Research Article
Gene Transfer–Mediated Pre-mRNA Segmental Trans-splicing As
a Strategy to Deliver Intracellular Toxins for Cancer Therapy
Katsutoshi Nakayama, Robert G. Pergolizzi, and Ronald G. Crystal
Department of Genetic Medicine, Weill Medical College of Cornell University, New York, New York
These DNA sequences include a 5V donor sequence that includes a
promoter and coding sequences of the NH2-terminal portion of the
toxin protein of interest, and a 3V acceptor sequence that includes a
promoter and coding sequences of the COOH-terminal portion of
the toxin protein. The 3V end of the donor fragment and 5V end of
the acceptor fragment contain complementary foreign hybridization sequences that facilitate subsequent spliceosome-mediated
trans-splicing of the two pre-mRNA fragments into a mature
mRNA that is then exported from the nucleus.
The present study is focused on the use of STS to deliver an
intracellular toxin to treat cancer. As an example, we have used
STS to deliver the 1A1 component of Shigatoxin, a potent
intracellular toxin produced by Shigella dysenteriae and some
strains of Escherichia coli (4). The toxin is a multisubunit protein
made up of one molecule of the A subunit responsible for the
toxicity of the protein, and five molecules of the B subunit
responsible for binding to a specific cell type. Once inside the cell,
the A subunit, an N-glycosidase which modifies the RNA
component of the ribosome to inactivate it, causes the cessation
of protein synthesis and death of the cell, primarily by apoptosis
(5). Removing the coding sequence for the B subunit ensures that
any subunit A produced by a cell will remain intracellular, and have
no effect systemically. In this report, we show the utility of STS for
the generation of intracellular toxins by assembling the Shigatoxin
A subunit mRNA from nontoxic pre-mRNA segments delivered to
tumor cells via adenovirus vectors.
Abstract
Virus-mediated transfer of genes coding for intracellular
toxins holds promise for cancer therapy, but the inherent
toxicity of such vectors make them a risk to normal tissues
and a challenge to produce due to the intrinsic dilemma that
expression of toxin molecules kills producer cells. We
employed pre-mRNA segmental trans-splicing (STS), in which
two engineered DNA fragments coding for 5V ‘‘donor’’ and 3V
‘‘acceptor’’ segments of a toxin gene, respectively, are
expressed by viral vectors. When co-delivered to target cells,
the two vectors generate two toxin pre-mRNA fragments which
are spliced by the target cell machinery to produce functional
mRNA and toxin. To test this approach, we used an enzymatic
fragment of Shigatoxin1A1 (STX1A1) known to provoke
apoptotic cell death. Two adenovirus vectors, Shigatoxin1A1
donor (AdStx1A1Do) and Shigatoxin1A1 acceptor (AdStx1A1Ac), respectively, were used to deliver the Stx1A1 gene
fragments. HeLa, HEp2, and A549 cells transfected with
AdStx1A1Do and AdStx1A1Ac had a dose-dependent reduction
in viability and inhibition of protein synthesis. Intratumoral
injection of AdStx1A1Do and AdStx1A1Ac into preexisting
HeLa, Hep2, and A549 tumors in immunodeficient mice
revealed significant inhibition of tumor growth. There was
no evidence of liver damage, suggesting that there was no
leakage of vector or toxin from the site of injection following
intratumoral injection of AdStx1A1Do and AdStx1A1Ac. These
results suggest that the obstacles preventing gene transfer of
intracellular toxins for local cancer therapy could be
overcome by pre-mRNA segmental trans-splicing. (Cancer Res
2005; 65(1): 254-63)
Materials and Methods
Cell Culture. The human cervical carcinoma cell line HeLa, human
epidermoid carcinoma cell line HEp2, and the lung carcinoma cell line A549
[American Type Culture Collection (ATCC), Manassas, VA; CCL-2, CCL-23,
and CCL-185, respectively] were cultured as described in the ATCC
instructions. All media and supplements were from Life Technologies
(Gaithersburg, MD) unless otherwise noted.
Adenovirus Vectors Expressing Shigatoxin Fragments. Shigatoxin1A1
(Stx1A1; Genbank #AE005174) is an enzymatic fragment of Shigatoxin1
(Stx1) derived from the pathogenic E. coli O157:H7 strain (ATCC 700927;
ref. 6). Stx1A1 acts as a specific N-glycosidase, cleaving a single adenine
residue from 28S rRNA, thereby provoking the inhibition of protein
synthesis and cell death (7–9). For eukaryotic cytoplasmic expression of
Stx1A1 fragments from adenovirus vectors, the bacterial signal sequence
was eliminated and an optimized Kozak motif and ATG (start) codon
were added. Based on a report suggesting that Stx1A2, the linker region
between Stx1A1 and Stx1B (the targeting domain), inhibits the activity of
Stx1A1, the Stx1A2 region was deleted (10, 11). A synthetic Stx1A1 gene
was constructed that encodes the native amino acid sequence but uses
human-preferred codons (12). In addition, Stx1A1 coding sequences were
selectively changed so they would not be inappropriately recognized by
the splicing apparatus. The final sequence encoding Stx1A1, comprised of
the start codon followed by amino acids 2 to 245, was inserted into
pcDNA3.1, and sequenced through ligation sites to confirm the identity of
each clone. All plasmids were prepared with Mini or Maxi kits (Qiagen,
Valencia, CA), according to the manufacturer’s protocol.
Introduction
Although there is considerable interest in the use of gene
transfer vectors to deliver intracellular toxins as potential
therapeutic agents for cancer, the development of this strategy
has been hampered by the inherent toxicity of viral vectors coding
for toxins (1). In this regard, not only is it a difficult challenge to
produce such vectors (attempts to produce a vector coding for an
intracellular toxin have been thwarted because the toxin kills the
producer cells), but if such vectors inadvertently escape from the
tumor they would be inherently dangerous to normal tissues (2).
To circumvent this challenge, we have employed a strategy called
‘‘segmental trans-splicing’’ (STS), a process in which two engineered individual DNA fragments coding for 5V and 3V fragments of
pre-mRNA of a toxin gene are delivered to mammalian cells (3).
Requests for reprints: Ronald G. Crystal, Department of Genetic Medicine, Weill
Medical College of Cornell University, 515 East 71st Street, S-1000, New York, NY 10021.
Phone: 212-746-2258; Fax: 212-746-8383; E-mail: [email protected].
I2005 American Association for Cancer Research.
Cancer Res 2005; 65: (1). January 1, 2005
254
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Segmental Pre-mRNA Trans-Splicing Delivery of Intracellular Toxins
Stx1A1 cDNA, and a polyA signal from bovine growth hormone. Specific
details of the trans-splicing sequence elements have been previously
described (3).
Adenovirus vectors were created to deliver the two fragments of the
Stx1A1 gene. The recombinant adenovirus vectors Shigatoxin1A1 donor
(AdStx1A1Do), Shigatoxin1A1 acceptor (AdStx1A1Ac) and null (AdNull), are
replication-deficient, E1, E3 serotype 5 vectors, with the expression cassette
in the E1 position. The Stx1A1 donor and acceptor expression cassettes
were developed as adenovirus vectors using the pAdEasy system
(Stratagene, La Jolla, CA). The AdNull vector is identical to AdStx1A1Do
or AdStx1A1Ac, except that it lacks an expression cassette. The vectors were
propagated in 293 cells (human embryonic kidney, ATCC), purified by two
rounds of cesium chloride density gradient ultracentrifugation, dialyzed,
and stored at -708C as previously described (13, 14). All vector doses were
The engineered trans-splicing junction of the humanized Stx1A1 gene
was located between G374 and G375 (Fig. 1, asterisk). The donor and
acceptor STS constructs were designed so that the resulting pre-mRNAs
would hybridize, and the nuclear spliceosome apparatus would transsplice the resulting hybridized pre-mRNAs into mature, humanized
Stx1A1 mRNA. Final elements in the plasmid Stx1A1 STS constructs
used to create the adenovirus vectors included: (1) donor (pStx1A1Do,
5V-3V) containing the cytomegalovirus immediate early promoter/enhancer, the 5V portion of Stx1A1 cDNA, the 5V portion of vascular
endothelial growth factor (VEGF) intron 6, a unique hybridization
domain and poly-adenylation signal; and (2) acceptor (pStx1A1Ac; 5V-3V)
containing the cytomegalovirus promoter/enhancer, and hybridization
domain complementary to the hybridization domain of the
donor construct, the 3V portion of VEGF intron 6, the 3V fragment of
Figure 1. Schematic illustration of the genomic configuration and strategy for STS of Stx1A1 genes. The genomic organization of the Stx1A1 gene (enzymatic unit of
Stx1) is shown at the top, with the scale of the diagram indicated by a size bar. The signal peptide, linker (Stx1A2) and binding unit (Stx1B) were removed to ensure
uniquely intracellular expression of Shigatoxin activity. Humanization of Stx1A1 was used for generation of STS adenovirus vectors. In the STS constructs, the 5V
fragment is termed the donor and the 3V fragment is the acceptor. AdStx1A1Do construct contains (5V-3V) cytomegalovirus immediate early promoter/enhancer, 5V
portion of Stx1A1 cDNA, 5Vportion of VEGF intron 6 and hybridization domain. The adenovirus AdStx1A1Ac contains cytomegalovirus promoter/enhancer, hybridization
domain complementary to the hybridization domain of the donor construct, 3V portion of VEGF intron 6, 3V fragment of Stx1A1 cDNA, and poly-adenylation signal.
*, location of the trans-splicing junction. Below the constructs are shown schematics of the predicted pre-mRNAs, with the splice donor, branch point, and splice
acceptor sites, as well as the complementary hybridization domains. The final STS spliced mRNA is as indicated at the bottom. The location of primer pairs
(PF and PR) used for PCR are indicated.
www.aacrjournals.org
255
Cancer Res 2005; 65: (1). January 1, 2005
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
used according to the manufacturer’s instructions. HeLa, HEp2, and A549
cell were seeded at 5 103 in 96-well plates in culture medium. After
overnight culture and counting, each cell line was infected with adenovirus
vectors AdNull, AdStx1A1Do + AdNull (1:1), AdStx1A1Ac + AdNull (1:1), or
AdStx1A1Do + AdStx1A1Ac (1:1). To assess the dose response of
AdStx1A1Do + AdStx1A1Ac on induction of apoptotic cell death, we also
prepared cells infected with AdStx1A1Do + AdStx1A1Ac + AdNull at ratios
of 1:1:48, or 1:1:8. All infections were done for 90 minutes with a total dose
of adenovirus maintained at 104 pu/cell. Each cell line was also treated with
Shigatoxin protein (100 ng/mL), and cisplatin (20 AM) as positive apoptotic
controls (13). Results for the negative control (medium) were set to 10, and
all other measurements normalized to the control for purposes of
comparison.
Loss of Cells. To assess the impact of adenovirus-mediated STS of
Stx1A1 on cell number, in vitro cell counts were determined daily. HeLa and
A549 cells were seeded at 2.5 104 in 6-well plates. After overnight culture
and determination of total cell number, each cell line was infected with
adenovirus vectors as described above at a dose of 104 pu/cell for 90
minutes. Cells were harvested using 0.05% trypsin, 0.53 mmol ethylenediamine tetraacetic acid (pH 7.4), on the indicated days after infection, and
the number of viable cells determined by the trypan blue exclusion method,
using a final concentration of 0.2% for 5 minutes and counted using a
hemocytometer.
expressed in particle units (pu) determined spectrophotometrically as
described by Mittereder et al. (15).
Adenovirus enhanced green fluorescent protein (eGFP) vectors were
prepared as previously described (16). To ensure that HeLa, HEp2, and A549
cell lines were equally responsive to infection with adenovirus vectors, the
cells were infected with adenovirus eGFP at a dose of 104 pu/cell, and
analyzed after 24 and 48 hours by fluorescent microscopy and flow
cytometry.
In vitro Expression of Stx1A1 mRNA by Adenovirus-Mediated STS.
To evaluate the expression of segmental trans-spliced Stx1A1, HeLa cells
were seeded at 1.5 105 cells/well in 24-well plates. After overnight
culture, cells were counted and infected with the adenovirus vectors
alone or in combination. All infections were done at a total dose of
8,000 pu/cell for 90 minutes. Sixteen hours after infection, total RNA
was isolated using Trizol (Invitrogen, Carlsbad, CA) and reversetranscribed (SuperScript First-Strand Synthesis System for reverse
transcription-PCR, Invitrogen) after oligo dT priming. PCR was done
with Platinum Taq DNA polymerase (Invitrogen). To detect the Stx1A1
mRNA production in vitro from adenovirus-mediated STS, primers PF
and PR,which span the trans-splicing junction (Fig. 1) were used. Primer
sequences were as follows: primer PF (CGCGGATCCGCCATGGAGTTCACCCTGGACTTCAG); primer PR (CCAGTTCAGGGTGAGATCGACGTCCTCGGCGGTC). PCR amplification (30 cycles) was carried
out at 948C for 30 seconds, 628C for 30 seconds, and 728C for 1 minute
followed by final extension at 728C for 5 minutes, and analyzed by
agarose gel electrophoresis. To assess the fidelity of adenovirus-mediated
STS, the reverse transcription-PCR products were purified by gel
extraction kit (QIAquick gel extraction kit; Qiagen), and sequenced.
Suppression of Tumor Growth by STS of the Stx1A1 Gene In vivo .
Six- to eight-week-old female BALB/c nu/nu mice, and BALB severe
combined immunodeficient mice (SCID) mice were obtained from Jackson
Laboratory (Bar Harbor, ME) and/or Taconic Laboratory (Germantown,
NY). To evaluate the expression of segmental trans-spliced Stx1A1 mRNA
in vivo, tumors were established in BALB/c nu/nu mice by s.c. injection of
5 106 A549 cells and allowed to grow for 7 days. When tumors were
established, adenovirus Stx1A1 STS vectors were administered directly into
the tumor. Twenty-four hours later, tumors and livers were harvested and
total RNA extracted from approximately 100 mg of tissue by homogenization in Trizol (Invitrogen) and reverse-transcribed as described above. To
detect the in vivo mRNA production of Stx1A1 by adenovirus-mediated
STS, reverse transcription-PCR was done with primers PF and PR as
described for the in vitro analysis of Stx1A1 mRNA expression (above).
Reverse transcription-PCR products were electrophoresed and purified
using a gel extraction kit (QIAquick gel extraction kit; Qiagen), and
sequenced.
Morphologic Assessment. To assess the impact of adenovirus-mediated
STS of Stx1A1 on morphology of target cells in vitro, HeLa cells were seeded
at 105 cells/well in 24-well plates. After overnight culture, cells were counted
and infected with adenovirus vectors, AdNull, AdStx1A1Do + AdNull,
AdStx1A1Ac + AdNull or AdStx1A1Do + AdStx1A1Ac. Ratios of mixed
vectors were 1:1. All infections were done for 90 minutes with the total
infection dose of adenovirus maintained at 104 pu/cell. Sixteen hours later,
morphology was analyzed by phase-contrast using an Olympus IX70
microscope (Olympus, Tokyo, Japan).
Cell Viability. To estimate the impact of adenovirus-mediated STS of
Stx1A1 on cell viability in vitro, the CellTiter 96 AQueous One Solution Cell
Proliferation Assay Kit (Promega, Madison, WI) was used according to the
manufacturer’s instructions. HeLa, HEp2, or A549 (3 103 each) were
seeded in 96-well culture plates. After overnight culture and counting, each
cell line was infected with adenovirus vectors AdNull, AdStx1A1Do +
AdNull, AdStx1A1Ac + AdNull, or AdStx1A1Do + AdStx1A1Ac. Infection
was done at a dose of 104 pu/cell for 90 minutes. Ratios of mixed vectors
were 1:1. Uninfected cells (medium only, negative control) or incubation
with 100 ng/mL Shigatoxin protein (positive control) were analyzed at the
same time. At the indicated day after infection (0, 1, 2, 3, or 4), the cells
were washed once in culture medium, and 20 L of reagent solution was
added to each well of the 96-well plate. After incubation at 378C in a
humidified 5% CO2 incubator for 1 hour, the absorbance at 490 nm was
recorded using a 96-well plate reader (model 680, Bio-Rad, Hercules, CA).
Data points for the negative control (medium) at day 4 were set to 100, and
all other measurements were normalized to that control for purposes of
comparison.
To assess the effect of adenovirus-mediated STS of Stx1A1 on
suppression of tumor growth in vivo, human tumor cells (107 HeLa, 107
HEp2, or 5 106 A549 cells) were injected s.c. into the flanks of
immunodeficient mice (HeLa and HEp2 into BALB SCID, A549 into BALB/c
nu/nu mice). Seven days later, tumors of comparable size (approximately
40 mm2 for HeLa and HEp2, and 30 mm2 for A549) were established. The
tumors were then injected with adenovirus STS vectors or PBS (pH 7.4),
intratumorally in an 80 AL volume thrice (days 0, 5, and 10). Tumor size was
measured in a blinded fashion with calipers every 2 to 3 days and recorded
as the product of width length (tumor area, mm2).
Assessment of Systemic Toxicity. To evaluate systemic toxicity which
might be induced by the adenovirus vector–based STS Shigatoxin delivery
strategy administered to the tumors, liver damage was assessed based on
the knowledge that > 90% of adenovirus vectors that reach the systemic
circulation localize to the liver (18–20). To accomplish this, the levels of
serum alanine aminotransferase and serum aspartate aminotransferase
were quantified in BALB/c nu/nu mice bearing injected A549 cell tumors
receiving intratumoral injection of AdStx1A1Do and AdStx1A1Ac. Mice
were bled from the tail vein (100 AL) pre-intratumoral, 2, and 5 days
post-intratumoral administration of AdStx1A1Do and AdStx1A1Ac. The
blood samples were centrifuged (3,000 g, 20 minutes) and sera were
collected. The levels of alanine aminotransferase and aspartate aminotransferase in each sample were analyzed (IDEXX Laboratories, West
Sacramento, CA).
Inhibition of Protein Synthesis. To assess inhibition of protein
synthesis by adenovirus-mediated STS of Stx1A1, cells grown in 24-well
plates were analyzed for [3H]leucine incorporation, using HeLa, HEp2 and
A549 cells seeded at 105 cells/well in 24-well plates (17). After overnight
culture and counting, each cell line was infected with adenovirus Stx1A1
STS vectors at a dose of 104 pu/cell. Results for the negative control
(medium) were set to 100, and all other measurements were normalized to
that control for purposes of comparison (percentage of control).
Induction of Apoptosis. To detect cell death via apoptosis induced by
adenovirus-mediated STS of Stx1A1, a cell death detection ELISA assay kit
(Cell Death Detection ELISA plus, Roche Applied Science, Nutley, NJ) was
Cancer Res 2005; 65: (1). January 1, 2005
Statistical Analysis. Results are expressed as mean F SD, except for
tumor areas in the in vivo tumor growth suppression experiments, in which
256
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Segmental Pre-mRNA Trans-Splicing Delivery of Intracellular Toxins
or AdStx1A1Do + AdStx1A1Ac, respectively. When reverse transcriptase was included, no amplification was detected from cells
infected with AdNull, AdStx1A1Do + AdNull, or AdStx1A1Ac +
AdNull (lanes 5-7). However, RNA from cells infected with
AdStx1A1Do + AdStx1A1Ac showed the anticipated product of
621 bp (lane 8), as did the control plasmid (lane 9). To assess the
fidelity of Stx1A1 STS, the reverse transcription-PCR products from
cells infected with AdStx1A1Do and AdStx1A1Ac (lane 8) were
purified and sequenced (Fig. 2B). The observed sequence across the
splice junction was identical to that of the intact Stx1A1 gene,
indicating that adenovirus-mediated STS can produce intact
Stx1A1 mRNA in HeLa cells.
To evaluate the cytotoxic potential of adenovirus-mediated STS
of Stx1A1 in vitro, the HeLa, HEp2, and A549 cell lines were
analyzed for their response to infection. HeLa and HEp2 cells have
receptors for Shigatoxin protein and are sensitive to external
Shigatoxin protein, whereas A549 cells do not express Shigatoxin
receptors, and are therefore resistant to external Shigatoxin protein (18, 21–23). All of these cell lines can be readily infected by
results are expressed as mean F SE. Statistical comparisons were made
using the unpaired two-tailed Student’s t test.
Results
Cell Death Mediated by Adenovirus Stx1A1 STS In vitro. As a
prelude to targeting tumor cells in vivo, it was necessary to show
that Stx1A1 gene segments delivered by STS could be co-expressed
in target cells, combine to form the functional Stx1A1 gene product
and kill cells. To determine whether adenovirus-mediated STS of
Stx1A1 was able to direct the synthesis of intact Stx1A1 mRNA,
HeLa cells were infected with adenovirus Stx1A1 STS vectors alone
or in combination. RNA isolated from the infected cells was
analyzed by reverse transcription-PCR using primers (PF and PR,
Fig. 1), which would only produce a product if trans-splicing had
occurred (Fig. 2A). Lanes 1 to 4 show the result of omission of
reverse transcriptase from the reverse transcription-PCR reaction,
and as expected, no products were observed in RNA from cells
infected with AdNull, AdStx1A1Do + AdNull, AdStx1A1Ac + AdNull,
Figure 2. Adenovirus-mediated Stx1A1 STS produces intact Stx1A1
mRNA in vitro and in vivo . A, evaluation of Stx1A1 STS in vitro by
reverse transcription-PCR. Analysis was carried out on total RNA from
HeLa cells with primers PF and PR (Fig. 1) 16 hours after infection with
the adenovirus vectors (8,000 pu). To show that RNA and not DNA
was amplified, a set of control reactions were done without the addition
of reverse transcriptase; these controls are shown in lanes 1 to 4. Lane
1, null adenovirus vector (AdNull); lane 2, AdStx1A1Do + AdNull; lane
3, AdStx1A1Ac + AdNull; lane 4, AdStx1A1Do + AdStx1A1Ac. In the
presence of reverse transcriptase, trans-spliced Stx1A1 mRNA yields
a reverse transcription-PCR product of 621 bp. Lanes 5 to 8 show the
results of reverse transcription-PCR amplification as in lanes 1 to 4,
but with reverse transcriptase included: lane 5, AdNull; lane 6,
AdStx1A1Do + AdNull; lane 7, AdStx1A1Ac + AdNull; lane 8,
AdStx1A1Do + AdStx1A1Ac. Lane 9 shows reverse transcription-PCR
(including reverse transcriptase) of intact humanized Stx1A1 plasmid
(positive control). Reverse transcription-PCR products were visualized
on ethidium bromide agarose gels. B, sequence of the reverse
transcription-PCR product of Stx1A1 STS isolated from HeLa cells
infected with AdStx1A1Do + AdStx1A1Ac (A, lane 8). The data shows
the sequence around the splice junction (asterisk in Fig. 1) in the
forward orientation. The observed sequence is identical to the
expected sequence. C, reverse transcription-PCR analysis of Stx1A1
expression in tumor cells from mice receiving intratumor injections with
Stx1A1 donor and acceptor adenoviruses. A549 flank tumors were
established in BALB/c nude (nu /nu ) mice by s.c. injection of 5 106
A549 cells and allowed to grow for 7 days. Adenovirus Stx1A1 STS
vectors or PBS were delivered intratumorally. Animals received
AdStx1A1Do + AdStx1A1Ac (total 5 1010 pu); AdStx1A1Do + AdNull
(total 5 1010 pu); AdStx1A1Ac + AdNull (total 5 1010 pu); AdNull
alone (5 1010 pu), or PBS. Tissues were harvested after 24 hours.
Reverse transcription-PCR controls were as described above for A ,
and are shown in lanes 1 to 4: lane 1, AdNull; lane 2, AdStx1A1Do +
AdNull; lane 3, AdStx1A1Ac + AdNull; lane 4, AdStx1A1Do +
AdStx1A1Ac. In the presence of reverse transcriptase, trans-spliced
Stx1A1 mRNA yields an reverse transcription-PCR product of 621 bp.
Lanes 5 to 8 show the results of reverse transcription-PCR
amplification as in lanes 1 to 4, but with reverse transcriptase included:
lane 5, AdNull; lane 6, AdStx1A1Do + AdNull; lane 7, AdStx1A1Ac +
AdNull; lane 8, AdStx1A1Do + AdStx1A1Ac. Lane 9, reverse
transcription-PCR (including reverse transcriptase) of intact
humanized Stx1A1 plasmid (positive control).
www.aacrjournals.org
257
Cancer Res 2005; 65: (1). January 1, 2005
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
positive control for apoptotic cell death in A549 cells, the cells
were treated with cisplatin [(sp-4-2)-diamminedichloroplatinum
(20 AM)], previously reported to kill cells in this manner (24).
HeLa and HEp2 cells infected with AdStx1A1Do + AdStx1A1Ac
revealed dose-dependent apoptotic DNA fragmentation (Fig. 4D
and E). The degree of relative apoptotic DNA fragmentation on
the cells infected with AdStx1A1Do + AdStx1A1Ac at the
maximum dose [AdStx1A1Do + AdStx1A1Ac (1:1)] was similar
to that seen in HeLa and HEp2 cells treated with Shigatoxin
protein. However, A549 cells infected with AdStx1A1Do +
AdStx1A1Ac revealed no apoptotic DNA fragmentation (Fig. 4F),
suggesting that more than one mechanism of cell killing may be
operative in Stx1A1 STS. Because the process of STS involves the
formation of a double-stranded RNA intermediate, it is conceivable that the double-stranded RNA-regulated serine/threonine
protein kinase could be induced, leading to apoptosis independently of Shigatoxin A (25, 26). This phenomenon was ruled out
in control experiments using cDNA for GFP with hybridization
domain sequences identical to those used in the current study.
Delivery to the liver of trans-splicing GFP vectors revealed liver
GFP expression without any increases in serum glutamic-oxaloacetic transaminase or serum glutamic-pyruvic transaminase, and
no evidence of apoptosis (not shown). From these data, we
conclude that the double-stranded RNA-regulated serine/threonine protein kinase system had not been activated and apoptosis
observed in the reported experiments was the direct result of
intracellular Shigatoxin expression.
In vivo Suppression of Tumor Growth with Adenovirus
Stx1A1 STS. To determine whether adenovirus-mediated STS of
Stx1A1 would produce intact Stx1A1 mRNA in vivo, RNA was
isolated from A549 tumors 24 hours after virus administration and
analyzed by reverse transcription-PCR (Fig. 2C). As expected,
omission of reverse transcriptase from the reverse transcriptionPCR reaction resulted in no products observed in tumors injected
with AdNull, AdStx1A1Do + AdNull, AdStx1A1Ac + AdNull, or
AdStx1A1Do + AdStx1A1Ac (lanes 1-4, respectively). When reverse
transcriptase was included, no amplification was detected from
tumors injected with AdNull, AdStx1A1Do + AdNull, or AdStx1A1Ac
+ AdNull (lanes 5-7). However, RNA from tumors injected with
AdStx1A1Do + AdStx1A1Ac (lane 8) showed the anticipated product
of 621 bp, as did the control plasmid (lane 9). To assess the fidelity
of Stx1A1 STS in vivo, the reverse transcription-PCR product from
the tumors injected with AdStx1A1Do and AdStx1A1Ac (lane 8)
was purified and sequenced. As for the in vitro analysis, the observed sequence across the splice junction was identical to that of
the intact Stx1A1 gene, indicating that adenovirus-mediated STS
could produce intact Stx1A1 mRNA following intratumoral injection of AdStx1A1Do and AdStx1A1Ac (not shown).
To assess the ability of adenovirus-mediated Stx1A1 STS to suppress the growth of tumors in vivo, HeLa, HEp2 and A549 tumors
were established in appropriate host mice by s.c. injection of cells
and allowed to grow for 7 days. Adenovirus Stx1A1 STS vectors or
PBS were then injected directly into the tumors, and tumor size
was monitored over time. HeLa, HEp2, and A549 tumors injected
with PBS, AdNull, AdStx1A1Do + AdNull, or AdStx1A1Ac + AdNull
showed similar growth curves (Fig. 5A-C; P > 0.1, all comparisons,
days 2 to 22). However, all tumors injected with AdStx1A1Do and
AdStx1A1Ac showed a marked suppression of growth [P < 0.05, days
14 to 26 in HeLa cells (Fig. 5A); days 10 to 22 in HEp2 (Fig. 5B); days
14 to 22 in A549 (Fig. 5C)], demonstrating the ability of adenovirusmediated Stx1A1 STS to suppress tumor growth in vivo.
adenovirus vectors, with more than 95% of cells infected at a dose
of 104 pu/mL, as confirmed by flow cytometry after GFP adenovirus
infection (not shown).
The morphologic changes in HeLa cells in response to
adenovirus-mediated Stx1A1 STS were analyzed (Fig. 3A-F). No
changes were observed in mock-infected cells (medium) or cells
infected with AdNull, AdStx1A1Do + AdNull, or AdStx1A1Ac +
AdNull (Fig. 3A, C, D and E, respectively). However, dramatic
morphologic changes, including cytoplasmic shrinkage and decreased cell numbers, were observed in the cells infected with
AdStx1A1Do + AdStx1A1Ac (Fig. 3F), which were similar to these in
the cells treated with Shigatoxin protein (positive control, Fig. 3B).
To assess the dose response of AdStx1A1Do + AdStx1A1Ac on HeLa
cell viability, cells were infected with AdStx1A1Do + AdStx1A1Ac +
AdNull at ratios of 1:1:48 or 1:1:8. The morphologic change and
decrease of cell numbers occurred in a dose-dependent manner
(not shown) with the 1:1 ratio of AdStx1A1Do + AdStx1A1Ac
yielding the most significant decrease in cell viability (Fig. 3F). The
morphologic changes observed in infected HeLa cells occurred
from 8 to 36 hours after infection, with all cells dislodged from the
culture plates by 48 hours. HEp2 cells infected with AdStx1A1Do +
AdStx1A1Ac showed similar morphologic changes (not shown).
A549 cells infected with AdStx1A1Do + AdStx1A1Ac became
quiescent, but did not show any cytotoxic changes over the period
studied (not shown).
The response of HeLa, HEp2, and A549 cells to adenovirusmediated Stx1A1 STS as a function of time was assessed
(Fig. 3G-K). Assessment of cell viabilities revealed complete killing
of HeLa (Fig. 3G), and significantly reduced cell viability in HEp2
and A549 (Fig. 3H and I). To assess the dose response of
AdStx1A1Do + AdStx1A1Ac on cell viability, the cells were infected
with AdStx1A1Do + AdStx1A1Ac + AdNull (1:1:8) at the same total
virus dose. Reducing the titer of AdStx1A1Do + AdStx1A1Ac in this
manner resulted in reduced cell death at all time points studied,
demonstrating a dose-dependent response for adenovirus-mediated Stx1A1 STS (not shown). The effect of adenovirus-mediated STS
of Stx1A1 on cell growth in vitro was assessed by cell counting
(Fig. 3J and K). The number of HeLa cells infected with
AdStx1A1Do + AdStx1A1Ac decreased rapidly, with complete cell
death 2 days after infection. A549 cells infected with AdStx1A1Do +
AdStx1A1Ac showed suppression of cell growth, but little change in
cell number 3 days after infection. These results were consistent
with the results of morphologic and cell viability analyses.
Inhibition of protein synthesis 8 hours after infection with
AdStx1A1Do + AdStx1A1Ac was studied in HeLa, HEp2, and A549
cells. Protein synthesis was significantly impaired in all cell lines
(Fig. 4A-C). No inhibition of protein synthesis was observed in
mock (medium only, control), AdNull, AdStx1A1Do + AdNull, or
AdStx1A1Ac + AdNull-infected cells. The degree of impairment of
protein synthesis in HeLa and HEp2 cells infected with
AdStx1A1Do + AdStx1A1Ac was similar to those seen in cells
treated with intact Shigatoxin protein. A549 cells showed no
response to treatment with Shigatoxin protein, likely due to the
lack of an external receptor for Shigatoxin (23). Significantly,
despite the lack of external receptors, protein synthesis in A549
cells was inhibited by the internal generation of Shigatoxin by STS
following infection with AdStx1A1Do + AdStx1A1Ac.
To determine whether cell death induced by the STS-mediated
delivery of STx1A1 was occurring via apoptosis, a DNA
fragmentation ELISA assay was used to assess HeLa, HEp2, and
A549 cells infected with the adenovirus Stx1A1 STS vectors. As a
Cancer Res 2005; 65: (1). January 1, 2005
258
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Segmental Pre-mRNA Trans-Splicing Delivery of Intracellular Toxins
Figure 3. Effect of adenovirus-mediated STS of Stx1A1 on cell viability and growth. A -F, viability of HeLa cells was analyzed by brightfield microscopy 18 hours after
infection with the vectors. A, medium alone, negative control; B, Shigatoxin protein (100 ng/mL, positive control); C, AdNull alone; D, AdStx1A1Do + AdNull; E,
AdStx1A1Ac + AdNull; and F, AdStx1A1Do + AdStx1A1Ac. The total dose of adenovirus was maintained at 104 pu/cell, with the ratios of mixed vectors at 1:1. All panels
are at the same magnification; bar = 50 Am. G-I, cell viability analysis. G, HeLa; H, HEp2; and I, A549 cells. Total virus doses were 104 pu/cell. AdNull was used as a
negative control and was mixed with the trans -splicing vectors to maintain the total viral dose as described for Fig. 2. For each panel, data is shown for infection with
AdNull (o), AdStx1A1Ac + AdNull (4), AdStx1A1Do + AdNull ( w ), AdStx1A1Do + AdStx1A1Ac ( ), no infection [medium only, negative control (5) or incubation with
Shigatoxin protein ( ) 100 ng/mL, positive control]. Ratios of mixed vectors were 1:1. Cell viability was assessed using the CellTiter 96 assay. J -K, cell growth analysis.
J, HeLa; and K, A549 cells. Data points are shown for infection with AdNull alone, AdStx1A1Ac + AdNull, AdStx1A1Do + AdNull, AdStx1A1Do + AdStx1A1Ac, no
infection (medium only, negative control) or incubation with Shigatoxin protein (100 ng/mL, positive control). Total virus doses were 104 pu/cell. X-axis, time after
transfection; Y-axis, absorbance relative to negative control (medium) at 490 nm. All data points are mean F SD, n = 4.
.
www.aacrjournals.org
259
Cancer Res 2005; 65: (1). January 1, 2005
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
(not shown). Because adenovirus vectors have great affinity for
liver cells following i.v. administration, we analyzed levels of the
serum liver enzymes alanine aminotransferase and aspartate
aminotransferase to evaluate the risk of leakage after local
administration of adenovirus-mediated Stx1A1 STS. Stx1A1 gene
expression was not detected in the livers of injected animals
(not shown), and liver enzymes were not elevated 5 days
after intratumoral injection of adenovirus Stx1A1 STS vectors
(Table 1).
One potential concern in the use of viral vectors that mediate
the delivery of a toxin is the possibility of leakage of the
AdStx1A1Do and AdStx1A1Ac vectors from the site of injection
to remote sites where normal, healthy cells might be damaged.
Several observations indicated that this did not occur. First, no
systemic toxicity (reflected by animal death) was observed
following intratumoral injection of these vectors, nor were there
differences among the groups in general alertness, state of
the skin coat, food intake, or body weight during observation
Figure 4. Inhibition of protein synthesis and induction of apoptosis by Stx1A1 trans-splicing in vitro . A-C, inhibition of protein synthesis (A) HeLa, (B ) HEp2; and
(C) A549. Cells were infected with either AdNull, AdStx1A1Ac + AdNull, AdStx1A1Do + AdNull, AdStx1A1Do + AdStx1A1Ac, or exposed to Shigatoxin protein
(100 ng/mL, positive control), or medium only (negative control). The virus dose was as described for Fig. 2. Incorporation of [3H]leucine by the cells was measured after
8 hours. Results for the negative control (medium) were set to 100, and all other measurements normalized to that control. D -F, apoptotic DNA fragmentation. D, HeLa
cells; E, HEp2 cells, and F, A549 cells. Cells were infected with adenovirus Shigatoxin donor and acceptor STS vectors at doses described for Fig. 2. AdNull was
used as a negative control and also mixed with the trans -splicing vectors to maintain total viral dose. Black columns, dose dependency of apoptosis with AdStx1A1
vectors, after mixing with AdNull at ratios of 1:1:0, 1:1:8, and 1:1:48. Twenty hours after infection, cells were analyzed using a Cell Death Detection ELISA. Uninfected
cells are shown as a negative control (medium, white column), and Shigatoxin protein (100 ng/mL) or cisplatin (CDDP, 20 AM; gray column ) as positive controls.
HeLa and HEp2 cells are sensitive to external Shigatoxin protein; A549 is known to be resistant to external Shigatoxin protein (18, 21–23). All data are normalized to the
negative control (medium). Y-axis, relative DNA fragmentation; X-axis, treatment groups.
Cancer Res 2005; 65: (1). January 1, 2005
260
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Segmental Pre-mRNA Trans-Splicing Delivery of Intracellular Toxins
Discussion
individual DNA fragments coding for 5V and 3V fragments of premRNA of a gene are delivered to mammalian cells (3).
Conventional trans-splicing gene transfer targets endogenous
mRNA with low efficiency, leading to limited production of the
trans-spliced product. STS overcomes this obstacle by generating
two separate pre-mRNAs at high concentration which bind
through unique binding sequences. The feasibility of STS has
been shown in vivo using a-cobratoxin, a secreted neurotoxin
that binds irreversibly to postsynaptic nicotinic acetylcholine
receptors (29). Plasmid-mediated STS of a-cobratoxin yielded
correctly trans-spliced a-cobratoxin mRNA and functional
a-cobratoxin protein with high efficiency in vitro and in vivo (3).
In this study, the speed with which the LD50 was achieved in
animals receiving trans-splicing toxin plasmids was evidence of
the very high efficiency of STS, which we ascribe to the high
relative abundance of the donor and acceptor pre-mRNAs driven
by strong cytomegalovirus promoters. Their interaction is
governed by Cot hybridization rules, e.g., more RNA and equal
Targeted killing of cancer cells by the expression of a plasmidencoded intracellular toxin has been shown using the diphtheria
toxin A–chain in vitro (27) and Pseudomonas exotoxin in vivo (28),
but gene transfer via plasmid vectors is a relatively inefficient
process. Theoretically, the ability to use viral vectors to direct the
expression of toxic genes to cancer cells using vector-mediated
gene transfer of intracellular cytotoxin or apoptosis-inducing genes
should be an effective strategy to add to the armamentarium
against tumors. However, the generation of viral vectors carrying
intracellular toxins has been difficult due to the fact that
expression of the toxin kills the packaging cells during generation
of the vector. The present report describes a new strategy, called
segmental trans-splicing, which provides a solution to this problem
by generating the toxic gene product from two fragments of a toxic
gene that, by themselves, are innocuous.
STS is a pre-mRNA, spliceosome-mediated trans-splicing–
based paradigm for gene transfer, in which two engineered
Figure 5. Effect of adenovirus Stx1A1 STS on tumor growth in vivo.
A, HeLa. Tumors were established in BALB SCID mice by s.c.
injection of 107 HeLa cells (n = 6 mice per group) and allowed to
grow for 7 days. Adenovirus Stx1A1 STS vectors or PBS were
delivered thrice intratumorally (arrows ; days 0, 5, and 10). Animals
received AdStx1A1Do + AdStx1A1Ac (total 5 1010 pu); AdStx1A1Do + AdNull (total 5 1010 pu), AdStx1A1Ac + AdNull (total
5 1010 pu); AdNull alone (5 1010 pu), or PBS. B, HEp2. Tumors
were established in BALB SCID mice by s.c. injection of 107 HEp2
cells (n = 6 mice per group) and allowed to grow for 7 days.
Adenovirus Stx1A1 STS vectors or PBS were then delivered
intratumorally as described for A . C, A549. Tumors were established
in BALB/c nu /nu mice by s.c. injection of 5 106 A549 cells
(n = 6 mice per group) and treated 7 days later with adenovirus
Stx1A1 STS vectors or PBS as in A and B . X-axis, time after the first
adenovirus inoculation. All data are presented as mean F SE, with a
minimum of n = 6/data point.
www.aacrjournals.org
261
Cancer Res 2005; 65: (1). January 1, 2005
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
the toxin. The Stx1A1 gene is expressed inside the cell and kills
only that cell. Without the binding domain, any Stx1A1 that
escapes the cell when lysis occurs cannot gain entry into other
cells. Thus, only the vector-targeted cells are affected by the
expression of the toxin and systemic effects are minimized. It
should be noted that the STS gene transfer approach would be
amenable to any intracellular toxin.
Relevance of Apoptosis Induced by Stx1. Cellular changes
that inhibit apoptosis play an essential role in tumor development
(35). Many chemotherapeutic drugs function via the activation of
apoptotic mechanisms leading to tumor cell death, and factors
that impair programmed cell death contribute to the resistance of
the tumor cells to drug treatment (35). Furthermore, apoptotic
cell death likely provides tumor antigens to the immune system
in an efficient manner (36). In the context of these considerations,
cancer therapies that function in part by inducing apoptosis of
malignant cells, may develop several antitumor host response
mechanisms against tumors (35).
The current concepts of Shigatoxin action suggest that it may
signal apoptosis in different cell types via different mechanisms
including, inhibition of protein synthesis, interaction of Stx1B
chains with the Gb3 receptor on target cells, and enzymatically
induced damage of DNA (37). Stx1 protein has been shown to
induce apoptosis in a variety of cells including human lung
epithelial cells, human renal cortical epithelial cells, THP-1
human monocytic cell lines, HEp2 cells, Vero cells, HeLa cells,
and endothelial cells from several organs treated with tumor
necrosis factor-a (18, 22–24, 38–43). The activation of apoptotic
pathways by caspase 3 and 8, and the down-regulation of the
antiapoptotic proteins Mcl-1 or FLICE-like inhibitory protein
have been observed following exposure to Stx1 protein (44, 45).
The mechanism by which Stx1 initially triggers activation of
apoptosis is not fully understood. Although Stx1 acts as
ribosome-inactivating protein, removing a specific adenine from
28S rRNA with an attendant inhibition of protein synthesis,
blockage of protein synthesis by cycloheximide does not induce
apoptosis or enhance the effect of Stx1 in endothelial cells, and
thus the inhibition of translation alone does not seem to be
sufficient to induce programmed cell death (46). One report
suggested that recombinant Stx1B (the cell-targeting element of
Stx1) could induce apoptosis in Burkitt’s lymphoma cells,
although at much higher concentrations than with the holotoxin
(46, 47). In contrast, the cloned Stx1B subunit is not toxic in
HeLa cells or Vero cells, even at high concentrations (18, 44). In
this report, the Stx1A1 activity was generated in the target cells
internally, thereby circumventing all external signaling and
activation of ancillary pathways.
Cancer Therapy Using Adenovirus-Mediated STS. In this
study, we employed an immunodeficient mouse model
implanted with human tumors to evaluate the effect of Stx1A1
on killing tumor cells in vivo. In a clinical study, Stx1A1 might
be used in combination with immunoactivation (48–50). In the
context that Stx1A1 delivered by STS induced apoptosis in
many tumor cell types, and that induction of apoptosis in
tumors induces host antitumor immune processes, this
combination should cause programmed cell death and induce
enhanced antitumor immune responses resulting in the
elimination of tumors.
Intratumoral administration of adenovirus for STS of Stx1A1
showed no liver damage, confirmed by the lack of Stx1A1 mRNA
expression in liver and no elevation of serum liver enzymes. In
Table 1. Effect of intratumoral administration of
adenovirus Shigatoxin STS vectors on liver toxicity
Time course (day)
Serum
enzyme
0
Alanine
38.3 F 3.2
aminotransferase
Aspartate
73.0 F 6.6
aminotransferase
2
5
42.0 F 6.6 39.4 F 4.5
74.2 F 8.9 77.8 F 12.6
NOTE: AdStx1A1Do + AdStx1A1Ac (both 5 1010 pu in 80 AL) were
administered to A549 flank tumors in BALB/c nu/nu mice. As an
assessment of systemic toxicity, liver enzymes were evaluated over
time. Data is from the same animal as in Fig. 5. The enzyme levels are
in IU (mean F SE).
amounts of RNA leads to faster interaction, and thus higher
efficiency (30). This distinguishes STS from traditional transsplicing into an endogenous pre-mRNA, the concentration of
which is limited by cellular regulatory elements.
Successful application of STS to the destruction of tumors
requires that cells be infected by both the donor and acceptor
vectors to produce toxin. High local doses or multiple injection
sites could minimize the impact of the two-vector requirement.
Although the use of two vectors is a restriction, there are potential
advantages to using more than one vector. First, the ability to use
two different promoters to enhance the specificity of expression,
e.g., using liver-specific and cancer-specific promoters in the two
vectors, ensure that only cycling hepatic cells would express the
toxin. Second, capsid-modified vectors or even different vector
types can be employed to enhance delivery and specificity to
specific tumors. Targeted vectors might permit systemic administration with associated improvements in the safety profile of this
therapeutic modality.
Cancer Therapy Using Stx1. Shigatoxin was chosen as the
model toxin for this study based on the fact that it had not been
delivered previously via gene transfer vector as an intracellular
toxin. Previous attempts to use Stx1 to kill cells either exploited
direct injection of Stx1 into tumors or used fusion products to
target the protein to specific cells. Intratumoral administration
of Stx1 protein significantly improved survival in a tumor
xenograft model in nude mice using a human malignant
meningioma (31) and a human astrocytoma (32). VEGF121 was
able to kill endothelial cells expressing VEGFR-2 in a dosedependent manner in vitro (33). Another study showed that a
Stx1A1-human CD4 fusion protein selectively killed cells infected
with HIV type 1 (25). Stx1 protein was used ex vivo to purge B
cell lymphoma cells expressing the Stx1A receptor from stem cell
grafts in a SCID mouse lymphoma model (34). Despite the
success of these models, the use of intact Stx1 protein, alone or
fused with another protein, is complicated by the fact that any
cell, tumor, or normal, that comes into contact with the toxin
could be killed. In contrast, the use of STS gene transfer to
deliver Stx1A1, stripped of its binding domain and retaining only
the intracellular enzymatic moiety, permits precise delivery of
Cancer Res 2005; 65: (1). January 1, 2005
262
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Segmental Pre-mRNA Trans-Splicing Delivery of Intracellular Toxins
Acknowledgments
adenovirus-mediated STS of Stx1A1, the manufactured toxin
cannot be secreted and cannot gain entry into other cells due to
the lack of a signal sequence and B-subunits. Because only the cells
infected with both AdStx1A1Do and AdStx1A1Ac should be
intoxicated and killed, the risk of leakage of virus vector is
minimized. Together with the experimental data, these properties
suggest there is a low risk of using STS to deliver toxins to tumors.
References
1. Qiao J, Caruso M. PG13 packaging cells produce recombinant retroviruses carrying a diphtheria toxin
mutant which kills cancer cells. J Virol 2002;76:7343–8.
2. Gomez-Navarro J, Curiel DT, Douglas JT. Gene therapy
for cancer. Eur J Cancer 1999;35:867–85.
3. Pergolizzi RG, Ropper AE, Dragos R, et al. In vivo
trans-splicing of 5V and 3V segments of pre-mRNA
directed by corresponding DNA sequences delivered by
gene transfer. Mol Ther 2003;8:999–1008.
4. Sandvig K. Shiga toxins. Toxicon 2001;39:1629–35.
5. O’Loughlin EV, Robins-Browne RM. Effect of Shiga
toxin and Shiga-like toxins on eukaryotic cells.
Microbes Infect 2001;3:493–507.
6. O’Brien AD, Newland JW, Miller SF, Holmes RK, Smith
HW, Formal S. Shiga-like toxin-converting phages from
Escherichia coli strains that cause hemorrhagic colitis
or infantile diarrhea. Science 1984;226:694–6.
7. Endo Y, Tsurugi K, Yutsudo T, Takeda Y, Ogasawara T,
Igarashi K. Site of action of a Vero toxin (VT2) from
Escherichia coli O157:H7 and of Shiga toxin on
eukaryotic ribosomes. RNA N-glycosidase activity of
the toxins. Eur J Biochem 1988;171:45–50.
8. Reisbig R, Olsnes S, Eiklid K. The cytotoxic activity of
Shigella toxin. Evidence for catalytic inactivation of the
60S ribosomal subunit. J Biol Chem 1981;256:8739–44.
9. Zollman TM, Austin PR, Jablonski PE, Hovde CJ.
Purification of recombinant Shiga-like toxin type I A1
fragment from Escherichia coli . Protein Expr Purif
1994;5:291–5.
10. Eiklid K, Olsnes S. Entry of Shigella dysenteriae toxin
into HeLa cells. Infect Immun 1983;42:771–7.
11. Haddad JE, al Jaufy AY, Jackson MP. Minimum
domain of the Shiga toxin A subunit required for
enzymatic activity. J Bacteriol 1993;175:4970–8.
12. Nakamura Y, Gojobori T, Ikemura T. Codon usage
tabulated from international DNA sequence databases:
status for the year 2000. Nucleic Acids Res 2000;28:292.
13. Rosenfeld MA, Siegfried W, Yoshimura K, et al.
Adenovirus-mediated transfer of a recombinant a
1-antitrypsin gene to the lung epithelium in vivo .
Science 1991;252:431–4.
14. Rosenfeld MA, Yoshimura K, Trapnell BC, et al.
In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway
epithelium. Cell 1992;68:143–55.
15. Mittereder N, March KL, Trapnell B. Evaluation of the
concentration and bioactivity of adenovirus vectors for
gene therapy. J Virol 1996;70:7498–509.
16. Frey BM, Hackett NR, Bergelson JM, et al. Highefficiency gene transfer into ex vivo expanded human
hematopoietic progenitors and precursor cells by
adenovirus vectors. Blood 1998;91:2781–92.
17. Garred O, van Deurs B, Sandvig K. Furin-induced
cleavage and activation of Shiga toxin. J Biol Chem
1995;270:10817–21.
18. Fujii J, Matsui T, Heatherly DP, et al. Rapid apoptosis
induced by Shiga toxin in HeLa cells. Infect Immun
2003;71:2724–35.
www.aacrjournals.org
Received 4/15/2004; revised 10/7/2004; accepted 10/28/2004.
Grant support: Supported in part by P01 HL51746, the Will Rogers Memorial
Fund, Los Angeles, CA, and The Malcolm Hewitt Wiener Foundation, Greenwich, CT.
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank N. Hackett for technical comments and suggestions, and N. Mohamed for
help in preparing this manuscript.
19. Herz J, Gerard R. Adenovirus-mediated transfer of
low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice. Proc Natl
Acad Sci U S A 1993;90:2812–6.
20. Worgall S, Wolff G, Falck-Pedersen E, Crystal R.
Innate immune mechanisms dominate elimination of
adenoviral vectors following in vivo administration.
Hum Gene Ther 1997;8:37–44.
21. Cherla RP, Lee SY, Tesh V. Shiga toxins and apoptosis.
FEMS Microbiol Lett 2003;228:159–66.
22. Ching JC, Jones NL, Ceponis PJ, Karmali MA,
Sherman PM. Escherichia coli Shiga-like toxins induce
apoptosis and cleavage of poly(ADP-ribose) polymerase
via in vitro activation of caspases. Infect Immun
2002;70:4669–77.
23. Uchida H, Kiyokawa N, Taguchi T, Horie H, Fujimoto
J, Takeda T. Shiga toxins induce apoptosis in pulmonary
epithelium-derived cells. J Infect Dis 1999;180:1902–11.
24. Seki K, Yoshikawa H, Shiiki K, Hamada Y, Akamatsu
N, Tasaka K. Cisplatin (CDDP) specifically induces
apoptosis via sequential activation of caspase-8, -3 and
-6 in osteosarcoma. Cancer Chemother Pharmacol
2000;45:199–206.
25. al Jaufy AY, Haddad JE, King SR, McPhee RA, Jackson
MP. Cytotoxicity of a shiga toxin A subunit-CD4 fusion
protein to human immunodeficiency virus-infected
cells. Infect Immun 1994;62:956–60.
26. Jagus R, Joshi B, Barber GN. PKR, apoptosis and
cancer. Int J Biochem Cell Biol 1999;31:123–38.
27. Maxwell IH, Maxwell F, Glode L. Regulated expression of a diphtheria toxin A-chain gene transfected into
human cells: possible strategy for inducing cancer cell
suicide. Cancer Res 1986;46:4660–4.
28. Yerushalmi N, Brinkmann U, Brinkmann E, Pai L,
Pastan I. Attenuating the growth of tumors by intratumoral administration of DNA encoding Pseudomonas
exotoxin via cationic liposomes. Cancer Gene Ther
2000;7:91–6.
29. Ruan KH, Stiles BG, Atassi MZ. The short-neurotoxin-binding regions on the alpha-chain of human and
Torpedo californica acetylcholine receptors. Biochem J
1991;274:849–54.
30. Wetmur JG. Hybridization and renaturation kinetics of nucleic acids. Annu Rev Biophys Bioeng 1976;
5:337–61.
31. Salhia B, Rutka JT, Lingwood C, Nutikka A, Van Furth
WR. The treatment of malignant meningioma with
verotoxin. Neoplasia 2002;4:304–11.
32. Arab S, Rutka J, Lingwood C. Verotoxin induces
apoptosis and the complete, rapid, long-term elimination of human astrocytoma xenografts in nude mice.
Oncol Res 1999;11:33–9.
33. Backer M, Backer J. Targeting endothelial cells
overexpressing VEGFR-2: selective toxicity of Shiga-like
toxin-VEGF fusion proteins. Bioconjug Chem 2001;12:
1066–73.
34. La Casse EC, Saleh MT, Patterson B, Minden MD,
Gariepy J. Shiga-like toxin purges human lymphoma
from bone marrow of severe combined immunodeficient mice. Blood 1996;88:1561–7.
263
35. Waxman D, Schwartz PS. Harnessing apoptosis for
improved anticancer gene therapy. Cancer Res 2003;
63:8563–72.
36. Rovere P, Vallinoto C, Bondanza A, et al. Bystander
apoptosis triggers dendritic cell maturation and
antigen-presenting function. J Immunol 1998;161:
4467–71.
37. Brigotti M, Alfieri R, Sestili P, et al. Damage to nuclear
DNA induced by Shiga toxin 1 and ricin in human
endothelial cells. FASEB J 2002;16:365–72.
38. Ergonul Z, Hughes AK, Kohan D. Induction of
apoptosis of human brain microvascular endothelial
cells by Shiga toxin 1. J Infect Dis 2003;187:154–8.
39. Kiyokawa N, Taguchi T, Mori T, et al. Induction of
apoptosis in normal human renal tubular epithelial
cells by Escherichia coli Shiga toxins 1 and 2. J Infect
Dis 1998;178:178–84.
40. Kojio S, Zhang H, Ohmura M, Gondaira F, Kobayashi
N, Yamamoto T. Caspase-3 activation and apoptosis
induction coupled with the retrograde transport of
Shiga toxin: inhibition by brefeldin A. FEMS Immunol
Med Microbiol 2000;29:275–81.
41. Pijpers AH, van Setten PA, van den Heuvel LP, et
al. Verocytotoxin-induced apoptosis of human microvascular endothelial cells. J Am Soc Nephrol 2001;
12:767–8.
42. Williams JM, Lea N, Lord JM, Roberts LM, Milford
DV, Taylor C. Comparison of ribosome-inactivating
proteins in the induction of apoptosis. Toxicol Lett
1997;91:121–7.
43. Yoshida T, Fukada M, Koide N, et al. Primary cultures
of human endothelial cells are susceptible to low doses
of Shiga toxins and undergo apoptosis. J Infect Dis
1999;180:2048–52.
44. Erwert RD, Winn RK, Harlan JM, Bannerman DD.
Shiga-like toxin inhibition of FLICE-like inhibitory
protein expression sensitizes endothelial cells to
bacterial lipopolysaccharide-induced apoptosis. J Biol
Chem 2002;277:40567–74.
45. Erwert RD, Eiting KT, Tupper JC, Winn RK, Harlan
JM, Bannerman DD. Shiga toxin induces decreased
expression of the anti-apoptotic protein Mcl-1 concomitant with the onset of endothelial apoptosis. Microb
Pathog 2003;35:87–93.
46. Jones NL, Islur A, Haq R, et al. Escherichia coli Shiga
toxins induce apoptosis in epithelial cells that is
regulated by the Bcl-2 family. Am J Physiol Gastrointest
Liver Physiol 2000;278:G811–9.
47. Mangeney M, Lingwood CA, Taga S, Caillou B, Tursz
T, Wiels J. Apoptosis induced in Burkitt’s lymphoma
cells via Gb3/CD77, a glycolipid antigen. Cancer Res
1993;53:5314–9.
48. Dalgleish AG, O’Byrne KJ. Chronic immune activation and inflammation in the pathogenesis of AIDS and
cancer. Adv Cancer Res 2002;84:231–76.
49. Porgador A, Snyder D, Gilboa E. Induction of
antitumor immunity using bone marrow-generated
dendritic cells. J Immunol 1996;156:2918–26.
50. Russell JH, Ley T. Lymphocyte-mediated cytotoxicity.
Annu Rev Immunol 2002;20:323–70.
Cancer Res 2005; 65: (1). January 1, 2005
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.
Gene Transfer−Mediated Pre-mRNA Segmental Trans
-splicing As a Strategy to Deliver Intracellular Toxins for
Cancer Therapy
Katsutoshi Nakayama, Robert G. Pergolizzi and Ronald G. Crystal
Cancer Res 2005;65:254-263.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/65/1/254
This article cites 48 articles, 23 of which you can access for free at:
http://cancerres.aacrjournals.org/content/65/1/254.full#ref-list-1
This article has been cited by 1 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/65/1/254.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on July 28, 2017. © 2005 American Association for Cancer
Research.