Na,K-ATPase Response to Osmotic Stress in Primary Dog
Lens Epithelial Cells
Susan E. Old,* Deborah A. Carper,* and Thomas C. Hohman\
Purpose. Na,K-ATPase activity increases in lens cells exposed to hypertonic stress. To test
whether the increase in activity involves stimulation of Na,K-ATPase expression, dog lens
epithelial cells were subjected to hypertonic stress, and the time course of Na,K-ATPase protein
and mRNA response was measured.
Methods. Primary cultures of dog lens epithelial cells were maintained in isotonic or hypertonic
media over the course of several days. Rubidium-86 uptake measurements, immunoreactive
protein, and northern blot analysis were performed.
Results. Dog lens epithelial cells exposed to hypertonic stress from culture medium supplemented with 150 mM NaCl or 250 mM cellobiose showed a twofold increase in Na,K-ATPase
activity. The increase in activity was blocked by cycloheximide and was reversible when the
cells were returned to isotonic medium. This activity was unaffected by the aldose reductase
inhibitor, tolrestat. Na,K-ATPase protein and mRNA levels increased in cells exposed to medium containing 150 mM NaCl. Northern blot analysis showed that the alpha-1 and beta-1
mRNA levels increased as early as 6 hours and maximally increased 1.5-fold to twofold by 12
to 24 hours.
Conclusions. Elevation of Na,K-ATPase activity in dog lens epithelial cells exposed to hypertonic
stress was associated with increased expression of Na,K-ATPase subunit mRNAs and was dependent on protein synthesis. These results suggest that upregulation of the enzyme activity is
the result of an induction of Na,K-ATPase. Invest Ophthalmol Vis Sci. 1995; 36:88-94.
JNa.K-ATPase is a ubiquitous membrane-bound enzyme that pumps Na+ and K+ across the cell membrane. It consists of two subunits, alpha and beta,
found in equal molar ratios in the complex. Each subunit has several isoforms expressed in a tissue-specific
manner.1 The alpha subunit is the catalytic subunit
and contains the ATP and cardiac glycoside-binding
sites. The role for the beta subunit has not been determined; however, its presence is required for activity.
Na,K-ATPase has an important role in maintaining a
proper electrochemical gradient across the cell membrane, in Na+-coupled cotransport systems, and in cell
volume regulation.2
Na,K-ATPase plays a critical role in lens homeostaFrom the* National Eye Institute, National Institutes of Health, Bethesda,
Maryland, and fWyeth-Ayerst Laboratory, Princeton, New Jersey.
Presented as a preliminary report at the Annual Meeting of the Association for
Research in Vision and Ophthalmology, Sarasota, Florida, May 1992.
Submitted for publication June 20, 1994; revised August 11, 1994; accepted
August 23, 1994.
Proprietary interest category: E (TCH).
Reprint requests: Deborah A. Carper, National Eye Institute/National Institutes of
Health, Bldg. 6 Rm. 232, 9000 Rockvilk Pike, Bethesda, MD 20892.
sis. Perturbation of the Na,K-pump can alter the levels
of sodium and potassium, increase intracellular water
content, and eventually cause loss of lens transparency.3 Pharmacologic agents, such as the Na,K-ATPase
inhibitor ouabain, have been shown to affect the metabolism of the lens in organ culture4"6 and the metabolism of cultured bovine lens epithelial cells.7 By disrupting the Na+ and K+ gradients established across
the cell membrane, this agent blocks the cellular transport of the organic osmolytes, taurine and myo-inositol. This effect has also been observed in hypertonically stressed human lens cells in which the enhanced accumulation of myo-inositol and taurine
were minimized by ouabain treatment.8
Regulation of Na.K-ATPase by specific hormones,
ionic interventions, or pharmacologic agents can induce functional Na,K-pump sites and cause enhanced
gene expression. Na+ directly regulates Na,K-ATPase
gene expression in cardiocytes.9 Thyroid hormone elevates Na,K-ATPase mRNA in kidney mesangial cells10
and hypertonic stress has been shown to upregulate
Na,K-ATPase expression in renal cortex cells.11
88
Investigative Ophthalmology & Visual Science, January 1995, Vol. 36, No. 1
Copyright © Association for Research in Vision and Ophthalmology
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
><
89
Osmotic Stress Response of Na,K-ATPase in Lens Cells
We have reported the upregulation of aldose reductase and alphaB-crystallin mRNA and protein in
cells cultured in hypertonic media, including dog lens
epithelial (DLE) cells.1213 Sorbitol and myo-inositol
(MI) also increase in hypertonic conditions as a result
of increased mRNA and activity of aldose reductase
and sodium-dependent myo-inositol transporters.14"21
Recendy, enhanced MI accumulation in hypertonically stressed human lens epithelial cells was shown
to be correlated with elevated Na,K-ATPase activity.8
The purpose of the present study was to examine the
effect of hypertonic stress on Na,K-ATPase activity and
to elucidate the mechanism involved. We report here
that Na,K-ATPase activity, protein, and subunit
mRNAs increase in hypertonically stressed DLE cells
and that this increase is due to an induction or stabilization of Na,K-ATPase gene expression and not enzyme activation.
METHODS
Cell Culture
Lenses were dissected from eyes of young beagle dogs
that were killed according to National Institutes of
Health guidelines. Epithelial cells were isolated and
cultured in Dulbecco's modified Eagle's medium with
low glucose, 1 g/1, as previously described.12 Confluent
cultures in the third passage were used in all experiments. Four to six plates (60 mm dishes) were used,
for western and northern blot analyses, and cells in
12-well plates were used in the enzyme assays. Cell
cultures were exposed to various experimental conditions, including culture medium made hypertonic
with the addition of 150 mM NaCl, (600 mOsm/kg),
or 250 mM cellobiose (550 mOsm/kg), or hypertonic
medium (600 mOsm/kg) with 5 /JM cycloheximide.
At the end of the experimental manipulations, the
cells were washed twice with phosphate-buffered saline
plus experimental components at 4°C. For rubidium86 uptake measurements and protein determinations,
the cells were scraped from the dishes in 0.5 ml IN
NaOH. The dishes were then washed with 0.5 ml IN
HC1 and combined with the cell suspension. For western blot analysis, the cells were scraped from the dish
in 1 ml of homogenizing buffer previously described
by Nishida et al.22 Both cell suspensions were disrupted in a glass homogenizer. For RNA isolation, the
washed cells were scraped from the dishes in 1 ml
phosphate-buffered saline plus experimental components and then spun at 1500 rpm for 7 minutes at
4°C. The cell pellets were stored at -70C.
Enzyme Assay
Ouabain-inhibited rubidium-86 (86Rb) uptake (Na,KATPase activity) was quantitated in the epithelial cells
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
cultured in media made hypertonic by the addition
of 150 mM NaCl or 250 mM cellobiose. Additional
experiments were performed in the presence of 5 ^tM
cycloheximide or 10 fiM tolrestat (Wyeth-Ayerst Research, Princeton, NJ). For these experiments, ouabain was added to half the cultures 60 minutes before
the addition of radiolabel. Cells in 12-well plates were
incubated for 3 to 15 minutes with 86Rb, 1 jxCi/ml of
media, 8.4 mCi/mg. After the incubation with radiolabel, the cells were harvested as described above. 86Rb
levels were quantitated by scintillation counting (TriCarb 2200 CA; Packard, Downers Grove, IL), and
Na,K-ATPase activity was determined as the difference
in 86Rb levels, normalized per milligram of cell protein, between cultures treated with and without ouabain. Results were expressed as the mean and standard
deviation of the measurements from three separate
experiments.
In preliminary experiments, the extent and rate
of 86Rb uptake was independent of previous exposure
to ouabain, which ranged from 15 to 60 minutes. Further, 86Rb uptake uninhibited by ouabain, 775 ± 50
DPM/mg protein/3 minutes, was not significantly different between control and hypertonically stressed
cells. In control and hypertonically stressed cells, ouabain-inhibited uptake (Na,K-ATPase activity) was
about 40% and 65%, respectively, of total 86Rb uptake
measured in the absence of ouabain.
Western Blot Analysis
The cell homogenate was centrifuged at l.OOOg-for 10
minutes at 4°C. The supernatant fraction was then
centrifuged at 100,000g- for 60 minutes at 4°C. The
pellet was dissolved in 250 fil of homogenizing
buffer.22 Cell proteins (10 ng per lane) were separated
by electrophoresis in SDS-polyacrylamide gels on the
Novex mini-gel electrophoresis system (Novex, Encinitas, CA), and the proteins were transferred to nitrocellulose membranes (Schleicher & Schuell, Keene,
NH). The immunoblot analysis was performed using
a Vectastain ABC kit according to the manufacturer's
protocols (Vector Laboratories, Burlington, CA). The
primary Na,K-ATPase antibody was purchased from
Accurate Chemical & Scientific (Westbury, NY) and
was used at a dilution of 1:85.
Northern Blot Analysis
RNA was isolated from the frozen cell pellets following
the procedure of Davis et al.23 Briefly, the frozen cell
pellet was solubilized immediately after the addition
of guanidinium isothiocyanate. Cesium chloride was
then added, and the samples were centrifuged for 20
hours at 174,000& 20°C (SW41 rotor, L8-80M Ultracentrifuge; Beckman Instruments, Palo Alto, CA). The
resulting pellet was dissolved in 0.3 M sodium acetate
and then extracted with phenolxhloroform (1:1) and
90
Investigative Ophthalmology & Visual Science, January 1995, Vol. 36, No. 1
precipitated in ethanol at -70°C for 30 minutes and
spun at 12,000g for 30 minutes. The resulting RNA
pellet was resuspended in water and stored at -70°C.
Total RNA (7.5 fig) was electrophoresed in a 1.1%
agarose gel in the presence of formaldehyde as described by Davis et al.23 The RNA was transferred to a
nylon membrane (ICN Biomedicals, Cleveland, OH),
and the blots were probed with random primed 32Plabeled DNA (Gibco BRL, Gaithersburg, MD). Probes
to the alpha-1 and beta-1 subunits of Na,K-ATPase
were made using the polymerase chain reaction
(PCR). PCR primers were designed from the rat
(alpha) and the dog (beta) DNA sequence (24 and
25, respectively). The two primer sequences used to
make the alpha probe were 5' TGGAACTCTGACTCAGAACCGGATGACAGT 3' and 5' GGAGATAAGACCCACGAAGCAGAGGTTATC 3'. The two primer sequences used to make the beta probe were 5' GATTGTGGCAATATGCCCAG 3' and 5' CGGTCTTTCTCACTGTAACC 3'. RT-PCR (Perkin-Elmer, Norwalk, CT) was performed on dog kidney endothelial
RNA to make a 637-base pair insert for alpha and a
496-base pair insert for beta. The PCR products were
cloned into the pCRlOOO vector (Invitrogen, San
Diego, CA), and the inserts were sequenced using the
Promega fmol sequencing system (Promega, Madison,
WI) and 33P-ATP (DuPont NEN, Boston, MA). The
18S rRNA probe was a gift of Dr. B. Holmes (Cornell
University, Ithaca, NY). The mRNA was quantified by
scanning the x-ray films on an UltraVision UC 111200S
(UMAX Technologies; MacNews, Evanston, IL) using
Photoshop and NIH Image software.
RESULTS
Activity Response
Primary cultures of dog lens epithelial cells were exposed to 150 mM NaCl for as long as 4 days (Fig. 1).
There was approximately a twofold increase in Na,KATPase activity, as measured by 86Rb uptake. The maximal response was evident within 24 hours of treatment and was maintained through the course of the
experiment (96 hours). A similar increase was observed when 250 mM cellobiose was used as the osmotic agent. The increase in Na,K-ATPase activity observed from hypertonic stress was blocked when cells
were exposed to hypertonic medium and 5 fiM cycloheximide for 24 hours. Cell viability, as measured by
the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide,26 and Na,K-ATPase activity in
control cells were unaffected by cycloheximide treatment (data not shown).
The NaCl-induced increase in activity was reversible. Two days after the cells were returned to isotonic
medium, the activity returned to basal levels (Fig. 2).
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
FIGURE l. Na,K-ATPase activity (86Rb uptake) in dog lens
epithelial cells after hyperosmotic stress. Primary lens cells
were grown in the presence of 150 mM NaCl or 250 mM
cellobiose for 0, 1, or 4 days. Lens cells were also grown in
the presence of 150 mM NaCl with 5 fjM cycloheximide
for 1 day. The ouabain-inhibited 86Rb uptake (Na,K-ATPase
activity) was determined and graphed as a percent of control. Data are expressed as the mean ± standard deviation
(bars) of the results from three separate experiments.
Because aldose reductase inhibitors (ARIs) restore
Na,K-ATPase deficits in diabetic model systems, the
effect of ARIs on Na,K-ATPase activity in hyperosmotically stressed cells was examined. The aldose reductase inhibitor, tolrestat, did not affect the increase in
activity observed with 150 mM NaCl or with 250 mM
cellobiose (data not shown).
Protein Response
Total epithelial cell proteins were separated by SDSPAGE. The proteins were transferred to nitrocellulose
and identified using a polyclonal antibody to Na,KATPase. Figure 3 shows that both the alpha (100-kD)
and beta (35-kD) subunits increased in cells grown in
media supplemented with 150 mM NaCl.
RNA Response
Complete sequence for the dog alpha-1 cDNA has
not been previously reported. We report here a 577nucleotide sequence for dog kidney alpha-1 (Fig. 4).
It is similar to the human HeLa alpha-1 sequence,27
the pig kidney alpha-1 sequence,28 and the rat brain
alpha-1 sequence.24 It shares significant nucleotide homology with human (89%), pig (89%), and rat (85%).
91
Osmotic Stress Response of Na,K-ATPase in Lens Cells
250-i
, CGAAG CCGAC ACCAC AGACA ,
GATAA GAGTT CAGCC .
L TCGAG CTGTG CTGTG GTTCT (
.g. a..g. .g..t aag.
FIGURE 2. Na,K-ATPase activity ( Rb uptake) in dog lens
epithelial cells in the presence of the aldose reductase inhibitor, tolrestat, and after removal of osmotic stress. Primary
lens cells were grown in the presence of 150 mM NaCl with
or without 10 fiM tolrestat. For reversal experiments, lens
cells were grown in the presence of 150 mM NaCl for 3 days,
at which time the NaCl was removed and the cells were
placed in isotonic media for 2 days before assaying activity.
The ouabain-inhibited 86Rb uptake (Na,K-ATPase activity)
was determined and graphed as a percent of control. Data
are expressed as the mean ± standard deviation (bars) of
the results from three separate experiments.
- 106
- 80
- 50
- 33
- 28
- 19
1 2
3
4
5
FIGURE 3. Western blot analysis of Na,K-ATPase. Primary dog
lens epithelial cells were grown in 150 mM NaCl and harvested atO (lane 1), 12 (lane 2), 24 (lane 3), 48 (lane 4), and
72 (lane 5) hours. Total lens proteins (10 //g/lane) were
electrophoresed under denaturing condidons. The proteins
were transferred to nitrocellulose. The alpha (100-kD) and
beta (35-kD) subunits of Na,K-ATPase were detected using
a polyclonal antibody.
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
L GCTGA AGGAT GCCTT 1CAGA ATCCC TACCT GGAGC '
nGURE 4. Nucleotide sequence comparison of the dog kidney alpha-1 clone to the human alpha-1 (24), the pig kidney
alpha-1 (25), and the rat brain alpha-1 (22). The numbering
pertains to the dog nucleodde sequence that does not include the rat-derived polymerase chain reaction primers.
The human sequence begins at nucleotide 1782, the pig
sequence begins at nucleodde 1491, and the rat sequence
begins at nucleodde 1701. The small letters represent base
changes, and the dots represent sequence identity.
At the amino acid level, the homology is even greater:
human 95%, pig 94%, and rat 92%. The sequence of
the dog beta-1 PCR clone (data not shown) was 100%
identical to the previously published sequence.25
Northern blots of total RNA from lens epithelial
cells cultured in 150 mM NaCl were probed with DNA
specific (as seen by sequence homology described
above) to the alpha-1 and beta-1 subunits of Na,KATPase. The alpha-1 subunit mRNA was elevated in
cells exposed for 6 hours to hypertonic media (Fig.
5). This increased level of mRNA (approximately 1.5fold) was maintained throughout the time course (48
hours). The beta-1 probe detected an increase in two
mRNA bands, a major band and a larger, less prominent upper band. Although the increase in the major
92
Investigative Ophthalmology & Visual Science, January 1995, Vol. 36, No. 1
0
6 12 24 48 48C
Na+, K+-ATPase
«1 subunit
Na\ K+-ATPase
/M subunit
••611
FIGURE 5. Northern blot of Na,K-ATPase alpha-1 and beta-1
subunit mRNAs. Primary lens epithelial cells were grown in
150 mM NaCl and harvested at 0, 6, 12, 24, and 48 hours.
Cells were also grown for 48 hours in isotonic media (48°C).
Total RNA (7.5 fig) was run on a 1.1% agarose gel in the
presence of formaldehyde. The RNA was transferred to a
nylon membrane and hybridized sequentially with DNA
probes corresponding to the alpha-1 and beta-1 subunits of
Na,K-ATPase and to an 18S rRNA control probe, used to
verify accuracy of RNA loading.
beta-1 mRNA band was not as rapid as that of the
alpha-1 subunit, by 24 hours the level of induction of
both the major beta-1 band and alpha-1 band was
similar (approximately 1.5-fold). The upper band of
the beta-1 mRNA was barely visible in unstimulated
cells; however, by 24 hours in 150 mM NaCl, the level
of this mRNA had doubled.
DISCUSSION
Primary cultures of dog lens epithelial cells respond
to hypertonic stress by upregulation of Na,K-ATPase
at the mRNA, the protein, and the activity levels. The
alpha-1 subunit mRNA increased by 1.5-fold, and the
multiple beta-1 mRNAs increased by 1.5-fold to twofold. Multiple beta mRNA bands have been reported
previously.29 The bands are found in various proportions in different tissues. These mRNAs are the result
of different mRNA processing, and all encode the
same protein. Both bands we observed responded to
osmotic stress. The level of induction of the alpha and
beta mRNAs is similar to that reported for renal cortex
cells when stressed by NaCl."
A twofold increase in Na,K-ATPase activity in response to osmotic stress was produced by both NaCl
and cellobiose. Thus, it appears that the Na,K-ATPase
increase is a general response to hypertonic stress and
not just due to the increase in Na+. Recent reports
have also shown an increase in Na,K-ATPase activity
due to osmotic stress in other cell types (human renal
cortex cells," human lens and retinal pigment epithe-
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
lial cells8), but to slightly lower levels than we observed.
The increase in Na,K-ATPase activity is blocked
by the addition of cycloheximide. This suggests that
new protein synthesis is necessary to achieve the elevated levels of activity. Thus, osmotic stress appears
to stimulate de novo synthesis of Na,K-ATPase. This
synthesis of new protein is consistent with the observed
increase of alpha and beta protein subunits on Western blot analysis. In addition, the increase in alpha
and beta mRNAs suggest that osmotic stress is producing an increase in Na,K-ATPase gene expression, although stabilization of mRNA cannot be ruled out by
our data. A similar increase in Na,K-ATPase mRNA
levels in renal cells produced in response to osmotic
stress was blocked by the addition of actinomycin D
and, thus, appears to be a result of increased gene
expression.11 The stimulation of activity in DLE cells
is reversible. The removal of osmotic stress returns
Na,K-ATPase levels to baseline within 48 hours.
In studies on animal and cultured cell models of
diabetic complications, an interrelationship has been
shown to exist between sorbitol, MI, and Na,K-ATPase.7'30"38 During diabetic hyperglycemia in tissues
in which glucose uptake is independent of insulin,
increased tissue levels of glucose lead to an accumulation of sorbitol and a concomitant depletion of MI.
These changes are accompanied by decreased Na,KATPase activity.30"35 The loss of Na,K-ATPase activity
is thought to occur as a result of decreased phosphoinositol turnover, a consequence of reduced cellular
jyjj 35-37 Administration of ARIs that block the cellular
accumulation of sorbitol and depletion of MI preserve
Na,K-ATPase activity. Our previous work on DLE cells
has demonstrated that sorbitol and MI are also coordinately regulated by hypertonic stress.39 Both sorbitol
and MI showed increased levels by 24 hours in dog
lens epithelial cells stimulated by NaCl. The addition
of the ARI tolrestat (Alredase) prevented the accumulation of sorbitol, whereas MI accumulation was unaffected. The accumulation of these compatible organic
osmolytes increases cellular tonicity, an adaptive response to prevent water loss.40 We have now observed
that Na,K-ATPase activity, as well as protein and
mRNA, increase during hypertonic stress in lens cells.
Under these conditions, blocking aldose reductase activity with tolrestat had no effect on Na,K-ATPase activity. From these studies, it would appear that Na,KATPase, MI, and polyol respond to both hypertonic
and diabetic stress in a coordinate manner, albeit the
response in hypertonic stress is an upregulation of
transport proteins and an accumulation of compatible
organic osmolytes.
In summary, Na,K-ATPase activity, protein, and
mRNA levels increase in response to osmotic stress.
The increase in activity is reversible by removing the
Osmotic Stress Response of Na,K-ATPase in Lens Cells
osmotic stress, and the increased activity is blocked
by cycloheximide. Therefore, increased Na,K-ATPase
activity in cells exposed to hypertonic stress is most
likely the result of the induction of Na,K-ATPase expression.
Key Words
Na,K-ATPase activity, Na,K-ATPase mRNA, hypertonic stress,
lens cell culture
References
1. Sweadner KJ. Isozymes of the Na+/K+-ATPase. Biochim
Biophys Ada. 1989;988:185-220.
2. Hoffmann EK, Simonsen LO. Membrane mechanisms
in volume and pH regulation in vertebrate cells. PhysiolRev. 1989; 69:315-382.
3. Kinoshita JH. Mechanisms initiating cataract formation: The Proctor Lecture. Invest Ophthalmol. 1974;
13:713-724.
4. Cotlier E. Myo-inositol: Active transport by the crystalline lens. Invest Ophthalmol 1970;9:681-691.
5. Reddy VN. Studies on intraocular transport of taurine
II: Accumulation in the rabbit lens. Invest Ophthalmol.
1970;9:206-219.
6. Varma SD, Chakrapani B, Reddy VN. Intraocular
transport of myoinositol II: Accumulation in the rabbit lens in vitro. Invest Ophthalmol. 1970; 10:794-800.
7. Cammarata PR, Tse D, Yorio,T. Uncoupling of attenuated myo-[3H]Inositol uptake and dysfunction in Na+K+-ATPase pumping activity in hypergalactosemic cultured bovine lens epithelial cells. Diabetes. 1991;
40:731-737.
8. Yokoyama T, Lin L-R, Chakrapani B, Reddy VN. Hypertonic stress increases NaK ATPase, taurine, and
myoinositol in human lens and retinal pigment epithelial cultures. Invest Ophthalmol Vis Sci. 1993;
34:2512-2517.
9. Yamamoto K, Ikeda U, Seino Y, et al. Regulation of
Na,K-Adenosine triphosphatase gene expression by
sodium ions in cultured neonatal rat cardiocytes. /
Clin Invest. 1993;92:1889-1895.
10. OharaT, Ikeda U, Muto S, Oguchi A, Tsuruya Y, Yamamoto K.ATPase gene expression in cultured rat mesangial cells. AmJPhysiol. 1993;265:F370-F376.
11. Yordy MR, Bowen JW. Na,K-ATPase expression and
cell volume during hypertonic stress in human renal
cells. Kidney Intl. 1993;43:940-948.
12. Carper D, Kaneko M, Stark H, Hohman T. Increase
in aldose reductase mRNA in dog lens epithelial cells
under hypertonic conditions. Exp Eye Res. 1990;
50:743-749.
13. Dasgupta S, Hohman TC, Carper D. Hypertonic stress
induces alphaB-crystallin expression. Exp Eye Res.
1992:54:461-470.
14. Bagnasco SM, Uchida S, Balaban RS, Kador PF, Burg
MB. Induction of aldose reductase and sorbitol in renal inner medullary cells by elevated extracellular
NaCl. ProcNatlAcad Sci USA. 1987; 84:1718-1720.
15. Garcia-Perez A, Marten B, Murphy HR, et al, Molecular cloning of cDNA coding for kidney aldose reduc-
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017
93
tase: Regulation of specific mRNA accumulation by
NaCl-mediated osmotic stress. J Biol Chem. 1989;
264:16815-16821.
16. Hohman TC, Carper D, Dasgupta S, Kaneko M. Osmotic stress induces aldose reductase in glomerular
endothelial cells. In: Wiener H, Wermuth B, Crabb
DW, eds. Enzymology and Molecular Biology of Carbonyl
Metabolism 3. New York: Plenum Press; 1990:139-152.
17. Lin L-R, Carper D, Yokoyama T, Reddy VN. The effect
of hypertonicity on aldose reductase, alphaB-crystallin, and organic osmolytes in the rednal pigment
epithelium. Invest Ophthalmol Vis Sci. 1993; 34:23522359.
18. Nakanishi T, Turner RJ, Burg MB. Osmoregulatory
changes in myo-inositol transport by renal cells. Proc
NatlAcad Sci USA. 1989;86:6002-6006.
19. Kwon HM, Yamauchi A, Uchida S, et al. Cloning of
the cDNa for a Na+/Myo-inositol cotransporter, a hypertonicity stress protein. J Biol Chem. 1992;267:62976301.
20. Cammarata PR, Chen H-Q. Osmoregulatory alterations in myo-inositol uptake by bovine lens epithelial
cells: I: A hypertonicity-induced protein enhances
myo-inositol transport. Invest Ophthalmol Vis Sci.
1994; 35:1223-1235.
21. Zhou C, Agarwal N, Cammarata PR. Osmoregulatory
alterations in myo-inositol uptake by bovine lens epithelial cells: II: Cloning of a 626 bp cDNA portion of
a Na+/Myo-inositol cotransporter, an osmotic shock
protein. Invest Ophthalmol Vis Sci. 1994;35:1236-1242.
22. Nishida K, Ohara T, Johnson J, et al. Na+/K+-ATPase
activity and its alpha II subunit gene expression in
rat skeletal muscle: Influence of diabetes, fasting and
refeeding. Metabolism. 1992;41:56-63.
23. Davis LG, Dibner MD, Battey JF. In: Basic Methods in
Molecular Biology . New York: Elsevier; 1986:130-147.
24. Shull GE, Greeb J, Lingrel JB. Molecular cloning of
three distinct forms of the Na+,K+-ATPase alpha-subunit from rat brain. Biochem. 1986;25:8125-8132.
25. Brown TA, Horowitz B, Miller RP, McDonough AA,
Farley RA. Molecular cloning and sequence analysis
of the (Na+ + K + )-ATPase beta subunit from dog
kidney. Biochim Biophys Acta. 1987;912:244-253.
26. Mosmann T. Rapid colorimetric assay for cellular
growth and survival: Application to proliferation and
cytotoxicity assays. /Immunol Methods. 1983:65:55-63.
27. Kaqakami K, Ohta T, Nojima H, Nagano K. Primary
structure of the alpha-subunit of human Na,K-ATPase
deduced from cDNA sequence. / Biochem. 1986;
100:389-397.
28. Monastyrskaya GS, Broude NE, Melkov AM, et al. The
primary structure of the alpha subunit of Na+,K+-ATPase: III: The complete nucleotide sequence corresponding to the coding part of the gene. Bioorg Khim.
1987; 13:20-26.
29. Young RM, Shull GE, Lingrel JB. Multiple mRNAs
from rat kidney and brain encode a single Na+,K+ATPase beta subunit protein. J Biol Chem. 1987;
262:4905-4910.
30. Yeh L-A, Rafford CE, Goddu KJ, Ash ton MA, Beyer
TA, Hutson NJ. Na+-K+-ATPase pumping activity is
94
31.
32.
33.
34.
35.
36.
Investigative Ophthalmology & Visual Science, January 1995, Vol. 36, No. 1
not directly linked to wyo-inositol levels after sorbinil
treatment in lenses of diabetic rats. Diabetes.
1987;36:1414-1419.
Yorek MA, Dunlap JA, Leeney EM. Effect of galactose
and glucose levels and sorbinil treatment on myo-inositol metabolism and Na+-K+ pump activity in cultured
neuroblastoma cells. Diabetes. 1989; 38:996-1004.
Greene DA, Lattimer SA. Action of sorbinil in diabetic
peripheral nerve. Diabetes. 1984;33:7112-7116.
Tesfamariam B, Gupta S, Oates PJ, Ruderman NB,
Cohen RA. Reduced Na+-K+ pump activity in diabetic
rabbit carotid artery: Reversal by aldose reductase inhibition. AmJPhysiol. 1993; 265:H1189-H1194.
Kawaba T, Cheng H-M, Kinoshita JH. The accumulation of myoinositol and rubidium ions in galactoseexposed rat lens. Invest Ophthalmol Vis Sri. 1986;
27:1522-1526.
Greene DA, Lattimer SA, Sima AAF. Sorbitol, phosphoinositides and the sodium-potassium ATPase in
the pathogenesis of diabetic complications. NEnglJ
Med. 1987; 316:599-606.
Thomas TP, Feldman EL, Nakamura J, et al. Ambient
glucose and aldose reductase-induced myo-inositol
37.
38.
39.
40.
depletion modulate basal and carbachol stimulated
inositol phospholipid metabolism and diacylglycerol
accumulation in human retinal pigment epithelial
cells in culture. ProcNatlAcad Sri USA. 1993;90:97l29716.
Nakamura J, DelMonte MA, Shewach D, Lattimer SA,
Greene DA. Inhibition of phosphatidylinositol synthase by glucose in human retinal pigment epithelial
cells. AmJPhysiol. 1992;262:E417-E426.
Stevens MJ, Lattimer SA, Kamijo M, VanHuysen C,
Sima AAF, Greene DA. Osmotically-induced nerve taurine depletion and the compatible osmolyte hypothesis in experimental diabetic neuropathy in the rat.
Diabetologia. 1993; 36:608-614.
Hohman TC, Carper D. Hypertonic stress induces aldose reductase and myo-inositol accumulation in lens
epithelial, kidney endothelial and Chinese hamster
ovary cells. In: Sakamoto N, et al, eds. Current Concepts
ofAldose Reductase and Its Inhibitors. New York: Elsevier;
1988:31-41.
Garcia-Perez A, Burg MB. Role of organic osmolytes
in adaptation of renal cells to high osmolality./Memfcr
Biol. 1991;119:1-13.
-t-
Downloaded From: http://iovs.arvojournals.org/ on 07/31/2017