From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
The Expression of p53 Protein in Non-Hodgkin’s Lymphomas Is Not Always
Dependent on p53 Gene Mutations
By Raquel Villuendas, Miguel A. Piris, Patrocinio Algara, Margarita Shnchez-Beato, Lydia Shnchez-Verde, Juan C. Martinez,
Juan L. Orradre, Pedro Garcia, Carmen Lopez, and Pedro Martinez
p53 overexpression has been found to be a fairly common
feature in high grade lymphomas in the majority of tumoral
cells. The results vary from series t o series, from 25% t o
33% of cases. To assess whether immunohistochemical
positivity for p53 correlated with the presenceof structural
gene abnormalities, DNA from 16 non-Hodgkin’s lymphomas with high and low p53 values was amplified and sequenced t o determine the existence of point mutations in
the highly conserved regions of the p53 gene. In the group
of 8 cases containing high levels of protein, 3 cases
showed missense point mutations at the codons mapping
between exons 5 through 8. Of the 8 cases of tumors containing undetectable or low levels of p53 protein, 1 case
presented a nonsense point mutation giving a stop codon.
No missense mutations were detected in this group. The
finding of p53 mutations in 4 of 16 cases confirms the
presence of p53 gene mutations in high grade lymphomas
distributed over different histologic groups. These include
Burkitt’s lymphoma, together with centroblastic, immunoblastic, and large cell lymphoma of mucosa origin. Nevertheless, the absence of mutations in 5 of the 8 cases that
overexpressed p53 suggests that the nuclear or cytoplasmic stabilization of p53 protein could also depend on other
factors. The absence of detectable levels of p53 protein
cannot discount the existence of p53 mutations, as is
shown by a case of Burkitt’s lymphoma in which a nonsense mutation was detected. The impact of this range of
p53 alterations on clinical course and treatment response
of the patients deserves to be explored, in an attempt to
differentiate the specific consequences of each one.
0 1993 by The American Society of Hematology.
P
some human sarcomas.29Inactivation by nuclear exclusion
53 IS A NUCLEAR phosphoprotein encoded by a gene
mapped at the short arm of chromosome 17 ( 1 7 ~ 1 3 has also been proposed.16
To assess whether immunohistochemical positivity for
band). It is involved in the negative regulation of cellular
p53 correlated with the presence of structural abnormalities
growth. Its precise function is not known, although there is
of the gene, 16 cases of high grade non-Hodgkin’s lymevidence indicating that p53 is a potent transcriptional actiphoma (NHL) in which immunohistochemistry analysis
vator with a DNA binding region. Recent data suggests that
was performed (8 with diffuse positivity and 8 negative or
p53 may be involved in DNA repair and apoptosis.’-’ Preonly focal positivity for p53) were studied to determine the
vious findings have shown that the wild type (WT) p53 proexistence of point mutations within the most frequently altein has a suppressor activity, enabling it to inhibit in vitro
tered regions of the gene, from exon 5 through 8.
transformation: Point mutations in p53 gene can cause the
loss of its suppressor function, thus transforming it into a
MATERIALS AND METHODS
dominant ~ncogene.’,~
Tissue
Samples
Deletions and mutations in the p53 tumor suppressor
gene are the most common genetic alteration found in huTumor specimens from 16 high grade NHL cases and reactive
tonsils from routine tonsillectomy specimens were obtained from
man tumors so far and have been described in a wide range
of human
including hematologic malignan~ies.~-’~the frozen tissue bank of the Pathology Department of the Virgen
de la Salud Hospital. Representative samples of tumor were snapThe majority of p53 mutations occur as missense changes
frozen in liquid nitrogen and stored at or below -70°C. Tissue
grouped in the highly conserved regions of the coding seimmediately adjacent to that stored was fixed for histopathologic
quence (exon 5 through 8). These mutations have been asdiagnosis. Formalin-fixed sections of each specimen were stained
sociated with increased nuclear or cytoplasmic expression
with hematoxylin eosin and examined histologically and then clasin human lung, breast, esophageal, ovarian, and colon carcisified according to the Kiel classifi~ation.~~
noma.I3-l9Higher levels ofp53 protein seem to result from a
Immunohistochemical Analysis
longer half-life of the mutated protein, arising from conformational changes that stabilize the protein for 4 to 8
Immunohistochemical analysis was performed in 16 cases on
frozen sections or cytospins, using the monoclonal antibody
h o ~ r s .However,
~ , ~ ~ owing to its short half-life of 20 minutes, WT p53 protein does not accumulate to amounts that
are detectable by immunohistochemical techniques.2’
From the Department of Genetics and the Department of Patholp53 overexpression has been found to be a fairly common
ogy, Virgen de la Salud Hospital, Toledo, Spain.
feature in high grade lymphomas. Results in different series
Submitted April 15, 1993; accepted July 21. 1993.
Supported by a grant fvom the Fondo de Investigaciones SanitarAdditionally, a
fluctuate between 25% and 33% of cases.22-26
ius, FIS (92/460).
pattern of focal expression in a small percentage of tumoral
Address reprint requests to Miguel A . Piris, MD, Department of
cells has also been identified in most high grade lymphomas
Pathology,
Virgen de la Salud Hospital, Av Barber s/n, 45004-Toand in a significant group of low grade lymphomas.22
ledo, Spain.
Other investigators have described p53 inactivation indeThe publication costs ofthis article were defrayed in part by page
pendent of mutation. This is due to its association with
charge payment. This article must therefore be hereby marked
DNA tumor viral proteins including the simian virus-40
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
large T antigen, papillomavirus E6 protein in cervical carciindicate this fact.
n o m a ~ , ~ and
’ , ~ ~adenovirus E l b protein. It has also been
0 I993 by The American Society of Hematology.
associated with cellular genes such as MDM2 protein in
0006-49 71/93/8210-0020$3.00/0
B/ood, Vol82, No 10 (November 15). 1993: pp 3151-3156
3151
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
3152
(MoAb) 1801 (Oncogen Science, Uniondale, NY) which specifically detects the mutant and WT protein, recognizing the N terminal epitope. The growth rate was tested with anti-ki67 MoAb (Dakopatts, Glostrup, Denmark). I801 and ki67 MoAbs were detected
by means of the alkaline-phosphatase antialkaline-phosphatase
te~hnique,~’
using Fast Red (Sigma, St Louis, MO) as chromogen.
Levamisole was used to inhibit endogenous alkaline phosphatase.
The slides were counter stained with hematoxylin. The cell line
HT29, containing a missense mutation at codon 273, was used as a
positive control. Reactive tonsils obtained from routine histopathologic laboratory work were used as negative controls.
Quantitative immunohistochemical investigation with a Cell Analyzer System (CAS 200, Lombard, IL; Becton Dickinson, Mountain View, CA) was used to score individual nuclei of the tumor
cells for the presence of p53 nuclear phosphoprotein and ki67 index. The total optical density of the immunostained area against
that of the nuclear area was calculated by the image analyzer. Intensity of expression was not evaluated. Nuclear boundary optical density and the antibody threshold were adjusted for each case examined. Five or more fields representative of each tumor were
analyzed, until a minimum of 500 cells had been studied.
Molecular Technique
Molecular analysis was performed in all 16 cases to locate p53
mutations within exon 5 through 8. Hematoxylin and eosin sections were reviewed to confirm the presence of neoplasic cells. The
fraction of malignant cells, calculated using PanB(CD19) and
PanT(CD3) antibodies, was at least 40%. DNA from tumoral tissue
(frozen samples) was extracted following standard protocol by digestion with proteinase K, purification with phenol/chloroform,
and precipitation by ethanol.’* Normal DNA from the same patients was obtained from bone marrow (BM).smears without tumoral infiltration, according to protocol described by Fey et al.33
Oligonucleotideprimers. Primers used for polymerase chain reaction (PCR) were derived from the p53 genomic sequence described by Chumaku PM, available from the EMBL Data Library
(Heidelberg, Germany) n X54 156 (unpublished), excepting the
primers p6-5’ and p5-3’ that were derived from published sequence~.’.~~
The sequence of the primers were as follows: for
exon 5 : p5-5’, 5’ TCCTTCCTCTTCCTACAG 3’, and p5-3’, 5’
ACCCTGGGCAACCAGCCCTGT 3’; for exon 6: p6-5‘: 5’
ACAGGGCTGGTTGCCCAGGGT 3‘, and p6-3‘: 5‘ AGTTGCAAACCAGACCTCAGGCG 3’; for exon 7: p7-5‘: 5‘
TCCTAGGTTGGCTCTGACTGT 3’, and p7-3’: 5’ AGTGGCCCTGACCTGGAGTCT 3‘; for exon 8: p8-5’: 5’ GGGACAGGTAGGACCTGATTTCCTT 3‘, and p8-3’: 5’ ATCTGAAGGCATAACTGCACCCTTGG 3’.
PCB. Genomic DNA (500 ng) was amplified in vitro for exons
5 to 8, using the primers described above for 30 cycles in a 100 p L
reaction containing 1.5 mmol/L CIMg,, 50 mmol/L KCI, I O
mmol/L Tris-CI (pH 8.3), 0.2 mmol/L dNTPs, 50 pm of each
primer, and 1.5 U of Taq polymerase. Reactions were overlaid with
mineral oil. PCR conditions used were as follows: 94°C for 1 minute 30 seconds, 58°C (for exons 6,7, and 8), 54°C (for exon 5) for 1
minute 30 seconds, and 72°C for 1 minute 30 seconds.
Nucleotide sequencing. Nucleotide sequences of amplified PCR
products were determined by asymmetric PCR. One microliter of
DNA from the double strand PCR reaction was reamplified for 35
cycles using one primer at 1/50 dilution under the same conditions
of PCR described above, except for the annealing temperature,
which used 57°C for the exons 6, 7, and 8 and 53°C for exon 5.
Single strand DNA products were purified by Sephadex G-50 and
sequenced using the Sequenase kit (USB Dideoxi, Cleveland, OH).
VILLUENDAS ET AL
All probable mutations and any areas of uncertainty were confirmed by sequencing the complementary strand.
RESULTS
Immunohistochemical Analysis
Immunohistochemical analysis was performed on 16
cases of NHL. p53 values that ranged from 0% to 52% were
found. The highest p53 values were found in 3 cases of Burkitt’s lymphoma (Table l). The percentage of p53 positive
cells in cases lacking p53 mutations was variable (Figs 1A
and B). Positive cells may correspond to proliferating cells,
as has been described in mitogen-stimulated lymphocytes3’
(Sanchez-Beato, submitted). In cases in which mutation was
found, the percentage of positive cells was also variable. In
case MT14, this percentage was higher (Fig IC) than that in
cases LL48 and LL47 (data not shown). p53 values were not
related to the percentage of tumoral cells. To determine the
possible relation between p53 positive cells and proliferation index, ki67 was assayed. The data shows that p53 values are lower or equal to ki67 values, because the values of
ki67 (32%) and p53 (34%) in case MT14 are statistically
equal (Table 1). Lack ofstaining was observed in case BK13
(Fig lD), which has a nonsense mutation. Staining was nuclear in most cases, with the exception of BKlO in which
cytoplasmic staining was also found.
Molecular Analysis
Molecular analysis was performed on all 16 cases with
tumors. In the group of 8 cases containing high levels of
protein detected by immunohistochemistry, 3 cases showed
missense point mutations (Fig 2), whereas the other 5 contained exclusively WT sequence. Among the 8 cases with
tumors containing undetectable or low levels of p53 protein, 1 case contained a nonsense point mutation giving a
stop codon (Fig 2B). The remaining 7 cases with tumors
contained WT sequences in the exons that were examined.
The missense mutations were found at the codons mapping
between exons 5 through 8. Two mutations were at codon
273 (Fig 2C), thus changing CGT to CAT and producing a
conversion of Arg to His. One mutation was at codon 158 at
exon 5, thus changing CGC to CAC, while also converting
Arg to His (Fig 2A). The nonsense mutation in case BKl3
was found at codon 196 in exon 6 that changed Arg to a
chain-terminating codon (Fig 2B).
The intensity of the mutant band varied from case to
case. In 2 cases (BK 13, LL47) WT sequence was not detectable at the mutation site, suggesting deletion of the WT
allele (BKl3, Fig 2A; and LL47, data not shown). The other
2 cases (MT14 and LL48) show WT and mutant bands of
similar intensity (Figs 2B and 2C). In case LL48, where
tumoral cells make up 40% of the tumor, the WT band is
probably caused by contamination of normal tissue. Nevertheless, in case MT 14, where 80% of the cells are tumoral,
the normal allele is probably present in the tumor.
To exclude the possibility that base changes detected in
tumor samples could be polymorphism or germline mutations, genomic DNA from normal BM cells from the same
patients was sequenced, and no nucleotide change was de-
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
MUTATION-INDEPENDENT P53 EXPRESSION IN LYMPHOMA
3153
Table 1. P53 Gene Accumulation and Gene Mutation in 16 Cases of
Case
Diagnosis
p53 (1801)
Expression (%)
p53 Mutation
(exons 5-81
BK13
LL66
MT8
MT5
MT17
BK4
MT24
LL65
BK16
LL47
LL48
LL72
MT14
BKl5
BKlO
A125
Burkitt
CB
CB MALT
CB MALT
CB MALT
IB-B
CB MALT
CB
Burkitt
IB
CB
IB
CB MALT
8urkitt
Burkitt
Burkitt
0
1
1
1
1
3
4
7
14
15
19
20
34
40
50
52
Codon 196
WT
WT
WT
WT
WT
WT
WT
WT
Codon 2 7 3
Codon 2 7 3
WT
Codon 158
WT
WT
WT
Nucleotide
Substitution
CGA
+
TGA
Arg
GCT + CAT
GCT + CAT
Arg
Arg
CGC + CAC
Arg
NHL
Amino Acid
Substitution
Ki67
+ stop
23
44
40
20
47
ND
ND
47
17
36
42
34
32
60
ND
ND
-P
-P
His
His
+ His
codon
(%I
% Tumoral
Cells
90
75
50
90
90
80
90
70
90
90
40
90
80
90
90
80
p53 and Ki67 values are determined by the CAS system
Abbreviation: ND, not done.
tected. All mutations were detected in both sense and antisense strands from several preparations of two or more independently amplified DNA samples. The percentage of p53
reactivity in those cases with missense mutations varies
from 15% to 34%.
DISCUSSION
p53 mutations have been described in a very wide variety
of human t ~ m o r including
s ~ ~ ~ hematopoietic malignancies
such as acute myeloblastic leukemia (AML),36,37blastic
transformation of chronic myeloid leukemia," and acute
lymphoblastic leukemia." In cases of NHL, p53 mutations
have been described in Burkitt's lymphoma9p3' and Burkitt's
cell lines?39 chronic lymphocytic leukemia,' and adult Tcell leukemia lymphoma.l2PmThe presence of p53 mutations in 4 of our series of 16 cases confirms the presence of
p53 gene mutations in high grade NHL. These mutations
were found distributed in different histologic groups of high
grade NHL, including Burkitt's lymphoma, centroblastic
(CB), immunoblastic (IB), and large cell lymphoma of mucosa-associated lymphoid tissue (MALT) origin, in a similar
frequency (20%) to that found in previous studies.41 p53
mutations were found in only 1 of 5 cases of Burkitt's lymphoma that were studied. The frequency of p53 mutations
in 33% of Burkitt's lymphomas in previous studies,' contrasts with the described presence of p53 mutations in 63%83% of the Burkitt's lymphoma cell lines studied'%39
thus far,
suggesting that p53 mutations could be given a selective
growth advantage for the in vitro establishment of cell
lines.42
The presence of p53 mutations and/or p53 overexpression in some high grade lymphomas is consistent with the
hypothesis that the p53 gene could play a role in the later
stages of lymphomagenesis or in the progression of the disease, as has been pointed out by Ichikawa et aL4' Initial
stages could be characterized by clonal B- or T-cell expan-
sions that are occasionally associated with chromosomal
translocation such as the ( 14;18)t characteristic of follicular
centroblastic-centrocytic(CB-CC) lymphoma or the (8;14)t
frequently found in Burkitt's lymphoma. Subsequent p53
alterations could contribute to transformation into more
aggressive tumors, such as those found in colorectal
cancer,43those which have been proposed in brain tumor
progression," or those arising in metastasis from human
papillomavirus-positive cervical c a r c i n ~ m a . ~ ~
All 4 cases with mutations showed G to A transition. This
is the type of base change most frequently found in lymphomas.' Codons 196 and 273, where three mutations were
found, correspond to CpG dinucleotide, a frequent site of
mutations. All three basic changes (at codons 158, 196, and
273) have already been identified in lymphomas and other
types of tumors.'.' The results may underestimate the frequency of p53 mutations, because analysis was performed
exclusively in these highly conserved regions of the p53
gene. Although the existence of mutations in other exons,
introns, or promoter regions could not be excluded, it seems
unlikely because conserved regions (exons 5 through 8) contain 98% of the mutation previously identified in human
A potential cause of underestimating the real
frequency of mutations is that direct sequencing could not
detect mutations present in small tumor populations. To
avoid this, we have only included cases in which tumoral
cells represent at least 40% of the tissue.
Immunostaining with 1801 p53 MoAb, which recognizes
an N-terminal epitope present in WT and mutant ~ 5 3 , ~ ~
was used to provide useful preliminary screening for detection of p53 mutations in tumors, because a relationship between the presence of p53 mutations and high levels of p53
protein expression has been described in lung ~ a n c e r , ' ~ , ~ '
breast ~ a n c e r , ' ~ ovarian
-'~
carcinoma," and colorectal
cancer cell lines." The detection of p53 protein through
immunohistochemical techniques seems to depend on the
stabilization of nuclear or cytoplasmic p53 as a conse-
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
3164
quence of conformational changes secondary to mutat i o n ~ . ~This
. ~ ' has led to the proposal that p53 detection may
be synonymouswith p53 mutation. Nevertheless,the findings of this series, where no mutation was detected in 5 or 8
cases with high p53 levels, do suggest that the nuclear or
cytoplasmic stabilization of p53 protein could also depend
on other factors, such as adhesion to other molecules
(MDW), as has been described in soft-tissue sarcomas.29
The presence of p53 independent of mutation has been described in human normal BM marrow blasts," in AML,M
and in the normal cells of a member of the family of a
cancer ~atient.~'
Recent findings suggest that p53 expression may be a stress response to a wide variety of DNA
attacks. p53 protein is able to induce growth arrest in cells
VILLUENDAS ET AL
with DNA damage.'.2 Immunohistochemicalfindings have
even shown p53 expression in reactive lymphocytes and
epithelial basal cells in toxoplasmic lymphadenitisand reactive tonsils, as well in phytohemagglutinin-stimulated lymp h o c y t e ~(Sanchez-Beato,
~~
submitted).
The combined analysis of p53 and ki67 expression shows
that p53 values were lower or equal to ki67 results in all
cases; this relation was independent of the presence of mutations. As well as confirming the existence of a relation
between growth fraction and p53 expression, as has been
already described (Sanchez-Beato, submitted), this result
suggests that in lymphomas with low growth fraction, p53
values cannot be used as a selection criteria in the search for
p53 mutations. This is due to the fact that mutations would
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
3155
MUTATION-INDEPENDENT P53 EXPRESSION IN LYMPHOMA
A
Mutant
G T
C
A
&*-’?*-
Codon 158
Arg
\
.’:
4-
-.
B
Wild T y p e
A
G
C
T
0
Fig 2. P53 gene sequence analysis by PCR-direct swuencina is shown. The codons at which the
mutations occur and the resulting base change in
the protein are indicated. Each sequence is shown
5 (top) 3 (bottom). Arrows point to the mutated
base pairs. (A) Case BK13, a Burkitt’s lymphoma
shows a mutant band in exon 6. Note the absence
of WT band. (B) Case MT14, a MALT CB lymphoma, shows a heterozygous missense mutation
in exon 5. Note the presence of mutant and WT
band. (C) Case LL48, a CB, shows a heterozygous
missense mutation in exon 8. Note the presence of
mutant and WT band.
b g
%
.
Codon 196 C\
G--,
0
A/
1
0
.
I
0
A
in any case produce scarcely detectable p53 protein. The
absence of p53 expression cannot rule out the existence of
p53 mutations, as shown by case number BK 13, in which a
nonsense mutation in codon 196 gives rise to a truncated
protein in which C-terminal domain is lost.
To conclude, we found several different types of p53
disregulation in cases of NHLs. These include missense mutations with overexpression of the protein, nonsense mutation with undetectable protein, and expression of the protein without accompanying mutations in the conserved
regions. The impact of these p53 alterations on clinical
course and treatment response of the patients deserves to be
explored in an attempt to differentiate the specific consequences of each.
ACKNOWLEDGMENTS
We gratefully thank Francesco Pezzella for his stimulating suggestions on the development of this study. We also thank Dr Kevin
Gatter (Nuffield Department of Pathology, John Radcliffe Hospital, Oxford, UK) for kindly providing the primers p5-5’. p6-3’, p7-5‘.
pl-3’. p8-5’. and p8-3’.
REFERENCES
I . Fritsche M, Haessler C, Brandner G: Production of nuclear
accumulation of the rumor-suppressor protein p53 by DNAdamaging agents. Oncogene 8:307, 1993
2. Hall PA, McKee PH, Menage HP, Dover R, Lane D P High
levels of pS3 protein in UV irradiated normal human skin. Oncogene 8:203, 1993
3. Yonish-Rouach E, Resnitzky D, Lotem J, Sachs L, Kimchi A,
Oren M: Wild-type p53 induces apoptosis of myeloid leukaemic
cells that is inhibited by interleukin-6. Nature 352:345, 1991
4. Finlay CA, Hinds PW, Levine AJ: The p53 protoncogene can
act as a suppressor of transformation. Cell 57:26 I , I989
I
-
-A/G
His
‘C
Mutant
G T
C
4 stop
.G Codon
‘A
0
3
-
Wild T y p e
C
G T
E , * , *.w
Codon 273 c,
GAr9
T’
-
A
c
I /
-n-
A
Mutant
G T
C
5. Hinds PC,Finlay CA, Levine AJ: Mutation is required to
activate the p53 gene for cooperation with the ras oncogene and
transformation. J Virol 63:739, 1989
6. Lane DP, Benchimol S: P53: Oncogene or antioncogene.
Genes Dev 4: I , I990
7. Hollstein M, Sidransky D, Vogelstein B, Hams CC: P53 mutations in human cancers. Science 253:49, 1991
8. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R,
Cleary K, Bigner SH, Davidson N. Baylin S, Devilee P Mutations
in the p53 gene occur in diverse human tumor types. Nature
342305. 1989
9. Gaidano G, Ballenni P, Gong JC. lnghirami, G, Ner A, Newcomb EW, Magrath IT, Knowles DM. Dalla-Favera R PS3 mutations in human lymphoid malignancies: Association with Burkitt
lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci
USA 88:5413, 1991
IO. Feinstein E, Cimino G, Gale RP, Alimena G, Berthier R,
Kishi K, Goldman J, Zaccana A, Berrebi A, Canaani E PS3 in
chronic myelogenous leukemia in acute phase. Proc Natl Acad Sci
USA 88:6293, 1991
1 I. Fenaux P, Jonveaux P. Quiquandon, Preudhomme C, Lai
JL, Vanrumbeke M, Loucheux-Lefebvre MH, Bauters F, Berger R,
Kerckaert J P Mutations of the p53 gene in Bcell lymphoblastic
acute leukemia: a report on 60 cases. Leukemia 6:42, 1992
12. Cesarman E, Chadburna A. Inghirami, Gaidano G, Knowles
DM: Structural and functional analysis of oncogenes and tumor
suppressor genes in adult T-cell leukemia lymphoma shows frequent p53 mutations. Blood 803205, 1992
13. lggo R, Gatter K, Bartek J, Lane D, Hams A L Increased
expression of mutant forms ofp53 oncogen in primary lung cancer.
Lancet 335:675, 1990
14. Bartek J, lggo R, Cannon J. Lane DP: Genetic and immunohistochemical analysis of mutant p53 in human breast cancer cell
lines. Oncogene 52393, 1990
15. Thor AD, Moore DH, Edgerton S, Kawasaki E, Reihsaus E.
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
3156
Lynch HT, Marcus JN, Schwartz L, Chen L, Mayall BH, Smith H:
Accumulation of p53 tumor suppressor gene protein: An independent marker of prognosis in breast cancers. J Natl Cancer Inst
84:845, 1992
16. Moll UM, Riou G, Levine AJ: Two distinct mechanisms
alter p53 in breast cancer: mutation and nuclear exclusion. Proc
Natl Acad Sci USA 89:7262, 1992
17. Bennet WP, Hollstein MC, He A, Zhu, Resau JH, Trump
BF, Metcalf RA, Welsh JA, Midgley C, Lane DP, Hams CC: Archival analysis of p53 genetic and protein alterations in Chineseesophageal cancer. Oncogene 6:1779, 1991
18. Marks JR, Davidoff AM, Kerns BJ, Humphrey PA, Pence
JC, Dodge RK, Clarke-Pearson DL, Iglehart JD, Bast RC, Berchuck A: Overexpression and mutations of p53 in epithelial ovarian
cancer. Cancer Res 51:2979, 1991
19. Rodrigues NR, Rowan A, Smith RE, Kerr IB, Bodmer WF,
Gannon JV, Lane D. P53 mutations in colorectal cancer. Proc Natl
Acad Sci USA 87:7555, 1990
20. Halevy 0, Hall A, Oren M: Stabilization of the p53 transformation-related protein in mouse fibrosarcoma cell lines: Effects of
protein sequence and intracellular environment. Mol Cell Biol
9:3385, 1989
21. Reich NC, Oren M, Levine AJ: Two distinct mechanism
regulate the levels of a cellular tumor antigen, p53. Mol Cell Biol
9:3385, 1989
22. Villuendas R, Pins MA, Orradre JL, Mollejo M, Algara P,
Sanchez L, Martinez JC, Martinez P: P53 protein expression in
lymphomas and reactive lymphoid tissue. J Pathol 166:235, 1992
23. Doglioni C, Pelosio P, Mombello A, Scarpa A, Chilosi M:
Immunohistochemical evidence of abnormal expression of the antioncogene-encoded p53 phosphoprotein in Hodgkin’s disease and
CD30’ anaplastic lymphomas. Hematol Pathol 5:67, 199 I
24. Soini Y, Paakko P, Alavaikko M, Vahakangas K: P53 expression in lymphatic malignancies. J Clin Path1 45:101 I , 1992
25. Said JW, Barrera R, Shintaku P, Nakamura H, Koeffler HP:
Immunohistochemical analysis of p53 expression in malignant
lymphomas. Am J Pathol 141:1343, 1992
26. Pezzella F, Momson H, Jones M, Gatter KC, Lane D, Hams
AL, Mason DY: Immunohistochemical detection of p53 and bc12
proteins in non-Hodgkin’s lymphoma. Histopathology 22:39, 1993
27. Scheffner M, Werness BA, Huibregtse JM, Levine AJ,
Howly PM: The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promoted the degradation of p53. Cell
63: 1129, 1990
28. Crook T, Wrede D, Tidy JA, Mason WP, Evan DJ, Vousdn
KH: Clona p53 mutation in primary cervical cancer: Association
with human papillomavirus negative tumors. Lancet 339: 1070,
1992
29. Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein
B: Amplification of a gene encoding a p53-associated protein in
human sarcomas. Nature 358:80, 1992
30. Lennert K, Feller A C Histopathology of Non-Hodgkin’s
Lymphoma. Berlin, Heidelberg, Springer-Verlag, 1992
3 1. Cordell JL, Falini B, Erber WN, Abdulaziz Z, Mac Donalds
S, Pulford KAF, Stein H, Mason DY: Immunoenzymatic labelling
of monoclonal antibodies using immunocomplex of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes). J Histochem Cytochem 32:219, 1984
32. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning. A
Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring
Harbor Laboratory, 1989
33. Fey MF, Pilkintgton SP, Summers P, Wainscoat JS: Molecular diagnosis of haematological disorders using DNA from stores
bone marrow slides. Br J Haematol 67:489, 1987
VILLUENDAS ET AL
34. Buchman VL, Chumakov PM, Ninkina NN, Samarina OP,
Georgiev GP: A variation in the structure of the protein-coding
region of the human p53 gene. Gene 70:245, 1988
35. Mercer WE, Baserga R: Expression ofthe p53 protein during
the cell cycle of human peripheral blood lymphocytes. Exp Cell Res
160:31, 1985
36. Fenaux P, Collyn d’Hooghe M, Jonveaux P, Lai JL, Loucheux-Lefebvre MH, Bauters F, Kerckaert J P Rearrangement and
expression ofthe p53 gene in Myelodysplastic Syndrome and Acute
Leukemia. Nouv Rev Fr Hematol 32:341, 1990
37. Slingerland JM, Minden MD, Benchimol S: Mutation ofthe
p53 gene in human acute myelogenous leukemia. Blood 78:1652,
1991
38. Ballerini P, Gaidano Gianluca, Gong JZ, Tassi V, Saglio G,
Knowles DM, Dalla-Favera R: Multiple genetic lesions in acquired
immunodeficiency syndrome-related non-Hodgkin’s lymphoma.
Blood 81:166. 1993
39. Farrell PJ, Allan JG, Shanahan F, Vousden K, Crook T: P53
is frequently mutated in Burkitt’s lymphoma cell lines. EMBO J
10:2379, 1991
40. Sakashita A, Hattori T, Miller CW, Suzushima H, Asou N,
Takatsuki K, Koeffler PH: Mutations ofthe p53 gene in adult T-cell
leukemia. Blood 79:477, 1992
41. lchikawa A, Hotta T, Takagi N, Kinoshita T, Nagai H, Murakami Y, Hayashi K, Saito H: Mutations of p53 gene and their
relation to disease progression in B-cell lymphoma. Blood 79:270 I,
1992
42. Sugimoto K, Toyoshima H, Sakai R, Miyagawa K, Hagiwara K, Iahikawa F, Takaku F, Yazaki Y, Hirai H: Frequent mutations in the p53 gene in human myeloid leukemia cell lines. Blood
19:2378, 1992
43. Fearon ER, Vogelstein B: A genetic model for colorectal tumorigenesis. Cell 61:759, 1990
44. Sidransky D, Mikkelsen T, Schwechheimer K, Rosemblum
ML, Cavanee W, Vogelstein B: Clonal expansion of p53 mutant
cell is associated with brain tumor progression. Nature 3552346,
I992
45. Crook T, Vousden KH: Properties of p53 mutations detected in primary and secondary cervical cancers suggest mechanisms of metastasis and involvement of environmental carcinogens. EMBO J 11:3935 1992
46. Takahashi T, DAmico D, Chiva I, Buchhagen DL, Minna
J D Identification of intronic point mutations as an alternative
mechanism for p53 inactivation in lung cancer. J Clin Invest
86:363, 1990
47. Banks SJ, Matlashewiski G, Crawford L: Isolation ofhuman
p53 specific monoclonal antibodies and their use in the studies of
human p53 expression. Eur J Biochem 159529, 1986
48. Bodner SM, Minna JD, Jensen SM, DAmico D, Carbone D,
Mitsudomi T, Fedorko J, Buchhagen DL, Nav MM, Gazdar AF,
Linnoila RI: Expression of mutant proteins in lung cancer correlates with the class of p53 gene mutation. Oncogene 7:743, 1992
49. Rivas CI, Wysnyews KI, Strise A, Perez A, Lambek C, Bruno
S, Darzynkiewycz Z, Clarkson B: Constitutive expression of p53
protein in enriched normal human marrow blast cell populations.
Blood 79:1982, 1992
50. Zhang W, Hu G, Ester J, Deisseroth A: Altered conformation of the p53 protein in myeloid leukemia cells and mitogenstimulated normal blood cells. Oncogene 7: 1645, 1992
5 1. Barnes DM, Hanby AM. Gillett CE, Mohammed S, Hodgson S, Bobrow LG, Leigh IM, Purkis T, MacGeoch C, Spurr NK,
Bartek J, Vojtesek B, Picksley SM, Lane DP: Abnormal expression
of wild type p53 protein in normal cells of a cancer family patient.
Lancet 340:259, 1992
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
1993 82: 3151-3156
The expression of p53 protein in non-Hodgkin's lymphomas is not
always dependent on p53 gene mutations
R Villuendas, MA Piris, P Algara, M Sanchez-Beato, L Sanchez-Verde, JC Martinez, JL Orradre, P
Garcia, C Lopez and P Martinez
Updated information and services can be found at:
http://www.bloodjournal.org/content/82/10/3151.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.