Surg 226: 191–197, 1997.
Hortobagyi T, Dempsey L, Fraser D, Zheng D, Hamilton G, Lambert
J, Dohm L. Changes in muscle strength, muscle fibre size and myofibrillar
gene expression after immobilization and retraining in humans. J Physiol
524: 293–304, 2000.
Janssen I, Heymsfield SB, Ross R. Low relative skeletal muscle mass
(sarcopenia) in older persons is associated with functional impairment and
physical disability. J Am Geriatr Soc 50: 889 – 896, 2002.
Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N, Greenhaff PL.
Disuse atrophy and exercise rehabilitation in humans profoundly affects
the expression of genes associated with the regulation of skeletal muscle
mass. FASEB J 18: 1025–1027, 2004.
Kadi F, Charifi N, Denis C, Lexell J. Satellite cells and myonuclei in
young and elderly women and men. Muscle Nerve 29: 120 –127, 2004.
Kamen G, Knight CA. Training-related adaptations in motor unit discharge rate in young and older adults. J Gerontol A Biol Sci Med Sci 59:
1334 –1338, 2004.
Kim JS, Kosek DJ, Petrella JK, Cross JM, Bamman MM. Resting and
load-induced levels of myogenic gene transcripts differ between older
adults with demonstrable sarcopenia and young men and women. J Appl
Physiol 99: 2149 –2158, 2005.
Klass M, Baudry S, Duchateau J. Age-related decline in rate of torque
development is accompanied by lower maximal motor unit discharge
frequency during fast contractions. J Appl Physiol 104: 739 –746, 2008.
Klass M, Baudry S, Duchateau J. Voluntary activation during maximal
contraction with advancing age: a brief review. Eur J Appl Physiol 100:
543–551, 2007.
Klitgaard H, Mantoni M, Schiaffino S, Ausoni S, Gorza L, LaurentWinter C, Schnohr P, Saltin B. Function, morphology and protein
expression of ageing skeletal muscle: a cross-sectional study of elderly
men with different training backgrounds. Acta Physiol Scand 140: 41–54,
1990.
Kugelberg E, Thornell LE. Contraction time, histochemical type, and
terminal cisternae volume of rat motor units. Muscle Nerve 6: 149 –153,
1983.
LeBlanc A, Rowe R, Evans H, West S, Shackelford L, Schneider V.
Muscle atrophy during long duration bed rest. Int J Sports Med 18, Suppl
4: S283–S285, 1997.
Maganaris CN, Baltzopoulos V, Ball D, Sargeant AJ. In vivo specific
tension of human skeletal muscle. J Appl Physiol 90: 865– 872, 2001.
Manton KG, Corder LS, Stallard E. Estimates of change in chronic
disability and institutional incidence and prevalence rates in the U.S.
elderly population from the 1982, 1984, and 1989. National Long Term
Care Survey. J Gerontol 48: S153–S166, 1993.
Marsh DR, Criswell DS, Carson JA, Booth FW. Myogenic regulatory
factors during regeneration of skeletal muscle in young, adult, and old rats.
J Appl Physiol 83: 1270 –1275, 1997.
Merton PA. Voluntary strength and fatigue. J Physiol 123: 553–564,
1954.
Metter EJ, Talbot LA, Schrager M, Conwit R. Skeletal muscle strength
as a predictor of all-cause mortality in healthy men. J Gerontol A Biol Sci
Med Sci 57: B359 –BB365, 2002.
Narici MV, Maganaris CN. Plasticity of the muscle-tendon complex with
disuse and aging. Exerc Sport Sci Rev 35: 126 –134, 2007.
Nielsen JS, Madsen K, Jorgensen LV, Sahlin K. Effects of lengthening
contraction on calcium kinetics and skeletal muscle contractility in humans. Acta Physiol Scand 184: 203–214, 2005.
Nisell R, Ekholm J. Patellar forces during knee extension. Scand J
Rehabil Med 17: 63–74, 1985.
Nisell R, Ericson MO, Nemeth G, Ekholm J. Tibiofemoral joint forces
during isokinetic knee extension. Am J Sports Med 17: 49 –54, 1989.
Okeefe SJD, Sender PM, James WPT. Catabolic loss of body nitrogen
in response to surgery. Lancet 2: 1035–1038, 1974.
Patten C, Kamen G, Rowland DM. Adaptations in maximal motor unit
discharge rate to strength training in young and older adults. Muscle Nerve
24: 542–550, 2001.
Pearson SJ, Young A, Macaluso A, Devito G, Nimmo MA, Cobbold
M, Harridge SD. Muscle function in elite master weightlifters. Med Sci
Sports Exerc 34: 1199 –1206, 2002.
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
8. Berg HE, Larsson L, Tesch PA. Lower limb skeletal muscle function
after 6 wk of bed rest. J Appl Physiol 82: 182–188, 1997.
9. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,
Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ.
Identification of ubiquitin ligases required for skeletal muscle atrophy.
Science 294: 1704 –1708, 2001.
10. Booth FW, Gollnick PD. Effects of disuse on the structure and function
of skeletal muscle. Med Sci Sports Exerc 15: 415– 420, 1983.
11. Booth FW, Seider MJ. Early change in skeletal muscle protein synthesis
after limb immobilization of rats. J Appl Physiol 47: 974 –977, 1979.
12. Brooks SV, Faulkner JA. Contraction-induced injury: recovery of skeletal muscles in young and old mice. Am J Physiol Cell Physiol 258:
C436 –C442, 1990.
13. Brown M, Hasser EM. Differential effects of reduced muscle use
(hindlimb unweighting) on skeletal muscle with aging. Aging (Milano) 8:
99 –105, 1996.
14. Carey KA, Farnfield MM, Tarquinio SD, Cameron-Smith D. Impaired
expression of notch signaling genes in aged human skeletal muscle.
Journal of Gerontology: BIOLOGICAL SCIENCES 62A: 9 –17, 2007.
15. Carson JA, Alway SE. Stretch overload-induced satellite cell activation
in slow tonic muscle from adult and aged Japanese quail. Am J Physiol
Cell Physiol 270: C578 –C584, 1996.
16. Conboy IM, Conboy MJ, Smythe GM, Rando TA. Notch-mediated
restoration of regenerative potential to aged muscle. Science 302: 1575–
1577, 2003.
17. D’Antona G, Pellegrino MA, Adami R, Rossi R, Carlizzi CN, Canepari M, Saltin B, Bottinelli R. The effect of ageing and immobilization
on structure and function of human skeletal muscle fibres. J Physiol 552:
499 –511, 2003.
18. de Boer, Maganaris CN, Seynnes OR, Rennie MJ, Narici MV. Time
course of muscular, neural and tendinous adaptations to 23 day unilateral
lower-limb suspension in young men. J Physiol 583: 1079 –1091, 2007.
19. Degens H, Alway SE. Skeletal muscle function and hypertrophy are
diminished in old age. Muscle Nerve 27: 339 –347, 2003.
20. Deschenes MR, Britt AA, Chandler WC. A comparison of the effects of
unloading in young adult and aged skeletal muscle. Med Sci Sports Exerc
33: 1477–1483, 2001.
21. Deschenes MR, Holdren AN, McCoy RW. Adaptations to short-term
muscle unloading in young and aged men. Med Sci Sports Exerc 40:
856 – 863, 2008.
22. Desplanches D, Mayet MH, Sempore B, Flandrois R. Structural and
functional responses to prolonged hindlimb suspension in rat muscle.
J Appl Physiol 63: 558 –563, 1987.
23. Doherty TJ. Invited review: Aging and sarcopenia. J Appl Physiol 95:
1717–1727, 2003.
24. Duchateau J, Hainaut K. Isometric or dynamic training: differential
effects on mechanical properties of a human muscle. J Appl Physiol 56:
296 –301, 1984.
25. Dupont-Versteegden EE. Apoptosis in muscle atrophy: relevance to
sarcopenia. Exp Gerontol 40: 473– 481, 2005.
26. Edström E, Altun M, Bergman E, Johnson H, Kullberg S, Ramı́rezLeón V, Ulfhake B. Factors contributing to neuromuscular impairment
and sarcopenia during aging. Physiol Behav 92: 129 –135, 2007.
27. Esmarck B, Andersen JL, Olsen S, Richter EA, Mizuno M, Kjaer M.
Timing of postexercise protein intake is important for muscle hypertrophy
with resistance training in elderly humans. J Physiol 535: 301–311, 2001.
28. Gallegly JC, Turesky NA, Strotman BA, Gurley CM, Peterson CA,
Dupont-Versteegden EE. Satellite cell regulation of muscle mass is
altered at old age. J Appl Physiol 97: 1082–1090, 2004.
29. Gandevia SC. Spinal and supraspinal factors in human muscle fatigue.
Physiol Rev 81: 1725–1789, 2001.
30. Gandevia SC, Macefield G, Burke D, McKenzie DK. Voluntary activation of human motor axons in the absence of muscle afferent feedback.
The control of the deafferented hand. Brain 113: 1563–1581, 1990.
31. Grounds MD. Age-associated changes in the response of skeletal muscle
cells to exercise and regeneration. Ann N Y Acad Sci 854: 78 –91, 1998.
32. Harridge SDR, Bottinelli R, Canepari M, Pellegrino MA, Reggiani C,
Esbjornsson M, Saltin B. Whole-muscle and single-fibre contractile
properties and myosin heavy chain isoforms in humans. Pflügers Arch
432: 913–920, 1996.
33. Hespel P, Op’t EB, Van LM, Urso B, Greenhaff PL, Labarque V,
Dymarkowski S, Van HP, Richter EA. Oral creatine supplementation
1179
1180
EFFECTS OF IMMOBILIZATION AND RETRAINING IN OLD AGE
J Appl Physiol • VOL
68. Strojnik V, Komi PV. Neuromuscular fatigue after maximal stretchshortening cycle exercise. J Appl Physiol 84: 344 –350, 1998.
69. Suetta C, Aagaard P, Magnusson SP, Andersen LL, Sipila S, Rosted
A, Jakobsen AK, Duus B, Kjaer M. Muscle size, neural activation and
rapid force characteristics in elderly men and women– effects of unilateral
long-term disuse due to hip-osteoarthritis. J Appl Physiol 102: 942–948,
2007.
70. Suetta C, Andersen JL, Dalgas U, Berget J, Koskinen SO, Aagaard P,
Magnusson SP, Kjaer M. Resistance training induces qualitative changes
in muscle morphology, muscle architecture and muscle function in elderly
postoperative patients. J Appl Physiol 105: 180 –186, 2008.
71. Suetta C, Magnusson SP, Rosted A, Aagaard P, Jakobsen AK, Larsen
LH, Duus B, Kjaer M. Resistance training in the early postoperative
phase reduces hospitalization and leads to muscle hypertrophy in elderly
hip surgery patients–a controlled, randomized study. J Am Geriatr Soc 52:
2016 –2022, 2004.
72. Urso ML, Clarkson PM, Price TB. Immobilization effects in young and
older adults. Eur J Appl Physiol 96: 564 –571, 2006.
73. Vandervoort AA. Aging of the human neuromuscular system. Muscle
Nerve 25: 17–25, 2002.
74. Welle S, Thornton C. Insulin-like growth factor-1, actin and myosin
heavy chain messenger mRNAs in skeletal muscle after an injection of
growth hormone in subjects over 60 years old. J Endocrinol 155: 93–97,
1997.
75. Welle S. Cellular and molecular basis of age-related sarcopenia. Can
J Appl Physiol 27: 19 – 41, 2002.
76. Whitman SA, Wacker MJ, Richmond SR, Godard MP. Contributions
of the ubiquitin-proteasome pathway and apoptosis to human skeletal
muscle wasting with age. Pflügers Arch 450: 437– 446, 2009.
77. Zarzhevsky N, Menashe O, Carmeli E, Stein H, Reznick AZ. Capacity
for recovery and possible mechanisms in immobilization atrophy of young
and old animals. Ann N Y Acad Sci 928: 212–225, 2001.
107 • OCTOBER 2009 •
www.jap.org
Downloaded from jap.physiology.org on November 5, 2009
58. Petrella JK, Kim JS, Mayhew DL, Cross JM, Bamman MM. Potent
myofiber hypertrophy during resistance training in humans is associated
with satellite cell-mediated myonuclear addition: a cluster analysis. J Appl
Physiol 104: 1736 –1742, 2008.
59. Pistilli EE, Siu PM, Alway SE. Interleukin-15 responses to aging and
unloading-induced skeletal muscle atrophy. Am J Physiol Cell Physiol
292: C1298 –C1304, 2007.
60. Powell PL, Roy RR, Kanim P, Bello MA, Edgerton VR. Predictability
of skeletal muscle tension from architectural determinations in guinea pig
hindlimbs. J Appl Physiol 57: 1715–1721, 1984.
61. Rantanen T, Harris T, Leveille SG, Visser M, Foley D, Masaki K,
Guralnik JM. Muscle strength and body mass index as long-term predictors of mortality in initially healthy men. J Gerontol A Biol Sci Med Sci
55: M168 –M173, 2000.
62. Reeves ND, Narici MV, Maganaris CN. In vivo human muscle structure
and function: adaptations to resistance training in old age. Exp Physiol 89:
675– 689, 2004.
63. Reeves ND, Narici MV, Maganaris CN. Effect of resistance training on
skeletal muscle-specific force in elderly humans. J Appl Physiol 96:
885– 892, 2004.
64. Renault V, Thornell LE, Eriksson PO, Butler-Browne G, Mouly V.
Regenerative potential of human skeletal muscle during aging. Aging Cell
1: 132–139, 2002.
65. Saltin B, Grimby G. Physiological analysis of middle-aged and old
former athletes. Comparison with still active athletes of the same ages.
Circulation 38: 1104 –1115, 1968.
66. Siu PM, Alway SE. Aging alters the reduction of pro-apoptotic signaling
in response to loading-induced hypertrophy. Exp Gerontol 41: 175–188,
2006.
67. Siu PM, Pistilli EE, Alway SE. Apoptotic responses to hindlimb suspension in gastrocnemius muscles from young adult and aged rats. Am J
Physiol Regul Integr Comp Physiol 289: R1015–R1026, 2005.
Aging Affects the Transcriptional Regulation of Human
Skeletal Muscle Disuse Atrophy
Charlotte Suetta1,4*., Ulrik Frandsen2., Line Jensen1,2, Mette Munk Jensen2, Jakob G. Jespersen1,
Lars G. Hvid2, Monika Bayer1, Stine J. Petersson3, Henrik D. Schrøder3, Jesper L. Andersen1,
Katja M. Heinemeier1, Per Aagaard2, Peter Schjerling1, Michael Kjaer1
1 Institute of Sports Medicine and Center for Healthy Aging, Faculty of Health Sciences, University of Copenhagen, Bispebjerg Hospital, Copenhagen, Denmark, 2 Institute
of Exercise Physiology and Clinical Biomechanics, University of Southern Denmark, Odense, Denmark, 3 Department of Clinical Pathology, Odense University Hospital,
Odense, Denmark, 4 Department of Clinical Physiology and Nuclear Medicine, Glostrup Hospital, University of Copenhagen, Copenhagen, Denmark
Abstract
Important insights concerning the molecular basis of skeletal muscle disuse-atrophy and aging related muscle loss have
been obtained in cell culture and animal models, but these regulatory signaling pathways have not previously been studied
in aging human muscle. In the present study, muscle atrophy was induced by immobilization in healthy old and young
individuals to study the time-course and transcriptional factors underlying human skeletal muscle atrophy. The results
reveal that irrespectively of age, mRNA expression levels of MuRF-1 and Atrogin-1 increased in the very initial phase (2–4
days) of human disuse-muscle atrophy along with a marked reduction in PGC-1a and PGC-1b (1–4 days) and a ,10%
decrease in myofiber size (4 days). Further, an age-specific decrease in Akt and S6 phosphorylation was observed in young
muscle within the first days (1–4 days) of immobilization. In contrast, Akt phosphorylation was unchanged in old muscle
after 2 days and increased after 4 days of immobilization. Further, an age-specific down-regulation of MuRF-1 and Atrogin-1
expression levels was observed following 2 weeks of immobilization, along with a slowing atrophy response in aged skeletal
muscle. Neither the immediate loss of muscle mass, nor the subsequent age-differentiated signaling responses could be
explained by changes in inflammatory mediators, apoptosis markers or autophagy indicators. Collectively, these findings
indicate that the time-course and regulation of human skeletal muscle atrophy is age dependent, leading to an attenuated
loss in aging skeletal muscle when exposed to longer periods of immobility-induced disuse.
Citation: Suetta C, Frandsen U, Jensen L, Jensen MM, Jespersen JG, et al. (2012) Aging Affects the Transcriptional Regulation of Human Skeletal Muscle Disuse
Atrophy. PLoS ONE 7(12): e51238. doi:10.1371/journal.pone.0051238
Editor: Jose A. L. Calbet, University of Las Palmas de Gran Canaria, Spain
Received May 26, 2011; Accepted November 5, 2012; Published December 19, 2012
Copyright: 2012 Suetta et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The study was supported by grants from the Danish National Research Council, the Danish Rheumatology Association, Faculty of Health Sciences,
University of Copenhagen, The Danish Ministry of Culture, MYOAGE (nr. 223576) funded by the European Commission under FP7, The Nordea Foundation and the
Lundbeck Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]
. These authors contributed equally to this work.
Introduction
such signaling pathways remains undescribed in elderly humans
exposed to immobilization.
We therefore set to investigate the modulation in cellular
signaling pathways involved in the initiation and temporal
development of human disuse muscle atrophy, and specifically
examine if aging affects the molecular regulation of human disuse
related muscle loss. Recent data from our group indicate that,
although immobility induces muscle atrophy in both young and
old individuals, the loss in muscle mass was more pronounced in
young [21], as also demonstrated in rodent models [22]. An agespecific regulation of the signaling pathways orchestrating the
initiation and time-course of human disuse muscle atrophy was
therefore hypothesized and a range of genes from signaling
pathways previously demonstrated to play a central role in the
regulation of skeletal muscle atrophy and hypertrophy in a variety
of animal models was profiled [4,6,23–32].
From the ubiquitin-dependent proteolytic system expression
levels of Muscle-specific muscle Ring Finger 1 (MuRF-1) and
Atrogin-1 was assessed as they have been demonstrated to play a
key role in the induction of muscle atrophy in multiple animal
Skeletal muscle wasting is a common debilitating condition
associated with human immobilization and aging resulting in a
reduced muscle function [1,2]. In animal models, loss of muscle
mass with immobilization or unloading has been suggested
primarily to occur through an accelerated degradation of
myofibrillar proteins via the ubiquitin-proteasome pathway [3–
6], although rapid decreases in protein synthesis also has been
shown [7,8]. Somewhat in contrast, studies in young human
individuals have suggested that a decline in protein synthesis
rather than accelerated protein breakdown is responsible for the
muscle loss observed with disuse [9–11]. With aging, muscle loss is
suggested to be associated with increased inflammation [12],
decreased anabolic signaling [13], increased apoptosis [14,15],
impaired myogenic responsiveness [16,17] as well as decreased
mitochondrial function [18]. Moreover, aging has been found to
affect signaling pathways that regulate myogenic growth factors
and myofibrillar protein turnover in skeletal muscle of rodents
[19,20]. However, the differential involvement and time course of
PLOS ONE | www.plosone.org
1
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Figure 1. Immobility-induced skeletal muscle atrophy causes an age-specific decline in muscle size. A. Scheme of experimental setup,
including the time points of muscle biopsy procedure. B. Percentage decreases in muscle size (mean muscle fiber area) after 4 days of immobility in
young (n = 11) and old (n = 9) as well as after 14 days of immobilization in young (n = 11) and old (n = 12), respectively. * Time effect, p,0.05
compared to pre, # Age effect, p,0.05 young compared to old within time point. Group mean data 6 SEM. Mean myofiber area was assessed in the
quadriceps femoris muscle, by muscle biopsy sampling. C. Muscle histology from resting state (pre) and immobility (14 d) was analyzed by
myofibrillar ATPase at pH 10.3 preincubations demonstrating type I (white) and type II muscle fibers (black) [52].
doi:10.1371/journal.pone.0051238.g001
disuse models [4,5,26], although data from human in vivo studies
have been less consistent [9,33–36]. As aging and muscle loss is
associated with a decrease in the activation and sensitivity of the
IGF-1/Akt signaling pathway [37] gene expression profiles of
Insulin-like Growth Factor 1 Ea (IGF-1Ea) and Mechano growth
factor (MGF: IGF-1Ec) were assessed, along with protein levels of
total and phosphorylated Akt as well as total and phosphorylated
ribosomal protein S6. Furthermore, since autophagy in parallel
with proteolysis, has been demonstrated to be an important
stimulator of muscle atrophy in animal models [25,32,38],
isoforms of the FoxO family (FoxO3 and possibly FoxO1) along
with markers of autophagy (GABARAPL, ATG4 and microtubule-associated protein 1 light chain 3 beta, MAP1LC3B) [39,40]
were examined. Further downstream, a range of genes of
importance for oxidative phosphorylation and glycolysis are
known to be coordinately suppressed in a variety of models for
muscle wasting in rodents [6,27] and recently also in young
human individuals following short term immobilization [35]. Over
expression of two of the master genes of mitochondrial biogenesis,
peroxisome proliferator-activated receptor gamma co-activator 1
alpha (PGC-1a) and the close homolog PGC-1b, has been shown
to prevent muscle atrophy by inhibiting muscle proteolysis [41],
and the expression levels of PGC-1a and PGC-1b were therefore
assessed to investigate the potential age-specificity of this signaling
pathway in human disuse muscle atrophy.
PLOS ONE | www.plosone.org
Although, the importance of apoptosis in human skeletal muscle
atrophy has been regarded as controversial, we investigated the
importance of this pathway by assessing the expression levels of the
Bcl-2–associated X protein (Bax), Bcl-2-like protein 1 (BCL2L1)
and tumor protein 53 (p53), as apoptosis seems to play an
important role in the development of muscle atrophy in aged
animal models [14,42–46]. Furthermore, the mRNA expression
level of Nuclear Factor of kappa light polypeptide gene enhancer
in B-cells 1 (NF-kB) along with the upstream pro-inflammatory
cytokine Tumor Necrosis Factor a (TNF-a) were profiled to study
the effect of immobility-induced disuse on the induction of the NFkB pathway [24]. In addition, expression levels of the proinflammatory cytokine IL-6 was profiled as an elevated expression
of this cytokine along with an increased expression level of TNF-a
has been linked to various diseases as well as aging [47].
Collectively, these transcriptional data were combined with
measures of contractile capacity, morphology of the immobilized
muscle and protein quantification in order to gain a more
thorough understanding of the pathways regulating muscle protein
degradation with disuse in old versus young human adults and
further to examine the influence of these molecular regulatory
pathways on muscle function and muscle size.
2
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Materials and Methods
Assessment of contractile muscle strength
Maximal muscle contraction strength was measured for the
quadriceps muscle in a custom made setup where the subjects were
seated in an upright position with back support and the hip and
knee joint flexed at 90u [49]. A steel cuff was strapped around the
lower leg, approximately 2 cm above the medial malleoli and was
connected via a rigid steel bar to a strain gauge load cell (Bofors
KRG-4, Bofors, Sweden), which was connected to an instrumentation-amplifier (Gould 5900, Gould Inc. Valley View, OH USA).
Study design
In the present manuscript results from two human intervention
studies are reported. At first, myofiber atrophy was induced for a
period of 2 weeks to investigate the signaling pathways regulating
disuse skeletal muscle atrophy in young and aged individuals,
respectively (Figure 1). Muscle biopsies of the vastus lateralis
muscle were collected prior to the intervention and immediately
after cast removal. In order to study the time-course and identify
signaling pathways involved in the initiation of disuse muscle
atrophy, two additional groups of young and aged individuals were
recruited and immobility was induced for 4 days. These subjects
were biopsied after 24 h (,1 d), 48 h (,2 d) and 96 h (,4 d) of
immobility (Figure 1A). Within age groups, subjects recruited for
the two immobilization protocols did not differ with respect to age,
weight, BMI and activity level (Table S1).
Muscle biopsy sampling and analyses
Subjects were prohibited to exercise at least 2 days before the
first biopsy and all subjects were biopsied at the same time of the
day (+/21 h) at each testing session. Biopsies were obtained from
the middle portion of m. vastus lateralis utilizing the percutaneous
needle biopsy technique of Bergström [50]. All biopsies were
obtained by the same investigator, and careful efforts were made
to extract tissue from the same depth and within ,2–3 cm
distance between each biopsy, which has been shown to be
sufficient to avoid the influence of muscle damage potentially
induced by repeated biopsies sampling [51]. After dissecting the
muscle samples of all visible blood, adipose and connective tissue,
the muscle samples were divided into two separate pieces, one
oriented in embedding medium (Tissue Tec) frozen in isopentane
cooled with liquid nitrogen and stored at 280uC and one piece
directly frozen in liquid nitrogen and stored at 280uC until further
analyses. Subsequently, serial transverse sections (10 mm) were cut
in a cryotome at 220uC and stained for myofibrillar ATPase at
pH 9.4 after both alkaline (pH 10.3) and acid (pH 4.3) preincubations [52]. All samples of each individual person were stained in
the same batch to avoid interassay variation. Based on the ATPase
staining pattern muscle fibers were characterized as type I and
type II and an average of 277+/249 fibers were analyzed in each
biopsy. For the determination of muscle fiber size only horizontally
fibers were used, with a minimum of 100 fibers included for the
analysis. A videoscope consisting of a microscope (Olympus BX
50) and color video camera (Sanyo high resolution CCD) in
combination with Tema Image-analyses System (Scanbeam Denmark) were used to calculate the mean muscle fiber area.
Human subjects
A total of 43 healthy men volunteered to participate in the two
immobilization studies, 20 persons were recruited for the 14 d
immobilization protocol (11 young: 24.4, range 21–27 yrs; 9 old:
67.3, range 61–74 yrs) while 23 persons were recruited for the 4 d
immobilization protocol (11 young: 24.3, range 21–30 yrs; 12 old:
66.8, range 60–72 yrs) (Table S1). Prior to inclusion a trained
physician screened all subjects to exclude individuals with
cardiovascular disease, diabetes, neural or musculoskeletal disease,
inflammatory or pulmonary disorders or any known predisposition
to deep venous thrombosis. The local Ethics Committee of
Copenhagen and Frederiksberg municipality approved the study
(KF01-322606) and all experimental procedures were performed
in accordance with the Declaration of Helsinki. Written informed
consent was obtained from all participants before inclusion in the
study.
Immobilization protocols
14 d immobilization. This protocol has been described in
detail before [21]along with results on muscle contractile
properties and morphology [21,48] but in brief immobilization
was accomplished by 2 weeks of randomized unilateral whole-leg
casting using a lightweight fiber cast applied from just above the
malleoli to just below the groin. The cast was positioned in 30u of
knee joint flexion to circumvent walking ability of the casted limb
and the subjects were carefully instructed to perform all
ambulatory activities on crutches and abstain from ground contact
as well as performing isometric contractions of quadriceps of the
immobilized leg. Muscle biopsies were obtained at rest 7 days
before the intervention (pre) and immediately following removal of
the cast 14 days post immobilization (14 d) (Figure 1A).
4 d immobilization. In order to obtain muscle biopsies
throughout the immobilization period these subjects had a
randomly assigned leg immobilized using a knee brace (DonJoy,
Orthopedics, Sunny Vista, CA, US) fixated at a knee angle of 30u.
As with the 14 d protocol subjects were provided with crutches
during the immobilization period. Muscle biopsies were obtained
1 wk prior to the immobilization (pre), 24 h post immobilization
(1 d), 48 h post immobilization (2 d) and 96 h post immobilization
(4 d). At all time points muscle biopsies were obtained at rest, and
the 1 d and 2 d time point biopsies were obtained without removal
of the brace, whereas the 4 d time point biopsies were taken
immediately after brace removal.
PLOS ONE | www.plosone.org
RNA purification
Total RNA was isolated from ,20 mg of frozen muscle biopsy
by phenol extraction (TriReagent; Molecular Research Center,
OH, USA) as previously described [53]. Intact RNA was
confirmed by denaturing agarose gel electrophoresis.
Real-time PCR
Total RNA (500 ng) was converted into cDNA in 20 ml using
the OmniScript reverse transcriptase (Qiagen, CA, USA) according to the manufacturer’s protocol. The mRNA expression of
FoxO1, FoxO3, FoxO4, PGC-1a, PGC-1b, IL-6, MGF, IGF-1Ea,
GAPDH and RPLP0 were analyzed by quantitative real-time RTPCR. For each of the mRNA targets, 0.25 ml cDNA was amplified
in a 25 ml SYBR Green PCR reaction containing 16 Quantitect
SYBR Green Master Mix (Qiagen) and 100 nM of each primer
(Table S2A). The amplification was monitored real-time using the
MX3000P real-time PCR machine (Stratagene, CA, USA). The
threshold cycle (Ct) values were related to a standard curve made
with the cloned PCR products and specificity ensured by melting
curves analysis and the quantities were normalized to RPLP0.
TaqMan based quantitative real-time RT-PCR of MuRF-1,
Atrogin-1, NF-kB, Bax, BCL2L1, p53, TNF-a, ATG4B, GABARAPL1, and RPLP0 mRNA (Table S2B) were performed in
3
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Figure 2. Immobility results in an increase in the transcriptional status and immunodetection of Atrogin-1 and MuRF-1 in the early
phase of disuse muscle atrophy. A & B. The mRNA level of Atrogin-1 and MuRF-1 was determined using qRT-PCR and significant increases were
found in the early phase (2–4 days) of immobility, in both young and old skeletal muscle. At the later time-point (14 d) Atrogin-1 and MuRF-1
expression levels decreased in aged muscle, whereas the expression levels of Atrogin-1 and MuRF-1 mRNA were unchanged from baseline in young
muscle. Data are geometric means 6 back-transformed SEM. C. Immunodetection of DAPI (blue), and MuRF-1 (red) are shown for 10 mm skeletal
muscle cryosections. Potential muscle fiber specificity was analyzed by simultaneous incubation of primary antibodies for MuRF-1 mixed with either
anti-skeletal Myosin-Fast or anti-skeletal Myosin-Slow (green), demonstrating an almost 100% affinity of MuRF-1 for type 1 muscle fibers. D. Total
numbers of MuRF-1 positive myofibers were quantified for both young and old muscle and a significant increase was detected in the number of
MuRF-1 positive fibers after 4 days of immobility. * Time effect, p,0.05 compared to pre. * Time effect, p,0.05 bar indicates young and old
combined compared to pre. Data are means 6 SEM. E. Immunodetection of DAPI (blue), Laminin (green) and MuRF-1 (red) are shown for 10 mm
skeletal muscle cryosections at pre, 1 d, 2 d and 4 d of immobilization.
doi:10.1371/journal.pone.0051238.g002
PLOS ONE | www.plosone.org
4
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Figure 4. Immobility induced skeletal muscle atrophy results in an age-specific decrease in Akt and ribosomal protein S6
phosphorylation. A. Western blotting of whole muscle protein homogenates of phosphorylated Akt and total Akt. B. Immobility decreased levels
of phosphorylated Akt/total Akt ratio (p-Akt/Akt) at the early (2–4 days) phase of immobility in young but not aged skeletal muscle. * Time effect,
p,0.05, compared to pre. # Age effect, p,0.001 young compared to old within time point. Due to lack of muscle tissue n = 6 (3 young and 3 old) in
these analyses. C. Western blotting of whole muscle protein homogenates of total and phosphorylated S6 ribosomal protein. D. The percentage of
the total number of subjects at each time point where p-S6 could be detected. Chi-square: Young p,0.001, Old p = 0.44. In a high number of
especially young subjects phosphorylated S6 ribosomal protein (but not total S6 ribosomal protein) became non detectable after immobilization
which made an exact quantification impossible.
doi:10.1371/journal.pone.0051238.g004
Western blotting analyses
Biosciences). Total and phosphorylated protein pairs were
detected simultaneously on the same membrane. Band intensities
were quantified using ImageJ (National Institutes of Health,
Bethesda, MD, USA). Total and phospho (serine 473) Akt primary
antibodies (Cell Signaling Technology, Danvers, MA, USA,
no. 2920 and 4060) were diluted 1:2,000 and actin (Sigma, Saint
Louis, MO, USA, no. A2066) primary antibody was diluted
1:10,000. Due to low tissue availability n equals 3 in each age
group for the measurement of total and phospho Akt. Western blot
analysis for LC3B, as well as S6 ribosomal protein and phospho-S6
ribosomal protein (Ser235/236) were performed on frozen tissue
homogenized in 10 volumes (wt/vol) of ice-cold buffer (300 mM
Sucrose, 1 mM EDTA, 10 mM NaN3, 40 mM tris-base and
40 mM histidine at pH 7.8 with protease inhibitors,
#05892791001, Roche Inc.) using a 1 ml glass homogenizer with
a glass pestle (Kontes Glass Industry, Vineland, NJ). Protein
content in the muscle homogenate was measured in triplicates
using a standard kit (Pierce BCA protein reagent no. 23225, Pierce
Inc.). Samples were heated at 90uC for 4 min, shortly vortexed
and spun in a microcentrifuge and equal amounts (20 mg) were
separated by SDS-PAGE using a 4–15% Tris/glycine gel
(Miniprotean TGX, BioRad, Hercules, CA, USA) at 200 V for
35 min. Gels were blotted (Trans-blot cell, Bio-Rad, 250 mA, 1 h)
to polyvinylidene difluoride membranes (Immun-Blot PVDF,
From each muscle biopsy 150 cryosections (10 mm) were
homogenized in a micro vial containing 1 silicium carbide crystal,
5 steel beads (2.3 mm) and 250 ml ice-cold homogenization buffer
(50 mM Tris-base, 1 mM EDTA, 1 mM EGTA, 10 mM betaglycerophosphate, 50 mM sodium fluoride, 0.5 mM sodium
orthovanadate, 0.1% v/v, Triton-X, 0.1% v/v mercaptoethanol
and protease inhibitor (Complete, Roche, Basel, Schwitzerland),
pH 7.5) using a FastPrep-24 (MP Biomedicals, Solon, OH, USA)
homogenizer. Laemmli buffer was added and protein concentrations were determined with the EZQ Protein Quantitation Kit
according to the manufacturer’s protocol (Molecular Probes,
Eugene, OR, USA). Then, samples were heated at 90uC for
4 min, shortly vortexed and spun in a microcentrifuge and equal
amounts (10 mg/4 ml) were separated by SDS-PAGE using a 4–
12% Bis-Tris gel (Criterion, Bio-Rad, Hercules, CA, USA) at
200 V for 1 h. Gels were blotted (Trans-blot cell, Bio-Rad,
400 mA, 2 h) to polyvinylidene difluoride membranes (Amersham
Hybond LFP, GE Healthcare, Buckinghamshire, UK), which were
blocked for 30 min with 20% Odyssey blocking buffer (Li-Cor
Biosciences, Lincoln, NE, USA) in phosphate-buffered saline,
incubated overnight at 4uC with primary antibody, incubated for
1 h in fluorophore-conjugated with secondary antibody and
visualized with the Odyssey Infrared Imaging System (Li-Cor
PLOS ONE | www.plosone.org
6
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
HRP-conjugated secondary antibody (Immun-Star Goat AntiRabbit (GAR)-HRP Conjugate, #170-5046, BioRad, Hercules,
Ca, USA) and visualized with Immun-star western kit (#1705070, BioRad, Hercules, Ca, USA). After detecting the phosphorylated protein, the membrane was stripped and the total protein
was detected. Band exposure and visualization were quantified
using ChemiDoc XRS with Image Lab Software (Bio-Rad
Laboratories, Inc.)
Statistical analyses
A part from total and phosphorylated S6 ribosomal protein, all
mRNA and Western blot data were log-transformed prior to
statistical analyses and are presented as geometric means 6 backtransformed SEM. To test for changes over time (mRNA,
TUNEL, Immunohistochemistry and Western blot analyses)
one-way Bonferroni corrected repeated-measures ANOVA was
performed separately for young and old individuals, respectively,
as well as for young and old combined (SPSS). Pair wise multitude
comparison procedures were evaluated using Student-NewmanKeuls Method post-hoc testing. Independent-samples t-testing
were used to test for differences between groups’ with a subsequent
Bonferroni correction. As phosphorylated S6 ribosomal protein
(but not total S6 ribosomal protein) became non-detectable after
immobilization in a high number of especially young subjects,
quantification of phosphorylated S6 ribosomal protein/total S6
ribosomal protein was not possible and we therefore decided to
perform a Chi-square test (young p,0.001, old p = 0.44). The
percentage of the total number of subjects where p-S6 could be
detected, at each time-point, are visualized in figure 4D. Nonparametric statistics were used to analyze changes in muscle fiber
CSA, since not all of these data were normally distributed. To
evaluate the effect of intervention over time a repeated-measures
Friedman test was used with post-hoc Wilcoxon testing. Betweengroup differences were analyzed with Kruskall-Wallis tests and
subsequent Mann-Whitney U testing. Data are presented as mean
values 6 SEM. A p-value of less than 0.05 was considered
statistically significant.
Results
Maximal contractile muscle strength
Figure 5. Changes in the transcriptional status of FoxO1,
FoxO3 and FoxO4 as a result of immobility-induced muscle
disuse. A–C. The mRNA level of FoxO1, FoxO3 and FoxO4 was
determined using qRT-PCR. No up-regulation in the mRNA expression
levels in any of these three genes was observed during the initial phase
of immobility, in contrast, a general down-regulation in all three genes
was observed in both young and aged muscle at the 4 d time point,
potentially reflecting a negative feedback signal from high presence of
active FoxO protein in the muscle cell. However, it is difficult to
interpret the role of FoxO in the present study since the phosphorylated
forms of FoxO were not measured. * Time effect, p,0.05 bar indicates
young and old within time point. Data are geometric means 6 backtransformed SEM.
doi:10.1371/journal.pone.0051238.g005
Maximal contractile muscle strength declined in both young
(13%) and old (14%) after 4 days of unloading, with no difference
between age groups (Figure S1A). Following 14 days of unloading
maximal isometric muscle strength was reduced by 20% in young
and by 16% in old, again with no age-related differences (Figure
S1A).
Muscle fiber cross sectional area
Despite the very limited period of immobilization, our
histological analyses revealed significant decreases in mean
myofiber area of approximately 10% in both young and old
subjects after 4 days of immobility (Figure 1B). However, following
14 days of immobilization the loss in mean myofiber size was
greater in young (219.9%) than old individuals (212.6%, p,0.01)
(Figure 1B). There was no difference between the decline in type 1
(O: 27.1%, Y: 28.1%) and type 2 (O: 210.9%, Y: 212.6%)
fibers at the 4 d time-point, however after 14 d the decline in type
2 fibers (O: 217.1%, Y: 226.5%) was significantly larger than in
type 1 fibers (O: 28.9%, Y: 214.3%) in both young and old
(p,0.05) (Figure S1B).
0.2 mm, BioRad, Hercules, Ca, USA), which were blocked for
60 min with 5% Blotting–Grade Blocker (#170-6404, BioRad,
USA) in phosphate-buffered saline with 0.05% Tween 20.
Membranes were subsequently incubated overnight at 4uC with
primary antibody LC3B (1:1000, #2775, Cell Signaling Technology) as well as S6 ribosomal protein (1:1000, #2217, Cell
Signaling Technology Inc.) and phospho-S6 ribosomal protein
(Ser235/236) (1:2000, #4858, Cell Signaling Technology Inc.).
Membranes were subsequently washed and incubated for 1 h with
PLOS ONE | www.plosone.org
7
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Figure 6. Changes in the transcriptional status of ATG4B and GABARAPL1 and LC3B II/I ratio as a result of immobility induced
disuse muscle atrophy. mRNA expression levels of ATG4B and GABARAPL1 were determined using qRT-PCR A–B. ATG4B mRNA expression
increased in both age groups after 14 days of immobility, otherwise no changes were observed in expression levels of ATG4B and GABARAPL1. * Time
effect, p,0.05 compared to pre. Data are geometric means 6 back-transformed SEM. C. Western blotting of whole muscle protein homogenates of
LC3B I and II isoforms; quantified in D. Immobility tended to increase levels of LC3B II/I ratio at 1 days (p = 0,093) and at 4 days (p = 0,066) in young
but not aged skeletal muscle (compared to pre). N = 18 (9 young and 9 old).
doi:10.1371/journal.pone.0051238.g006
Ubiquitin ligases
Forkhead box O (FoxO) transcription factors
The present data revealed a rapid up-regulation of MuRF-1 and
Atrogin-1 mRNA expression levels after 48 h in both young and
old subjects (Figure 2, A–B). These data were further supported by
immunohistochemical staining for MuRF-1 (Figure 2C), which
demonstrated an acute increase in the number of MuRF-1 positive
fibers and nuclei within the first days of immobility in both young
and old muscle (Figure 2D). Notably, there was an almost 100%
affinity of MuRF-1 for type 1 muscle fibers (Figure 2C), although
this was not accompanied by a selective type 1 muscle fiber
atrophy at the 4 d time point (Figure S1B).
There was no up-regulation in the mRNA expression levels of
any of the three isoforms of the FoxO family in skeletal muscle
(FoxO1, FoxO3 and FoxO4) after 4 days or 14 days of
immobilization. In fact, a general down-regulation in all three
genes was observed in both young and aged muscle after 4 days of
unloading but not at the 14 days time point (Figure 5, A–C). No
age related differences were observed at any time point (Figure 5,
A–C).
Autophagy
The mRNA expression profiles of cysteine protease ATG4B and
GABARAPL1 were examined, and a significant up-regulation of
ATG4B was observed after 14 days of immobility in both young
and old (Figure 6A), whereas no changes were observed for the
expression level of GABARAPL1 (Figure 6B). However, using
immunohistochemical targeting of ATG4B no visible autophagosomes could be observed in biopsies obtained from young and old
individuals (data not shown). However, protein analysis of
microtubule-associated protein 1 Light Chain 3 beta (LC3B) I
and II by Western blotting (LC3B II/I ratio) tended to increase at
1 day (p = 0,093) and 4 days (p = 0,066) of immobility in young,
but not aged skeletal muscle (compared to pre) (Figure 6, C–D).
IGF-1/Akt signaling
The data revealed an age-specific (old subjects only) upregulation of IGF-1Ea and MGF at 1 d and 2 d of immobilization,
while a general up-regulation was observed in both age groups
after 14 days of immobility (Figure 3, A–B). Furthermore, protein
analysis by Western blotting revealed selective decreases in
phosphorylated Akt/total Akt ratio (2 d and 4 d) in young
individuals. In addition, the number of subjects, where phosphorylated S6 ribosomal protein could be detected within the very first
days of immobilization was reduced in young compared to old
individuals (1 d and 2 d) (Figure 4, A–D). No change was observed
in protein levels of Actin in neither young nor old muscle (Figure
S3).
PLOS ONE | www.plosone.org
PGC-1 co-activators
The expression levels of PGC-1a mRNA revealed a marked
down-regulation at 1 d in young muscle (Figure 7A) and a down8
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
histochemical staining for TUNEL and the endothelial marker
CD-31, as well as the macrophage marker CD-68 and the muscle
satellite cell marker Pax7 did not reveal any TUNEL-positive
endothelial cells, macrophages (data not shown) or muscle satellite
cells (Figure 8F).
NF-kB signaling and pro-inflammatory cytokines
Apart from a small increase in the expression of NF-kB at 14 d,
there was no change in the mRNA expression of NF-kB or TNF-a
at any time-point in neither young nor old muscle. Further, there
was a small increase in the expression level of IL-6 mRNA in both
young and aged muscle after 4 days of immobility, but beside this
no major induction of this pro-inflammatory cytokine was
observed (Figure S2).
Discussion
The mechanisms underlying human skeletal muscle atrophy in
aged muscle are largely unknown. In the present study, we report
transcriptional data from regulatory signaling pathways related to
skeletal muscle disuse-atrophy, which has not previously been
studied in aging human muscle. The main findings were that
irrespectively of age the ubiquitin-proteasome pathway was
activated in the very initial phase (2–4 days) of human disusemuscle atrophy along with a marked reduction in markers of
oxidative metabolism. Moreover, an age-specific regulation of Akt
and S6 phosphorylation was observed with a decrease in young
muscle within the first days (1–4 days) of immobilization. In
contrast, aged muscle demonstrated a rise in Akt phosphorylation
at 4 days along with a decrease in mRNA expression levels of
MuRF-1 and Atrogin-1 after 14 days of leg muscle immobilization. Furthermore, elderly individuals demonstrated less overall
muscle loss with disuse than their young counterparts after 14 days
(but not 4 days) of muscle disuse. Neither the immediate loss in
muscle mass, nor the subsequent age-differentiated signaling
responses could be explained by changes in inflammatory
mediators or markers of apoptosis.
Certain controversy exists in the literature regarding whether
muscle atrophy in human skeletal muscle is regulated primarily via
an increase in protein degradation or a decrease in protein
synthesis. In animal models, evidence has pointed at protein
degradation as the main driving factor, with the ubiquitindependent proteolytic system being rapidly activated [3–6] in
relation to unloading and various disease states [4,6,26], although
decreases in protein synthesis also have been demonstrated
[7,55,56]. In contrast, the role of the ubiquitin-proteasome
pathway in human in vivo studies has been less consistent [9,33–
36,57]. Our data revealed a significant up-regulation in MuRF-1
and Atrogin-1 within the initial days of immobility (,2–4 days),
with no difference between young and aged muscle. Similar results
have recently been observed after 48 h and 72 h of unloading in
young human individuals [35,57], which could suggest a role for
the ubiquitin-proteasome pathway in the initiation of human
skeletal muscle atrophy. The fact that we observed more modest
changes compared to previous animal reports may reflect that
more drastic and/or systemic wasting models were used in these
animal studies [4–6] compared to human immobilization models.
Notably, the present data revealed that expression levels of
Atrogin-1 and MuRF-1 returned to basal levels after 14 days of
immobility in young individuals and was further down-regulated
in old individuals, along with a (compared to young) smaller
decrease in muscle fiber area. These findings may indicate that the
ubiquitin-proteasome pathway mediate a transient rise in protein
degradation in human skeletal muscle important for the initial and
Figure 7. Changes in the transcriptional status of PGC-1a and
PGC-1b as a result of immobility-induced disuse-muscle
atrophy. The mRNA level of PGC-1a and PGC-1b was determined
using qRT-PCR. A. The results revealed a marked down-regulation of
PGC-1a at 24 h in young muscle and a down-regulation in both young
and old muscle at the later time points (2 d, 4 d and 14 d). B. The
expression levels of PGC-1b mRNA also revealed an age-specific downregulation after 24 h in young muscle and a down-regulation in both
young and old muscle at 2 d and 4 d. In contrast to PGC-1a, the
expression levels of PGC-1b mRNA returned to basal levels at 14 days of
immobilization, indicating that the two genes may play different roles
in the later stages of muscle unloading. * Time effect, p,0.05 compared
to pre. Data are geometric means 6 back-transformed SEM.
doi:10.1371/journal.pone.0051238.g007
regulation in both young and old muscle at both intermediate and
later time points (2 d, 4 d and 14 d). In line with the present PGC1a data, expression levels of PGC-1b mRNA revealed a rapid agespecific down-regulation in young muscle following 1 d immobilization, and a more sustained down-regulation in both young and
aged muscle at 2 d and 4 d of immobilization (Figure 7B). In
contrast, expression levels of PGC-1b mRNA returned to basal
levels at 14 d immobilization in both age-groups.
Apoptosis
Our data revealed an age-specific up-regulation of Bax and p53
in aged muscle after only 2 days of immobility, with further
increasing levels after 4 days in both young and old muscle
(Figure 8, A&C). These data were supported by a significant
increase in TUNEL-positive nuclei (Figure 8, D–E). However,
very few TUNEL-positive myonuclei were observed in both young
and old muscle and the expression pattern was not related to the
immobilization intervention (data not shown). TUNEL-positive
nuclei were mainly localized outside the plasma membrane in the
interstitial space between muscle cells, potentially comprised by
satellite cells, endothelial cells and leukocytes. Double immunoPLOS ONE | www.plosone.org
9
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
Figure 8. Immobility increases the transcriptional status of Bax, BCL2L1 and p53 and the immunodetection of TUNEL. A–C. The
mRNA level of Bax, BCL2L1 and p53 was determined using qRT-PCR and significant increases were found in the early phase (0–4 days) as well as later
phase (14 days) of disuse-muscle atrophy D. Skeletal muscle cryosections were immunostained for nNOS (red), DAPI (blue) and TUNEL (green). E.
Total numbers of TUNEL-positive nuclei were quantified for both young and old muscle and significant increases of TUNEL-positive nuclei were
detected in old muscle in the early phase of immobility (1–2 days) and in both young and old after 4 days of immobility. F. Double
immunohistochemical staining for TUNEL and the muscle satellite cell marker Pax7 did not reveal any TUNEL-positive muscle satellite cells. Additional
green fluorescent expression on the shown image is due to autofluorescence by lipofusin and this is considered non-specific in our analysis. *Time
effect, p,0.05 compared to pre. * Time effect, p,0.05 bar indicates young and old combined compared to pre. Data are means 6 SEM.
doi:10.1371/journal.pone.0051238.g008
rapid loss of muscle mass with disuse but may not be important for
a more prolonged atrophy response [35]. Notably, a similar timecourse of MuRF-1 and Atrogin-1 expression levels has been
demonstrated in the rat model after denervation and spinal cord
injury [26].
A transient rise in signaling markers of protein degradation
does, however, not exclude a simultaneous down-regulation of
protein synthesis with immobilization which has been demonstrated to occur in young individuals [9–11,58,59]. In line with
PLOS ONE | www.plosone.org
these results, as well as previous data shown by Booth and coworkers in a rat model [7], a decline was observed in
phosphorylated Akt and phosphorylated ribosomal protein S6 in
the initial phase of immobility (day 1–4) in the present study. In
addition to being a central regulator of muscle protein synthesis
and muscle hypertrophy the IGF-1/Akt signaling pathway has
been proposed to be a potent suppressor of myofibrillar proteolysis
and atrophy related ubiquitin ligases, respectively [23,39,60,61].
In speculative terms, the present findings of an age-specific pattern
10
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
in Akt and ribosomal protein S6 phosphorylation suggests that
immobility leads to reduced protein synthesis in young skeletal
muscle, in line with previous findings [9–11,58,59]. In contrast,
the - relative to young - higher Akt phosphorylation in elderly in
combination with an early up-regulation of MGF and IGF-1Ea
expression is potentially contributing to the attenuated atrophy
response in aging skeletal muscle observed in the present study. In
support of these findings, the expression of molecular markers for
anabolic signaling (mTOR and S6K1) and elevated protein
synthesis rate either remained unchanged or increased in 24 and
27 months old sarcopenic rats compared to young animals [62].
Although a coordinated regulation of the ubiquitin-proteasome
and the autophagy-lysosome pathways has been shown to exist in
mice [25,32,63], the present study did not demonstrate an increase
in expression levels of ATG4, GABARAPL or FoxO3 mRNAs
(Figure 6, A–B and Figure 5B). However, we did see a trend
towards an increase in LC3B II/I protein ratio selectively in young
muscle after 1 d and 4 d of immobility, which suggests that the
autophagic process (lipidation) was initiated at least in the young
myofibers and thus, crosstalk between the ubiquitin-proteasome
and the autophagy-lysosome pathways may also exist in the
human model. However, more detailed studies investigating both
upstream and downstream regulators of the autophagic and
proteolytic processes in humans are needed to elucidate these
signaling pathways. Further, the present data revealed that disuse
of skeletal muscle resulted in a marked down-regulation of genes
involved in oxidative metabolism, consistent with findings from
recent human gene array studies [34,35]. Specifically, our results
demonstrated age-specific differences in the modulation of PGC1a and PGC-1b, with a delayed and smaller response in old
muscle compared to that of young individuals. These findings
support the hypothesis that the down-regulation of PGC-1a and
PGC-1b could be important determinants for the initiation of
human skeletal muscle atrophy, as also observed in rodents
[27,41]. Although only minor transcriptional changes of FoxO
were noted in the present study, we found a rapid increase in
atrogenes downstream of FoxO (Figure 2). However, as protein
levels of FoxO were not determined, it is not possible to exclude
that high levels of FoxO in the cell and the nucleus will feedback
upon the FoxO signaling it self. If so, the present finding of
reduced FoxO after 4 days could reflect a feedback phenomenon.
Another topic of debate has been the role of apoptosis in human
skeletal muscle atrophy and sarcopenia. There are a significant
amount of data indicating an important role for apoptosis in the
development of muscle atrophy observed with aging in animal
models [14,42–46], whereas human data have been more
inconsistent [64–66]. Notably, despite an increase in TUNELpositive nuclei was observed primarily in aging muscle after
immobility (Figure 8, D–E), there were limited signs of specific
cellular TUNEL-positive myonuclei in young as well as old
muscle, in contrast to previous findings in the murine model [67].
The TUNEL-positive nuclei observed in the present study were
primarily localized in the interstitial space between muscle cells
and the cellular origin and were neither macrophages, endothelial
cells nor muscle satellite cells. Thus myofiber as well as muscle
satellite cells apoptosis seems not to play a key role for the
initiation of human disuse-muscle atrophy in agreement with
recent mice studies [68].
In conclusion, the present findings collectively demonstrate that
a number of signaling pathways related to both muscle atrophy
and muscle hypertrophy are activated in the initial phase of disuse
along with a rapid atrophy response in skeletal muscle of both
young and old individuals. Importantly, activation of the
ubiquitin-proteasome pathway was observed along with a downPLOS ONE | www.plosone.org
regulation of PGC-1a and PGC-1b during the first 1–2 days of
disuse, suggesting that proteolysis may play an important role in
the initiation of human disuse atrophy in both young and old
muscle. These changes were accompanied by rapid decreases in
phosphorylated Akt and phosphorylated ribosomal protein S6
selectively in young muscle. In contrary, aged muscle selectively
showed an elevated Akt phosphorylation and up-regulation of
IGF-1Ea and MGF in combination with a decrease in Atrogin-1
and MuRF-1 mRNA expression levels and a less marked atrophy
response in the later phase of disuse.
Although several fundamental mechanistic questions in regards
to muscle loss remains to be answered, the present data provide
novel insights into the molecular regulation of human skeletal
muscle disuse-atrophy and its modulation by aging. Our findings
indicate that the initiation and regulation of human skeletal muscle
atrophy is age dependent and involves a number of independent
signaling pathways. These findings may be important for the
identification of biomarkers and future therapeutic intervention
paradigms that can be used to counteract human skeletal muscle
atrophy in relation to aging and disuse.
Supporting Information
Figure S1 Immobility-induced decrease in maximal
contractile muscle strength and atrophy of type I and
type II muscle fibers. A. Four days of immobility revealed a
rapid decrease in maximal contractile muscle in both young and
old. The rate of loss in muscle strength seemed to slow down in
both groups at 14 d. B. The relative decreases in muscle fiber area
of type I and type II fibers after 4 d and 14 d of immobility in
young and old individuals, revealed a rapid decrease in muscle
fiber area of type I as well as type II fibers, respectively. In contrast
to young subjects, the rate of muscle loss slowed down in old
individuals after 14 d of immobility. * Time effect, p,0.05
compared to pre. # Age effect, p,0.05 difference between young
and old within time point. Data are means 6 SEM.
(TIF)
Figure S2 Changes in the transcriptional status of NFkB, TNF-a and IL-6 as a result of immobility induced
disuse muscle atrophy. The mRNA level of NF-kB, TNF-a
and IL-6 was determined using qRT-PCR. A–B. A part from a
small increase in the expression of NF-kB at 14 d, we did not find
any change in the mRNA expression of NF-kB or TNF-a at any
time-point in neither young nor old muscle. C. A part from a small
increase in the expression level of IL-6 mRNA in both young and
aged muscle after 4 days of immobility, no major induction of this
pro-inflammatory cytokine was observed. * Time effect, p,0.05
compared to pre. * Time effect, p,0.05 bar indicates young and
old combined compared to pre. Data are geometric means 6
back-transformed SEM.
(TIF)
Unchanged actin protein levels during skeletal muscle disuse-atrophy. A. Western blotting of whole
muscle protein isolates; quantified in B. Protein levels of actin
were unchanged at the early (2–4 days) phase of immobility in
both young and aged skeletal muscle. Data are geometric means 6
back-transformed SEM. Due to lack of muscle tissue n = 6 (3
young and 3 old) in these analyses.
(TIF)
Figure S3
Figure S4 Changes in the transcriptional status of
GAPDH as a result of immobility induced disuse muscle
atrophy. mRNA expression levels of GAPDH were determined
11
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
using qRT-PCR. * Time effect, p,0.05 compared to pre. Data
are geometric means 6 back-transformed SEM.
(TIF)
Atrogin-1, NF-kB, Bax, BCL2L1, p53, TNF-a, ATG4B, GABARAPL1, and RPLP0 mRNA were performed in the ABI Prism
7900HT Sequence System (Applied Biosystems) using ABI
TaqMan Low Density Arrays (Applied Biosystems).
(TIF)
Table S1 Subject characteristics. There was no difference
between subjects from the 14 days and 4 days immobilization
study with respect to age, weight and BMI, young and old
respectively, however, old subjects weighed more and had a higher
body mass index (BMI) than young subjects. # Age effect, p,0.05
old compared to young within time point. Data are means 6
SEM.
(TIF)
Acknowledgments
We would like to express our gratitude to the subjects who participated in
this study for their efforts and contribution to this work.
Author Contributions
Primers for the qRT-PCR and TaqMan Low
Density array (LDA) assay ID. A. The mRNA expression of
FoxO1, FoxO3, FoxO4, PGC-1a, PGC-1b, IL-6, MGF, IGF-1Ea
and RPLP0 were analyzed by quantitative real-time RT-PCR. B.
TaqMan based quantitative real-time RT-PCR of MuRF-1,
Table S2
Conceived and designed the experiments: CS UF PS MK. Performed the
experiments: CS UF LGH LJ MMJ JGJ. Analyzed the data: LJ MMJ JGJ
MB LGH JLA SJP HDS UF PS CS. Contributed reagents/materials/
analysis tools: PAA HDS KH PS. Wrote the paper: CS UF PAA MK.
References
22. Pistilli EE, Siu PM, Alway SE (2006) Molecular regulation of apoptosis in fast
plantaris muscles of aged rats. J Gerontol A Biol Sci Med Sci 61: 245–255.
23. Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, et al. (2001) Akt/
mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can
prevent muscle atrophy in vivo. Nat Cell Biol 3: 1014–1019.
24. Hunter RB, Stevenson E, Koncarevic A, Mitchell-Felton H, Essig DA, et al.
(2002) Activation of an alternative NF-kappaB pathway in skeletal muscle during
disuse atrophy. FASEB J 16: 529–538.
25. Mammucari C, Milan G, Romanello V, Masiero E, Rudolf R, et al. (2007)
FoxO3 controls autophagy in skeletal muscle in vivo. Cell Metab 6: 458–471.
26. Sacheck JM, Hyatt JP, Raffaello A, Jagoe RT, Roy RR, et al. (2007) Rapid
disuse and denervation atrophy involve transcriptional changes similar to those
of muscle wasting during systemic diseases. FASEB J 21: 140–155.
27. Sandri M, Lin J, Handschin C, Yang W, Arany ZP, Lecker SH, et al. (2006)
PGC-1alpha protects skeletal muscle from atrophy by suppressing FoxO3 action
and atrophy-specific gene transcription. Proc Natl Acad Sci U S A 103: 16260–
16265.
28. Calura E, Cagnin S, Raffaello A, Laveder P, Lanfranchi G, et al. (2008) Metaanalysis of expression signatures of muscle atrophy: gene interaction networks in
early and late stages. BMC Genomics 9: 630.
29. Stevenson EJ, Giresi PG, Koncarevic A, Kandarian SC (2003) Global analysis of
gene expression patterns during disuse atrophy in rat skeletal muscle. J Physiol
551: 33–48.
30. Jagoe RT, Goldberg AL (2001) What do we really know about the ubiquitinproteasome pathway in muscle atrophy? Curr Opin Clin Nutr Metab Care 4:
183–190.
31. Raffaello A, Laveder P, Romualdi C, Bean C, Toniolo L, et al. (2006)
Denervation in murine fast-twitch muscle: short-term physiological changes and
temporal expression profiling. Physiol Genomics 25: 60–74.
32. Zhao J, Brault JJ, Schild A, Cao P, Sandri M, et al. (2007) FoxO3 coordinately
activates protein degradation by the autophagic/lysosomal and proteasomal
pathways in atrophying muscle cells. Cell Metab 6: 472–483.
33. Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N, et al. (2004) Disuse
atrophy and exercise rehabilitation in humans profoundly affects the expression
of genes associated with the regulation of skeletal muscle mass. FASEB J 18:
1025–1027.
34. Chen YW, Gregory CM, Scarborough MT, Shi R, Walter GA, et al. (2007)
Transcriptional pathways associated with skeletal muscle disuse atrophy in
humans. Physiol Genomics 31: 510–520.
35. Abadi A, Glover EI, Isfort RJ, Raha S, Safdar A, et al. (2009) Limb
immobilization induces a coordinate down-regulation of mitochondrial and
other metabolic pathways in men and women. PLoS ONE 4: e6518.
36. Leger B, Cartoni R, Praz M, Lamon S, Deriaz O, et al. (2006) Akt signalling
through GSK-3beta, mTOR and Foxo1 is involved in human skeletal muscle
hypertrophy and atrophy. J Physiol 576: 923–933.
37. Leger B, Derave W, De BK, Hespel P, Russell AP (2008) Human sarcopenia
reveals an increase in SOCS-3 and myostatin and a reduced efficiency of Akt
phosphorylation. Rejuvenation Res 11: 163–175B.
38. Zhao J, Brault JJ, Schild A, Goldberg AL (2008) Coordinate activation of
autophagy and the proteasome pathway by FoxO transcription factor.
Autophagy 4: 378–380.
39. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, et al. (2004) Foxo
transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and
cause skeletal muscle atrophy. Cell 117: 399–412.
40. Senf SM, Dodd SL, Judge AR (2010) FOXO signaling is required for disuse
muscle atrophy and is directly regulated by Hsp70. Am J Physiol Cell Physiol
298: C38–C45.
1. Bloomfield SA (1997) Changes in musculoskeletal structure and function with
prolonged bed rest. Medicine and Science in Sports and Exercise 29: 197–206.
2. Janssen I, Heymsfield SB, Ross R (2002) Low relative skeletal muscle mass
(sarcopenia) in older persons is associated with functional impairment and
physical disability. Journal of the American Geriatrics Society 50: 889–896.
3. Furuno K, Goodman MN, Goldberg AL (1990) Role of different proteolytic
systems in the degradation of muscle proteins during denervation atrophy. J Biol
Chem 265: 8550–8557.
4. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, et al. (2001)
Identification of ubiquitin ligases required for skeletal muscle atrophy. Science
294: 1704–1708.
5. Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL (2001) Atrogin-1, a
muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl
Acad Sci U S A 98: 14440–14445.
6. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, et al. (2004) Multiple
types of skeletal muscle atrophy involve a common program of changes in gene
expression. FASEB J 18: 39–51.
7. Booth FW, Seider MJ (1979) Early change in skeletal muscle protein synthesis
after limb immobilization of rats. J Appl Physiol 47: 974–977.
8. Watson PA, Stein JP, Booth FW (1984) Changes in actin synthesis and alphaactin-mRNA content in rat muscle during immobilization. Am J Physiol 247:
C39–C44.
9. de Boer MD, Selby A, Atherton P, Smith K, Seynnes OR, et al. (2007) The
temporal responses of protein synthesis, gene expression and cell signalling in
human quadriceps muscle and patellar tendon to disuse. J Physiol 585: 241–251.
10. Gibson JN, Halliday D, Morrison WL, Stoward PJ, Hornsby GA, et al. (1987)
Decrease in human quadriceps muscle protein turnover consequent upon leg
immobilization. Clin Sci (Lond) 72: 503–509.
11. Glover EI, Phillips SM, Oates BR, Tang JE, Tarnopolsky MA, et al. (2008)
Immobilization induces anabolic resistance in human myofibrillar protein
synthesis with low and high dose amino acid infusion. J Physiol 586: 6049–6061.
12. Bruunsgaard H, Andersen-Ranberg K, Hjelmborg JB, Pedersen BK, Jeune B
(2003) Elevated levels of tumor necrosis factor alpha and mortality in
centenarians. Am J Med 115: 278–283.
13. Cuthbertson D, Smith K, Babraj J, Leese G, Waddell T, et al. (2005) Anabolic
signaling deficits underlie amino acid resistance of wasting, aging muscle.
FASEB J 19: 422–424.
14. Dirks A, Leeuwenburgh C (2002) Apoptosis in skeletal muscle with aging.
Am J Physiol Regul Integr Comp Physiol 282: R519–R527.
15. Dupont-Versteegden EE (2005) Apoptosis in muscle atrophy: relevance to
sarcopenia. Exp Gerontol 40: 473–481.
16. Carlson ME, Suetta C, Conboy MJ, Aagaard P, Mackey A, et al. (2009)
Molecular aging and rejuvenation of human muscle stem cells. EMBO Mol Med
1: 381–391.
17. Grounds MD (1998) Age-associated changes in the response of skeletal muscle
cells to exercise and regeneration. Ann N Y Acad Sci 854: 78–91.
18. Marcinek DJ, Schenkman KA, Ciesielski WA, Lee D, Conley KE (2005)
Reduced mitochondrial coupling in vivo alters cellular energetics in aged mouse
skeletal muscle. J Physiol 569: 467–473.
19. Alway SE, Lowe DA, Chen KD (2001) The effects of age and hindlimb
supension on the levels of expression of the myogenic regulatory factors MyoD
and myogenin in rat fast and slow skeletal muscles. Exp Physiol 86: 509–517.
20. Bar-Shai M, Carmeli E, Reznick AZ (2005) The role of NF-kappaB in protein
breakdown in immobilization, aging, and exercise: from basic processes to
promotion of health. Ann N Y Acad Sci 1057: 431–447.
21. Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K, et al. (2009) Effects
of aging on human skeletal muscle after immobilization and retraining. J Appl
Physiol 107: 1172–1180.
PLOS ONE | www.plosone.org
12
December 2012 | Volume 7 | Issue 12 | e51238
Regulation of Disuse Atrophy in Human Muscle
41. Brault JJ, Jespersen JG, Goldberg AL (2010) Peroxisome proliferator-activated
receptor gamma coactivator 1alpha or 1beta overexpression inhibits muscle
protein degradation, induction of ubiquitin ligases, and disuse atrophy. J Biol
Chem 285: 19460–19471.
42. Marzetti E, Wohlgemuth SE, Lees HA, Chung HY, Giovannini S, et al. (2008)
Age-related activation of mitochondrial caspase-independent apoptotic signaling
in rat gastrocnemius muscle. Mech Ageing Dev 129: 542–549.
43. Marzetti E, Carter CS, Wohlgemuth SE, Lees HA, Giovannini S, et al. (2009)
Changes in IL-15 expression and death-receptor apoptotic signaling in rat
gastrocnemius muscle with aging and life-long calorie restriction. Mech Ageing
Dev 130: 272–280.
44. Phillips T, Leeuwenburgh C (2005) Muscle fiber specific apoptosis and TNFalpha signaling in sarcopenia are attenuated by life-long calorie restriction.
FASEB J 19: 668–670.
45. Pistilli EE, Jackson JR, Alway SE (2006) Death receptor-associated pro-apoptotic
signaling in aged skeletal muscle. Apoptosis 11: 2115–2126.
46. Siu PM, Pistilli EE, Butler DC, Alway SE (2005) Aging influences cellular and
molecular responses of apoptosis to skeletal muscle unloading. Am J Physiol Cell
Physiol 288: C338–C349.
47. Bruunsgaard H, Pedersen BK (2003) Age-related inflammatory cytokines and
disease. Immunol Allergy Clin North Am 23: 15–39.
48. Hvid L, Aagaard P, Justesen L, Bayer ML, Andersen JL, et al. (2010) Effects of
aging on muscle mechanical function and muscle fiber morphology during shortterm immobilization and subsequent retraining. J Appl Physiol 109: 1628–1634.
49. Suetta C, Andersen JL, Dalgas U, Berget J, Koskinen S, et al. (2008) Resistance
training induces qualitative changes in muscle morphology, muscle architecture,
and muscle function in elderly postoperative patients. J Appl Physiol 105: 180–
186.
50. Bergström J (1962) Muscle electrolytes in man. Scand J Clin Lab Invest
68(suppl): 1–110.
51. Guerra B, Gomez-Cabrera MC, Ponce-Gonzalez JG, Martinez-Bello VE,
Guadalupe-Grau A, et al. (2011) Repeated muscle biopsies through a single skin
incision do not elicit muscle signaling, but IL-6 mRNA and STAT3
phosphorylation increase in injured muscle. J Appl Physiol 110: 1708–1715.
52. Brooke MH, Kaiser KK (1970) Muscle fiber types: How many and what kind?
Arch Neurol 23: 369–379.
53. Kadi F, Schjerling P, Andersen LL, Charifi N, Madsen JL, et al. (2004) The
effects of heavy resistance training and detraining on satellite cells in human
skeletal muscles. J Physiol 558: 1005–1012.
54. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402–408.
PLOS ONE | www.plosone.org
55. Thomason DB, Biggs RB, Booth F (1989) Protein metabolism and beta-myosin
heavy-chain mRNA in unweighted soleus muscle. Am J Physiol 257: R300–305.
56. Thomason DB, Booth FW (1990) Atrophy of the soleus muscle by hindlimb
unweighting. J Appl Physiol 68: 1–12.
57. Gustafsson T, Osterlund T, Flanagan JN, von WF, Trappe TA, et al. (2010)
Effects of 3 days unloading on molecular regulators of muscle size in humans.
J Appl Physiol 109: 721–727.
58. Ferrando AA, Lane HW, Stuart CA, vis-Street J, Wolfe RR (1996) Prolonged
bed rest decreases skeletal muscle and whole body protein synthesis. Am J Physiol
270: E627–E633.
59. Paddon-Jones D, Sheffield-Moore M, Cree MG, Hewlings SJ, Aarsland A, et al.
(2006) Atrophy and impaired muscle protein synthesis during prolonged
inactivity and stress. J Clin Endocrinol Metab 91: 4836–4841.
60. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, et al. (2004) The IGF1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin
ligases by inhibiting FOXO transcription factors. Mol Cell 14: 395–403.
61. Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL (2004) IGF-I stimulates
muscle growth by suppressing protein breakdown and expression of atrophyrelated ubiquitin ligases, atrogin-1 and MuRF1. Am J Physiol Endocrinol Metab
287: E591–E601.
62. Kimball SR, O’Malley JP, Anthony JC, Crozier SJ, Jefferson LS (2004)
Assessment of biomarkers of protein anabolism in skeletal muscle during the life
span of the rat: sarcopenia despite elevated protein synthesis. Am J Physiol
Endocrinol Metab 287: E772–E780.
63. Sandri M (2008) Signaling in muscle atrophy and hypertrophy. Physiology
(Bethesda) 23: 160–170.
64. Malmgren LT, Jones CE, Bookman LM (2001) Muscle fiber and satellite cell
apoptosis in the aging human thyroarytenoid muscle: a stereological study with
confocal laser scanning microscopy. Otolaryngol Head Neck Surg 125: 34–39.
65. Strasser H, Tiefenthaler M, Steinlechner M, Eder I, Bartsch G, et al. (2000) Age
dependent apoptosis and loss of rhabdosphincter cells. J Urol 164: 1781–1785.
66. Whitman SA, Wacker MJ, Richmond SR, Godard MP (2009) Contributions of
the ubiquitin-proteasome pathway and apoptosis to human skeletal muscle
wasting with age. Pflugers Arch 450: 437–446.
67. Dupont-Versteegden EE, Strotman BA, Gurley CM, Gaddy D, Knox M, et al.
(2006) Nuclear translocation of EndoG at the initiation of disuse muscle atrophy
and apoptosis is specific to myonuclei. Am J Physiol Regul Integr Comp Physiol
291: R1730–R1740.
68. Bruusgaard JC, Gundersen K (2008) In vivo time-lapse microscopy reveals no
loss of murine myonuclei during weeks of muscle atrophy. J Clin Invest 118:
1450–1457.
13
December 2012 | Volume 7 | Issue 12 | e51238
3789
J Physiol 591.15 (2013) pp 3789–3804
Ageing is associated with diminished muscle re-growth
and myogenic precursor cell expansion early after
immobility-induced atrophy in human skeletal muscle
C. Suetta1,2 , U. Frandsen3 , A. L. Mackey1 , L. Jensen3 , L. G. Hvid3 , M. L. Bayer1 , S. J. Petersson4 ,
H. D. Schrøder4 , J. L. Andersen1 , P. Aagaard3 , P. Schjerling1 and M. Kjaer1
The Journal of Physiology
1
Institute of Sports Medicine and Center of Healthy Ageing, Faculty of Health and Medical Sciences, University of Copenhagen, Bispebjerg Hospital,
Denmark
2
Department of Clinical Physiology and Nuclear Medicine, Glostrup Hospital, University of Copenhagen, Denmark
3
Institute of Exercise Physiology and Clinical Biomechanics, University of Southern Denmark, Denmark
4
Department of Pathology, Odense University Hospital, Odense, Denmark
Key points
• Elderly individuals require a prolonged recovery phase in order to return to initial muscle mass
levels following short-term immobilisation.
• The cellular mechanisms responsible for the attenuated re-growth and associated molecular
signalling processes in ageing human skeletal muscle are not fully understood.
• The main study finding was the observation of a less marked muscle mass recovery after
immobilisation in elderly compared to young individuals that was paralleled by an elevation
in myogenic precursor cell content in young individuals only, whereas the elderly failed to
demonstrate any change in myogenic precursor cells.
• No age-related differences were observed in the expression of major myogenic regulating factors
known to promote skeletal muscle hypertrophy or satellite cell proliferation (IGF-1Ea, MGF,
MyoD1, myogenin, HGF gene products).
• In contrast, the expression of myostatin demonstrated a more pronounced up-regulation
following immobilisation along with an attenuated down-regulation in response to reloading
in older compared to young individuals, which may have contributed to the present lack of
satellite cell proliferation in ageing muscle.
Abstract Recovery of skeletal muscle mass from immobilisation-induced atrophy is faster in
young than older individuals, yet the cellular mechanisms remain unknown. We examined the
cellular and molecular regulation of muscle recovery in young and older human subjects subsequent to 2 weeks of immobility-induced muscle atrophy. Retraining consisted of 4 weeks of
supervised resistive exercise in 9 older (OM: mean age) 67.3, range 61–74 yrs) and 11 young
(YM: mean age 24.4, range 21–30 yrs) males. Measures of myofibre area (MFA), Pax7-positive
satellite cells (SCs) associated with type I and type II muscle fibres, as well as gene expression
analysis of key growth and transcription factors associated with local skeletal muscle milieu, were
performed after 2 weeks immobility (Imm) and following 3 days (+3d) and 4 weeks (+4wks)
of retraining. OM demonstrated no detectable gains in MFA (vastus lateralis muscle) and no
increases in number of Pax7-positive SCs following 4wks retraining, whereas YM increased their
MFA (P < 0.05), number of Pax7-positive cells, and had more Pax7-positive cells per type II fibre
than OM at +3d and +4wks (P < 0.05). No age-related differences were observed in mRNA
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
DOI: 10.1113/jphysiol.2013.257121
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
3790
C. Suetta and others
J Physiol 591.15
expression of IGF-1Ea, MGF, MyoD1 and HGF with retraining, whereas myostatin expression
levels were more down-regulated in YM compared to OM at +3d (P < 0.05). In conclusion, the
diminished muscle re-growth after immobilisation in elderly humans was associated with a lesser
response in satellite cell proliferation in combination with an age-specific regulation of myostatin.
In contrast, expression of local growth factors did not seem to explain the age-related difference
in muscle mass recovery.
(Resubmitted 16 April 2013; accepted after revision 29 May 2013; first published online 3 June 2013)
Corresponding author C. Suetta: Department of Clinical Physiology and Nuclear Medicine, Glostrup Hospital,
University of Copenhagen, Ndr. Ringvej 57, 2600 Glostrup, Denmark. Email: [email protected]
Abbreviations CDKN1A (p21), cyclin-dependant kinase inhibitor 1A; CDKN1B (p27), cyclin-dependant kinase
inhibitor 1B; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; HGF, hepatocyte growth factor;
IGF-1Ea, insulin-like growth factor-1Ea; MFA, mean fibre area; MGF, mechano growth factor; MFA, myofibre area;
OM, older males; RM, repetition maximum; SC, satellite cell; YM, young males.
Introduction
Human skeletal muscle is a highly plastic tissue, which
is reflected by its ability to rapidly adapt to short-term
changes in habitual loading intensity (Hespel et al. 2001;
Jones et al. 2004; Hvid et al. 2011) and it has been
demonstrated that elderly individuals require a prolonged
recovery phase in order to return to initial muscle mass
levels following short-term immobilisation (Suetta et al.
2009; Hvid et al. 2010). Yet, there is a paucity of studies
examining the cellular mechanisms responsible for the
attenuated re-growth and associated molecular signalling
processes in ageing human skeletal muscle.
The regulation of muscle growth and maintenance of
muscle mass are known to be influenced by a unique
population of muscle resident stem cells referred to
as satellite cells (SCs) or myogenic stem cells (Mauro,
1961; Moss & Leblond, 1970; Heslop et al. 2001).
Notably, an impaired response to muscle damage has
been documented as a consequence of ageing in mice
(Conboy et al. 2003) and recently also demonstrated in
human individuals when examining a subpopulation of
individuals from the present intervention (Carlson et al.
2009). As suggested by the latter data, the age-related
impairment in muscle re-growth following disuse could,
at least in part, reside in an impaired capacity for myogenic stem cell proliferation and activation in aged myofibres (Carlson et al. 2009), but it is not known whether
such changes are related to muscle fibre phenotype (type
I vs. type II fibres). Further, systemic factors appear
to play an important role in explaining the impaired
proliferative capacity of SCs cultured from old vs. young
human adults (Carlson et al. 2009) in close accordance
with previous findings using the murine model (Conboy
et al. 2005). There is, however, also evidence of local
mechanisms influencing satellite cell activation (Sheehan
et al. 2000; Horsley & Pavlath, 2003; Lorenzon et al.
2004; Mitchell & Pavlath, 2004) and recent data suggest
a close relation between various systemic and local factors
in the regulation of SC function in vivo (Chakkalakal
et al. 2012). Furthermore, myogenic regulatory factors
such as MyoD and myogenin, the growth and
differentiation factor myostatin, as well as growth factors
like hepatocyte growth factor (HGF), fibroblast growth
factor (FGF) and insulin-like growth factor (IGF-I)
have been shown to be involved in the regulation of
muscle mass with changes in mechanical muscle loading
while also affecting satellite cell activation, proliferation
and differentiation (Mezzogiorno et al. 1993; Adams &
Haddad, 1996; McPherron et al. 1997; McCroskery et al.
2003; Gopinath & Rando, 2008). However, it is not known
to what extent the expression of these factors are associated
with any age-related differences in recovery of muscle
mass after a period of muscle immobilisation. Based on
the previous findings, we hypothesised that satellite cell
proliferation would be impaired especially in relation
to type II myofibres along with a reduced expression
of key anabolic genes in elderly compared to young
individuals during rehabilitation after immobilisation of
skeletal muscle.
Methods
Subjects
Twenty healthy males, 11 young males (YM; 24.4 years,
range 21–30 years) and 9 older males (OM; 67.3 years,
range 61–74 years) volunteered to participate in the
study. Prior to inclusion all subjects were screened by
a physician to exclude individuals with cardiovascular
disease, diabetes, neural or musculoskeletal disease,
inflammatory or pulmonary disorders or any known predisposition to deep venous thrombosis. The local ethics
committee of Copenhagen and Frederiksberg approved
the conditions of the study (KF01-322606) and all
experimental procedures were performed in accordance
with the Declaration of Helsinki. Written informed consent
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Ageing affects human skeletal muscle recovery
J Physiol 591.15
was obtained from all participants before inclusion in the
study.
3791
and the other directly frozen in liquid nitrogen and stored
at −80◦ C until further analyses.
ATPase staining and muscle fibre area
Intervention procedures
The intervention protocol along with data on changes in
muscle contractile function and morphology have been
described previously (Suetta et al. 2009; Hvid et al. 2010).
In brief, immobility was accomplished by 2 weeks of
randomised unilateral whole-leg casting using a lightweight whole-leg fibre cast extending from the malleoli
to the proximal groin region. The retraining protocol
comprised 4 weeks of surveyed and supervised unilateral
strength training for the immobilised leg, with three
sessions performed per week using a protocol consistently
proven effective for inducing substantial gains in muscle
size in elderly individuals with 12 weeks of training in our
laboratory (Esmarck et al. 2001; Lange et al. 2002; Suetta
et al. 2004a,b). After a 5–8 min warm-up on a stationary
bike, subjects performed isolated knee extension and
flexion, and leg press exercises. Each exercise was
performed in 3–4 sets × 12 repetitions (reps) (at 15 rep
maximum (RM)) in week 1, followed by 5 sets × 10 reps
(at 12RM) in weeks 2 and 3, and 4 sets × 10 reps (at 12RM)
in week 4. Training loads were determined at baseline and
loads were progressively adjusted on a weekly basis by use
of 5RM testing.
Muscle biopsy sampling
Muscle biopsies were obtained at ∼1 week prior to
the immobilisation (Pre), immediately after 2 weeks of
immobilisation (Imm), following 3 days of retraining
(+3d) and finally after 28 days of retraining (+4wks). Subjects were prohibited from exercise for at least 2 days before
the first biopsy and were carefully instructed only to eat a
light meal in the morning of the day of biopsy sampling.
Further, to minimise the influence of diurnal variation, all
subjects were biopsied at the same time of the day (±1 h)
at successive test sessions.
As described in detail elsewhere (Suetta et al. 2008;
Hvid et al. 2010) biopsies were obtained from the
middle portion of vastus lateralis muscle utilising the
percutaneous needle biopsy technique of Bergström
(Bergström, 1962), and careful efforts were made to extract
tissue from the same depth and within ∼2–3 cm distance
between each biopsy, to avoid the potential influence
of muscle damage from repeated biopsies (Guerra
et al. 2011). After dissecting the muscle samples of visible
blood, adipose and connective tissue, samples were divided
into two separate pieces, one oriented in embedding
medium (Tissue-Tek, Sakura Finetek, USA) frozen in isopentane cooled with liquid nitrogen and stored at −80◦ C
Subsequently serial transverse sections (10 μm) were cut
in a cryotome at −20◦ C and stained for myofibrillar
ATPase at pH 9.4 after both alkaline (pH 10.3) and acid
(pH 4.3 and 4.6) preincubations (Brooke & Kaiser, 1970).
All samples of each individual person were stained in the
same batch to avoid interassay variation. Based on the
ATPase staining pattern muscle fibres were characterised
as type I and type II and an average of 213 ± 39 fibres
were analysed in each biopsy. For the determination of
muscle fibre size only truly horizontal fibres were used,
with a minimum of 50 fibres included for the analysis.
A videoscope consisting of a microscope (Olympus BX
50) and colour video camera (Sanyo high resolution
CCD) in combination with Tema Image Analysis System
(Scanbeam, Denmark) were used to determine the mean
fibre area of the muscle fibres.
Satellite cell analysis
SC analysis was carried out by microscopic evaluation
of cryosections that had been immunohistochemically
stained for Pax7, as previously described in detail (Mackey
et al. 2010). A combination of immunoenzymatic and
immunofluorescence methods was employed to allow
the staining of Pax7, type I myosin and laminin on the
same section. Sections were fixed for 5 min with a 5%
formaldehyde solution (Histofix, Histolab, Gothenburg,
Sweden), followed by incubation for 1 h with blocking
buffer (0.05 M Tris-buffered saline (TBS) containing
0.01% Triton X-100, 1% bovine serum albumin, 1%
skimmed milk powder and 0.1% sodium azide). Satellite
cells were labelled with a mouse anti-Pax7 antibody (cat.
no. MO15020; Neuromics, Edina, MN, USA), diluted
1:500 in the blocking buffer, and incubated overnight
at 4◦ C. The next day, the slides were washed in two
changes of TBS containing 0.01% Triton. A biotinylated
goat anti-mouse secondary antibody (cat. no. E0433;
Dako Denmark, Glostrup, Denmark) was then applied,
followed by Vector Elite ABC kit (cat. no. PK6100;
Vector Laboratories, Peterborough, UK). Horseradish
peroxidase activity was visualised with the ImmPACT
diaminobenzidine substrate (cat. no. SK-4105; Vector
yes Laboratories). The sections were then incubated for
2 h at room temperature with a mixture of the two
primary antibodies, mouse anti-A4.951 (cat. no. A4.951;
Developmental Studies Hybridoma Bank, Iowa, IA, USA)
and rabbit anti-laminin (cat. no. Z0098; Dako, Denmark),
for visualisation of type I myosin and laminin, respectively.
A mixture of Alexa Fluor 488 goat anti-rabbit (Molecular
Probes cat. no. A11034; Invitrogen, Taastrup, Denmark)
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
3792
C. Suetta and others
and Alexa Fluor 568 goat anti-mouse secondary antibodies (Molecular Probes, cat. no. A11031) was applied
for 45 min. Washing in two changes of TBS was carried
out between all steps, except for between the blocking and
Pax7 incubation steps, where no washing was performed.
4� ,6-Diamidino-2-phenylindole (DAPI) in the mounting
medium (Molecular Probes ProLong Gold anti-fade
reagent, cat. no. P36935) stained the nuclei, rendering
nuclei blue, type I myosin red and laminin green. Sites
of Pax7 antigenicity were stained brown, visible by light
microscopy. The number of Pax7 cells associated with
type I (A4.951-positive) or type II (A4.951-negative)
fibres was counted separately and expressed relative to
the total number of type I or type II fibres included in
the assessment, as described in detail (Mackey et al. 2010;
Fig. 2).
J Physiol 591.15
quality-check Ct values, assess triplicates, exclude runs
when the difference among triplicates exceeded 0.5Ct and
finally to normalise data to RPLP0 using the 2Ct method
(Livak & Schmittgen, 2001).
Correlation analyses
Correlation analyses were performed at post
immobilisation (Imm) to examine the relationship
between myofibre area (fibre type I and type II) and
number of Pax7-positive (+) cells (total, fibre type I
and type II), for young and older individuals combined.
Furthermore, correlation analyses were performed
between changes during the retraining (4wks relative to
Imm) in myofibre area (MFA, fibre type I and type II)
and number of Pax7+ cells (total, fibre type I and type II)
for young and older individuals combined.
RNA purification
Total RNA was isolated from ∼20 mg of frozen muscle
biopsy by phenol extraction (TriReagent; Molecular
Research Center, OH, USA) as previously described (Kadi
et al. 2004b). Intact RNA was confirmed by denaturing
agarose gel electrophoresis.
Real-time PCR
The mRNA expression of IGF-1Ea, mechano growth
factor (MGF, also known as IGF-1Ec) and RPLP0 was
analysed by real-time PCR as described previously (Suetta
et al. 2012). Total RNA (500 ng) was converted into
cDNA in 20 μl using the OmniScript reverse transcriptase
(Qiagen, CA, USA) according to the manufacturer’s
protocol. For each of the mRNA targets, 0.25 μl cDNA was
amplified in a 25 μl SYBR Green PCR reaction containing
1 × Quantitect SYBR Green Master Mix (Qiagen) and
100 nM of each primer (Table 1A). The amplification was
monitored real-time using the MX3000P real-time PCR
machine (Stratagene, CA, USA). The threshold cycle (Ct)
values were related to a standard curve made with the
cloned PCR products and specificity ensured by melting
curves analysis; the quantities were normalised to RPLP0.
Quantitative real-time PCR of myostatin, Pax7, MyoD1,
myogenin, FGF2, fibroblast growth factor receptor 1
(FGFR1), HGF, c-Met, CDKN1A (p21), CDKN1B (p27)
and RPLP0 mRNA were performed in the ABI Prism
7900HT Sequence Detection System (Applied Biosystems,
UK) using ABI TaqMan Low Density Arrays (Applied
Biosystems; Table 1B). Each sample was run in triplicate
with four samples per card. cDNA, 250 ng, was mixed with
100 μl TaqMan Gene Expression Mastermix and loaded
into two ports (2.5 ng cDNA per reaction). Raw data were
extracted and analysed using the SDS 2.1 software (Applied
Biosystems, UK) and qBasePlus (Biogazelle) was used to
Statistical analyses
Statistical analyses were performed with SigmaPlot v11.0.
Interaction between Age and Time was tested with a
two-way repeated measures ANOVA. Differences over
time were tested with one-way repeated measures ANOVA
for Young and Old separately. If an overall time difference
was found, the different time points were compared
using Student–Newman–Keuls post hoc test. Pair-wise
comparisons between Young and Old at each time point
were obtained from the two-way repeated measures
ANOVA (to include global variance) and Bonferroni
corrected.
Non-parametric statistical analysis was used to evaluate
changes in muscle fibre cross-sectional area, since not all
data were normally distributed. To evaluate the effect of
intervention over time, the Friedmann two-way analysis
of variance by ranks of related samples was used with
subsequent analysis using the Wilcoxon signed rank test
for paired samples. Intergroup differences were evaluated
using the Kruskal–Wallis signed rank test. Correlation
analysis was performed using the Spearman’s rho (r s )
method. Data are presented as mean values ± SEM or for
mRNA data geometric means ± back-transformed SEM.
A P value of less than 0.05 was considered significant.
Results
Muscle fibre cross-sectional area
Young individuals showed a 21.3% increase in type I
fibre area (4440.4 ± 499.9 vs. 5386.3 ± 508.9 μm2 ,
P < 0.05) along with a 35.5% increase in type II
myofibre area (4347.5 ± 419.5 vs. 5904.4 ± 483.3 μm2 ,
P < 0.05) after retraining (+4wks; Fig. 1). In contrast,
no increases in type I fibre area (4830.3 ± 517.5 vs.
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Ageing affects human skeletal muscle recovery
J Physiol 591.15
3793
Table 1. Primers for qRT-PCR and TaqMan low density array (LDA) assay ID
A. Primers for qRT-PCR using SYBR Green assay
Gene products
MGF
IGF-1Ea
GAPDH
RPLP0
Sense primer
Antisense primer
GCCCCCATCTACCAACAAGAACAC
GACATGCCCAAGACCCAGAAGGA
CCTCCTGCACCACCAACTGCTT
GGAAACTCTGCATTCTCGCTTCCT
CGGTGGCATGTCACTCTTCACTC
CGGTGGCATGTCACTCTTCACTC
GAGGGGCCATCCACAGTCTTCT
CCAGGACTCGTTTGTACCCGTTG
B. Applied Biosystems TaqMan Low Density Array assay ID
Gene products
Assay ID
MyoD
Myogenin
HGF
c-Met
FGF2
FGFR1
Pax7
Myostatin
CDKN1A (p21)
CDKN1B (p27)
RPLP0
Hs02330075_g1
Hs01072232_m1
Hs00300159_m1
Hs01565581_m1
Hs00266645_m1
Hs01552926_m1
Hs00242962_m1
Hs00193363_m1
Hs01121172_m1
Hs00153277_m1
Hs99999902_m1
A. mRNA expression of MGF (IGF-1Ec), IGF-1Ea and RPLP0 was analysed by SYBR Green-based quantitative real-time RT-PCR. B.
TaqMan-based quantitative real-time RT-PCRs of MyoD1, myogenin, HGF, c-Met, FGF2, FGFR1, Pax7, myostatin, CDKN1A, CDKN1B and
RPLP0 mRNA were performed using ABI TaqMan Low Density Arrays.
4848.2 ± 336.9 μm2 ) or type II fibre area (4004.3 ± 467.4
vs. 4225.1 ± 276.2 μm2 ) were observed in the older
individuals. Furthermore type II fibre area was restored
with retraining in young individuals to reach
higher levels than observed in older individuals
(YM: 5386.3 ± 508.9 μm2 , OM: 4225.1 ± 276.2 μm2 ,
P < 0.05). No difference was observed in fibre-type
distribution between YM (type I: 55.5%; type II: 44.5%)
and OM (type I: 56.1%; type II: 43.9%) at Pre or following
the interventions (Hvid et al. 2010).
Satellite cells: association with fibre type
To analyse for satellite cells, Pax7+ cells were assessed for
type I and II fibres separately, as illustrated in Fig. 2. An
overall effect of age was found for Pax7+ cells in relation
to type II (P < 0.01), but not type I fibres (Fig. 3). The
number of Pax7+ cells in the young subjects increased
compared to Pre in both type I and II fibres at all time
points. No changes in the elderly individuals were seen
over time and in the type II fibres at +3d and +4wks; this
was significantly different to the young individuals.
mRNA expression levels at baseline
At baseline (Pre) there was no age-related differences in
the expression levels of IGF-1Ea, MGF, MyoD1, myogenin, HGF, c-Met, FGF2, FGFR1, Pax7, CDKN1A (p21)
or CDKN1B (p27) whereas the expression levels of myo-
statin mRNA and GAPDH were lower in old compared to
young (Fig. 4, P < 0.05).
IGF-1Ea and MGF
Expression levels of IGF-1Ea and MGF (IGF-1Ec) mRNA
increased in young individuals with immobilisation
(Fig. 5A and B). Expression levels of IGF-1Ea
demonstrated a subsequent marked decrease after 3 days
of retraining in young individuals and after 4 weeks
of retraining mRNA expression levels were increased
compared to baseline levels as well as post immobilisation
(Imm) in both young and old (Fig. 5A, P < 0.05).
Expression levels of MGF mRNA remained elevated
after 3 days of retraining in the young (P < 0.05), and
after 4 weeks of retraining mRNA expression levels
were further increased compared to baseline and post
immobilisation (Imm) levels, respectively, in the young
(Fig. 5B, P < 0.05).
MyoD1 and myogenin
MyoD1 expression increased in both young and older
males with immobilisation, and in addition showed a
marked decrease following 3 days of retraining in both
young and old (P < 0.05, Fig. 5C). After 4 weeks of
retraining MyoD1 mRNA levels returned to baseline
levels in both young and old (Fig. 5C). Myogenin mRNA
expression increased markedly in both young and old,
while decreasing after 3 days of retraining in both young
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
3794
C. Suetta and others
and old (Fig. 5D, P < 0.05). After 4 weeks of retraining
myogenin expression levels remained reduced compared
to post immobilisation levels (Fig. 5D).
HGF and c-Met
Expression levels of HGF and c-Met mRNA increased in
young individuals in the early phase of retraining (+3d,
P < 0.05; Fig. 5E and F) but remained unaltered after
immobilisation and more prolonged retraining. In old
individuals no change in expression levels of HGF and
c-Met was observed at any time point.
FGF2 and FGFR1
FGF2 mRNA levels remained unaltered at all time points
in young as well as older individuals (P < 0.05, Fig. 5G).
Conversely, FGFR1 mRNA expression increased in both
young and old following immobilisation, followed by
marked decreases after 3 days of retraining in both young
Type I fiber area (µm2)
A
Type I fiber area
7000
#
6000
Young
Old
*
5000
4000
3000
0
Pre
B
Imm
Type I fiber area (µm2)
#
6000
Young
Old
* *
5000
4000
3000
0
Pre
Imm
and old (+3d; Fig. 5H). After 4 weeks of retraining, FGFR1
mRNA expression increased compared to baseline and the
initial training phase (+3d) approaching values similar to
the expression levels observed following immobilisation
(Fig. 5H).
Pax7
The expression of Pax7 mRNA following immobilisation
was higher in the older males compared to the young males
(Fig. 5I). Although there was an interaction (Age × Time,
P < 0.05), it was not possible to pinpoint whether this
difference was due to an increase in the elderly or a
decrease in the young, or both. No differences with time
or age were detected at the retraining time points, except
for a lower level at +3d compared to +4wks in the
young.
Myostatin
Myostatin mRNA expression increased in the elderly
with immobilisation, and showed a marked decrease
after 3 days of retraining (+3d) in both young and old
(P < 0.05, Fig. 5J). After 4 weeks of retraining, myostatin
expression levels returned to baseline levels in both young
and old. The temporal changes in myostatin mRNA
expression differed between young and old individuals,
with a less pronounced down-regulation of myostatin
expression levels in the initial phase of retraining (+3d)
in older individuals (P < 0.05, Fig. 5J).
CDKN1A (p21) and CDKN1B (p27)
+4wks
Type II fiber area
7000
J Physiol 591.15
+4wks
Figure 1. Changes in myofibre cross-sectional area following
2 weeks of immobilisation and 4 weeks of retraining in young
and older human individuals
A, type I myofibre cross-sectional area. B, type II myofibre
cross-sectional area. Open bars represent young (n = 9) and grey
bars represent older individuals (n = 7). Pre, ∼1 week prior to the
immobilisation; Imm, after 2 weeks of immobilisation; +4wks, after
28 days of retraining. ∗ Time effect, P < 0.05, compared to Pre.
#Time effect, P < 0.05 compared to Imm. ∞Age effect, P < 0.05
young compared to old within time point. Group mean data ± SEM.
Expression levels of CDKN1A (p21) remained unchanged
with immobilisation (Imm) while decreasing in both
young and older males after 3 days of retraining (P < 0.05;
Fig. 5K ). After 4 weeks of retraining CDKN1A mRNA
expression returned to baseline levels in both young and
old (P < 0.05, Fig. 5K ). No change in the expression level
of CDKN1B (p27) was observed with immobilisation;
however, a marked decrease was observed in both young
and old after 3 days of retraining (P < 0.05, Fig. 5L).
After 4 weeks of retraining CDKN1B mRNA expression
levels returned to baseline levels in both young and older
individuals (Fig. 5L).
Correlation analysis
After muscle disuse, the number of Pax7+ cells was
positively related to myofibre area (r s = 0.712, P < 0.01;
n = 16; Fig. 6A). Comparison within fibre type showed
that this relationship was true for both type I (r s = 0.779;
P < 0.001; n = 16) and type II fibres (r s = 0.694; P < 0.01;
n = 16). Notably, analysing the retraining phase, relative
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Regulation of Disuse Atrophy in Human Muscle
HRP-conjugated secondary antibody (Immun-Star Goat AntiRabbit (GAR)-HRP Conjugate, #170-5046, BioRad, Hercules,
Ca, USA) and visualized with Immun-star western kit (#1705070, BioRad, Hercules, Ca, USA). After detecting the phosphorylated protein, the membrane was stripped and the total protein
was detected. Band exposure and visualization were quantified
using ChemiDoc XRS with Image Lab Software (Bio-Rad
Laboratories, Inc.)
Statistical analyses
A part from total and phosphorylated S6 ribosomal protein, all
mRNA and Western blot data were log-transformed prior to
statistical analyses and are presented as geometric means 6 backtransformed SEM. To test for changes over time (mRNA,
TUNEL, Immunohistochemistry and Western blot analyses)
one-way Bonferroni corrected repeated-measures ANOVA was
performed separately for young and old individuals, respectively,
as well as for young and old combined (SPSS). Pair wise multitude
comparison procedures were evaluated using Student-NewmanKeuls Method post-hoc testing. Independent-samples t-testing
were used to test for differences between groups’ with a subsequent
Bonferroni correction. As phosphorylated S6 ribosomal protein
(but not total S6 ribosomal protein) became non-detectable after
immobilization in a high number of especially young subjects,
quantification of phosphorylated S6 ribosomal protein/total S6
ribosomal protein was not possible and we therefore decided to
perform a Chi-square test (young p,0.001, old p = 0.44). The
percentage of the total number of subjects where p-S6 could be
detected, at each time-point, are visualized in figure 4D. Nonparametric statistics were used to analyze changes in muscle fiber
CSA, since not all of these data were normally distributed. To
evaluate the effect of intervention over time a repeated-measures
Friedman test was used with post-hoc Wilcoxon testing. Betweengroup differences were analyzed with Kruskall-Wallis tests and
subsequent Mann-Whitney U testing. Data are presented as mean
values 6 SEM. A p-value of less than 0.05 was considered
statistically significant.
Results
Maximal contractile muscle strength
Figure 5. Changes in the transcriptional status of FoxO1,
FoxO3 and FoxO4 as a result of immobility-induced muscle
disuse. A–C. The mRNA level of FoxO1, FoxO3 and FoxO4 was
determined using qRT-PCR. No up-regulation in the mRNA expression
levels in any of these three genes was observed during the initial phase
of immobility, in contrast, a general down-regulation in all three genes
was observed in both young and aged muscle at the 4 d time point,
potentially reflecting a negative feedback signal from high presence of
active FoxO protein in the muscle cell. However, it is difficult to
interpret the role of FoxO in the present study since the phosphorylated
forms of FoxO were not measured. * Time effect, p,0.05 bar indicates
young and old within time point. Data are geometric means 6 backtransformed SEM.
doi:10.1371/journal.pone.0051238.g005
Maximal contractile muscle strength declined in both young
(13%) and old (14%) after 4 days of unloading, with no difference
between age groups (Figure S1A). Following 14 days of unloading
maximal isometric muscle strength was reduced by 20% in young
and by 16% in old, again with no age-related differences (Figure
S1A).
Muscle fiber cross sectional area
Despite the very limited period of immobilization, our
histological analyses revealed significant decreases in mean
myofiber area of approximately 10% in both young and old
subjects after 4 days of immobility (Figure 1B). However, following
14 days of immobilization the loss in mean myofiber size was
greater in young (219.9%) than old individuals (212.6%, p,0.01)
(Figure 1B). There was no difference between the decline in type 1
(O: 27.1%, Y: 28.1%) and type 2 (O: 210.9%, Y: 212.6%)
fibers at the 4 d time-point, however after 14 d the decline in type
2 fibers (O: 217.1%, Y: 226.5%) was significantly larger than in
type 1 fibers (O: 28.9%, Y: 214.3%) in both young and old
(p,0.05) (Figure S1B).
0.2 mm, BioRad, Hercules, Ca, USA), which were blocked for
60 min with 5% Blotting–Grade Blocker (#170-6404, BioRad,
USA) in phosphate-buffered saline with 0.05% Tween 20.
Membranes were subsequently incubated overnight at 4uC with
primary antibody LC3B (1:1000, #2775, Cell Signaling Technology) as well as S6 ribosomal protein (1:1000, #2217, Cell
Signaling Technology Inc.) and phospho-S6 ribosomal protein
(Ser235/236) (1:2000, #4858, Cell Signaling Technology Inc.).
Membranes were subsequently washed and incubated for 1 h with
PLOS ONE | www.plosone.org
7
December 2012 | Volume 7 | Issue 12 | e51238
3796
C. Suetta and others
response to short-term reloading in old compared to
young humans. However, due to the relatively short
observation period, we cannot conclude to what extent
the recovery of skeletal muscle mass in elderly undergoing
short-term immobilisation is impaired or just occurs
more slowly than in young counterparts. In support of
the second view, observations over more prolonged periods of reloading (e.g. 12 weeks) have demonstrated that
the elderly can fully recover whole muscle cross-sectional
area and myofibre area after long-term (months to years)
muscle disuse due to hip osteoarthritis and subsequent
elective hip-replacement surgery, but only if the reloading
phase comprises a systematic use of resistance-based
exercise (Suetta et al. 2004b, 2008).
Changes in myogenic progenitor cells with reloading
In skeletal muscle the myogenic stem cells, also referred
to as satellite cells (SCs), are known to play a key
role in the maintenance, growth and repair of myofibres (Mauro, 1961; Moss & Leblond, 1970; Heslop
et al. 2001; Pallafacchina et al. 2012). During the process
of load-induced muscle hypertrophy, satellite cells are
Figure 3. Pax7-positive cells pre- and post immobilisation and
following 4 weeks of retraining: association with fibre type
A, number of Pax7+ cells associated with fibre type I. B, number of
Pax7-positive satellite cells associated with fibre type II. +3d, after
3 days of retraining. ∗ Time effect, P < 0.05 compared to Pre. ∞Age
effect, P < 0.05 difference between young and old within time
point. Data are means ± SEM.
J Physiol 591.15
thought to proliferate, differentiate and eventually fuse
with existing myofibres (McCormick & Schultz, 1994).
The resulting donation of new myonuclei by the fusion of
SCs with existing myofibres is thought to ensure that myonuclear domain size stays within certain functional limits
in situations of marked myofibre hypertrophy (Kadi et al.
2004b; Petrella et al. 2008). In humans, skeletal muscle
SCs seems to be maintained into the seventh decade of
life (Roth et al. 2000; Petrella et al. 2006; Hikida, 2011),
with a decline in content and activation capabilities with
progressive ageing (Renault et al. 2002; Kadi et al. 2004a;
Verdijk et al. 2007) accompanied by a reduced migration
capacity of existing SCs in turn resulting in a reduced
regeneration potential after muscle injury and disuse
(Carlson & Faulkner, 1989; Mitchell & Pavlath, 2004;
Conboy et al. 2005; Carlson & Conboy, 2007). Despite
a mean age of only ∼70 years in our aged individuals signs
of impaired SC proliferation with immobilisation and subsequent retraining were observed compared to young subjects (∼25 years old), indicating an attenuated myogenic
response to changes in exercise pattern (Fig. 3A and B).
Interestingly, compared to the changes induced by 2 weeks
of disuse, more accentuated age-related differences in SC
activation were observed in the acute (+3d) as well as the
prolonged (+4wk) phase of reloading (Fig. 3A and B). The
latter trend is in line with Dreyer et al. (2006) reporting a
greater increase in SC content in young compared to aged
skeletal muscle within 24 h following 92 maximal eccentric
muscle contractions (Dreyer et al. 2006). The importance
of SC number in relation to muscle size across the age-span
was underlined by Kim and co-workers who demonstrated
a positive linear association between muscle size and SC
number in baseline muscle biopsies obtained from young
and older human individuals (Kim et al. 2005b). Extending
those data, here we report for the first time in human
individuals that a positive relationship exists between
SC number and myofibre area following disuse atrophy
(Fig. 5A) as well as in response to subsequent reloading
(Fig. 5B).
Since human ageing is associated with a preferential
reduction in muscle fibre type II size (Andersen, 2003;
Aagaard et al. 2010) it has been speculated that SC content
might decrease more in type II fibres compared to type I
fibres with ageing (Kim et al. 2005b). In young human
individuals, SC appears to be similar between type I and
type II muscle fibres (Kadi et al. 2006; Verdijk et al. 2007).
In contrast, age-related type II muscle fibre atrophy is
accompanied by a type II muscle fibre-specific reduction
in SC content (Verdijk et al. 2007; Verney et al. 2008).
In support of these observations, young and old adults
demonstrating marked exercise-induced gains in myofibre area (i.e. ‘hypertrophy responders’) are characterised
by a greater concurrent up-regulation in myogenic SCs
compared to individuals with a less robust hypertrophy
response (Petrella et al. 2008). However, although the
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Ageing affects human skeletal muscle recovery
J Physiol 591.15
3797
Changes in MyoD1 and myogenin expression with
reloading
regenerative capacity of human skeletal muscle seems to
decline at a more advanced age (reflected by a decline in
SC number and/or proliferative capacity), the impairment
in SC function does not seem to prevent a significant
capacity for muscle hypertrophy provided that the intervention period is sufficiently long (months), as reported
even at very old age (Thornell et al. 2003; Dedkov et al.
2003; Shefer et al. 2006).
In the present study MyoD1 and myogenin expression
were markedly up-regulated with immobilisation in both
age groups, whereas subsequent reloading led to both
an acute (+3d) and a sustained (+4wks) decrease in
MyoD1 and myogenin expression in young as well as aged
skeletal muscle. The rise in MyoD1 and myogenin mRNA
expression following immobilisation independently of
age may represent a compensatory signalling pathway
for partial muscle retention during periods of acute
muscle loss, while also observed in other atrophy
situations (Alway et al. 2001). Following resistance-type
exercise increased expression of MyoD1 and myogenin
mRNA has been observed in both young and older
adults (Psilander et al. 2003; Kim et al. 2005a; Kosek
et al. 2006; Raue et al. 2006; Costa et al. 2007; McKay
et al. 2008). In the present study, however, only a
modest up-regulation in myogenin expression compared
to the basal non-immobilised state was observed
following the reloading phase consisting of 4 weeks
of resistance training, suggesting that retraining after
short-term disuse atrophy may evoke different molecular
signalling stimuli compared to regular resistance exercise
intervention.
Changes in IGF-1 expression with reloading
Numerous growth factors are known to regulate satellite
cell activity, among which insulin-like growth factor 1
(IGF-1) is known to play an essential role in the process
of muscle hypertrophy (Rosenblatt et al. 1994; Adams
& Haddad, 1996; Suetta et al. 2010). The discovery of
distinct IGF-1 isoforms (mechano growth factor (MGF)
and IGF-1Ea) has suggested different roles for IGF-1,
namely that MGF mainly triggers satellite cell activation
and proliferation, while IGF-1Ea is thought to mainly
promote differentiation of proliferating SCs (Yang &
Goldspink, 2002). In line with those findings the present
study demonstrated a differentiated regulation in IGF-1Ea
and MGF expression, with both an acute and a sustained
up-regulation of MGF mRNA expression in response to
retraining (+3d and +4wks), whereas IGF-1Ea expression
was up-regulated in the later phase of reloading (+4wks)
only, suggesting a supportive role of paracrine/autocrine
IGF signalling in the process of human muscle hypertrophy, at least when recovering from short-term muscle
disuse. In contrast to earlier findings in rodent and human
skeletal muscle (Owino et al. 2001; Hameed et al. 2003)
the present up-regulation in MGF mRNA expression
with reloading (post 4 weeks resistance training) was not
attenuated in older vs. young individuals in the present
study.
Changes in HGF and c-Met expression with reloading
Hepatocyte growth factor (HGF) is generally considered
to be one of the most important growth factors involved
in organ regeneration (Zarnegar, 1995) as well as a
key regulator of satellite cell activity during muscle
regeneration (Jennische et al. 1993). The presence of HGF
transcripts in newly regenerated myotubes and in satellite
cells suggests that HGF activity is mediated primarily
through paracrine/autocrine mechanisms (Anastasi et al.
1997; Sheehan & Allen, 1999). Furthermore, HGF is a
mRNA pre-values relative to the young group
Young
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
GAPDH
CDKN1B (p27)
*
CDKN1A (p21)
Pax7
FGFR1
FGF2
c-Met
HGF
Myogenin
MyoD1
0.1
Myostatin
*
1
MGF
Figure 4. mRNA values relative to the
young group at baseline (Pre)
∗ Age effect, P < 0.05 young compared to
old. Data are geometric
means ± back-transformed SEM.
Old
IGF-1Ea
Relative to meanYoung Pre
10
3798
C. Suetta and others
potent growth factor that has the ability to stimulate
quiescent satellite cells to enter the cell cycle early in
vitro as well as in vivo (Allen et al. 1995; Tatsumi et al.
1998) and is therefore considered most important during
*# *#
§
Imm
*#
10
Young
Old
§
*
*
1
0.1
Pre
Imm
+3d
+4wks
Young
Old
* *
0.1
*#
Pre
10
Imm
#
+3d
#
§
#
+4wks
1
0.1
Pre
Myogenin
10
* *
#
#
#
*#
§
1
0.1
Pre
Imm
+3d
Young
Old
Imm
+3d
+4wks
c-Met
10
Young
Old
*#
1
0.1
Pre
Imm
+3d
+4wks
FGF2
10
Young
Old
1
0.1
Pre
H
D
Young
Old
*
G
MyoD1
10
1
Relative change from Pre
Relative change from Pre
+4wks
HGF
F
MGF
C
Relative change from Pre
+3d
Relative change from Pre
Pre
Old
*#
1
0.1
§
Young
Relative change from Pre
10
B
Relative change from Pre
E
IGF-1Ea
*
the early phase of re-growth (Tatsumi et al. 1998). In
support of this, we observed a significant increase in HGF
mRNA expression in young individuals in response to early
retraining (+3d) but not after more sustained retraining
Relative change from Pre
Relative change from Pre
A
J Physiol 591.15
Imm
+3d
+4wks
FGFR1
10
* *
1
0.1
Pre
Imm
*§ *§
#
Young
Old
#
+3d
+4wks
+4wks
Figure 5. mRNA expression levels relative to baseline following 2 weeks of immobilisation and 4 weeks
of retraining
A, IGF-1Ea; B, MGF; C, MyoD1; D, myogenin; E, HGF; F, c-Met; G, FGF2; H, FGFR1; I, Pax7; J, myostatin; K,
CDKN1A (p21); L, CDKN1B (p27). ∗ Time effect, P < 0.05 compared to Pre. #Time effect, P < 0.05 compared
to Imm. §Time effect, P < 0.05 compared to +3d. ∞Age effect, P < 0.05 young compared to old. Data are
geometric means ± back-transformed SEM.
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Ageing affects human skeletal muscle recovery
J Physiol 591.15
(+4wks) (Fig. 5E). In contrast to HGF, a marked decrease
in the HGF receptor c-Met expression was observed in
response to early retraining (+3d) in young individuals,
which may support the hypothesis previously proposed
that increasing concentrations of HGF reduces c-Met
which forms a negative feedback mechanism inducing SC
quiescence in regenerating muscle (Tatsumi et al. 2009;
Yamada et al. 2010).
Changes in FGF2 and FGFR1 expression with reloading
In recent years, fibroblast growth factors (FGFs) and
their receptors (FGFRs) have gained increased focus as
major players in both embryonic development and skeletal
muscle tissue repair (Coutu & Galipeau, 2012). Moreover,
somatic stem cells have been suggested as major targets
of FGF signalling in both tissue homeostasis and repair
where FGFs appear to promote self-renewing proliferation
and inhibit cellular senescence in nearly all tissues tested
to date (Coutu & Galipeau, 2012). Fibroblast growth
factor 2 (FGF2) is a polypeptide growth factor that
stimulates SC proliferation in already activated SCs (Allen
& Boxhorn, 1989; Mezzogiorno et al. 1993). However,
despite our findings of marked SC proliferation with
reloading, expression levels of FGF2 remained unchanged
at all time points examined, suggesting that FGF may
be less important for SC proliferation in human skeletal
muscle, at least in relation to reloading subsequent to
immobilisation.
Changes in myostatin expression with reloading
Myostatin is a member of the transforming growth
factor-β superfamily and a strong negative regulator of
skeletal muscle mass, known to inhibit myogenic SC
activation (McPherron et al. 1997; Trendelenburg et al.
2009). Although the mechanisms are not fully understood,
myostatin is thought to modulate key regulators of the cell
cycle such as cyclin-dependent kinase inhibitors p21cip
and p27kip (Kim et al. 2005a), thereby inhibiting SC cycle
progression from G0 to S phase (McCroskery et al. 2003).
Down-regulated myostatin mRNA expression has been
observed in response to exercise training in both young
and elderly individuals (Roth et al. 2003; Kim et al. 2005a;
Raue et al. 2006; Costa et al. 2007), with some studies
reporting an attenuated response with ageing (Kim et al.
2005b; Haddad & Adams, 2006). In line with the latter
findings, McKay and colleagues recently demonstrated a
∞
Relative change from Pre
Young
Old
Age*Time p<0.05
§
1
0.1
Pre
J
Relative change from Pre
The observed differences in immunohistochemical Pax7+
cell content of the vastus lateralis muscle in young and
older individuals during immobilisation and subsequent
retraining (Fig. 3) were not associated with corresponding
changes in mRNA for Pax7. In fact, the expression level of
Pax7 was down-regulated in young and up-regulated in old
individuals following 2 weeks of immobilisation (Fig. 5I),
indicating that factors other than Pax7 mRNA levels may
influence the content of Pax7+ SCs during immobilisation
and retraining conditions in humans.
k
Pax7
10
Changes in Pax7 expression with reloading
Imm
+3d
+4wks
10
*
0.1
∞
*# *#
1
Pre
Imm
CDKN1A (p21)
10
Young
Old
0.1
+3d
§
Young
Old
§
+4wks
*#
#
1
Pre
l
Myostatin
Imm
§
+3d
+4wks
CDKN1B (p27)
Relative change from Pre
Relative change from Pre
I
3799
10
Young
Old
*# *#
1
0.1
Pre
Imm
+3d
§
§
+4wks
Figure 5. Continued
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
C. Suetta and others
4000
2000
0
0.00
Relative change in MFA (%)
B
rs=0.712
p<0.01
100
80
60
40
20
-20
Conclusions
Collectively, the present data suggest that significant
age-specific differences may exist for the ability of human
skeletal muscle to regenerate after immobility-induced
muscle atrophy. More specifically, our results indicate
an attenuated – or at least delayed – response in aged
individuals to active reloading subsequent to short-term
rs=0.693
p<0.01
-40
-100 -50
0
50 100 150 200
Relative change in Pax7+ cells
per fibre (%)
6000
4000
2000
0
0.05
0.10
0.15
0.20
Pax7+ cells per fibre at Imm
120
0
In line with the regulation in myostatin mRNA, expression
levels of cyclin-dependent kinase inhibitors CDKN1A
(p21) and CDKN1B (p27) decreased in response to acute
loading in the present study. Both CDKN1A and CDKN1B
are known to block cell cycle progression and induce
SC cell cycle withdrawal (Coqueret, 2003). Furthermore,
ectopic expression of CDKN1B has been shown to block
the IGF-I-induced increase in satellite cell proliferation
(Chakravarthy et al. 2000) and thus CDKN1B is considered
a key regulatory factor in the regulation of satellite cell cycle
progression (Machida et al. 2003).
rs=0.779
p<0.01
100
80
60
40
20
-20
8000
6000
4000
2000
0.00
0.05
0.10
0.15
0.20
Pax7+ cells per type I fibre at Imm
120
0
Type II fibre area at Imm (um2)
6000
Changes in cyclin-dependent kinase inhibitors with
reloading
8000
Type I fibre area at Imm (um2)
8000
Relative change in type I area (%)
A
MFA at Imm (um2)
markedly blunted myogenic response in older compared to
younger individuals (McKay et al. 2012). Although stem
cell-specific myostatin levels did not appear to differ at
baseline, acute resistance exercise (75% 1RM) was found
to evoke ∼70% greater content of myostatin-positive
type II-associated SCs in old versus young adults at 24 h
post exercise, suggesting that the greater co-localisation
of myostatin with SCs may provide a mechanism for
the impaired myogenic capacity of aged muscle (McKay
et al. 2012). Somewhat unexpectedly, the expression level
of myostatin mRNA was lower in old compared to young at
baseline in the present study, which might reflect the rather
high activity level (equal to that of young) of the present
group of elderly individuals. Despite this, an age-specific
difference in the regulation of myostatin was also observed
in the present study, manifested by a reduced suppression
with reloading in aged vs. young individuals (Fig. 5J). This
observation may explain, at least in part, the impaired
capacity for SC proliferation and re-growth in aged skeletal
muscle observed in the present study, although the interpretation of these data is limited if only assessing transcript
levels.
J Physiol 591.15
rs=864
p<0.01
-40
-100 -50
0
50 100 150 200
Relative change in Pax7+ cells
per Type I fibre (%)
Relative change in type II area (%)
3800
rs=0.694
p<0.01
0
0.00 0.05 0.10 0.15 0.20 0.25
Pax7+ cells per type II fibre at Imm
120
100
80
60
40
20
0
-20
rs=0.304
p<0.01
-40
-100 -50
0
50 100 150 200
Relative change in Pax7+ cells
per Type II fibre (%)
Figure 6. Association between changes in myofibre area and number of Pax7+ cells
A, number of Pax7+ cells versus fibre area for all fibres collapsed or separated into type I or II fibres post
immobilisation (Imm). B, relative changes in myofibre area (MFA, type I or type II) following 4 weeks of retraining
(relative to post immobilisation) versus the change in number of Pax7+ cells (total, type I associated and type II
associated). Open triangles, young individuals; filled triangles, older individuals.
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
J Physiol 591.15
Ageing affects human skeletal muscle recovery
disuse, as reflected by attenuated gains in myofibre area
and SC number despite no age-related differences being
observed in local growth factors responsible for promoting
skeletal muscle hypertrophy (IGF-1Ea, MGF, MyoD1,
myogenin, HGF). These disparate trends may partly reside
on a reduced cellular sensitivity to paracrine/autocrine
growth factors as basal MRF mRNA expression appears to
be chronically up-regulated in senescent muscle (Edström
& Ulfhake, 2005; Kim et al. 2005a; Kosek et al. 2006; Raue
et al. 2006). Our findings of an age-specific regulation in
myostatin expression levels may also have contributed to
the apparent lack of increase in SC number and myofibre area with ageing in response to reloading. Gaining
an improved understanding of the ability of human
skeletal muscle to recover from atrophy has important
implications for the development of effective molecular
and rehabilitative countermeasures against physical frailty
in the continuously growing population of elderly adults.
References
Aagaard P, Suetta C, Caserotti P, Magnusson SP & Kjaer M
(2010). Role of the nervous system in sarcopenia and muscle
atrophy with aging: strength training as a countermeasure.
Scand J Med Sci Sports 20, 49–64.
Adams GR & Haddad F (1996). The relationships among
IGF-1, DNA content, and protein accumulation during
skeletal muscle hypertrophy. J Appl Physiol 81, 2509–2516.
Allen RE & Boxhorn LK (1989). Regulation of skeletal muscle
satellite cell proliferation and differentiation by transforming
growth factor-beta, insulin-like growth factor I, and
fibroblast growth factor. J Cell Physiol 138, 311–315.
Allen RE, Sheehan SM, Taylor RG, Kendall TL & Rice GM
(1995). Hepatocyte growth factor activates quiescent skeletal
muscle satellite cells in vitro. J Cell Physiol 165, 307–312.
Alway SE, Dawn AL & Kuangjen DC (2001). The effects of age
and hindlimb supension on the levels of expression of the
myogenic regulatory factors MyoD and myogenin in rat fast
and slow skeletal muscles. Exp Physiol 86, 509–517.
Anastasi S, Giordano S, Sthandier O, Gambarotta G, Maione R,
Comoglio P & Amati P (1997). A natural hepatocyte growth
factor/scatter factor autocrine loop in myoblast cells and the
effect of the constitutive Met kinase activation on myogenic
differentiation. J Cell Biol 137, 1057–1068.
Andersen JL (2003). Muscle fibre type adaptation in the elderly
human muscle. Scand J Med Sci Sports 13, 40–47.
Bergström J (1962). Muscle electrolytes in man. Scand J Clin
Lab Invest 14 (Suppl. 68), 1–110.
Brooke MH & Kaiser KK (1970). Muscle fibre types: How many
and what kind? Arch Neurol 23, 369–379.
Carlson BM & Faulkner JA (1989). Muscle transplantation
between young and old rats: age of host determines recovery.
Am J Physiol Cell Physiol 256, C1262–C1266.
Carlson ME & Conboy IM (2007). Loss of stem cell regenerative
capacity within aged niches. Aging Cell 6, 371–382.
Carlson ME, Suetta C, Conboy MJ, Aagaard P, Mackey A, Kjaer
M & Conboy I (2009). Molecular aging and rejuvenation of
human muscle stem cells. EMBO Mol Med 1, 381–391.
3801
Chakkalakal JV, Jones KM, Basson MA & Brack AS (2012). The
aged niche disrupts muscle stem cell quiescence. Nature 490,
355–360.
Chakravarthy MV, Abraha TW, Schwartz RJ, Fiorotto ML &
Booth FW (2000). Insulin-like growth factor-I extends in
vitro replicative life span of skeletal muscle satellite cells by
enhancing G1 /S cell cycle progression via the activation of
phosphatidylinositol 3� -kinase/Akt signaling pathway. J Biol
Chem 275, 35942–35952.
Conboy IM, Conboy MJ, Smythe GM & Rando TA (2003).
Notch-mediated restoration of regenerative potential to aged
muscle. Science 302, 1575–1577.
Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL &
Rando TA (2005). Rejuvenation of aged progenitor cells by
exposure to a young systemic environment. Nature 433,
760–764.
Coqueret O (2003). New roles for p21 and p27 cell-cycle
inhibitors: a function for each cell compartment? Trends Cell
Biol 13, 65–70.
Costa A, Dalloul H, Hegyesi H, Apor P, Csende Z, Racz L, Vaczi
M & Tihanyi J (2007). Impact of repeated bouts of eccentric
exercise on myogenic gene expression. Eur J Appl Physiol
101, 427–436.
Coutu DL & Galipeau J (2012). Roles of FGF signalling in stem
cell self-renewal, senescence and aging. Aging (Albany NY) 3,
920–933.
Dedkov EI, Kostrominova TY, Borisov AB & Carlson BM
(2003). MyoD and myogenin protein expression in skeletal
muscles of senile rats. Cell Tissue Res 311, 401–416.
Dreyer HC, Blanco CE, Sattler FR, Schroeder ET & Wiswell RA
(2006). Satellite cell numbers in young and older men 24
hours after eccentric exercise. Muscle Nerve 33, 242–253.
Edström E & Ulfhake B (2005). Sarcopenia is not due to lack of
regenerative drive in senescent skeletal muscle. Aging Cell 4,
65–77.
Esmarck B, Andersen JL, Olsen S, Richter EA, Mizuno M &
Kjaer M (2001). Timing of postexercise protein intake is
important for muscle hypertrophy with resistance training in
elderly humans. J Physiol 535, 301–311.
Gopinath SD & Rando TA (2008). Stem cell review series: aging
of the skeletal muscle stem cell niche. Aging Cell 7,
590–598.
Guerra B, Gómez-Cabrera MC, Ponce-González JG,
Martinez-Bello VE, Guadalupe-Grau A, Santana A, Sebastia
V, Viña J & Calbet JA (2011). Repeated muscle biopsies
through a single skin incision do not elicit muscle signalling,
but IL-6 mRNA and STAT3 phosphorylation increase in
injured muscle. J Appl Physiol 110, 1708–1715.
Haddad F & Adams GR (2006). Aging-sensitive cellular and
molecular mechanisms associated with skeletal muscle
hypertrophy. J Appl Physiol 100, 1188–1203.
Hameed M, Orrell RW, Cobbold M, Goldspink G & Harridge
SD (2003). Expression of IGF-I splice variants in young and
old human skeletal muscle after high resistance exercise.
J Physiol 547, 247–254.
Heslop L, Beauchamp JR, Tajbakhsh S, Buckingham ME,
Partridge TA & Zammit PS (2001). Transplanted primary
neonatal myoblasts can give rise to functional satellite cells as
identified using the Myf5nlacZl+ mouse. Gene Ther 8,
778–783.
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
3802
C. Suetta and others
Hespel P, Op’t Eijnde B, Van Leemputte M, Urso B, Greenhaff
PL, Labarque V, Dymarkowski S, Van Hecke P & Richter EA
(2001). Oral creatine supplementation facilitates the
rehabilitation of disuse atrophy and alters the expression of
muscle myogenic factors in humans. J Physiol 536,
625–633.
Hikida RS (2011). Aging changes in satellite cells and their
functions. Curr Aging Sci 4, 279–297.
Horsley V & Pavlath GK (2003). Prostaglandin F2α stimulates
growth of skeletal muscle cells via an NFATC2-dependent
pathway. J Cell Biol 161, 111–118.
Hvid L, Aagaard P, Justesen L, Bayer ML, Andersen JL,
Ortenblad N, Kjaer M & Suetta C (2010). Effects of aging on
muscle mechanical function and muscle fibre morphology
during short-term immobilization and subsequent
retraining. J Appl Physiol 109, 1628–1634.
Hvid LG, Ortenblad N, Aagaard P, Kjaer M & Suetta C (2011).
Effects of ageing on single muscle fibre contractile function
following short-term immobilisation. J Physiol 589,
4745–4757.
Jennische E, Ekberg S & Matejka GL (1993). Expression of
hepatocyte growth factor in growing and regenerating
rat skeletal muscle. Am J Physiol Cell Physiol 265,
C122–C128.
Jones SW, Hill RJ, Krasney PA, O’Conner B, Peirce N &
Greenhaff PL (2004). Disuse atrophy and exercise
rehabilitation in humans profoundly affects the expression
of genes associated with the regulation of skeletal muscle
mass. FASEB J 18, 1025–1027.
Kadi F, Charifi N, Denis C & Lexell J (2004a). Satellite cells and
myonuclei in young and elderly women and men. Muscle
Nerve 29, 120–127.
Kadi F, Charifi N & Henriksson J (2006). The number
of satellite cells in slow and fast fibres from human
vastus lateralis muscle. Histochem Cell Biol 126,
83–87.
Kadi F, Schjerling P, Andersen LL, Charifi N, Madsen JL,
Christensen LR & Andersen JL (2004b). The effects of heavy
resistance training and detraining on satellite cells in human
skeletal muscles. J Physiol 558, 1005–1012.
Kim JS, Cross JM & Bamman MM (2005a). Impact of
resistance loading on myostatin expression and cell cycle
regulation in young and older men and women. Am J Physiol
Endocrinol Metab 288, E1110–E1119.
Kim JS, Kosek DJ, Petrella JK, Cross JM & Bamman MM
(2005b). Resting and load-induced levels of myogenic gene
transcripts differ between older adults with demonstrable
sarcopenia and young men and women. J Appl Physiol 99,
2149–2158.
Kosek DJ, Kim JS, Petrella JK, Cross JM & Bamman MM
(2006). Efficacy of 3 days/wk resistance training on myofiber
hypertrophy and myogenic mechanisms in young vs. older
adults. J Appl Physiol 101, 531–544.
Lange KH, Andersen JL, Beyer N, Isaksson F, Larsson B,
Rasmussen MH, Juul A, Bulow J & Kjaer M (2002). GH
administration changes myosin heavy chain isoforms in
skeletal muscle but does not augment muscle strength or
hypertrophy, either alone or combined with resistance
exercise training in healthy elderly men. J Clin Endocrinol
Metab 87, 513–523.
J Physiol 591.15
Livak KJ & Schmittgen TD (2001). Analysis of relative gene
expression data using real-time quantitative PCR and the
2−��CT method. Methods 25, 402–408.
Lorenzon P, Bandi E, de Guarrini F, Pietrangelo T, Schäfer R,
Zweyer M, Wernig A & Ruzzier F (2004). Ageing affects the
differentiation potential of human myoblasts. Exp Gerontol
39, 1545–1554.
McCormick KM & Schultz E (1994). Role of satellite cells in
altering myosin expression during avian skeletal muscle
hypertrophy. Dev Dyn 199, 52–63.
McCroskery S, Thomas M, Maxwell L, Sharma M & Kambadur
R (2003). Myostatin negatively regulates satellite cell
activation and self-renewal. J Cell Biol 162, 1135–1147.
Machida S & Booth FW (2004). Regrowth of skeletal muscle
atrophied from inactivity. Med Sci Sports Exerc 36, 52–59.
Machida S, Spangenburg EE & Booth FW (2003). Forkhead
transcription factor FoxO1 transduces insulin-like growth
factor’s signal to p27Kip1 in primary skeletal muscle satellite
cells. J Cell Physiol 196, 523–531.
McKay BR, O’Reilly CE, Phillips SM, Tarnopolsky MA & Parise
G (2008). Co-expression of IGF-1 family members with
myogenic regulatory factors following acute damaging
muscle-lengthening contractions in humans. J Physiol 586,
5549–5560.
McKay BR, Ogborn DI, Bellamy LM, Tarnopolsky M & Parise
G (2012). Myostatin is associated with age-related human
muscle stem cell dysfunction. FASEB J 26, 2509–2521.
Mackey AL, Andersen LL, Frandsen U, Suetta C & Sjogaard G
(2010). Distribution of myogenic progenitor cells and
myonuclei is altered in women with vs. those without
chronically painful trapezius muscle. J Appl Physiol 109,
1920–1929.
McPherron AC, Lawler AM & Lee SJ (1997). Regulation of
skeletal muscle mass in mice by a new TGF-β superfamily
member. Nature 387, 83–90.
Mauro A (1961). Satellite cell of skeletal muscle fibers. J Biophys
Biochem Cytol 9, 493–495.
Mezzogiorno A, Coletta M, Zani BM, Cossu G & Molinaro M
(1993). Paracrine stimulation of senescent satellite cell
proliferation by factors released by muscle or myotubes from
young mice. Mech Ageing Dev 70, 35–44.
Mitchell PO & Pavlath GK (2004). Skeletal muscle atrophy
leads to loss and dysfunction of muscle precursor cells. Am J
Physiol Cell Physiol 287, C1753–C1762.
Moss FP & Leblond CP (1970). Nature of dividing nuclei in
skeletal muscle of growing rats. J Cell Biol 44, 459–462.
Owino V, Yang SY & Goldspink G (2001). Age-related loss of
skeletal muscle function and the inability to express the
autocrine form of insulin-like growth factor-1 (MGF) in
response to mechanical overload. FEBS Lett 505,
259–263.
Pallafacchina G, Blaauw B & Schiaffino S (2012). Role of
satellite cells in muscle growth and maintenance of muscle
mass. Nutr Metab Cardiovasc Dis (in press; DOI:
10.1016/j.numecd.2012.02.002).
Petrella JK, Kim JS, Cross JM, Kosek DJ & Bamman MM
(2006). Efficacy of myonuclear addition may explain
differential myofiber growth among resistance-trained
young and older men and women. Am J Physiol Endocrinol
Metab 291, E937–E946.
�
C 2013 The Authors. The Journal of Physiology �
C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
J Physiol 591.15
Ageing affects human skeletal muscle recovery
Petrella JK, Kim JS, Mayhew DL, Cross JM & Bamman MM
(2008). Potent myofiber hypertrophy during resistance
training in humans is associated with satellite cell mediated
myonuclear addition: a cluster analysis. J Appl Physiol 104,
1736–1742.
Psilander N, Damsgaard R & Pilegaard H (2003). Resistance
exercise alters MRF and IGF-I mRNA content in human
skeletal muscle. J Appl Physiol 95, 1038–1044.
Raue U, Slivka D, Jemiolo B, Hollon C & Trappe SW (2006).
Myogenic gene expression at rest and after a bout of
resistance exercise in young (18–30 yr) and old (80–89 yr)
women. J Appl Physiol 101, 53–59.
Renault V, Rolland E, Thornell LE, Mouly V & Butler-Browne
G (2002). Distribution of satellite cells in the human vastus
lateralis muscle during aging. Exp Gerontol 37, 1513–1514.
Rosenblatt JD, Yong D & Parry DJ (1994). Satellite cell activity
is required for hypertrophy of overloaded adult rat muscle.
Muscle Nerve 17, 608–613.
Roth SM, Martel GF, Ferrell RE, Metter EJ, Hurley BF & Rogers
MA (2003). Myostatin gene expression is reduced in humans
with heavy-resistance strength training: a brief
communication. Exp Biol Med (Maywood) 228, 706–709.
Roth SM, Martel GF, Ivey FM, Lemmer JT, Metter EJ, Hurley
BF & Rogers MA (2000). Skeletal muscle satellite cell
populations in healthy young and older men and women.
Anat Rec 260, 351–358.
Sheehan SM & Allen RE (1999). Skeletal muscle satellite cell
proliferation in response to members of the fibroblast
growth factor family and hepatocyte growth factor. J Cell
Physiol 181, 499–506.
Sheehan SM, Tatsumi R, Temm-Grove CJ & Allen RE (2000).
HGF is an autocrine growth factor for skeletal muscle
satellite cells in vitro. Muscle Nerve 23, 239–245.
Shefer G, Van de Mark DP, Richardson JB & Yablonka-Reuveni
Z (2006). Satellite-cell pool size does matter: defining the
myogenic potency of aging skeletal muscle. Dev Biol 294,
50–66.
Suetta C, Aagaard P, Rosted A, Jakobsen AK, Duus B, Kjaer M
& Magnusson SP (2004a). Training-induced changes in
muscle CSA, muscle strength, EMG, and rate of force
development in elderly subjects after long-term unilateral
disuse. J Appl Physiol 97, 1954–1961.
Suetta C, Andersen JL, Dalgas U, Berget J, Koskinen S, Aagaard
P, Magnusson SP & Kjaer M (2008). Resistance training
induces qualitative changes in muscle morphology, muscle
architecture, and muscle function in elderly postoperative
patients. J Appl Physiol 105, 180–186.
Suetta C, Clemmensen C, Andersen JL, Magnusson SP,
Schjerling P & Kjaer M (2010). Coordinated increase in
skeletal muscle fibre area and expression of IGF-I with
resistance exercise in elderly post-operative patients. Growth
Horm IGF Res 20, 134–140.
Suetta C, Frandsen U, Jensen L, Jensen MM, Jespersen JG, Hvid
LG, Beyer M, Petersson SJ, Schrøder HD, Andersen JL,
Heinemeier K, Aagaard P, Schjerling P & Kjaer M (2012).
Aging affects the transcriptional regulation of human
skeletal muscle disuse atrophy. PLoS One 12, 1–13.
3803
Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K,
Simonsen L, Ortenblad N, Magnusson SP, Kjaer M &
Aagaard P (2009). Effects of aging on human skeletal muscle
after immobilization and retraining. J Appl Physiol 107,
1172–1180.
Suetta C, Magnusson SP, Rosted A, Aagaard P, Jakobsen AK,
Larsen LH, Duus B & Kjaer M (2004b). Resistance training
in the early postoperative phase reduces hospitalization and
leads to muscle hypertrophy in elderly hip surgery patients–a
controlled, randomized study. J Am Geriatr Soc 52,
2016–2022.
Tatsumi R, Anderson JE, Nevoret CJ, Halevy O & Allen RE
(1998). HGF/SF is present in normal adult skeletal muscle
and is capable of activating satellite cells. Dev Biol 194,
114–128.
Tatsumi R, Sankoda Y, Anderson JE, Sato Y, Mizunoya W,
Shimizu N, Suzuki T, Yamada M, Rhoads RP Jr, Ikeuchi Y &
Allen RE (2009). Possible implication of satellite cells in
regenerative motoneuritogenesis: HGF upregulates neural
chemorepellent Sema3A during myogenic differentiation.
Am J Physiol Cell Physiol 297, C238–C252.
Thornell LE, Lindstrom M, Renault V, Mouly V &
Butler-Browne GS (2003). Satellite cells and training in the
elderly. Scand J Med Sci Sports 13, 48–55.
Trendelenburg AU, Meyer A, Rohner D, Boyle J, Hatakeyama S
& Glass DJ (2009). Myostatin reduces Akt/TORC1/p70S6K
signalling, inhibiting myoblast differentiation and myotube
size. Am J Physiol Cell Physiol 296, C1258–C1270.
Verdijk LB, Koopman R, Schaart G, Meijer K, Savelberg HH &
van Loon LJ (2007). Satellite cell content is specifically
reduced in type II skeletal muscle fibers in the elderly. Am J
Physiol Endocrinol Metab 292, E151–E157.
Verney J, Kadi F, Charifi N, Feasson L, Saafi MA, Castells J,
Piehl-Aulin K & Denis C (2008). Effects of combined lower
body endurance and upper body resistance training on the
satellite cell pool in elderly subjects. Muscle Nerve 38,
1147–1154.
Yamada M, Tatsumi R, Yamanouchi K, Hosoyama T,
Shiratsuchi S, Sato A, Mizunoya W, Ikeuchi Y, Furuse M &
Allen RE (2010). High concentrations of HGF inhibit
skeletal muscle satellite cell proliferation in vitro by inducing
expression of myostatin: a possible mechanism for
reestablishing satellite cell quiescence in vivo. Am J Physiol
Cell Physiol 298, C465–C476.
Yang SY & Goldspink G (2002). Different roles of the IGF-I Ec
peptide (MGF) and mature IGF-I in myoblast proliferation
and differentiation. FEBS Lett 522, 156–160.
Zarnegar R (1995). Regulation of HGF and HGFR gene
expression. EXS 74, 33–49.
Additional information
Competing interests
None.
C 2013 The Authors. The Journal of Physiology C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
3804
C. Suetta and others
J Physiol 591.15
Author contributions
Funding
The study was performed at the Institute of Sports Medicine
Copenhagen, Bispebjerg Hospital, Denmark. Conception and
design of the study: C.S., U.F., P.S., P.A. and M.K. Collection,
analysis and interpretation of data: C.S., U.F., A.L.M., L.J.,
L.G.H., M.L.B., S.J.P., H.D.S., J.L.A. and P.S. Writing or revising
the manuscript critically: C.S., U.F., A.L.M., P.S., P.A., L.J., L.G.H.
and M.K. All authors have approved the final version of the
manuscript.
This study was supported by grants from the Danish Medical
Research Council, the Danish Rheumatology Association,
Faculty of Health Sciences, University of Copenhagen, The
Danish Ministry of Culture, Lundbeck Foundation, EU 7th
framework programme ‘Myoage’, and Nordea Foundation
(Healthy Ageing Grant).
Acknowledgements
We wish to express our gratitude to the subjects who participated
in this study for their abundant efforts and contribution to this
work.
Translational perspective
We report measures of myofiber area and myogenic stem cell number (SC) associated with type
I and type II muscle fibres in young and older humans, in combination with transcriptional data
from regulatory pathways related to skeletal muscle re-growth in immobilised and re-trained aging
human muscle. The main study finding was a less marked muscle mass recovery after immobilisation
in elderly compared to young individuals that was paralleled by an elevation in SC content in young
only, whereas elderly failed to demonstrate any change in SC’s. This potential coupling of SC
proliferation and recovery in myofiber area in young individuals occurred despite no age related
differences in the expression of myogenic regulating genes normally known to promote skeletal
muscle hypertrophy or SC proliferation. However, expression of myostatin was more pronounced
after immobilisation along with an attenuated down-regulation in response to re-loading in older
compared to young individuals, which may have contributed to the lack of SC proliferation in
aging muscle. The age-specific regulation in myostatin expression may also have contributed to the
apparent lack of increase in SC number and myofiber area with aging in response to re-loading.
Collectively, the present findings underlines that elderly have an impaired ability to recover from
disuse muscle atrophy and thus, elderly may need longer time to recover from periods of disuse or
disease compared to younger ones.
Gaining insight in the ability to recover muscle from atrophy has implications for effective
molecular and rehabilitative countermeasures against frailty in the growing population of elderly.
C 2013 The Authors. The Journal of Physiology C 2013 The Physiological Society
Downloaded from J Physiol (jp.physoc.org) at Copenhagen University Library on November 3, 2014
Experimental Gerontology 52 (2014) 1–8
Contents lists available at ScienceDirect
Experimental Gerontology
journal homepage: www.elsevier.com/locate/expgero
Aging impairs the recovery in mechanical muscle function following 4
days of disuse
L.G. Hvid a,⁎, C. Suetta b,c, J.H. Nielsen a, M.M. Jensen a, U. Frandsen a, N. Ørtenblad a, M. Kjaer b, P. Aagaard a
a
b
c
Institute of Sports Science and Clinical Biomechanics, SDU Muscle Research Cluster (SMRC), University of Southern Denmark, Odense, Denmark
Institute of Sports Medicine, Bispebjerg Hospital and Center of Healthy Aging, Faculty of Health Science, University of Copenhagen, Copenhagen, Denmark
Department of Diagnostics, Glostrup Hospital, University of Copenhagen, Denmark
a r t i c l e
i n f o
Article history:
Received 26 June 2013
Received in revised form 5 January 2014
Accepted 8 January 2014
Available online 18 January 2014
Section Editor: Christiaan Leeuwenburgh
Keywords:
Aging
Disuse
Muscle function
Immobilization
Physical function
a b s t r a c t
As aged individuals are frequently exposed to short-term disuse caused by disease or musculoskeletal injury, it is
important to understand how short-term disuse and subsequent retraining affect lower limb mechanical muscle
function. The purpose of the present study was, therefore, to investigate the effect of 4 days of lower limb disuse
followed by 7 days of active recovery on mechanical muscle function of the knee extensors in young (24.3 ±
0.9 years, n = 11) and old (67.2 ± 1.0 years, n = 11) recreationally active healthy males. Slow and moderate dynamic muscle strength were assessed using isokinetic dynamometry (60 and 180° s−1, respectively) along with
isometric muscle strength and rapid muscle force capacity examined as contractile rate of force development
(RFD), Impulse, and relative RFD (rRFD) during the initial phase of contraction (100 ms time interval relative
to onset of contraction). Prior to disuse, marked age-related differences (p b 0.05) were observed in isometric
and dynamic muscle strength (~35%) as well as in RFD and Impulse (~39%). Following disuse, young and old individuals experienced comparable decrements (p b 0.05) in isometric strength (~9%), slow dynamic strength
(~13%), and RFD and Impulse (~19%), whereas old individuals only experienced decrements (p b 0.05) in moderate dynamic strength (12%) and rRFD (~17%). Following recovery, all measures of mechanical muscle function
were restored in young individuals compared to pre-disuse values, while isometric, slow and moderate dynamic
muscle strength remained suppressed (p b 0.05) in old individuals (~8%) along with a tendency to suppressed
RFD100 (p = 0.068). In conclusion, 4 days of lower limb disuse led to marked decrements in knee extensor mechanical muscle function in both young and old individuals, yet with greater decrements observed in moderate
dynamic strength and rapid muscle force capacity in old individuals. While 7 days of recovery – including free
ambulation, one test session and a single session of strength training – was sufficient to restore mechanical
muscle function in young individuals, old individuals appeared to have an impaired ability to fully recover as
evidenced by suppressed values of isometric and dynamic muscle strength and rapid muscle force capacity.
© 2014 Elsevier Inc. All rights reserved.
1. Introduction
Disuse has been shown to induce marked impairments in lower limb
mechanical muscle function of both young and old individuals, characterized by decrements in isometric and dynamic muscle strength as
well as in rapid muscle force capacity (e.g. rate of force development
(RFD) and contractile Impulse) (Deschenes et al., 2008; Hvid et al.,
2010; Kortebein et al., 2008; LeBlanc et al., 1992; Narici and de Boer,
2011; Suetta et al., 2009). As these specific measures of muscle function
have been shown to be strong predictors of general functional status,
quality of life, and risk of mortality in aged individuals (Buchman
et al., 2007; Cesari et al., 2009; Newman et al., 2006; Pijnappels et al.,
⁎ Corresponding author at: Institute of Sports Science and Clinical Biomechanics,
University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark. Tel.: +45
6550 4483.
E-mail address: [email protected] (L.G. Hvid).
0531-5565/$ – see front matter © 2014 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.exger.2014.01.012
2008; Wyszomierski et al., 2009), even short periods of disuse may
lead to severe consequences for a single individual. Specifically, rapid
muscle force capacity (i.e. the ability to produce as much force as possible within fractions of a second, e.g. 100 ms) has been advocated to be
highly important for the ability to counteract unexpected perturbations
during walking and thus avoiding falling (Aagaard et al., 2002; Caserotti
et al., 2008; Wyszomierski et al., 2009). In support, having a low vs. a
high rate of force development (RFD) has been shown to discriminate
older fallers from non-fallers, respectively (Pijnappels et al., 2008).
Based on existing data, impairments in lower limb mechanical muscle function appear to occur very fast within the initial phase (days) of
disuse followed by an attenuated rate of decline as time progresses
(Deschenes et al., 2008; Deutz et al., 2013; Hvid et al., 2010, 2013;
Kortebein et al., 2008; LeBlanc et al., 1992; Narici and de Boer, 2011;
Suetta et al., 2009, 2012). Moreover, the subsequent recovery in
mechanical muscle function following cessation of disuse appears to
be compromised in older compared to younger individuals, at least
after more prolonged periods (14 days) of disuse (Hvid et al., 2010;
2
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
Suetta et al., 2009), altogether contributing to an increased risk of functional impairments and disability.
Yet, no previous studies have comprehensively investigated lower
limb mechanical muscle function in response to disuse lasting less
than 7 days and subsequent recovery in aged individuals. As aged individuals are frequently exposed to short periods of disuse due to disease
or musculoskeletal injury occasionally involving hospitalization
(Cookson and Laudicella, 2011; Covinsky et al., 2003; Saczynski et al.,
2010), knowledge of the potential disuse-induced impairments in
mechanical muscle function as well as of the responsible underlying
mechanisms is of major importance.
The purpose of the present study was, therefore, to investigate the
effect of 4 days of lower limb disuse followed by 7 days of recovery on
mechanical muscle function of the knee extensors (isometric and
dynamic strength as well as rapid muscle force capacity) in young and
old healthy men. It was hypothesized that young and old individuals
would show a comparable decline in mechanical muscle function with
disuse, and that old individuals would have an impaired ability to recover compared to young individuals.
2. Material and methods
2.1. Study design
While the present study focuses on the effects of short-term disuse
and subsequent recovery on lower limb muscle mechanical function
in old individuals vs. young individuals, detailed information on the
disuse design and additional data comprising disuse-induced effects
on single fiber contractile function and molecular signaling pathways
have previously been published (Hvid et al., 2013; Suetta et al., 2012).
In brief, young and old healthy men underwent 4 days of unilateral
lower limb disuse followed by 7 days of active recovery. In addition to
a familiarization session ~ 2 weeks prior to the start of the study
(Fam), tests of knee extensor mechanical muscle function as well as
body weight and height were performed ~1 week before (Pre) and 24
hrs after disuse (Post), as well as 7 days after recovery (Rec) (Fig. 1).
Tests of mechanical muscle function were performed in both limbs,
thus with the contra-lateral “non-disused” leg serving as an internal
control. Muscle biopsies were obtained from the vastus lateralis muscle
at Pre, Post, and Rec, in order to examine myosin heavy chain (MHC)
isoform composition as and muscle fiber cross-sectional area (CSA) of
the disused leg. To minimize the influence of discomfort from the biopsy
and particularly the risk of severe muscle damage in the older subjects,
tests of mechanical muscle function were performed the day following
the muscle biopsy (Fig. 1) according to previous procedures (Hvid
et al., 2010; Suetta et al., 2009). Subjects were instructed not to engage
in any vigorous activities 48 hrs prior to all test sessions. To minimize
the influence from diurnal variation, each subject was tested at the
same time of day (±2 hrs).
Fig. 1. Study overview. In addition to a familiarization session (Fam), various tests of
mechanical muscle function of the knee extensors were carried out prior to (Pre) and following disuse (Post), as well as after recovery (Rec). Muscle biopsy sampling (B) was performed at Pre, Post, and Rec, always 1 day preceding tests of mechanical muscle function.
In addition to free ambulation and the activities during post testing, the period of recovery
included one session of high-intense unilateral resistance training (RT).
2.2. Subjects
While twenty-three healthy men were initially recruited for the
study, one subject did not adhere to the disuse protocol for which
reason his data was excluded from the analysis. Altogether, 11 young
men (24.3 ± 0.9 yrs, 180.4 ± 2.7 cm, 74.3 ± 2.4 kg) and 11 old men
(67.2 ± 1.0 yrs, 178.8 ± 1.7 cm, 87.7 ± 3.0 kg) participated in
the study, with body mass differing between young and old individuals
(p b 0.05). Care was taken to include young and old individuals with
comparable levels of physical activity. This was done by using a questionnaire to estimate the amount (hours per week) of occupational
(groups I–IV, ranging from predominantly sedentary work to heavy
manual work) and recreational activities (groups I–IV, ranging from
almost completely inactive to regular high-intense physically active,
including description of the activities) on a general basis (Saltin
and Grimby, 1968). Based on the questionnaire data, physical activity
levels were similar in young and old individuals (4.3 ± 0.6 vs. 4.4 ±
0.6 hrs wk−1, respectively) with no differences in low-to-moderate intensity occupational (group II sitting or standing, some walking) and recreational activities (group II some physical activity during at least 4 h per
week). None of the subjects had previous experience with systematic resistance training.
Sample size was calculated based on findings from previous shortterm disuse studies (Deschenes et al., 2008; Hvid et al., 2010; Suetta
et al., 2009) using a statistical power (β) of 0.80, level of significance
(α) = 0.05, and an expected range of change of ~ 10% in maximal
knee extensor isometric strength.
All subjects were thoroughly informed of the details of the study and
gave written, informed consent prior to participation. The study was
approved by the Ethical Committee of Copenhagen and Frederiksberg
in accordance with the Helsinki declaration (KF01-322606).
2.3. Disuse protocol
Details of the disuse protocol have been described elsewhere (Hvid
et al., 2013). Briefly, 4 days of randomized unilateral lower limb disuse
was conducted using a knee brace (DonJoy, DJO Global Inc., USA) fixed
in a 30° knee angle (0° = full extension), with plastic strips applied to
ensure that the brace was not removed during the disuse period. All
ambulatory activities were carried out on the contralateral limb using
crutches. Subjects were carefully instructed to refrain from weightbearing activities (~ ground contact) using the disused leg, but were
encouraged to perform unloaded ankle flexion–extension on a daily
basis in order to reduce the potential risk of venous thrombosis. Daily
contact was kept with all subjects to ensure optimal compliance and
to avoid health implications.
2.4. Recovery protocol
Immediately after the removal of the knee brace, subjects were
biopsied and subsequently received manual mobilization of the disused
leg to ensure that minimal pain was present and that normal range of
motion could be obtained at the knee joint. In addition to returning to
free ambulation and the test session of mechanical muscle function
the day after the removal of the knee brace, subjects performed one session of supervised unilateral resistance training (including 5RM testing)
of the disused leg three days after the removal of the brace (Fig. 1).
Exercises included knee extension, leg press, and knee flexion using
load adjustable machines (Technogym International, Italy). Following
a brief warm-up (cycle ergometer, 5 min, 50–150 W) and determination of loading intensity of the chosen exercises by use of the 5RM testing, subjects performed 3 sets × 12 reps (at 15RM) using moderate (~1–
2 s) and slow movement speeds (~3–4 s) in the concentric and eccentric
contraction phases, respectively.
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
2.5. Assessment of knee extensor mechanical muscle function
Maximal voluntary isometric (MVC) and dynamic muscle strength
as well as rapid muscle force capacity (RFD and Impulse) were obtained
for the knee extensors using an isokinetic dynamometer (Kinetics
Communicator — Chattecx, USA) (Aagaard et al., 2002; Hvid et al., 2010).
2.5.1. Dynamic and isometric muscle strength
Following several warm-up trials, subjects performed a number of
maximal dynamic concentric knee extensions at slow (60° s−1) and at
moderate angular speed (180° s−1) in a range of 90 to 20° (0° = full extension). Subsequently, subjects performed three maximal isometric
knee extensions at a knee joint angle of 70°, while instructed to contract
as fast and forcefully as possible, and maintain maximal force exertion
for 2–3 s. All knee extension trials were separated by a 1 min rest period.
For both slow and moderate dynamic strength as well as isometric
strength, the trial with the highest force (~torque) was selected for further analysis (including rapid muscle force capacity, see below). Strong
verbal encouragement along with online visual feedback was given to
the subjects during all testing. Onset of contraction was defined as the
instant when force production exceeded the baseline level force by 3%
of the maximal force value. All trials with a visible initial countermovement were discarded from the analysis. Individual dynamometer
settings were registered to ensure identical subject positioning at all
test sessions (Fig. 1). Measures of knee extensor muscle strength were
gravity corrected and subsequently normalized to body mass, thus
reflecting how well an individual would cope with whole body movement tasks (Hvid et al., 2010). Yet, to enable comparison to previously
published data, absolute values of isometric strength are presented also.
2.5.2. Rapid muscle force capacity
Rapid muscle force capacity was assessed as the contractile rate of
force (torque) development (RFD), Impulse, and relative RFD (rRFD)
(Aagaard et al., 2002). RFD was derived as the average tangential
slope of the torque–time curve (Δtorque/Δtime) calculated in
the time interval 0–100 ms relative to the onset of contraction
(RFD100 ), and contractile Impulse as the area under the torque–time
curve (∫ torque dt) in the same time interval (Impulse100 ), thus
reflecting the initial phase of rising muscle force. In comparison to
RFD, contractile Impulse additionally reflects the entire time history of
contraction and consequently the velocity that the limb segment
would achieve at that specific time instant (100 ms) if allowed to
move (Aagaard et al., 2002). Measures of rapid muscle force capacity
were normalized to body mass, thus reflecting how well an individual
would cope with performing rapid whole body movement tasks (Hvid
et al., 2010). We chose to analyze rapid muscle force capacity in the
time interval 0–100 ms, as this has previously been argued to be functionally important (Aagaard et al., 2002; Wyszomierski et al., 2009)
e.g. in discriminating older fallers from non-fallers (Pijnappels et al.,
2008). The rRFD was calculated by expressing absolute RFD values relative to maximal isometric strength (MVC) (Aagaard et al., 2002). This
measure can be used to examine whether intervention-induced changes in rapid muscle force capacity is due to changes in ‘qualitative’ factors
(e.g. initial motor unit firing rate, MHC isoform composition, single muscle fiber contractile function, tendon mechanical properties) (Aagaard
et al., 2002).
3
MHC isoform composition was analyzed as previously described
using gel electrophoresis (Andersen and Aagaard, 2000; Danieli Betto
et al., 1986; Hvid et al., 2011, 2013). Briefly, one part of the biopsy
muscle sample was manually homogenized, mixed with ice-cold buffer
in a 1:10 ratio (in mM: 300 sucrose, 1 EDTA, 10 NaN3, 40 Tris-base and
40 L-histidine, pH 7.8), frozen in liquid nitrogen, and subsequently
stored at − 80 °C. At the day of analysis, muscle homogenates
were mixed with 200 μL of sample-buffer (10% glycerol, 5% 2mercaptoethanol and 2.3% SDS, 62.5 mM Tris and 0.2% bromophenol
blue at pH 6.8), boiled in water at 100 °C for 3 min, and loaded in 3 protein amounts (10–40 μL) on a SDS-PAGE gel (6% polyacrylamide (100:1
acrylamide:bisacrylamide), 30% glycerol, 67.5 mM tris-base, 0.4% SDS,
and 0.1 M glycine). Gels were run at 80 V for 42 hrs at 4 °C, MHC
bands were visualized with Coomassie staining, gels were scanned
(Linoscan 1400 scanner, Germany), and MHC bands quantified
densitometrically (Phoretix 1D, nonlinear, UK) as an average of the
three loaded protein amounts.
Muscle fiber cross-sectional area (CSA) was analyzed as previously
described using immunohistochemistry to identify type I (stained)
and type II (unstained) fibers (Suetta et al., 2012, 2013). Briefly, one
part of the biopsy muscle was oriented in the embedding medium
(Tissue-Tek, Sakura Finetek, USA), frozen in liquid nitrogen and subsequently stored at −80 °C. At the day of analysis, transverse serial sections (8 μm) of each sample were cut at − 22 °C using a cryostat
(HM560; Microm, Walldorf, Germany) and mounted on glass slides.
Following rehydration of the slides, fixation and permeabilization in
4% normal buffered formalin and triton X-100 (0.1%) for 10 min, immune fluorescent stainings were performed by incubation with rabbit
anti-laminin (rabbit anti-laminin, cat. no. Z0097, DakoCytomation)
and mouse anti-skeletal myosin slow (M8421, 1:2000, St Louis, MO,
USA). After washing, slides were then incubated with the secondary
antibodies (Alexa-555 goat anti-mouse (Invitrogen, A21424, Life Technologies Denmark, Naerum, Denmark, 1:1000) and Alexa-488 goat
anti-rabbit (Invitrogen, A11034, 1:1000)). Finally, sections were
mounted with cover glass and stainings visualized on a computer screen
using a fluorescent microscope (Carl Zeiss Axio Imager M1, Germany)
and a high-resolution AxioCam (Carl Zeiss). A digital analysis program
(Carl Zeiss, AxioVision 4.6) was used for the determination of muscle
fiber CSA, including truly horizontally cut fibers only, with a minimum
of 50 fibers (range 50–200) analyzed per time point.
2.7. Statistical analysis
Statistical analysis was performed as previously described using linear mixed model (STATA 10.1, StataCorp, USA) (Hvid et al., 2011, 2013).
Data were tested for normal distribution, and if absent, appropriate
transformations were carried out prior to analysis (all measures of
rapid muscle force capacity were square-root transformed). Measurements of mechanical muscle function, MHC isoform composition as
well as muscle fiber CSA were analyzed with Group (Young, Old) and
Time (Pre, Post, Rec) as fixed effects, and with Subject ID as random
effect. Relationships between measures of mechanical function and
MHC isoform content or muscle fiber CSA were investigated using
Pearson's correlation analysis. Data are presented as mean ± se unless
otherwise stated. n denotes number of subjects. Level of statistical
significance was set at p b 0.05.
3. Results
2.6. MHC isoform composition and muscle fiber cross-sectional area
3.1. Maximal isometric and dynamic strength
Muscle biopsies (Bergstrom, 1962) were obtained from the middle
portion of the vastus lateralis muscle approximately one week prior to
disuse (Pre), immediately after removal of the knee brace (Post), and
following 6 days of recovery (Post). This was carried out by the same
investigator in order to minimize variability due to muscle depth and
vicinity of location.
Prior to disuse, marked age-related differences were observed in
knee extensor muscle strength, as evidenced by lower levels of isometric and dynamic strength in old individuals vs. young individuals (~35%;
p b 0.05) (Table 1). Following disuse, young and old individuals experienced comparable changes in isometric (− 10 ± 2 and − 8 ± 4%,
4
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
Table 1
Knee extensor mechanical muscle function.
Knee extensor mechanical muscle function prior to (Pre) and following 4 days of disuse (Post), and following 7 days of recovery (Rec) in young and old healthy men. Assessment of
strength encompasses isometric strength, slow dynamic strength (60° s−1), and moderate dynamic strength (180° s−1), while rapid muscle force capacity encompasses RFD, relative RFD
(rRFD), and Impulse in the initial 100 ms of rising muscle force. Values are given for both the disused leg and the contra-lateral control leg as group mean ± se. p b 0.05; a: different
from young individuals, b: different from Pre (at Post or at Rec), c: different from Post (at Rec), and d: relative changes different from those observed in young individuals. In addition
to the body mass normalized values, absolute values are presented for isometric strength enabling comparison to previous published data. See Fig. 2 for a graphical display of mean
torque–time curves.
respectively; p b 0.05) and slow dynamic strength (−10 ± 4 and −16 ±
4%, respectively; p b 0.05), whereas moderate dynamic strength changed
in old individuals only (−12 ± 4%; p b 0.05) (Table 1). Following recovery, isometric and slow dynamic strength returned to pre-disuse values
in young individuals, whereas isometric as well as slow and moderate
2.75
Rec
Pre
Post
2.50
2.25
Young
Torque (Nm.kg-1)
2.00
dynamic strength remained suppressed in old individuals (− 7 ± 3,
− 9 ± 2 and − 9 ± 2%, respectively; p b 0.05) (Table 1).
In the control leg, measures of knee extensor muscle strength in
both young and old individuals were not different from those observed
in the disused leg prior to disuse (Table 1). No changes were observed
following disuse or following recovery (Table 1).
As shown in Table 1, absolute values of isometric strength (in Nm),
follow the same pattern of percentage changes as the body mass
normalized values.
3.2. Rapid muscle force capacity
Pre
Rec
Post
1.75
1.50
1.25
Old
1.00
0.75
Marked age-related differences were also observed in knee extensor
rapid muscle force capacity, as evidenced by lower RFD and Impulse in
the initial phase of rising muscle force(0–100 ms) in old individuals
vs. young individuals (~ 39%; p b 0.05) (Table 1). However, no agerelated differences were observed in rRFD (Table 1).
0.50
0.25 Tonset
0.00
0
50
100
150
200
250
300
Table 2
MHC isoform composition.
Time (ms)
Fig. 2. Group mean torque–time curves obtained during maximal voluntary isometric
contraction (MVC) of the knee extensors prior to disuse (Pre, solid line), following 4
days of disuse (Post, dashed line), and following 7 days of recovery (Rec, dash-dotted
line) in young (black lines) and old men (gray lines). Data are provided for the first 300
ms of contraction only. Torque is displayed normalized to body mass. Solid circles denote
onset of contraction (t = 0 ms). RFD and Impulse was calculated in the time interval
0–100 ms relative to onset of contraction, i.e. reflecting the initial phase of rising muscle
force (see Table 1 for specific values).
Young (n = 11)
Old (n = 11)
MHC %
I
IIa
IIx
I
IIa
IIx
Pre
Post
Rec
51 ± 3
50 ± 4
48 ± 4
47 ± 4
47 ± 4
48 ± 4
3±1
3±1
3±2
59 ± 3 a
63 ± 5 a
56 ± 4
38 ± 3 a
34 ± 5 a
40 ± 4
3±1
3±1
4±2
Percentage MHC isoform composition (vastus lateralis muscle) in young and old men prior
to (Pre) and following 4 days of disuse (Post), and following 7 days of recovery (Rec).
Values are group mean ± se. p b 0.05; a: different from young individuals.
5
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
Type II
6000
0
Young
Old
Young
a
Rec
0
a,b
Post
1000
a
Rec
1000
Rec
2000
Post
2000
Pre
3000
Rec
3000
Post
4000
4000
Post
a,b
Pre
5000
b
5000
b
Pre
6000
Pre
Cross-sectional area (µ.m-2)
Type I
Old
Fig. 3. Cross-sectional areas of type I and II muscle fibers (vastus lateralis muscle) in young and old men prior to (Pre) and following 4 days of disuse (Post), and following 7 days of recovery
(Rec). Values are group mean ± se. p b 0.05; a: different from young individuals, b: different from Pre (at Post or at Rec).
Following 4 days of disuse, the isometric torque–time curves
appeared less steep in both young and old individuals (Fig. 2). Consequently, RFD and Impulse decreased in young (RFD100 — 13 ± 5% and
Impulse100 — 17 ± 6%; p b 0.05) and old (RFD100 — 23 ± 5% and
Impulse100 —21 ± 8%; p b 0.05) individuals (Table 1). Moreover, rRFD
decreased in old individuals (rRFD100 —17 ± 3%; p b 0.05), showing
a greater relative decrease than that observed in young individuals
(p b 0.05) (Table 1). Following 7 days of recovery, isometric knee extensor torque–time curves became steeper as reflected by gains in
RFD, Impulse, and rRFD to reach pre-disuse values (Table 1). However, as suggested by visual inspection of the torque–time curves
(Fig. 2), old individuals appeared to demonstrate an attenuated recovery of rapid muscle force capacity (tendency observed for
RFD100 ; p = 0.068). When using absolute values (in Nm), an identical
pattern of torque–time curves was seen as that displayed in Fig. 2 (data
not shown).
In the control leg, measures of knee extensor rapid muscle force capacity in both young and old individuals were not different from those
observed in the disused leg prior to disuse (Table 1). No changes were
observed following disuse or recovery (Table 1).
young and old individuals, except for type I CSA in old individuals
which remained suppressed (−7.2%, p b 0.05) (Fig. 3).
Prior to disuse, correlations between muscle fiber CSA and measures
of mechanical muscle function were observed in old individuals (type II
CSA and isometric strength, r2 = 0.69), but not in young individuals or
when combining data for both young and old individuals (data not
shown). With both disuse and recovery, no correlations were observed
between the relative (percentage) changes in muscle fiber CSA and
measures of mechanical muscle function, combined or separately
(data not shown).
4. Discussion
As the main overall finding in the present study, only 4 days of lower
limb disuse induced marked decrements in mechanical muscle function
both in young and old healthy individuals. Furthermore, while mechanical muscle function was fully restored in young individuals following 7
days of active recovery it remained suppressed in old individuals.
3.3. MHC isoform composition
3.4. Muscle fiber cross-sectional area
Prior to disuse, muscle fiber CSA of type I fibers was similar when comparing young and old individuals, whereas CSA of type II fibers was smaller in old individuals vs. young individuals (Fig. 3). Following 4 days of
disuse, type I muscle fiber CSA decreased in young individuals (−8.1%,
p b 0.05) and tended to decrease in old individuals (−7.1%, p = 0.073),
while type II muscle fiber CSA decreased in both young and old individuals (−12.6 and −10.9%, respectively, p b 0.05). Following 7 days of recovery, type I and type II CSA returned to pre-disuse values in both
Disuse (days)
0
Decrease (%)
in muscle strength
Prior to disuse, the vastus lateralis muscle showed a higher type I
MHC isoform content along with a lower type IIa MHC isoform content
in old individuals compared to young individuals (Table 2). In contrast,
the composition of MHC I, IIa, and IIx isoforms remained unaltered
following the periods of disuse and recovery, respectively (Table 2).
Prior to disuse, correlations between MHC isoform content and measures of mechanical muscle function were observed when data were
combined for young and old individuals (MHC IIa and Impulse100,
r2 = 0.22, p b 0.05; MHC IIa and RFD100 , r2 = 0.16, p = 0.07), but
not separately. With both disuse and recovery, no correlations were
observed between the relative (percentage) changes in MHC isoform
content and measures of mechanical muscle function, combined or separately (data not shown).
-5
-10
5
10
15
20
25
30
35
40
45
Young: open symbols
Old: grey symbols
Disuse
approach
Cast
-15
ULLS
-20
Bed rest
-25
Brace
-30
Fig. 4. Decrease in maximal isometric knee extensor strength (MVC) plotted against the
duration of lower limb disuse up to 45 days (n = 27 studies). While a majority of studies
have been carried out in young subjects (~25 years), only four studies have examined old
subjects (~ 67 years) including the present study. Notably, in addition to the present
experiments, only a single previous study has been conducted to investigate the subsequent ability to recover following the disuse period in old individuals (Hvid et al., 2010).
A least-square curve fit has been applied for illustrative purposes (hyperbolic regression,
best non-linear fit). ULLS: unilateral lower limb suspension. Studies including young subjects (Adams et al., 1994; Bamman et al., 1998; Berg and Tesch, 1996; Berg et al., 1997,
2007; Clark et al., 2006; de Boer et al., 2007; Deschenes et al., 2002, 2008; Dudley et al.,
1992; Hespel et al., 2001; Horstman et al., 2012; Hortobagyi et al., 2000; Hvid et al.,
2010; Jones et al., 2004; Kawakami et al., 2001; Kubo et al., 2000, 2004; Labarque et al.,
2002; Rozier et al., 1979; Schulze et al., 2002; Yasuda et al., 2005), and studies including
old subjects (Deschenes et al., 2008; Hvid et al., 2010; Kortebein et al., 2008).
6
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
4.1. Effects of aging
Prior to disuse, age-related reductions in knee extensor muscle
strength and rapid muscle force capacity were observed (~ 35 and
~39%, respectively) in agreement with previous observations (Ditroilo
et al., 2010; Hvid et al., 2010; Kubo et al., 2007; Macaluso et al., 2002).
As suggested by correlation analyses, this may in part be explained by
the slower MHC isoform composition (higher MHC I isoform content,
lower MHC IIa isoform content) as well as by the smaller type II fiber
CSA shown in old individuals compared to young individuals, factors
that has previously been shown to affect muscle force/RFD output
(Clarkson et al., 1981; Harridge et al., 1996; Hvid et al., 2010; Klitgaard
et al., 1990; Korhonen et al., 2006; Larsson et al., 1979).
In the present study, young and old subjects spend the same amount
of hours doing occupational and recreational activities at an intensity corresponding to low-to-moderate, thus indicating that the observed findings were due to the effect of aging per se and not caused by potential
differences in physical activity levels. Nevertheless, as the questionnaire
assessed physical activity on a general basis, age-related differences
may potentially have existed in patterns of habitual physical activity in
old individuals (continuous, shifting between low and moderate intensities) vs. young individuals (intermittent, shifting between low, moderate,
and high intensities), thus hypothetically influencing the observed findings in mechanical muscle function.
4.2. Effects of disuse
In the present study 4 days of lower limb disuse led to marked decrements in maximal knee extensor isometric and dynamic muscle
strength as well as in rapid muscle force capacity in both young and
old healthy individuals. The magnitude of changes was in strong agreement with previous reports, collectively confirming that disuse-induced
decrements in lower limb mechanical muscle function occur very fast
within the initial phase (days) of disuse irrespectively of age, followed
by an attenuated rate of decline with more prolonged periods of disuse
(weeks) (see Fig. 4 for references). Thus, collapsed data from known
studies (including the present data) reveal average decreases per day
in isometric muscle strength of 2.05, 1.53, and 1.37% during 10, 15,
and 20 days of disuse, respectively (Fig. 4). Although less often examined, greater decrements in rapid muscle force capacity (RFD) appear
to occur (Bamman et al., 1998; de Boer et al., 2007; Horstman et al.,
2012; Hvid et al., 2010; Kubo et al., 2000). Intriguingly, even greater
decrements may therefore have been observed in both young and old
individuals if testing of mechanical muscle function had been carried
out on the day of cast removal, and not the following day (see
Section 2.1 Study design).
While the present data suggest that disuse-induced decrements in
lower limb isometric and slow dynamic strength occur independently
of age (at least up until ~70 years), moderate dynamic strength and to
some extent rapid muscle force capacity revealed disproportionally
greater impairments in old individuals compared to young individuals,
also in support of previous observations (Deschenes et al., 2008; Hvid
et al., 2010; Suetta et al., 2009). This may be explained by different physiological variables involved in slow and moderate-to-fast muscle contractions, respectively. The latter are specifically influenced by muscle
quantity particularly of fast type II muscle fibers (Clarkson et al., 1981;
Hvid et al., 2010; Klitgaard et al., 1990; Larsson et al., 1979), yet also
by qualitative factors such as fiber type composition (higher proportions of MHC II vs. I isoforms favor high muscle force/RFD output during
moderate-to-fast contractions) (Clarkson et al., 1981; Harridge et al.,
1996; Hvid et al., 2010; Klitgaard et al., 1990; Korhonen et al., 2006;
Larsson et al., 1979), intrinsic contractile properties of fibers of a given
MHC isoform composition (Bottinelli et al., 1999; Hvid et al., 2011,
2013; Metzger and Moss, 1990) and specific patterns of efferent neural
input (Aagaard et al., 2002; Klass et al., 2008). In the present study, no
disuse-induced changes in fiber type (MHC isoform) composition
were observed in either young individuals or old individuals (Table 2),
decrements in type I and type II muscle fiber CSA as well as decrements
in specific force (force per cross-sectional area) of isolated single muscle
fibers occurred independently of age (Hvid et al., 2013). However, the
fact that relative RFD decreased with disuse in old individuals only
(Table 1) suggests that qualitative changes, likely involving modulations in efferent neural input, were responsible for the age-dependent
decrements observed in moderate dynamic strength as well as in
rapid muscle force capacity (Fig. 2, Table 1).
4.3. Effects of recovery
In conjunction with previous observations (Hvid et al., 2010; Suetta
et al., 2009, 2013), the findings of the present study suggest that the
magnitude and time-course of changes in mechanical muscle function
during recovery following short-term disuse are compromised in old
individuals compared to young individuals.
While the recovery period (including free ambulation, a high-intense
test session, and a single high-intense training session) appeared effective
of restoring knee extensor mechanical muscle function in the young
study participants in accordance with previous reports (Berg and Tesch,
1996; Hespel et al., 2001; Hortobagyi et al., 2000; Hvid et al., 2010;
Jones et al., 2004; Labarque et al., 2002), knee extensor mechanical muscle function remained suppressed in the old study participants, as also observed following 14 days of disuse (Hvid et al., 2010; Suetta et al., 2009).
Yet, it remains unknown whether old individuals would have benefitted
from an even stricter scheme of recovery (e.g. including an additional
session of strength training), or whether skeletal muscles of old individuals simply failed to tolerate the regime of active recovery chosen in
the present study.
The observed impairment in restoring lower limb mechanical muscle function following short-term disuse in old adults may in part reside
from qualitative muscle factors as discussed above (RFD100 tended to
remain reduced in old individuals following 7 days of recovery), while
likely also from an age-related impairment in the capacity for muscle
re-growth as shown in the present (type I CSA remained suppressed
in old individuals following 7 days of recovery) as well as in previous
studies (Carlson et al., 2009; Tanaka et al., 2004).
4.4. Functional implications
The present findings showing that old individuals experienced
marked decrements in knee extensor mechanical muscle function following only 4 days of disuse, combined with an attenuated/slower
rate of recovery, are likely to have important functional consequences.
In particular since the selected measures of knee extensor mechanical
muscle function (isometric and dynamic muscle strength as well as
rapid muscle force capacity) have been shown to be a strong predictor
of functional status including fundamental elements required to maintain independent living in older individuals (e.g. mobility and ability
to counteract falls) while also influencing quality of life and risk of
mortality (Buchman et al., 2007; Cesari et al., 2009; Newman et al.,
2006; Wyszomierski et al., 2009). As the age of the present older
study participants was ~67 years, we can only speculate to what extent
similar disuse and retraining periods would have affected mechanical
muscle function of very old individuals (i.e. N 80 years). It may be speculated that substantially greater disuse-induced decrements in mechanical muscle function would have been observed as indicated by data
from animal disuse studies (Arora et al. 2008), accompanied by an
even slower rate of training-induced recovery as observed in human
training studies comprising very old individuals (Laroche et al., 2008;
Raue et al., 2009).
Altogether, it seems of paramount importance to develop effective
preventive and/or rehabilitative intervention strategies to counteract
the deleterious impact of short-term disuse in aged individuals, in particular when considering the rapid rate of decline observed in the initial
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
days of disuse (cf. Fig. 3). For this purpose, we specifically suggest use of
exercise interventions based on high-intensity resistance training, as
this has previously been proven highly effective in improving mechanical muscle function (particularly through improvements in neural
input) in old and very old individuals while at the same time being
safe and well tolerated (Caserotti et al., 2008; Hvid et al., 2010). Notably,
the impaired ability to recover following short-term disuse in aged individuals, i.e. the slower rate by which mechanical muscle function is
restored (present study as well as previous data from our lab (Hvid et
al., 2010; Suetta et al., 2009; Suetta et al., 2013)), should be taken into
account when planning counteractive intervention strategies.
5. Conclusions
Lower limb mechanical muscle function decreased markedly in both
young and old males following short-term (4 days) disuse. The observed
decrements in isometric and slow dynamic muscle strength were independent of age whereas the observed decrements in moderate dynamic
muscle strength and rapid muscle force capacity (RFD, Impulse) tended
to be greater at old age. The subsequent recovery (7 days) in mechanical
muscle function was affected negatively by age, manifested by an impaired ability to fully restore dynamic/isometric muscle strength and
rapid muscle force capacity in old individuals.
Conflict of interest
The Authors declare no conflicts of interest in relation to the content
of this article.
Acknowledgments
We like to thank the experimental subjects for their participation in
the study. The study was supported by grants from the Lundbeck
Foundation, the Nordea Foundation and the Danish National Research
Council (Medical Sciences: FSS).
References
Aagaard, P., Simonsen, E.B., Andersen, J.L., Magnusson, P., Dyhre-Poulsen, P., 2002. Increased rate of force development and neural drive of human skeletal muscle following resistance training. J. Appl. Physiol. 93, 1318–1326.
Adams, G.R., Hather, B.M., Dudley, G.A., 1994. Effect of short-term unweighting on human
skeletal muscle strength and size. Aviat. Space Environ. Med. 65, 1116–1121.
Andersen, J.L., Aagaard, P., 2000. Myosin heavy chain IIX overshoot in human skeletal
muscle. Muscle Nerve 23, 1095–1104.
Arora, P., Husom, A.D., Ferrington, D.A., Thompson, L.V., 2008. Age-dependent effects of
treadmill exercise during a period of inactivity. Exp Gerontol 43, 668–673.
Bamman, M.M., Clarke, M.S., Feeback, D.L., Talmadge, R.J., Stevens, B.R., Lieberman, S.A.,
Greenisen, M.C., 1998. Impact of resistance exercise during bed rest on skeletal
muscle sarcopenia and myosin isoform distribution. J. Appl. Physiol. 84, 157–163.
Berg, H.E., Tesch, P.A., 1996. Changes in muscle function in response to 10 days of lower
limb unloading in humans. Acta Physiol. Scand. 157, 63–70.
Berg, H.E., Larsson, L., Tesch, P.A., 1997. Lower limb skeletal muscle function after 6 wk of
bed rest. J. Appl. Physiol. 82, 182–188.
Berg, H.E., Eiken, O., Miklavcic, L., Mekjavic, I.B., 2007. Hip, thigh and calf muscle atrophy
and bone loss after 5-week bedrest inactivity. Eur. J. Appl. Physiol. 99, 283–289.
Bergstrom, J., 1962. Muscle electrolytes in man. Scand J Clin Lab Invest 68, 1–110.
Bottinelli, R., Pellegrino, M.A., Canepari, M., Rossi, R., Reggiani, C., 1999. Specific contributions of various muscle fibre types to human muscle performance: an in vitro study.
J. Electromyogr. Kinesiol. 9, 87–95.
Buchman, A.S., Wilson, R.S., Boyle, P.A., Tang, Y., Fleischman, D.A., Bennett, D.A., 2007.
Physical activity and leg strength predict decline in mobility performance in older
persons. J. Am. Geriatr. Soc. 55, 1618–1623.
Carlson, M.E., Suetta, C., Conboy, M.J., Aagaard, P., Mackey, A., Kjaer, M., Conboy, I., 2009.
Molecular aging and rejuvenation of human muscle stem cells. EMBO Mol. Med. 1,
381–391.
Caserotti, P., Aagaard, P., Larsen, J.B., Puggaard, L., 2008. Explosive heavy-resistance training in old and very old adults: changes in rapid muscle force, strength and power.
Scand. J. Med. Sci. Sports 18, 773–782.
Cesari, M., Pahor, M., Lauretani, F., Zamboni, V., Bandinelli, S., Bernabei, R., Guralnik, J.M.,
Ferrucci, L., 2009. Skeletal muscle and mortality results from the InCHIANTI Study.
J. Gerontol. A: Biol. Sci. Med. Sci. 64, 377–384.
7
Clark, B.C., Fernhall, B., Ploutz-Snyder, L.L., 2006. Adaptations in human neuromuscular
function following prolonged unweighting: I. Skeletal muscle contractile properties
and applied ischemia efficacy. J. Appl. Physiol. 101, 256–263.
Clarkson, P.M., Kroll, W., Melchionda, A.M., 1981. Age, isometric strength, rate of tension
development and fiber type composition. J. Gerontol. 36, 648–653.
Cookson, R., Laudicella, M., 2011. Do the poor cost much more? The relationship between
small area income deprivation and length of stay for elective hip replacement in the
English NHS from 2001 to 2008. Soc. Sci. Med. 72, 173–184.
Covinsky, K.E., Palmer, R.M., Fortinsky, R.H., Counsell, S.R., Stewart, A.L., Kresevic, D.,
Burant, C.J., Landefeld, C.S., 2003. Loss of independence in activities of daily living in
older adults hospitalized with medical illnesses: increased vulnerability with age.
J. Am. Geriatr. Soc. 51, 451–458.
Danieli Betto, D., Zerbato, E., Betto, R., 1986. Type 1, 2A, and 2B myosin heavy chain
electrophoretic analysis of rat muscle fibers. Biochem. Biophys. Res. Commun. 138,
981–987.
de Boer, M.D., Maganaris, C.N., Seynnes, O.R., Rennie, M.J., Narici, M.V., 2007. Time course
of muscular, neural and tendinous adaptations to 23 day unilateral lower-limb
suspension in young men. J. Physiol. 583, 1079–1091.
Deschenes, M.R., Giles, J.A., McCoy, R.W., Volek, J.S., Gomez, A.L., Kraemer, W.J., 2002.
Neural factors account for strength decrements observed after short-term muscle
unloading. Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R578–583.
Deschenes, M.R., Holdren, A.N., McCoy, R.W., 2008. Adaptations to short-term muscle
unloading in young and aged men. Med. Sci. Sports Exerc. 40, 856–863.
Deutz, N.E., Pereira, S.L., Hays, N.P., Oliver, J.S., Edens, N.K., Evans, C.M., Wolfe, R.R., 2013.
Effect of beta-hydroxy-beta-methylbutyrate (HMB) on lean body mass during 10
days of bed rest in older adults. Clin. Nutr. 32 (5), 704–712.
Ditroilo, M., Forte, R., Benelli, P., Gambarara, D., De Vito, G., 2010. Effects of age and limb
dominance on upper and lower limb muscle function in healthy males and females
aged 40–80 years. J. Sports Sci. 28, 667–677.
Dudley, G.A., Duvoisin, M.R., Adams, G.R., Meyer, R.A., Belew, A.H., Buchanan, P., 1992.
Adaptations to unilateral lower limb suspension in humans. Aviat. Space Environ.
Med. 63, 678–683.
Harridge, S.D., Bottinelli, R., Canepari, M., Pellegrino, M.A., Reggiani, C., Esbjornsson, M.,
Saltin, B., 1996. Whole-muscle and single-fibre contractile properties and myosin
heavy chain isoforms in humans. Pflugers Arch. 432, 913–920.
Hespel, P., Op't Eijnde, B., Van Leemputte, M., Urso, B., Greenhaff, P.L., Labarque, V.,
Dymarkowski, S., Van Hecke, P., Richter, E.A., 2001. Oral creatine supplementation
facilitates the rehabilitation of disuse atrophy and alters the expression of muscle
myogenic factors in humans. J. Physiol. 536, 625–633.
Horstman, A.M., de Ruiter, C.J., van Duijnhoven, N.T., Hopman, M.T., de Haan, A., 2012.
Changes in muscle contractile characteristics and jump height following 24 days of
unilateral lower limb suspension. Eur. J. Appl. Physiol. 112, 135–144.
Hortobagyi, T., Dempsey, L., Fraser, D., Zheng, D., Hamilton, G., Lambert, J., Dohm, L., 2000.
Changes in muscle strength, muscle fibre size and myofibrillar gene expression after
immobilization and retraining in humans. J. Physiol. 524 (Pt 1), 293–304.
Hvid, L., Aagaard, P., Justesen, L., Bayer, M.L., Andersen, J.L., Ortenblad, N., Kjaer, M., Suetta,
C., 2010. Effects of aging on muscle mechanical function and muscle fiber morphology during short-term immobilization and subsequent retraining. J. Appl. Physiol. 109,
1628–1634.
Hvid, L.G., Ortenblad, N., Aagaard, P., Kjaer, M., Suetta, C., 2011. Effects of ageing on single
muscle fibre contractile function following short-term immobilisation. J. Physiol. 589,
4745–4757.
Hvid, L.G., Suetta, C., Aagaard, P., Kjaer, M., Frandsen, U., Ortenblad, N., 2013. Four days of
muscle disuse impairs single fiber contractile function in young and old healthy men.
Exp. Gerontol. 48, 154–161.
Jones, S.W., Hill, R.J., Krasney, P.A., O'Conner, B., Peirce, N., Greenhaff, P.L., 2004. Disuse atrophy and exercise rehabilitation in humans profoundly affects the expression of genes associated with the regulation of skeletal muscle mass. FASEB J. 18,
1025–1027.
Kawakami, Y., Akima, H., Kubo, K., Muraoka, Y., Hasegawa, H., Kouzaki, M., Imai, M.,
Suzuki, Y., Gunji, A., Kanehisa, H., Fukunaga, T., 2001. Changes in muscle size, architecture, and neural activation after 20 days of bed rest with and without resistance
exercise. Eur. J. Appl. Physiol. 84, 7–12.
Klass, M., Baudry, S., Duchateau, J., 2008. Age-related decline in rate of torque development is accompanied by lower maximal motor unit discharge frequency during fast
contractions. J. Appl. Physiol. 104, 739–746.
Klitgaard, H., Mantoni, M., Schiaffino, S., Ausoni, S., Gorza, L., Laurent-Winter, C., Schnohr,
P., Saltin, B., 1990. Function, morphology and protein expression of ageing skeletal
muscle: a cross-sectional study of elderly men with different training backgrounds.
Acta Physiol. Scand. 140, 41–54.
Korhonen, M.T., Cristea, A., Alen, M., Hakkinen, K., Sipila, S., Mero, A., Viitasalo, J.T.,
Larsson, L., Suominen, H., 2006. Aging, muscle fiber type, and contractile function in
sprint-trained athletes. J. Appl. Physiol. 101, 906–917.
Kortebein, P., Symons, T.B., Ferrando, A., Paddon-Jones, D., Ronsen, O., Protas, E., Conger, S.,
Lombeida, J., Wolfe, R., Evans, W.J., 2008. Functional impact of 10 days of bed rest in
healthy older adults. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 63, 1076–1081.
Kubo, K., Akima, H., Kouzaki, M., Ito, M., Kawakami, Y., Kanehisa, H., Fukunaga, T., 2000.
Changes in the elastic properties of tendon structures following 20 days bed-rest in
humans. Eur. J. Appl. Physiol. 83, 463–468.
Kubo, K., Akima, H., Ushiyama, J., Tabata, I., Fukuoka, H., Kanehisa, H., Fukunaga, T., 2004.
Effects of 20 days of bed rest on the viscoelastic properties of tendon structures in
lower limb muscles. Br. J. Sports Med. 38, 324–330.
Kubo, K., Ishida, Y., Komuro, T., Tsunoda, N., Kanehisa, H., Fukunaga, T., 2007. Age-related
differences in the force generation capabilities and tendon extensibilities of knee
extensors and plantar flexors in men. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 62,
1252–1258.
8
L.G. Hvid et al. / Experimental Gerontology 52 (2014) 1–8
Labarque, V.L., Eijnde, B.O., Van Leemputte, M., 2002. Effect of immobilization and
retraining on torque–velocity relationship of human knee flexor and extensor
muscles. Eur. J. Appl. Physiol. 86, 251–257.
LaRoche, D.P., Roy, S.J., Knight, C.A., Dickie, J.L., 2008. Elderly women have blunted
response to resistance training despite reduced antagonist coactivation. Med. Sci.
Sports Exerc. 40, 1660–1668.
Larsson, L., Grimby, G., Karlsson, J., 1979. Muscle strength and speed of movement in
relation to age and muscle morphology. J. Appl. Physiol. 46, 451–456.
LeBlanc, A.D., Schneider, V.S., Evans, H.J., Pientok, C., Rowe, R., Spector, E., 1992. Regional
changes in muscle mass following 17 weeks of bed rest. J. Appl. Physiol. 73, 2172–2178.
Macaluso, A., Nimmo, M.A., Foster, J.E., Cockburn, M., McMillan, N.C., De Vito, G., 2002.
Contractile muscle volume and agonist–antagonist coactivation account for differences in torque between young and older women. Muscle Nerve 25, 858–863.
Metzger, J.M., Moss, R.L., 1990. Effects of tension and stiffness due to reduced pH in mammalian fast- and slow-twitch skinned skeletal muscle fibres. J. Physiol. 428, 737–750.
Narici, M.V., de Boer, M.D., 2011. Disuse of the musculo-skeletal system in space and on
earth. Eur. J. Appl. Physiol. 111, 403–420.
Newman, A.B., Kupelian, V., Visser, M., Simonsick, E.M., Goodpaster, B.H., Kritchevsky, S.B.,
Tylavsky, F.A., Rubin, S.M., Harris, T.B., 2006. Strength, but not muscle mass, is
associated with mortality in the health, aging and body composition study cohort.
J. Gerontol. Ser. A Biol. Sci. Med. Sci. 61, 72–77.
Pijnappels, M., van der Burg, P.J., Reeves, N.D., van Dieen, J.H., 2008. Identification of elderly fallers by muscle strength measures. Eur. J. Appl. Physiol. 102, 585–592.
Raue, U., Slivka, D., Minchev, K., Trappe, S., 2009. Improvements in whole muscle and
myocellular function are limited with high-intensity resistance training in octogenarian women. J. Appl. Physiol. 106, 1611–1617.
Rozier, C.K., Elder, J.D., Brown, M., 1979. Prevention of atrophy by isometric exercise of a
casted leg. J. Sports Med. Phys. Fitness 19, 191–194.
Saczynski, J.S., Lessard, D., Spencer, F.A., Gurwitz, J.H., Gore, J.M., Yarzebski, J., Goldberg,
R.J., 2010. Declining length of stay for patients hospitalized with AMI: impact on
mortality and readmissions. Am. J. Med. 123, 1007–1015.
Saltin, B., Grimby, G., 1968. Physiological analysis of middle-aged and old former
athletes. Comparison with still active athletes of the same ages. Circulation 38,
1104–1115.
Schulze, K., Gallagher, P., Trappe, S., 2002. Resistance training preserves skeletal muscle
function during unloading in humans. Med. Sci. Sports Exerc. 34, 303–313.
Suetta, C., Hvid, L.G., Justesen, L., Christensen, U., Neergaard, K., Simonsen, L., Ortenblad,
N., Magnusson, S.P., Kjaer, M., Aagaard, P., 2009. Effects of aging on human skeletal
muscle after immobilization and retraining. J. Appl. Physiol. 107, 1172–1180.
Suetta, C., Frandsen, U., Jensen, L., Jensen, M.M., Jespersen, J.G., Hvid, L.G., Bayer, M.,
Petersson, S.J., Schroder, H.D., Andersen, J.L., Heinemeier, K.M., Aagaard, P.,
Schjerling, P., Kjaer, M., 2012. Aging affects the transcriptional regulation of human
skeletal muscle disuse atrophy. PLoS One 7, e51238.
Suetta, C., Frandsen, U., Mackey, A.L., Jensen, L., Hvid, L.G., Beyer, M.L., Petersson, S.J.,
Schroder, H.D., Andersen, J.L., Aagaard, P., Schjerling, P., Kjaer, M., 2013. Aging is associated with diminished muscle re-growth and myogenic precursor cell expansion in
the early recovery phase after immobility-induced atrophy in human skeletal muscle.
J. Physiol. 591, 3789–3804.
Tanaka, T., Kariya, Y., Hoshino, Y., 2004. Histochemical study on the changes in muscle
fibers in relation to the effects of aging on recovery from muscular atrophy caused
by disuse in rats. J. Orthop. Sci. 9, 76–85.
Wyszomierski, S.A., Chambers, A.J., Cham, R., 2009. Knee strength capabilities and slip
severity. J. Appl. Biomech. 25, 140–148.
Yasuda, N., Glover, E.I., Phillips, S.M., Isfort, R.J., Tarnopolsky, M.A., 2005. Sex-based differences in skeletal muscle function and morphology with short-term limb immobilization. J. Appl. Physiol. 99, 1085–1092.