From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
Brief report
Single-tube multiplex-PCR screen for common deletional
determinants of ␣-thalassemia
Samuel S. Chong, Corinne D. Boehm, Douglas R. Higgs, and Garry R. Cutting
␣-Thalassemia is very common throughout all tropical and subtropical regions of
the world. In Southeast Asia and the
Mediterranean regions, compound heterozygotes and homozygotes may have
anemia that is mild to severe (hemoglobin
[Hb] H disease) or lethal (Hb Bart’s
hydrops fetalis). We have developed a
reliable, single-tube multiplex–polymerase chain reaction (PCR) assay for the 6
most frequently observed determinants
of ␣-thalassemia. The assay allows sim-
ple, high throughput genetic screening
for these common hematological disorders. (Blood. 2000;95:360-362)
r 2000 by The American Society of Hematology
Introduction
␣-Thalassemia is the most common inherited disorder of hemoglobin (Hb) synthesis in the world, with gene frequencies varying between
1% and 98% throughout the tropics and subtropics.1 Unlike
␤-thalassemia, in which nondeletional mutations predominate, G
95% of recognized ␣-thalassemia involves deletion of 1 or both
␣-globin genes from chromosome 16p13.3.1,2 The most common of
these are the -␣.3.7 and -␣.4.2 single gene deletions, the —SEA and
—FIL Southeast Asian double gene deletions, and the —MED and
-␣.20.5 Mediterranean double gene deletions. Although a high
incidence of the — THAI deletion has been reported in Taiwan,3,4 it
was recently suggested that these patients have the —FIL mutation.5
With the exception of the original patient with this mutation,6 no
others have been described, and the allele frequency is unknown.
Until several years ago, the standard procedure for molecular
characterization of ␣-thalassemia was Southern blot analysis. DNA
sequence analysis of each deletion breakpoint has now enabled PCRbased testing,4,7-10 which is faster, less expensive, safer (no radioactivity
involved), and easier to interpret than Southern blot analysis. Currently,
however, separate tests are required for the different mutations because
of different reagent and thermocycling requirements. Additionally,
reproducibility of some PCR-based tests have been problematic, particularly those involving the -␣.37 allele. These problems stem in part from
the differences in GC nucleotide content of the various deletion
junctions and also from the considerable sequence homology within the
␣-globin cluster, especially at the ␣2 and ␣1 loci.
We have developed a single-tube multiplex-PCR assay capable
of detecting any combination of these 6 common single and double
gene deletions.
Study design
Sequence information on the deletion breakpoints and a control locus (the
LIS1 gene at 17p13.3) has been published previously.4,5,11-15 Primers were
From the McKusick-Nathans Institute of Genetic Medicine and Department of
Pediatrics, Johns Hopkins School of Medicine, Baltimore, Maryland; the
Departments of Pediatrics and Obstetrics & Gynecology, National University of
Singapore, Singapore; and the MRC Molecular Hematology Unit, Institute of
Molecular Medicine, Oxford, England.
Submitted April 26, 1999; accepted September 2, 1999.
Supported by research funds from the Johns Hopkins University and by a grant
from the Academic Research Fund of the National University of Singapore
(NUS/ARF 3 690 044).
360
designed to amplify the junction fragments of the ␣-thalassemia determinants that could be easily identified by size (Table). Since each of the 6
deletions either partially or completely removes the ␣2 gene (Figure 1A), its
positive amplification was used to indicate heterozygosity when a deletion
allele was also present. Additionally, amplification of a large (2.5 kilobase)
segment of the LIS1 gene 38UTR was included as a control for amplification success.
Each 50 µL reaction contained 20 mmol/L Tris-HCl pH 8.4, 50 mmol/L
KCl, 1.5 mmol/L MgCl2, 1 mol/L betaine (SIGMA, St. Louis, MO), 0.2 µL
of each primer (Table 1), 0.2 mmol/L of each dNTP, 2.5 units of polymerase
(Platinum Taq; Life Technologies, Gaithersburg, MD), and 100 ng of
genomic DNA. Reactions were carried out on a thermal cycler (Genius;
Techne, Cambridge, UK), with an initial 5-minute denaturation at 95°C, 30
cycles of 97°C for 45 seconds, 60°C for 1 minute 15 seconds, 72°C for 2
minutes 30 seconds, and a final extension at 72°C for 5 minutes. Following
amplification, 10 µL of product was electrophoresed through a 1% agarose,
1 ⫻ TBE gel at 5-6 volts/cm for 1 hour, stained in ethidium bromide, and
visualized on an ultraviolet transilluminator.
Results and discussion
The assay was tested on a total of 115 blood and prenatal DNA
archival samples. The ␣-globin genotypes had been determined
previously by Southern blot analysis. Samples were amplified,
products were separated on agarose gels, and genotypes were
scored before checking against the previously determined Southern results.
In 16 samples tested (number of samples noted in brackets), there
were no amplification products observed: (—SEA/␣␣ [9],-␣.37/␣␣
[6], —MED/␣␣ [1]) (data not shown). Repeat reactions with a fresh
multiplex-PCR mix or a previously tested primer pair specific to a
different locus did not alter the outcome (data not shown). This suggests that rather than a specific failure of the multiplex-PCR system,
these DNA samples were inadequate for any standard PCR reaction.
Reprints: Samuel S. Chong, Department of Pediatrics, National University of
Singapore, Level 4, Main Building, National University Hospital, 5 Lower Kent
Ridge Road, Singapore 119074, Singapore; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
r 2000 by The American Society of Hematology
BLOOD, 1 JANUARY 2000 • VOLUME 95, NUMBER 1
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
BLOOD, 1 JANUARY 2000 • VOLUME 95, NUMBER 1
␣-THALASSEMIA MULTIPLEX-PCR SCREEN
361
Table. Primers for single-tube multiplex-PCR analysis of common-thalassemia deletions
Name
58 = 38 Sequence
GenBank ID: Nucleotides
Amplicon (Size)
LIS1-F
GTCGTCACTGGCAGCGTAGATC
HSLIS10:407 = 428
LIS1 38UTR frag
LIS1-R
GATTCCAGGTTGTAGACGGACTG
HSLIS10:2909 = 2887
(2503 bp)
␣2/3.7-F
CCCCTCGCCAAGTCCACCC
HUMHBA4:5676 = 5694
-␣3.7jxn frag
3.7/20.5-R
AAAGCACTCTAGGGTCCAGCG
HUMHBA4:11514 = 11494
(2022/2029 bp)
␣2/3.7-F
see above
␣2-R
AGACCAGGAAGGGCCGGTG
HUMHBA4:7475 = 7457
(1800 bp)
4.2-F
GGTTTACCCATGTGGTGCCTC
HUMHBA4:3064 = 3084
-␣4.2jxn frag
4.2-R
CCCGTTGGATCTTCTCATTTCCC
HUMHBA4:8942 = 8920
(1628 bp)
SEA-F
CGATCTGGGCTCTGTGTTCTC
HSGG1:26120 = 26140
--SEAjxn frag
SEA-R
AGCCCACGTTGTGTTCATGGC
HSCOS12:3817 = 3797
(1349 bp)
FIL-F
TGCAAATATGTTTCTCTCATTCTGTG
HSGG1:11684 = 11709
--FILjxn frag
FIL-R
ATAACCTTTATCTGCCACATGTAGC
HSCOS12:570 = 546
(1166 bp)
20.5-F
GCCCAACATCCGGAGTACATG
HSGG1:17904 = 17924
-(␣)20.5jxn frag
3.7/20.5-R
see above
MED-F
TACCCTTTGCAAGCACACGTAC
HSGG1:23123 = 23144
--MEDjxn frag
MED-R
TCAATCTCCGACAGCTCCGAC
HSGG1:41203 = 41183
(807 bp)
In 10 additional samples (—SEA/␣␣ [5], -␣.3.7/␣␣ [3], —MED/␣␣
[1], —MED/—MED [1]), 1 or 2 ␣-globin fragments successfully
amplified, but the LIS1 positive control fragment was absent (data
not shown). In accordance with the intended function of the LIS1
positive control, these samples were excluded from further analysis, since situations where smaller fragments amplify but larger
ones do not can occur with partially degraded or impure DNA
template or with incorrect PCR conditions. In the case of heterozygous or compound heterozygous samples, failure to detect the
second ␣-globin fragment would lead to misdiagnosis.
In the remaining 89 samples, the LIS1 positive control fragment
amplified successfully: (␣␣/␣␣ [10], ␣.3.7/␣␣ [21],—SEA/␣␣ [24],
-␣.4.2/␣␣ [2], —FIL/␣␣ [7], —MED/␣␣ [2], -(␣).20.5/␣␣ [3], -␣.3.7/—SEA
[3], -␣.3.7/ -␣.4.2 [2], -␣.4.2/—SEA [2], —FIL/—SEA [2], -(␣).20.5/—MED
[1], -␣.3.7/-␣.3.7 [5], —SEA/—SEA [3], —MED/—MED [1], -(␣).20.5/(␣).20.5 [1]). For each of these samples, co-amplification of the
expected ␣-globin fragment or fragments was also observed, and
the assigned ␣-globin genotypes were confirmed for all samples
(Figure 1B).
The intensities of the ␣2 and -␣.3.7 fragments were often weaker
than for the other fragments, probably due to a combination of their
Figure 1. Multiplex-PCR genotype analysis of the
␣-globin gene cluster. (A) Schematic representation of
the ␣-globin gene cluster. Figure indicates extents of
each deletion represented in the multiplex-PCR assay
and relative positions of the primers (except for the
control LIS1-F and LIS1-R primers, which are located on
a different chromosome). Locations of sequence homology (X, Y, Z boxes) and hypervariable regions (HVR) are
also shown. (B) Representative results from DNA samples
with various ␣-globin genotypes. The M indicates the 1
kb-Plus molecular weight marker (Life Technologies), and
the AL, the allelic ladder comprising all 8 possible amplification fragments.
␣2 gene
(1007 bp)
higher GC content and large size. Nevertheless, allele dropout
(amplification failure) of either of these fragments was not
observed. Unexpected or inappropriate fragments were not observed in any of the samples tested, confirming the specificity of
this assay. These results demonstrate the successful development of
a single-tube multiplex-PCR assay for common deletional determinants of ␣-thalassemia.
The simplicity and universality of this multi-ethnic multiplexPCR assay should significantly reduce the cost and complexity of
screening for these common ␣-thalassemia deletions. The assay is
especially useful in cosmopolitan populations, such as in the
United States and the United Kingdom, where in the majority of
cases and irrespective of patient ethnicity, only a single diagnostic
test needs to be performed.
Acknowledgment
We thank P. Sanders for technical assistance.
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
362
BLOOD, 1 JANUARY 2000 • VOLUME 95, NUMBER 1
CHONG et al
References
1. Higgs DR, Vickers MA, Wilkie AOM, Pretorius
I-M, Jarman AP, Weatherall DJ. A review of the
molecular genetics of the human ␣-globin gene
cluster. Blood. 1989;73:1081-1104.
2. Kazazian Jr H. The thalassemia syndromes: molecular basis and prenatal diagnosis in 1990. Semin Hematol. 1990;27:209-228.
3. Ko TM, Chen TA, Hsieh MI, Tseng LH, Hsieh FJ,
Chuang SM, Lee TY. Alpha-thalassemia in the
four major aboriginal groups in Taiwan. Hum
Genet. 1993:92:79-80.
4. Ko T-M, Tseng L-H, Kao C-H, Lin Y-W, Hwa H-L,
Hsu P-M, Li S-F, Chuang S-M. Molecular characterization and PCR diagnosis of Thailand deletion
of ␣-globin gene cluster. Am J Hematol. 1998;57:
124-130.
—THAI
5. Higgs DR, Ayyub H, Chong SS. The
and —FIL determinants of ␣ thalassemia in
Taiwan. Am J Hematol. 1999;60:80-81.
6. Winichagoon P, Higgs DR, Goodbourn SE, Clegg
JB, Weatherall DJ, Wasi P. The molecular basis
of alpha-thalassaemia in Thailand. EMBO J.
1984;3:1813-1818.
functional ␣ loci among non-Asians with Hb H
disease. Cell. 1979;17:33-42.
7. Bowden DK, Vickers MA, Higgs DR. A PCRbased strategy to detect the common severe determinants of ␣ thalassemia. Br J Haematol.
1992;81:104-108.
12. Embury SH, Lebo RV, Dozy AM, Kan YW. Organization of the ␣-globin genes in the Chinese
␣-thalassemia syndromes. J Clin Invest. 1979;63:
1307-1310.
8. Ko T-M, Tseng L-H, Hsieh F-J, Hsu P-M, Lee T-Y.
Carrier detection and prenatal diagnosis of alphathalassemia of Southeast Asian deletion by polymerase chain reaction. Hum Genet. 1992:88:245248.
13. Embury SH, Miller JA, Dozy AM, Kan YW, Chan
V, Todd D. Two different molecular organizations
account for the single ␣-globin gene of the ␣-thalassemia-2 genotype. J Clin Invest. 1980;66:
1319-1325.
9. Baysal E, Huisman THJ. Detection of common
deletional ␣-thalassemia-2 determinants by PCR.
Am J Hematol. 1994;46:208-213.
14. Nicholls RD, Fischel-Ghodsian N, Higgs DR: Recombination at the human ␣-globin gene cluster:
sequence features and topological constraints.
Cell. 1987;49:369-378.
10. Chang JG, Liu TC, Chiou SS, Chen JT, Chen TP,
Lin CP. Rapid detection of -(␣)4.2 deletion of
␣-thalassemia-2 by polymerase chain reaction.
Ann Hematol. 1994;69:205-209.
11. Orkin SH, Old J, Lazarus H, Altay C, Gurgey A,
Weatherall DJ, Nathan DG. The molecular basis
of ␣-thalassemias: frequent occurrence of dys-
15. Lo Nigro C, Chong SS, Smith ACM, Dobyns WB,
Carrozzo R, Ledbetter DH. Point mutations and
an intragenic deletion in LIS1, the lissencephaly
causative gene in isolated lissencephaly sequence and Miller-Dieker syndrome. Hum Mol
Genet. 1997;6:157-164.
From www.bloodjournal.org by guest on July 28, 2017. For personal use only.
2000 95: 360-362
Single-tube multiplex-PCR screen for common deletional determinants of α
-thalassemia
Samuel S. Chong, Corinne D. Boehm, Douglas R. Higgs and Garry R. Cutting
Updated information and services can be found at:
http://www.bloodjournal.org/content/95/1/360.full.html
Articles on similar topics can be found in the following Blood collections
Brief Reports (1942 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.