ASSIGNMENT 6 (5%) - BLAST BLAST Search: Based on the sequence on the page 2, find the search result by using the link provided (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__96 06__9558&LINK_LOC=blasthome) and answer all the questions 1 - 4. Use default parameter on the website for question 1 and 2. The link should direct us to the interface as shown below. Please refer to the steps given. Step 1: User should enter the given sequence in the box for Enter Query Sequence. Step 2: Choose blastn for the program selection. For Question 3 only Step 3: Click BLAST to get the results. Step 1 Step 3 Step 2 1 Sequence: GTGTCAATGTGTTTTGTGCTTATATTTTTCCTGCACTAAATTGAGGCATTATTTACTTT CCAACGAGTGTATTGTGGTAAGTAAGGCCGACGTGATGAAATACATGTTATCGGCCC CTGTGTTAAAAGGACGAATTGGGAAGTGGATTTTTGCCTTAACAGAGTTTGACCTCA GATATGAATCGGCCAAAGCAGTCAAAGGACAAGCCCTGGCCGATTTCATTGTTCAA CATAGAGACGAATCGGTTGCGTACGCAGATATTGTGCCATGGACATTGTATTTTGAT GGATCCGTCTGCAGACATGGATGCGGTATCGGCCTAGTTATCATATCCCCTCGGGGG GCAAGCTTTGAGTTTGCTTTTACTATCAAGCCTTATTACACTAACAATCAAGCAGAG TACGAAGCGGTGCTTAAAGGCTTGCAGTTATTACAAGAAGTCGAGGCCGATTCCGTA GAGATCATTGGTGACTCACAACTGGTAATTAATCAACTTTCTGGAGAGTATGAATGC AAAGATGACATCCTCAAAGTCTACAATGAAGATTGCAAGGTGTTGTTTCAAGCATTC AGGATCGTAACGATGAGGCATATACCCAGGAAGCAAAACTTCGAGGCCAATGACCT GGCTCAGGGGGCATCGGGATACAGGCCGATGGCCAAGGGTGCACGAGTTCAAATTG CCACCGTAGACGCCGACGATTGGAGATTTGCTATCATTGATTATTTGAAGAATCCTT CCCAATCGGCGTCACGAAAGATGAAATACAAAGTATTGCAGTATGTCCTGTTAGATG ATGATTTATACCATCGGATGATTGATGGTGTCTTGCTCAAGTGCCTAGGTCCTGAGG AGGCCAGAGTCGTTATGAGCGAGGTCCATGCCTGATGCTA Question 1: Give number of hits. (1 mark) Question 2: Give the max identities of the sequence (%). (1 mark) Question 3: (a) Give the number of hits when the query subrange is changed (1 mark) =1, =28. (Refer interface given) (b) Give one reason for the difference (if any) in term number of hits when searching the whole sequence vs. 28 words size sequence. (1 mark) 2 Question 4: Figure 1: Blosum62 Substitution Matrix QUERY L E N T F F V Q A N SUBJECT Y E N I T I I Q S N SCORE Based on the Figure 1 and table above, fill in the score by using Blosum62 Substitution Matrix. (1 mark) 3
© Copyright 2026 Paperzz