Egyptian Journal of Medical Microbiology, April 2014
Vol. 23, No. 2
Comparison of Broad Range 16S rDNA PCR and BACTEC System for
Detection of Neonatal Sepsis
Safaa Mohamad El-Ageery 1, Howayda Nabih Fouad Mahran 2,
Soumaya El-Sayed Hadhoud 3
Medical microbiology & immunology Department, Faculty of Medicine, MansouraUniversity,
Egypt, Medical Laboratories Technology Department, Faculty of Applied Medical Sciences,
Taibah University, Saudi Arabia1; Medico-legal department, Ministry of Justice, Alexandria,
Egypt, Medical Laboratories Technology Department, Faculty of Applied Medical Sciences,
Taibah University, Saudi Arabia2; Pediatrics Department, Faculty of Medicine, Sohag
University, Egypt, Pediatrics Department, Faculty of Medicine, Taibah University, Saudi
Arabia3
ABSTRACT
Background: Bacterial sepsis is a feared complication of the newborn. A large proportion of infants
admitted to the Neonatal Intensive Care Unit (NICU) for suspected sepsis receive treatment with potent
systemic antibiotics while a diagnostic workup is in progress. The gold standard for detecting bacterial
sepsis is blood culture. However, the sensitivity of blood culture is suspected to be low. Molecular assays
for the detection of bacterial DNA in the blood represent possible new diagnostic tools for early
identification of a bacterial cause. Aim: The aim of this study was to compare a broad range 16S rDNA
PCR done on blood samples without prior enrichment to conventional BACTEC blood culture for
detecting bacteria in blood samples from neonates with suspected sepsis. Methods: Fifty five neonates
with clinically diagnosed sepsis were included in this study. A broad range 16S rDNA polymerase chain
reaction (PCR) without preincubation was compared to conventional diagnostic work up for clinical
sepsis, including BACTEC PEDS PLUS/F blood culture, for early determination of bacterial sepsis in
each infant. Results: Only 20 infants had a positive blood culture. Analysis by 16Sr DNA PCR revealed
21 samples positive for the presence of bacterial DNA. PCR failed to be positive in one sample from
blood culture positive infant, and was positive in 2 samples with blood culture negative infants.
Compared to blood culture the diagnosis of bacterial proven sepsis by PCR revealed 95.0% sensitivity,
94.3% specificity, 90.5% positive predictive value and 97.1% negative predictive value. PCR combined
with blood culture revealed bacteria in 40.0% of the patients diagnosed with sepsis. Conclusion: There is
a need for PCR as a method to quickly point out the infants with sepsis. However, uncertainty about a
bacterial cause of sepsis was not reduced by the PCR result, reflecting that blood culture is irreplaceable
at present, since pure isolates are essential for antimicrobial drug susceptibility testing.
Key Words: Neonatal sepsis, broad range 16S rDNA PCR, BACTEC system.
Ethical approval: Ethical Committee of Maternity & Pediatric Hospital in Al-Madinah Al-Monawarah
and scientific research of Taibah University approved the study.
and morbidity rates.(4) However, diagnosing
neonatal sepsis is difficult since clinical signs
are often vague, and laboratory parameters are
unspecific. Initiation of broad-spectrum
systemic antibiotic treatment is based only on
the suspicion of sepsis since no early definitive
diagnostic test is yet available. The clinician
accepts some over-treatment because of the high
risk of mortality if sepsis is left untreated.(10-13)
Conventional blood culture is considered
the gold standard in the etiological diagnosis of
neonatal bacterial sepsis.(14,15) However,
obtaining sufficiently large amounts of blood
for culture from neonates are often difficult ,
and it often takes 48–72 hours to obtain a
preliminary positive result. Some bacterial
species, however, are difficult to isolate, or
BACKGROUND
Neonatal sepsis is a major cause of
morbidities and mortalities mostly remarkable
in the third world nations.(1-3) Neonatal sepsis
has been divided into two main categories
including early (72 hours of age) and late-onset
(after 72 hours of age) sepsis. (4-7) Unfortunately
signs and symptoms of neonatal sepsis such as
respiratory distress and irritability are vague and
not confined to the diseases;(8) other noninfectious processes also may present with the
same manifestations.(9)
Early diagnosis and subsequent therapy for
the infected infants or those with a higher risk
may play a vital role in lowering such mortality
7
Egyptian Journal of Medical Microbiology, April 2014
Vol. 23, No. 2
grow slowly in the laboratory due to stringent
growth requirements, while others may not
grow because of prior empirical treatment of
patients with antimicrobial agents.(16-19)
Detection of bacterial DNA in blood
samples of neonates is suggested to represent a
rapid and sensitive supplement to blood culture
in
diagnosing
bacterial
sepsis
in
neonates.(11,20,21)
Molecular
diagnostic
techniques, such as PCR, are being developed to
aid in the diagnosis of bacterial infection by
detecting bacterial genetic material.(22) Unlike
culture, most molecular assays are designed
specifically for one organism. Broad-range
assays, based on ribosomal genes (rDNA), are
designed to overcome this limitation. Bacterial
rDNA consists of highly conserved nucleotide
sequences that are shared by all bacterial
species, interspersed with variable regions that
are genus- or species-specific. The DNA
sequences of the variable regions form the basis
of phylogenetic classification of microbes.(23)
By using PCR primers that are targeted at
conserved regions of rDNA, it is possible to
design broad-range PCRs capable of detecting
DNA from almost any bacterial species.(24,25)
The aim of this study was to compare a
broad range 16S rDNA PCR done on blood
samples
without
prior enrichment to
conventional BACTEC PEDS PLUS/F blood
culture for detecting bacteria in blood samples
from infants with suspected sepsis.
samples for PCR were blinded and stored in
room temperature for until 72 hours, divided
into plasma and cell fractions, and were then
stored at -70°C before analysis.
PCR reactions
PCR reactions were set up to amplify
bacterial
DNA
using
the
primer
5'TGAAGAGTTTGATCATGGCTCAG,
5'AAGGAGGTGATCCAACCG. The primer
reacts with highly conserved regions of the
bacterial 16S rDNA gene to provide PCR
products of approximately 1500 basepairs.(26)
The primer is routinely used in some laboratory
for 16S rDNA based identification of unknown
isolates (Eurogentec, Belgium). Each PCR
reaction (50 μl) consisted of 1 × Amplitaq Gold
buffer
(Applied
Biosystems,USA)
supplemented with 2.5 U Amplitaq Gold Low
DNA enzyme (Applied Biosystems,USA), 2
mM MgCl2, 0.2 mM dNTP (Roche Diagnostics,
Germany), 20 μl template and PCR grade water
(Roche Diagnostics, Germany). Cycling
conditions included a 5 minute denaturing step
at 94°C followed by 30 to 40 cycles of 20
seconds at 94°C, 20 seconds at 58°C and 60
seconds at 72°C. PCR results were considered
positive when visible PCR products of the
correct size were found in DNA isolated from
either the plasma or the cell fraction. PCR
results were considered negative when no
visible PCR products of correct size were
found.(27)
METHODS
RESULTS
Patients
A six-month prospective study was done on
55 neonates admitted to the NICU at Maternity
and Pediatric Hospital in Al-Madinah AlMonawarah. The patients were discharged from
the NICU with diagnosis of sepsis: infants with
suspicion of sepsis or development of clinical
signs consistent of sepsis. All infants included
in the study were treated with systemic
antibiotics.
Microbial analyses
A minimum of 1 ml full blood for
conventional BACTEC Peds PLUS/F blood
culture (Becton Dickinson, USA), and 1–2 ml
EDTA blood for 16S rDNA PCR were obtained
by standard sterile procedures before starting
general systemic antibiotic treatment. Only one
blood culture bottle was routinely drawn from
each patient. The bottles for culturing were
immediately incubated. The EDTA-blood
Comparison of 16S rDNA PCR and blood
culture
As presented in the table; twenty of the
infants had a positive blood culture result.
Blood cultures from 20 of 55 patients, counting
for 36.4% (20/55) of the patients diagnosed with
sepsis in this study. Twenty one patients had a
positive PCR, so 38.2 % (21/55) of patients
were diagnosed with sepsis by PCR. One
patient with a positive blood culture had a
negative PCR result. Two patients had a
positive PCR in spite of a negative blood
culture. The comparison between the PCR
results and those obtained using BACTEC
reveals a high level of agreement between the
two methodologies, with PCR sensitivity,
specificity, and positive and negative predictive
values of 95.0, 94.3, 90.5, and 97.1%,
respectively.
8
Egyptian Journal of Medical Microbiology, April 2014
Vol. 23, No. 2
Table. Comparison of broad range 16 S rDNA and conventional BACTEC blood culture:
PCR test results
BACTEC blood culture
Total no.
Positive
Negative
19
2
21
Positive
1
33
34
Negative
20
35
55
Total no.
neonates will be difficult to identify by any
method based on detection of bacterial DNA or
growth.(35) Jordan et al.,(36) showed a higher
level of agreement between the two
methodologies when preincubation was
performed before PCR testing. They used 200–
500 microl EDTA-fullblood preincubated at
37°C for 5 hours before PCR-testing, and found
96% sensitivity, 99.4% specificity, and 88.9%
positive and 99.8% negative predictive values
for PCR compared with the culturing of 0.5–1.0
ml full blood with BACTEC 9240. However, a
drawback with this procedure is that only live
bacteria, able to grow in blood culture bottles
will be detected.
Second, a dramatic loss in sensitivity was
observed when we attempted to detect the
bacterial 16S rDNA gene from whole blood
specimens with volumes of appreciably less
than 200 µl. More specifically, culture-positive
blood specimens whose paired samples for PCR
testing had volumes ranging from 25 to 75 µl
lacked detectable levels of the 16S rDNA
gene.This observation led us to establish a
minimum blood volume reqirement of 200 µl
for 16S rDNA PCR testing.(20)
This study reiterates the current problem;
the vast majority of term infants admitted to the
NICU for suspected sepsis are not infected but
have symptoms consistent with those of other
medical conditions that mimic sepsis, such as
hypoglycemia, delayed transition, or transient
tachypnea. Despite this fact, these term infants
was treated with antibiotics for at least 48 hours
while awaiting the results of the preliminary
blood culture report.
Automated blood culturing systems are
good given time, but if a laboratory test could
be developed that would rule out bacterial
septicemia in less time than blood culturing,
those infants whose symptoms had resolved
could be taken off of antibiotics and discharged
from the NICU sooner. NICU admissions and
intravenous antibiotic therapies result in
expensive hospital stays for infants that separate
newborns from their mothers and create
potential difficulties in successful bonding and
breast-feeding, while exposing infants to
antibiotics which are increasingly expensive and
DISCUSSION
Neonatal sepsis is a frequent cause of
morbidity and mortality, defined as clinical
syndrome characterized by systemic signs of
infection and bacteremia in the first month of
life.(28) Neonatal infections currently cause
about 1.6 million deaths annually in developing
countries.(29)
In the present study the diagnosis of
bacterial sepsis in the newborn by PCR revealed
95.0% sensitivity, 94.3% specificity, 90.5%
positive and 97.1% negative predictive value.
The high negative predictive value that was
calculated for the PCR assay compared to that
of culture is indicative of the assay’s usefulness
in accurately ruling out the diagnosis of
bacterial sepsis in the uninfected term neonate
admitted to the NICU for such an evaluation.
While neonatal sepsis was clinically
diagnosed in 55 patients in the study, a
pathogenic bacterium was detected in the blood
culture of only 36.4% of these patients. With the
molecular method of broad range 16S rDNA
PCR, the detection of bacteria improved to
38.2%. Based on the criteria used for the
diagnosis of sepsis, these two methods
combined had a sensitivity of 40.0%.
Two patients tested positive for broad range
bacterial PCR but had negative blood cultures.
The blood cultures may have been negative due
to inadequate amount of blood drawn for
optimal detection of bacteria.(30-32)
Some
investigators found that low-level bacteraemia
(<10 cfu/ml) is far more common (up to 68%)
in paediatric patients than previously believed.
They concluded that it is necessary to collect up
to 4.5% of the patient's blood volume
(approximately 4 ml/kg) in at least two blood
cultures to detect low concentrations of
pathogens in the blood. However, as neonates
are very sensitive to even small losses of blood,
collecting more than 1–2 ml of blood is not an
option for this group of patients.(33,34)
In one patient, blood culture was positive
with a concordant negative PCR result.This
result could reflect the presence of a low level
of live bacteria. Even if improving the detection
limit, low level bacteraemia (<10 cfu/ml) in
9
Egyptian Journal of Medical Microbiology, April 2014
overused. At best these practices increase the
financial burden on our health care system, and
at worst they contribute to the increasingly
serious problem of antibiotic resistance.
Although blood culturing will not be completely
replaced by a nucleic acid amplification
technology anytime soon, as pure isolates
remain essential for antimicrobial drug
susceptibility testing, PCR does appear to be an
excellent diagnostic test choice for a rapid
means of ruling out bacterial sepsis in certain
select patient populations.(20,37)
Vol. 23, No. 2
7.
8.
9.
10.
CONCLUSION
16S rDNA PCR method used in this study
increased the sensitivity in detecting bacterial
DNA in newborns with signs of sepsis. PCR has
potential as a method for earlier detection of
bacteria but this technology needs to be further
developed and improved. Blood culture is
irreplaceable at present, since pure isolates are
essential for antimicrobial drug susceptibility
testing.
11.
12.
REFERENCES
1.
2.
3.
4.
5.
6.
Bizzarro, M.J., Raskind, C., Baltimore,
R.S. and Gallagher, P.G.(2005): Seventy
five years of neonatal sepsis at Yale: 19282003. Pediatrics ,116 (3):595-602.
Osrin, D., Vergnano, S. and Costello, A.(
2004): Serious bacterial infections in
newborn infants in developing countries.
Curr. Opin. Infect. Dis., 17 (3):217-224.
Stoll, B.J., Hansen, N.I., AdamsChapman, I., Fanaroff, A.A., Hintz, S.R.
and Vohr, B.( 2004): Neurodevelopmental
and growth impairment among extremely
low-birth-weight infants with neonatal
infection. JAMA. ,292(19):2357-2365.
Saiman,L. (2013): Infectious diseases of
the fetus and newborn infant. JAMA., 307
(17):1865-1866.
Gladstone, I.M., Ehrenkranz, R.A.,
Edberg, S.C. and Baltimore, R.S.(1990):
A tenyear review of neonatal sepsis and
comparison with the previous fifty-year
experience. Pediatr. Infect. Dis. J., 9
(11):819-825.
Lawn, J.E.,Wilczynska-Ketende, K. and
Cousens, S.N.(2006): Estimating the
causes of 4 million neonatal deaths in the
year 2000. Int.J. Epidemiol. ,35(3):706618.
13.
14.
15.
16.
17.
18.
10
Afroza, S. ( 2006): Neonatal sepsis: a
global problem: an overview. Mymensingh
Med. J.,15(1):108-114.
Ng, P.C. (2004): Diagnostic markers of
infection in neonates. Arch. Dis. Child
Fetal Neonatal Ed.,89(3):229-235.
Mishra, U.K., Jacobs, S.E., Doyle, L.W.
and Garland, S.M. (2006): Newer
approaches to the diagnosis of early onset
neonatal sepsis. Arch. Dis. Child Fetal
Neonatal Ed., 91(3):208-212.
Thomas, R.E. and Baker, P.( 1995): A
cost-outcome description of the septic
work-up for bacterial infection in neonates
in a tertiary care hospital. Intl. J. of
Technology
Assessment
in
Health
Care,11:11-25.
Laforgia, N., Coppola, B., Carbone, R.,
Grassi, A., Mautone, A. and Iolascon, A.
(1997): Rapid detection of neonatal sepsis
using polymerase chain reaction. Acta.
Paediatr., 86:1097-1099.
Stoll, B.J., Hansen, N.I., Sánchez, P.J.,
Faix, R.G., Poindexter, B.B., Van Meurs,
K.P., Bizzarro, M.J., Goldberg, R.N.,
Frantz, I.D. , Hale, E.C., Shankaran, S.,
Kennedy, K., Carlo, W.A., Watterberg,
K.L., Bell, E.F., Walsh, M.C., Schibler,
K., Laptook, A.R., Shane, A.L., Schrag,
S.J., Das, A. and Higgins, R.D. (2011):
Early onset neonatal sepsis: the burden of
group B Streptococcal and E. coli disease
continues. Pediatrics,127(5):817-826.
Beverly, S., Brozanski, B. S. (2003):
Prevention of Early-onset GBS Sepsis:
Evaluation of a Changing Paradigm. J. of
Perinatology, 23: 263–264.
Gerdes, J.S. (1991): Clinicopathologic
approach to the diagnosis of sepsis. Clinics
in Perinatology, 18:361-381.
Mylotte, J. M. and Tayara, A. (2000):
Blood Cultures: Clinical Aspects and
Controversies. Eur. J. Clin. Microb. Infect.
Dis., 19 (3): 157-163
Jacobs, R.F., Sowell, M.K., Moss, M.and
Fiser, D.H. (1990): Septic shock in
children: bacterial etiologies and temporal
relationships. Pediatr. Infect. Dis. J., 9:196200.
Richardson,G.J.,
McCormck,
D.K.,
Workman, K. and Goldmann, D.A.
(1993): Score for Neonatal Acute
Physiology: a physiologic index for
neonatal intensive care. Pediatrics, 91:617623.
Saez-Liorenz, X., Vargas, S., Guerra, F.
and Coronado, L. (1995): Applications of
new sepsis definitions to evaluate outcome
Egyptian Journal of Medical Microbiology, April 2014
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
of pediatric patients with severe systemic
infections. Pediatr. Infect. Dis. J., 14:557561.
Connel. T.G., Rele, M., Cowley, D.,
Buttery, J.P. and Curtis, N. (2007): How
reliable is a negative blood culture result?
Volume of blood submitted for culture in
routine practice in a children's hospital.
Pediatrics, 119:891-896.
Jordan, J.A., Durso, M.B., Butchko,
A.R., Jones, K.G.and Brozanski, B.S.
(2006): Evaluating the near-term infant for
early onset sepsis: progress and challenges
to consider with 16S rDNA polymerase
chain reaction testing. J. Mol. Diagn.,
8:357-363.
Silveira, R.C., Schlabendorff, M. and
Procianoy, R.S. (2001): Predictive value
of SNAP and SNAP-PE for neonatal
mortality. J. Pediatr., 77:455-460.
Fredricks, D. N. and Relman, D. A.
(1999): Application of polymerase chain
reaction to the diagnosis of infectious
diseases. CID., 29, 475–488.
Doolittle, W. F. (1999): Phylogenetic
classification and the universal tree.
Science 284, 2124–2128.
Drancourt, M., Bollet, C., Carlioz, R.,
Martelin, R., Gayral, J. P. and Raoult, D.
(2000): 16S ribosomal DNA sequence
analysis of a large collection of
environmental and clinical unidentifiable
bacterial isolates. J. Clin. Microbiol., 38:
3623–3630.
Janda, J.M. and Abbott, S.L. (2002):
Bacterial identification for publication:
when is enough enough? J. Clin. Microbiol.
40: 1887–1891.
Baker, G.C., Smith, J.J.and Cowan, D.A.
(2003): Review and re-analysis of domainspecific 16S primers. J. Microbiol.
Methods, 55:541-55.
Heininger, A., Binder, M., Ellinger, A.,
Pfisterer, J., Botzenhart, K., Unertl, K.
and Doering, G. (2004): Effect of
comprehensive validation of the template
isolation procedure on the reliability of
bacteraemia detection by a 16S r RNA gene
PCR. Clin. Microbiol. Infect., 10:452-458.
Gjini, A.B., Stuart, J.M., Cartwright, K.,
Cohen, J., Jacobs, M., Nichols, T., Ninis,
N., Prempeh, H., Whitehouse, A. and
Heyderman, R.S. (2006): Quality of inhospital care for adults with acute bacterial
Vol. 23, No. 2
29.
30.
31.
32.
33.
34.
35.
36.
37.
11
meningitis: a national retrospective survey.
QJM., 99(11):761-769.
Vergnano, S., Sharland, M., Kazembe,
P., Mwansambo, C .and Heath, P.
(2005): Neonatal sepsis: an international
perspective.
Arch. Dis. Child. Fetal
Neonatal Ed., 90 (3): 220–224.
Chiesa, C., Panero, A., Osborn, J.F.,
Antonella F. Simonetti, A. F., and Lucia
Pacifico, L.(2003): Diagnosis of Neonatal
Sepsis: A Clinical and Laboratory
Challenge. Clin. chem. 50 (2): 279-287.
Gonsalves,W. I., Cornish,N., Moore, M.,
Chen, A. and Varman,M.(2009): Effects
of Volume and Site of Blood Draw on
Blood Culture Results. J. Clin. Microbiol.,
47(11): 3482–3485.
Buttery, J. P. (2002): Blood cultures in
newborns and children: optimising an
everyday test. Arch. Dis. Child Fetal
Neonatal Ed., 87:25–28
Kellogg, J.A.,
Manzella,J.P. and
Bankert, D.A. (2000): Frequency of LowLevel Bacteremia in Children from Birth to
Fifteen Years of Age. J. Clin. Microbiol. ,
38(6): 2181–2185.
Kellogg,
J.A.,
Ferrentino,
F.L.,
Goodstein, M.H., Liss, J., Shapiro, S.L.
and Bankert, D.A. (1997): Frequency of
low-level bacteriemia in infants from birth
to two months of age. Pediatr. Infect. Dis.
J., 16:381-385.
Nilsen, T.R., Farstad, T., Britt Nakstad,
B., Vigdis Lauvrak, V, and Steinbakk,
M. (2009): Comparison of broad range 16S
rDNA PCR and conventional blood culture
for diagnosis of sepsis in the newborn: a
case control study. BMC Pediatrics, 9:1-8.
Jordan, J.A., Durso, M.B., Butchko,
A.R., Jones, K.G. and Brozanski, B.S.
(2006): Evaluating the near-term infant for
early onset sepsis: progress and challenges
to consider with 16rDNA polymerase chain
reaction testing. J. Mol. Diagn., 8:357-363.
Liu, C.L. Ai, H.W., Wang, W.P., Chen,
L., Hu, H.B. , Ye, T. , Zhu, X.H., Wang,
F., Liao, Y.L., Wang, Y., Ou, G., Xu, L.
, Sun, M., Jian, C. , Chen, Z.J. , Li, L.,
Zhang, B. , Tian, L. , Wang, B., Yan, S.
and Sun, Z.Y. (2014): Comparison of 16S
rRNA gene PCR and blood culture for
diagnosis of neonatal sepsis. Archives de
Pédiatrie. 21(2) : 162–169
‫‪Vol. 23, No. 2‬‬
‫‪Egyptian Journal of Medical Microbiology, April 2014‬‬
‫مقارنة بين التفاعل التسلسلي البوليميريزي باستخدام ‪16‬اس ريبوسومال د ن أ واسع المجال‬
‫وجهاز الباكتك لتشخيص تلوث الدم البكتيري في األطفال حديثي الوالدة‬
‫صفاء محمد العجيري‪ ,1‬هويدا نبيه فؤاد مهران‪ ,2‬سمية السيد‬
‫هدهود‪3‬‬
‫قسم الميكروبيولوجي والمناعة الطبية‪-‬كلية الطب‪ -‬جامعة المنصورة ‪ ,‬قسم تقنية المختبرات الطبية‪ -‬كلية العلوم الطبية‬
‫التطبيقية‪ -‬جامعة طيبة‪ ،1‬قسم الطب الشرعي‪-‬وزارة العدل‪-‬االسكندرية ‪ ,‬قسم تقنية المختبرات الطبية‪ -‬كلية العلوم الطبية‬
‫‪3‬‬
‫التطبيقية‪ -‬جامعة طيبة‪ ،2‬قسم األطفال‪ -‬كلية الطب‪ -‬جامعة سوهاج‪ ,‬قسم األطفال‪ -‬كلية الطب‪ -‬جامعة طيبة‬
‫الخلفية‪ :‬يعتبر تلوث الدم البكتيري من المضاعفات المخيفة التي تصيب األطفال حديثي الوالدة‪ .‬ولذلك يعطى هؤالء األطفال‬
‫مضادات حيوية قوية فور تشخيصهم إكلينيكيا بوحدة العناية المركزة لألطفال حديثي الوالدة (الحضانة) وذلك لحين التأكد من‬
‫التشخيص معمليا‪ .‬وتعتبر مزرعة الدم هي الطريقة القياسية والذهبية لتشخيص تلوث الدم البكتيري‪ ,‬ولكن تعتبرحساسية هذه‬
‫الطريقة قليلة‪ .‬ولذلك تمثل إختبارات االبيولوجيا الجزيئية لكشف الحامض النووي البكتيري وسيلة حديثة للتشخيص المبكر‪.‬‬
‫الهدف من البحث‪ :‬مقارنة بين التفاعل التسلسلي البوليميريزي باستخدام ‪16‬اس ريبوسومال د ن أ واسع المجال بدون تحضين‬
‫وجهاز الباكتك للتشخيص المبكر لتلوث الدم البكتيري في األطفال حديثي الوالدة‪.‬‬
‫خطوات البحث‪ :‬اشتملت هذه الدراسة على ‪ 55‬طفل حديثي الوالدة مشخصين اكلينيكيا بتلوث الدم البكتيري بالحضانة‪ .‬وقد تم‬
‫التشخيص المعملي لكل طفل منهم باستخدام كل من التفاعل التسلسلي البوليميريزي باستخدام ‪16‬اس ريبوسومال د ن أ واسع‬
‫المجال بدون تحضين ومزرعة الدم باستخدام جهاز الباكتك‪.‬‬
‫النتائج‪ :‬تم التأكد من التشخيص معمليا لعشرين طفال عن طريق مزرعة الدم باستخدام جهاز الباكتك ولواحد وعشرين طفل‬
‫باستخدام التفاعل التسلسلي البوليميريزي باستخدام ‪16‬اس ريبوسومال د ن أ واسع المجال‪ .‬وقد وجد أن التفاعل التسلسلي‬
‫البوليميريزي كان سلبيا في واحد من األطفال المشخصين ايجابيا بمزرعة الدم‪ ,‬وكانت المزرعة سلبية في اثنان من األطفال‬
‫المشخصين اي جابيا بالتفاعل التسلسلي البوليميريزي‪ .‬وقد وجد أن استخدام كلتا الطريقتين سويا بالمعمل تزيد من حساسية‬
‫التشخيص المعملي إلى ‪.%40‬‬
‫االستنتاج‪ :‬يعتبر استخدام التفاعل التسلسلي البوليميريزي باستخدام ‪16‬اس ريبوسومال ر د ن أ واسع المجال طريقة أسرع من‬
‫الطرق التقليدية باستخدام مزرعة الدم للتشخيص المعملي ولكنه اليمكن االستغناء عن التشخيص المعملي بمزارع الدم ألنها‬
‫تحدد نوع البكتيريا ومنها تجرى مزرعة الحساسية للميكروب لتحديد المضادات الحيوية المناسبة‪.‬‬
‫‪12‬‬