Research Article
1507
Claudin-10 exists in six alternatively spliced isoforms
that exhibit distinct localization and function
Dorothee Günzel1,*, Marchel Stuiver2, P. Jaya Kausalya3, Lea Haisch2, Susanne M. Krug1, Rita Rosenthal1,
Iwan C. Meij4, Walter Hunziker3, Michael Fromm1 and Dominik Müller2
1
Institute of Clinical Physiology, Charité, 12200 Berlin, Germany
Department of Pediatric Nephrology, Charité, 13535 Berlin, Germany
3
Institute of Molecular and Cell Biology (IMCB), Singapore 138673
4
Max-Delbrueck-Center for Molecular Medicine, 13125 Berlin, Germany
2
*Author for correspondence (e-mail: [email protected])
Journal of Cell Science
Accepted 24 January 2009
Journal of Cell Science 122, 1507-1517 Published by The Company of Biologists 2009
doi:10.1242/jcs.040113
Summary
The tight junction protein claudin-10 is known to exist in two
isoforms, resulting from two alternative exons, 1a and 1b
(Cldn10a, Cldn10b). Here, we identified and characterized
another four claudin-10 splice variants in mouse and human.
One (Cldn10a_v1) results from an alternative splice donor site,
causing a deletion of the last 57 nucleotides of exon 1a. For each
of these three variants one further splice variant was identified
(Cldn10a_v2, Cldn10a_v3, Cldn10b_v1), lacking exon 4. When
transfected into MDCK cells, Cldn10a, Cldn10a_v1 and
Cldn10b were inserted into the tight junction, whereas isoforms
of splice variants lacking exon 4 were retained in the
endoplasmic reticulum. Cldn10a transfection into MDCK cells
confirmed the previously described increase in paracellular
anion permeability. Cldn10a_v1 transfection had no direct
effect, but modulated Cldn10a-induced organic anion
permeability. At variance with previous reports in MDCK-II
Introduction
Claudins are a family of proteins located in the tight junction (TJ)
of epithelial cells. They are predicted to span the membrane four
times (Fig. 1). As both the N-terminus and C-terminus reside in the
cytoplasm, there are two extracellular loops through which claudins
of neighbouring cells are assumed to interact, as they have been
demonstrated to exhibit a barrier function and to regulate
paracellular permeability (Wen et al., 2004; Hou et al., 2005). In
tubular epithelia, a segment-specific distribution of different claudins
is observed (Kiuchi-Saishin et al., 2002; Hashizume et al., 2004;
Guan et al., 2005; Inai et al., 2005; Holmes et al., 2006; Ohta et
al., 2006). Amongst these is claudin-10 which is differentially
expressed along the length of many tubular epithelia including the
nephron in the kidney.
In mouse submandibular gland, immunohistochemical staining
for claudin-10 demonstrated localization within the TJ mainly in
the terminal tubules, whereas it was hardly detectable in the ducts
(Hashizume et al., 2004). In the epididymis of 10-week-old rats,
claudin-10 was found in the TJs of the efferent duct and the initial
segment, but not in the caput, corpus or cauda, although in cells of
the two latter segments some extra-junctional staining was observed
[basal and cytoplasmic, respectively (Guan et al., 2005)].
In mouse and rat gut, claudin-10 was found in all segments (Inai
et al., 2005), but with highest expression levels near the ileocecal
region (Holmes et al., 2006). Claudin-10 was present in the small
intestine in all TJs along the villus-crypt axis, whereas it was
cells, transfection of high-resistance MDCK-C7 cells with
Cldn10b dramatically decreased transepithelial resistance,
increased cation permeability, and changed monovalent cation
selectivity from Eisenman sequence IV to X, indicating the
presence of a high field-strength binding site that almost
completely removes the hydration shell of the permeating
cations. The extent of all these effects strongly depended on the
endogenous claudins of the transfected cells.
Supplementary material available online at
http://jcs.biologists.org/cgi/content/full/122/10/1507/DC1
Key words: Kidney, Renal cell lines, Tight junction, Alternative
splicing, Subcellular localization, Epithelial transport, Ion
permeability, Eisenman sequence
restricted to the crypts and absent from the surface epithelium in
the large intestine (Inai et al., 2005; Holmes et al., 2006).
In the kidney, claudin-10 distribution has been reported to differ
between mouse and cattle (Kiuchi-Saishin et al., 2002; Ohta et al.,
2006). In cattle, immunohistochemical staining revealed the
presence of claudin-10 in the proximal tubule and the thick
ascending limb of Henle’s loop (Ohta et al., 2006), whereas, in
mouse kidney, staining was originally reported to be restricted to
the thin descending limb and the thick ascending limb of Henle’s
loop (Kiuchi-Saishin et al., 2002). In contrast to this finding, Van
Itallie et al. (Van Itallie et al., 2006) found claudin-10 to be present
in all parts of the nephron, except for the glomerulus.
Furthermore, Van Itallie et al. (Van Itallie et al., 2006) reported
the existence of two claudin-10 splice variants (Cldn10a and
Cldn10b), giving rise to two claudin-10 isoforms, claudin-10a and
claudin-10b, respectively. Claudin-10a appeared to be restricted to
the kidney, whereas claudin-10b was found in all tissues
investigated. Within the kidney, they found claudin-10a to be
preferentially expressed in the cortex and claudin-10b in the
medulla. The two variants differ only in their first exon. In mouse
and human claudin-10, the coding sequence of exon 1a encompasses
214 bp, whereas exon 1b consists of 220 bp, rendering claudin-10b
two amino acids longer than claudin-10a. Although very similar in
length, the two isoforms differ greatly with respect to the electric
charge within their first extracellular loop (Fig. 1). Claudin-10a
contains seven positively charged and two (mouse) or one (human)
1508
Journal of Cell Science 122 (10)
isoforms was further investigated in MDCK-C7 cells. Because of
its high transepithelial resistance (≥1000 Ω ·cm2), this cell line has
previously been found advantageous for the detection of paracellular
pore formation (Amasheh et al., 2002). Furthermore, MDCK-C7
cell layers are only moderately cation selective (PNa/PCl ~1.5) and
therefore may allow disclosure of increases in selectivity for cations
as well as anions. Functional analyses demonstrate that claudin10a and claudin-10b change the interaction of the paracellular pore
with the hydration shell of the permeating anions and cations,
respectively, rather than conveying a general increase in anion or
cation permeability. Claudin-10a_i1 appears to further modulate
claudin-10a function.
Comparison of claudin-10 effects observed in MDCK-II and
MDCK-C7 cells indicates that the extent of these effects strongly
depends on the endogenous claudins of the cells used as expression
system.
Results
Journal of Cell Science
Identification of Cldn10a, Cldn10a_v1 and Cldn10b in mouse
and human
Fig. 1. Predicted membrane topology of claudin-10. Membrane topology of
claudin-10a (A) and claudin-10b (B) variants as predicted by the UniProt
database. Cysteines of the first extracellular loop (black circles) and
electrically charged amino acids of the two extracellular loops (+, –) are
indicated. Claudin-10a_i1 and claudin-10a_i3 lack 19 amino acids (57 base
pairs) in the first extracellular loop as indicated by Δ57, claudin-10a_i2,
claudin-10a_i3 and claudin-10b_i1 lack the 36 amino acids encoded by exon 4
(as indicated by Δexon 4), encompassing the fourth transmembrane region. In
ΔP mutants the two C-terminal amino acids (YV) of the PDZ-binding motif
are mutated (AA).
negatively charged amino acids within the first extracellular loop.
By contrast, there are four positive and five negative charges in the
first extracellular loop of claudin-10b. This observation gave rise
to the assumption that expression of these two isoforms might have
different effects on the ion permeability of TJs. Subsequent
electrophysiological measurements revealed that, when expressed
in MDCK-II cells, claudin-10a increased Cl– permeability whereas
Na+ permeability decreased. Expressing claudin-10b had no effect
on the permeability of either ion. When expressed in LLC-PK1 cells,
expression of claudin-10a again caused an increase in Cl–
permeability whereas expression of claudin-10b caused an increase
in Na+ permeability. By specific site-directed mutation of single
charged amino acids, the observed increase in Cl– permeability
caused by claudin-10a was linked to the positive charges of amino
acid R33 [referred to as R32 by Van Itallie et al. (Van Itallie et al.,
2006)] and R62 [referred to as either R59 or R61 by Van Itallie et
al. (Van Itallie et al., 2006)].
In the present study, four further alternative Cldn10 transcripts
were identified in mouse and human. When transfected into
MDCK-II and MDCK-C7 cells (sub-clones of Madin-Darby canine
kidney cells differing in their claudin-2 expression) claudin-10a,
claudin-10b and one isoform (claudin-10a_i1) encoded by the
additional splice variants were localized in the tight junction,
whereas the other three were retained in the endoplasmic reticulum.
Physiological function of the three tight junctional claudin-10
Two Cldn10 splice variants were found in the human and mouse
NCBI database (Cldn10a, Cldn10b), only differing in their first
exon. To investigate the expression of the two Cldn10 variants in
mouse kidney, a PCR with variant specific forward primers was
performed on mouse kidney cDNA. Expression of both variants
was found, but also an additional lower band for Cldn10a was
detected (Fig. 2A). After cloning and sequencing, it was found that
the lower band had a deletion of the last 57 nucleotides of exon 1a,
resulting from an alternative splice donor site in this exon, which
causes an in frame deletion of 19 amino acids (Cldn10a_v1).
Interestingly, this deletion is located in the predicted first
extracellular loop and would cause a deletion of the second cysteine
of the highly conserved W-GLW-C-C motif (Van Itallie and
Anderson, 2006) and, in mouse, a deletion of six of the nine charged
amino acids of this loop (in human: five of the eight charged amino
acids; Fig. 1A, Fig. 3) including R62 investigated by Van Itallie et
al. (Van Itallie et al., 2006).
Further investigation of the database revealed the same 57
nucleotide deletion in spliced ESTs from Trichosurus vulpecula
(brushtail possum) kidney (DY598763) and dog kidney
(CO688322), stressing the potential relevance of this new splice
variant. In addition, one human spliced EST was found with the
same deletion (N41613), but this EST came from a placenta cDNA
library. To prove the existence of this splice variant in human kidney,
a PCR was successfully performed using a forward primer that
bridges over this deletion and extends for six nucleotides into exon 2
(this primer did not give a product under the same conditions when
using pure Cldn10a as template).
Three Cldn10 isoforms lack exon 4
Upon detailed analysis of the Cldn10 ESTs in the database, another
putative messenger RNA from mouse kidney was identified that
lacks exon 4 (BC021770), which, if translated, would result in an
in frame deletion of 36 amino acids. In an attempt to identify this
variant as well, a reverse primer was designed that bridges exon 4
and extends for four nucleotides into exon 3 (Figs 1 and 3). It was
confirmed by PCR on mouse kidney cDNA that such a variant exists
and it was also noticed that a lower band appeared. Upon cloning
and sequencing this shorter product, it was found that, in addition
to exon 4, it lacked the same 57 nucleotides from the first exon as
mentioned before.
Journal of Cell Science
Cldn10 isoform localization and function
1509
Fig. 3. Alternative splice variants in mouse. Diagram of the genomic
organization of the Cldn10 gene and below it, the alternative transcripts that
were found. Six Cldn10 messengers were found in mouse kidney, resulting
from alternative first exons, an alternative splice donor site in exon 1a,
indicated with an asterisk (*), and in some cases a deletion of exon 4. The
genomic sequence is depicted as a line. Exons, depicted as filled rectangles,
are given above the genomic structure. UTRs are depicted as narrower filled
rectangles in front of the ATG start codons and after the TAA stop codon.
Fig. 2. Differential murine Cldn10 expression. (A) RT-PCR analysis of mouse
kidney for Cldn10. Both Cldn10a (left) and Cldn10b (right) are expressed
here. Additionally, a 57 bp shorter transcript, indicated with an asterisk (*),
was found for Cldn10a. The size of the marker fragments in bp is indicated on
the right. (B) Semi-quantitative RT-PCR for Cldn10 variants on mouse
multiple tissue cDNA (MTC) panels (Clontech). These panels are normalized
for four housekeeping genes. The PCR results after 35 cycles are shown. As a
positive control, manually obtained kidney cDNA was used. Whereas Cldn10a
variants are found in kidney and uterus, Cldn10b is expressed ubiquitously
with the highest and lowest expression levels in kidney and liver, respectively.
The size of the marker fragments in bp is indicated on the right. (C) PCRs on
cDNA from dissected nephron segments. PCT, proximal convoluted tubule;
mTAL, medullary thick ascending limb of Henle; CCD, cortical collecting
duct; OMCD and IMCD, outer and inner medullary collecting duct. Whole
kidney cDNA was used as a positive control. The size of the marker
fragments, in bp, is indicated on the right.
The approximately 100 base pair shorter band that was also
amplified in addition to Cldn10b (see arrows in Fig. 2B), although
too scarce to be sequenced or cloned directly, could point to Cldn10b
lacking exon 4. In fact an RT-PCR on mouse total kidney RNA
with a forward primer in exon 1b and the reverse primer bridging
exon 4, with subsequent sequencing, confirmed the existence of
such a splice variant (c.f. Fig. 3).
The three splice variants lacking exon 4 will be referred to as
Cldn10a_v2, Cldn10a_v3 and Cldn10b_v1, respectively (see also
Table 1 for nomenclature). As exon 4 has been predicted to contain
the complete fourth transmembrane region, the C-termini of the
resulting proteins may come to lie on the extracellular side of the
membrane (note, however, that TMHMM Server v 2.0 assigns an
alternative transmembrane region to these isoforms).
Tissue distribution of Cldn10 expression
To study tissue-specific expression of the identified Cldn10 variants,
a semi-quantitative PCR was performed on two mouse tissue cDNA
panels. It was found that, whereas Cldn10a expression was only
observed in kidney and uterus, Cldn10b was expressed in all tissues
tested, with low expression in liver and highest expression in kidney.
A similar expression pattern for this isoform was also observed by
Van Itallie et al. (Van Itallie et al., 2006). Cldn10a_v1, which was
not described by Van Itallie et al. (Van Itallie et al., 2006), is also
expressed in kidney and uterus (Fig. 2B).
Cldn10 expression along the nephron
Since no splice-variant-specific antibodies to claudin-10 exist, we
carried out RT-PCRs for Cldn10a and Cldn10b on dissected tubule
segments to look for differential expression along the nephron. It
was found that Cldn10a is expressed in the proximal convoluted
tubule (PCT), medullary thick ascending limb of Henle’s loop
(mTAL) and cortical collecting duct (CCD), and possibly in the
outer (OMCD) but not inner medullary collecting duct (IMCD),
whereas Cldn10b is expressed in mTAL, OMCD and IMCD, but
not in PCT or CCD. Cldn10a_v1 expression was always found in
conjunction with that of Cldn10a (Fig. 2C).
Transient Cldn10 expression in MDCK-II cells: subcellular
localization
To determine the subcellular localization of each Cldn10 isoform,
N-terminal HA epitope-tagged constructs were generated and
transiently expressed in MDCK-II cells. Cells were
coimmunolabeled with antibodies to HA to detect the different
Table 1. Nomenclature of mouse and human CLDN10 variants and isoforms
Human
Splice variant 1
Splice variant 1 57 bp deletion in exon 1a
Splice variant 1 deletion of exon 4
Splice variant 1 57 bp deletion in exon 1a and deletion of exon 4
Splice variant 2
Splice variant 2 deletion of exon 4
Mouse
Variants
Isoforms
Variants
Isoforms
Human/mouse
protein name
CLDN10a
CLDN10a_v1
CLDN10a_v2
CLDN10a_v3
CLDN10b
CLDN10b_v1
CLDN10a
CLDN10a_i1
CLDN10a_i2
CLDN10a_i3
CLDN10b
CLDN10b_i1
Cldn10a
Cldn10a_v1
Cldn10a_v2
Cldn10a_v3
Cldn10b
Cldn10b_v1
Cldn10a
Cldn10a_i1
Cldn10a_i2
Cldn10a_i3
Cldn10b
Cldn10b_i1
claudin-10a
claudin-10a_i1
claudin-10a_i2
claudin-10a_i3
claudin-10b
claudin-10b_i1
1510
Journal of Cell Science 122 (10)
Journal of Cell Science
Fig. 4. Confocal images demonstrating
subcellular localization of Cldn10 isoforms
in MDCK-II cells. (A) Subcellular
localization of Cldn10 isoforms in
MDCK-II cells. MDCK-II cells were
transiently transfected with all six mouse
Cldn10 variant constructs, fixed with 2%
PFA and stained with anti-ZO-1 (red) and
anti-HA (green) antibodies. (B) ER-retained
Cldn10 isoforms. MDCK-II cells transiently
transfected with the three Cldn10 variants
lacking exon 4 were fixed with 2% PFA and
stained to visualize ER (anti-calrecticulin;
green) and Cldn10 isoforms (anti-HA; red).
(C) Subcellular localization of isoforms with
mutated PDZ-binding motif. MDCK-II cells
were transiently transfected with
Cldn10aΔP, Cldn10a_v1ΔP and Cldn10bΔP
mutants, fixed with 2% PFA and stained
with anti-ZO-1 (red) and anti-HA (green)
antibodies. (D) Z-scans of Cldn10expressing cell layers fixed with methanol
and stained for claudin-10 (red) and
occludin (green). Yellow staining indicates
colocalization of claudin-10 and occludin
within the tight junction. Nuclei are stained
with DAPI (blue). Basolateral side is to the
left, apical side to the right. Detector gain
was adjusted to yield similar tight junctional
claudin-10 signals in all cells. Under these
conditions, a strong claudin-10 background
signal is visible for all PDZ mutants,
indicating that most of the protein does not
reach the TJ. (E) Binding of C-terminal
Cldn10 to the ZO-1 PDZ domain. In vitro
transcribed and translated ZO-1 PDZ
domain was incubated with peptides
corresponding to the C-terminal of wildtype or mutant Cld10 coupled to beads.
Proteins bound to beads were analyzed by
SDS-PAGE, western blot and probed with
Myc antibody. (One of three similar
experiments.)
Cldn10 isoforms and either the TJ marker ZO-1 or the ER marker
calreticulin, and analyzed by confocal laser scanning microscopy.
For all six mouse Cldn10 isoforms, all isoforms translated from exon4-containing constructs were found to be localized in the plasma
membrane, showing partial colocalization with ZO-1, indicating
integration into TJs (Fig. 4A). By contrast, the isoforms translated
from constructs lacking exon 4 colocalized with calreticulin and/or
were present in vesicular structures (Fig. 4B), suggesting that they
failed to reach or be retained at the plasma membrane.
Cldn10 binds ZO-1
Claudins have been demonstrated to be anchored in the TJ through
interaction of their C-terminal PDZ-binding motif to PDZ-domain-
containing proteins such as ZO-1 (Itoh et al., 1999; Müller et al.,
2003). To test if Cldn10 binds ZO-1, MDCK-II cells were
transfected with the three Cldn10 variants containing exon 4, or
with mutants in which the C-terminal PDZ-binding motif was
mutated (ΔP). Although all three mutant variants still appeared to
be located in the plasma membrane, the colocalization with ZO-1
was strongly reduced (yellow in Fig. 4C; supplementary material
Fig. S1). However, at increased detector gain it could be
demonstrated that some of the mutated protein still resided within
the TJ (yellow in Fig. 4D).
Pull-down experiments confirmed an interaction between the ZO1 PDZ domains and the C-terminus of Cldn10, which is identical
in the three isoforms. Mutation of the PDZ-binding motif
Cldn10 isoform localization and function
1511
abolished the interaction of the PDZ domain with the ΔP Cterminus (Fig. 4E).
Stable expression of Cldn10a, Cldn10a_v1 and Cldn10b in
MDCK-C7 and MDCK-II cells
High resistance MDCK-C7 cells were stably transfected with
mouse and human Cldn10a and Cldn10b and with mouse
Cldn10a_v1. For comparison with published data (Van Itallie et al.,
2006), mouse Cldn10a and Cldn10a_v1 were additionally
transfected into low resistance MDCK-II cells.
In agreement with the transiently expressed proteins (see above),
all isoforms were located in the TJ as judged from colocalization
with the TJ marker occludin identified by confocal laser-scanning
microscopy (see supplementary material Fig. S1). Since isoforms
translated from constructs lacking exon 4 were not detected on the
cell surface, they were not analyzed further.
Journal of Cell Science
Dilution potentials and biionic potentials for cell monolayers
expressing Cldn10 variants
Ussing chamber experiments were carried out to analyze
transepithelial resistance and ion permeabilities of cell layers and
these results are summarized in Fig. 5A (see also supplementary
material Fig. S2 for alternative clones). These experiments
demonstrated that MDCK-C7 cell layers transfected with mouse or
human Cldn10b had a strongly reduced transepithelial resistance
accompanied by an increased ratio in paracellular permeability for
Na+ over Cl– (PNa/PCl). The increase in PNa/PCl was predominantly
caused by an increase in PNa. Transfection with mouse or human
Cldn10a or mouse Cldn10a_v1 did not affect PNa/PCl (Fig. 5B;
supplementary material Fig. S2).
In contrast to the findings of Van Itallie et al. (Van Itallie et al.,
2006) obtained in low resistance MDCK-II cells, no effect of
Cldn10a on PCl was observed in high resistance MDCK-C7 cells,
indicating that the positive charges in position 33 and 62 may be
necessary but not sufficient for the reported increase in Cl–
permeability. Therefore, the experiments were repeated in MDCKII cells and PCl/PNa determined in dilution potential measurements.
In agreement with the findings of Van Itallie et al. (Van Itallie et
al., 2006), Cldn10a induced an increase in PCl/PNa, an effect that
was predominantly due to an increase in PCl and that was not
observed in cells transfected with Cldn10a_v1. As permeability to
NO3– was even greater than to Cl–, NO3– permeability was also
investigated in MDCK-C7 cells. In these cells, a small increase in
PNO3/PNa was observed upon transfection with Cldn10a, but not
with Cldn10a_v1. Conversely, permeability to the larger pyruvate
was reduced in Cldn10a-transfected cells, compared with control
cells and cells transfected with Cldn10a_v1. Transfection with
Cldn10b caused a decrease in PNO3/PNa, PCl/PNa and PPyr/PNa, which
is fully explained by the increase in PNa demonstrated above
(Fig. 6).
When comparing relative permeabilities for various monovalent
cations in MDCK-C7 cells, these permeabilities followed Eisenman
sequence IV for alkali metals: K+>Rb+>Cs+=Na+>Li+ (Fig. 7A,
inset) in control cell monolayers (Eisenman, 1962). Values found
in Cldn10a (human or mouse)-transfected or Cldn10a_v1 (mouse)transfected cell monolayers did not differ significantly from the
values found in control cells.
In sharp contrast, Cldn10b (mouse or human)-transfected cell
monolayers showed a preference for Na+>Li+>K+>Rb+>Cs+,
corresponding to Eisenman sequence X. Interestingly, not only
mutation of the PDZ-binding motif but also the N-terminal fusion
Fig. 5. Transepithelial resistance and Na+ to Cl– permeability ratio of
transfected MDCK-C7 cell layers. (A) Transfection with Cldn10 caused
transepithelial resistance (Rt) to decrease in all MDCK-C7 cell layers except
those transfected with mouse Cldn10a (**P<0.01). By contrast, Rt of cocultures of MDCK-C7 cells transfected with mouse Cldn10a and Cldn10a_v1
was increased (**P<0.01, mean ± s.e.m., n=13-41). (B) Na+ over Cl–
permeability ratio (PNa/PCl) was greatly increased in Cldn10b-transfected
MDCK-C7 cell layers and in co-cultures of Cldn10a- and Cldn10b-transfected
cells. Cldn10bΔP mutant-transfected MDCK-C7 cells also showed increased
PNa/PCl values, however, the increase was considerably reduced, compared
with cells transfected with the intact PDZ-binding motif (**P<0.01, mean ±
s.e.m., n=3-35).
of YFP to the human Cldn10b abolished the decrease in
transepithelial resistance, the increase in PNa (a slight increase in
PNa was still observed in the ΔP mutant) and the change in Eisenman
sequence (Fig. 7A), although YFP-CLDN10b appeared to be
located in the TJ (supplementary material Fig. S1).
Permeability to divalent cations was also generally increased in
Cldn10b (mouse or human)-transfected cell monolayers, but
unchanged in Cldn10a- and Cldn10a_v-transfected cell monolayers
(Fig. 7B). Differences between permeabilities of the divalent
cations investigated (Mg2+, Ca2+, Sr2+, Ba2+) were too small to
attribute them to specific ‘Sherry sequences’ for divalent ions
(Diamond and Wright, 1969).
Co-culture experiments
As shown above, Cldn10a and Cldn10a_v1 are always expressed
together. It can therefore be postulated that both isoforms, claudin10a and claudin-10a_i1, are integrated into the same TJ, where they
will interact both within the same membrane (cis-interaction) and
with the extracellular loops of the corresponding isoforms from
Journal of Cell Science
1512
Journal of Cell Science 122 (10)
Fig. 6. Anion permeabilities (relative to PNa) induced by claudin-10 isoforms
in MDCK-II and MDCK-C7 cells. (A) Transepithelial resistance (left, Rt) and
relative anion permeability (right; black bars, NO3–; grey bars, Cl–) of mouse
Cldn10a- and Cldn10a_v1-transfected, low resistance MDCK-II cells. Rt was
not significantly affected by Cldn10a and Cldn10a_v1 transfection (n=8-12),
whereas relative anion permeabilities were increased in Cldn10a-transfected
MDCK-II cell layers (**P<0.01, mean ± s.e.m., n=3-7). (B) Relative anion
permeability (black bars, NO3–; grey bars, Cl–; white bars, pyruvate) of
Cldn10a-, Cldn10a_v1- and Cldn10b-transfected, high resistance MDCK-C7
cells (mouse or human Cldn10 as indicated). Cldn10a transfection increased
relative PNO3 and decreased relative PPyruvate, whereas Cldn10a_v1 transfection
had no effect. Cldn10b transfection caused an apparent decrease in relative
anion permeability, because of the increase in PNa, as shown in Fig. 5B. Coculture of Cldn10a- and Cldn10a_v1-transfected cell layers retained the
increased relative PNO3 but not the decreased relative PPyruvate (*P<0.05,
**P<0.01, mean ± s.e.m., n=4-27).
neighbouring cells (trans-interaction). Furthermore, Cldn10a and
Cldn10b were both detected in micro-dissected mTAL material,
although isoform-specific antibodies would be required to determine
their expression at the cellular level to determine if they may be in
direct contact. To explore the effects of such interactions in trans, coculture experiments were carried out. Equal amounts of suspensions
of the respective transfected MDCK-C7 cells were mixed and seeded
onto filter supports to be used in Ussing chamber experiments.
When claudin-10a- and claudin-10a_i1-expressing cells were cocultured, electrical resistance was increased, beyond control values
(Fig. 5A). Permeability to monovalent cations was unchanged
(compared with controls, claudin-10a and claudin-10a_i1), whereas
permeability to divalent cations was decreased (Fig. 7). Cell layers
retained the increased permeability for NO3– observed in claudin10a-expressing cell layers, however, the decrease in pyruvate
permeability was lost (Fig. 6B). Thus, claudin10a_i1 appears to
modulate the permeability of the TJ to large organic anions. In
additions, these finding support trans-interactions between the
respective isoforms.
Fig. 7. Cation permeabilities (relative to PCl) induced by claudin-10 isoforms
in MDCK-C7 cells. (A) Relative monovalent cation permeabilities of MDCKC7 cells transfected with Cldn10a, Cldn10a_v1 and Cldn10b, YFP::Cldn10b,
and ΔP mutants (mouse or human Cldn10 as indicated). Cldn10b transfection
of MDCK-C7 cells caused monovalent cation permeabilities to increase.
Eisenman sequence changed from IV in controls (inset) to X. Both effects
were abolished by N-terminal YFP. Transfection with Cldn10b-ΔP caused a
minor increase in cation permeabilities but no change in Eisenman sequence.
Upon co-culture of Cldn10a- and Cldn10b-transfected cells, cation
permeability was high, but permeability sequence changed to Eisenman
sequence I (**P<0.01, mean ± s.e.m., n=3-35). (B) Relative divalent cation
permeabilities of MDCK-C7 cells transfected with Cldn10a, Cldn10a_v1 and
Cldn10b (mouse or human Cldn10 as indicated). Cldn10b transfection of
MDCK-C7 cells caused divalent cation permeabilities to increase. Cldn10a
and Cldn10a_v1 transfection had no effect on divalent cation permeability,
whereas co-culture of these cells caused a reduction in divalent cation
permeability. (*P<0.05, **P<0.01, mean ± s.e.m., n=3-18).
Co-cultures of cells expressing claudin-10a and claudin-10b still
exhibited the increase in cation permeability observed in claudin10b-expressing cells, however, the permeability sequence almost
reversed to Cs+>Rb+>K+>Na+>Li+, which corresponds to Eisenman
sequence I (Fig. 7A). The combined effect of these two claudins
therefore reduces interaction between ion and pore below that
observed in control cells.
Discussion
Claudin-10 isoforms
Two major isoforms of claudin-10, Cldn10a and Cldn10b, were
previously described by Van Itallie et al. (Van Itallie et al., 2006).
These isoforms differ in the amino acids encoded by the first of
Journal of Cell Science
Cldn10 isoform localization and function
the five claudin-10 exons. This results in differences in the first
extracellular loops of the protein isoforms and, most remarkably
in the net charge of the first extracellular loop (CLDN10a, +5 in
mouse, +6 in human; CLDN10b, –1 in mouse and human; see Fig.
1). CLDN10a_i1, a third isoform identified in this study, also
appears to reside within the TJ. This variant lacks 19 amino acids
within the first extracellular loop, including four of the positively
and, in mouse, one of the negatively charged amino acids of the
first loop of CLDN10a, resulting in a net charge of +2 in mouse
and human. One of the positive charges lacking (R62) is one of
the two positive charges found to be essential for CLDN10a
function as a paracellular anion channel (Van Itallie et al., 2006).
Furthermore, CLDN10a_i1 lacks the second of two cysteines (C61
in CLDN10a) highly conserved within the claudin family. Mutation
of this cysteine in Cldn5 completely abolished its effect on
paracellular tightness (Wen et al., 2004). However, it cannot be
ruled out that an additional cysteine (C77) present in the first loop
could substitute for C61.
For each of the messenger RNAs encoding these three isoforms
there also exists an alternatively spliced transcript lacking exon 4
which, when overexpressed in MDCK-II cells, was not
incorporated into the TJ and was therefore not investigated
electrophysiologically. Whether the isoforms lacking exon 4 are
of any functional significance remains to be determined,
paricularly given their apparently low expression levels as
compared with Cldn10a and Cldn10a_v1. One possibility is that
cis-oligomerization between Cldn10a and Cldn10a_i1 and the ERretained variants could serve to regulate surface expression levels
of Cldn10a and Cldn10a_i1.
Tissue distribution
With respect to expression of the six Cldn10 splice variants in
various mouse tissues (brain, eye, spleen, lymph node, thymus,
lung, liver, stomach, kidney, testis, prostate, placenta, uterus,
skeletal muscle, heart, smooth muscle), we observed ubiquitous
expression of the two transcripts containing exon 1b (Cldn10b,
Cldn10b_v1), thus confirming the findings for Cldn10b already
described (Van Itallie et al., 2006). All four transcripts containing
exon 1a (Cldn10a, Cldn10a_v1, Cldn10a_v2, Cldn10a_v3) were
found in the kidney and the uterus. Within the kidney, PCT and
CCD expressed only transcripts containing exon 1a, OMCD and
IMCD predominantly (OMCD) or only (IMCD) transcripts
containing exon 1b, whereas mTAL expressed all variants.
The expression pattern of claudin-10 described by KiuchiSaishin et al. (Kiuchi-Saishin et al., 2002) is at variance with that
found by Van Itallie et al. (Van Itallie et al., 2006). Kiuchi-Saishin
et al. found claudin-10 exclusively in the proximal tubule and the
TAL (Kiuchi-Saishin et al., 2002). Similar to our data, Van Itallie
et al. (Van Itallie et al., 2006) found weak claudin-10 expression
in PCT and DCT, and high expression in the macula densa, the
cortical and medullary TAL and both CCD and IMCD, with a
Cldn10a preferentially expressed in the cortex whereas Cldn10b
was more abundant in the medulla. Thus, the findings in the present
study seem to be most similar to those of Van Itallie et al. (Van
Itallie et al., 2006).
Functional characterization of claudin-10a, claudin-10a_v1 and
claudin-10b
When expressed in low resistance MDCK-II or high resistance
MDCK-C7 cells, CLDN10a, CLDN10a_i1 and CLDN10b were
located in the TJ of the transfected cell layers, as judged from
1513
colocalization with the TJ marker protein occludin by confocal laser
scanning microscopy. Therefore these cell layers were further
investigated electrophysiologically. In agreement with the data
published by Van Itallie et al. (Van Itallie et al., 2006), Cldn10atransfected low resistance MDCK-II cell layers showed an increase
in paracellular anion (Cl–, NO3–) permeability, an effect not observed
in Cldn10a_v1-transfected cells. By contrast, when high-resistance
MDCK-C7 cells were transfected with Cldn10a, no effect on PCl
was observed. Cldn10a transfected cell layers, however, showed
an increased PNO3 and a decreased PPyr, indicating a stronger
interaction between the TJ pore and the permeating anion. Neither
effect was present in Cldn10a_v1- or in Cldn10b-transfected cell
layers.
Of the three claudin-10 isoforms investigated in the present
study, only claudin-10a_i1 appeared to lack a specific function
with respect to paracellular ion permeabilities in MDCK-C7 cells.
However, when the extracellular loops of claudin-10a and claudin10a_i1 were brought into contact in trans by co-culturing the
respective transfected cells, the decrease in paracellular pyruvate
permeability was lost whereas the increase in NO3– permeability
remained unchanged. We therefore conclude that claudin-10a_i1
may specifically modulate the function of claudin-10a with
respect to organic anions. As both isoforms are always coexpressed
(see Fig. 2), it is tempting to speculate that organic anion
permeability is regulated by relative amounts of claudin-10a and
claudin-10a_i1 within the TJ, especially in the PCT and possibly
also in the uterus. Validation of this hypothesis will require
isoform-specific antibodies to analyze expression at the single cell
level.
In Cldn10b-transfected MDCK-C7 cell layers, electrical
resistance was greatly reduced, because of a dramatic increase in
cation permeability. Furthermore, the permeability sequence for
monovalent cations changed from Eisenman sequence IV in control,
Cldn10a- or Cldn10a_v1-transfected MDCK-C7 cells to Eisenman
sequence X in Cldn10b-transfected MDCK-C7 cells, indicating a
change in pore–ion interaction from a low field strength to a high
field strength binding site in the presence of Cldn10b. This increase
in field strength causes partial removal of the hydration shell of the
permeating ion and thus sorts ions according to their unhydrated
diameter. A low transepithelial resistance (in the order of 30 Ω ·cm2)
and a high Eisenman sequence (VIII or IX) has previously been
determined by Greger (Greger, 1981) in isolated TAL segments of
the rabbit kidney.
In contrast to all other nephron segments investigated, Cldn10a
and Cldn10b were both detected in microdissected mTAL
material. As no isoform-specific antibodies are available, it is
not clear whether cells expressing these two isoforms are present
in distinct regions of the TAL, or whether they are coexpressed
throughout the TAL. To mimic the latter possibility, cells
expressing the respective isoforms were co-cultured and subjected
to Ussing chamber experiments. Strikingly, monovalent cation
permeability, although still high, completely reversed its
permeability sequence to Eisenman sequence I. This indicates
that removal of the hydration shell of these ions is no longer
possible in paracellular pores consisting of trans-interacting
claudin-10a and claudin-10b. This is in contrast to the conditions
found in isolated TAL tubules (Greger, 1981), making it unlikely
that such an interaction occurs under physiological conditions,
at least in the TAL.
Thus, claudin-10b is most probably the major contributor to the
low resistance and strong cation selectivity of the TAL in vivo.
1514
Journal of Cell Science 122 (10)
Journal of Cell Science
Alterations of the C- and N-terminus
Mutation of the C-terminal PDZ-binding motif greatly reduced the
amount of claudin-10 residing in the TJ, as judged from
immunocytochemical stainings. This, as expected from analogous
experiments on claudin-16 (Kausalya et al., 2006), reduced
(CLDN10b) or abolished (CLDN10a) the contribution of the
claudins to the electrophysiological properties of the transfected
cell monolayer. It is noteworthy that alteration of the N-terminus
by the addition of YFP to CLDN10b also completely abolished
functionality of the protein, although, as judged from confocal laser
scanning microscopy, YFP-CLDN10b was still located in the TJ.
One possibility is that the YFP interferes with cis-interactions of
neighbouring claudins within the TJ.
Even more dramatic effects were observed for the three splice
variants lacking exon 4, which, if translated, would carry an inframe deletion of 36 amino acids. These 36 amino acids contain
the complete fourth transmembrane region of the proteins (topology
according to UniProt database), which means that the C-termini of
these proteins should come to lie on the extracellular side of the
membrane. Alternatively, another database (TMHMM Server v 2.0)
assigns an alternative transmembrane region for these isoforms. In
both cases, the resulting structural changes are envisaged to prevent
the C-terminal interactions with PDZ domains.
None of these isoforms appeared to reach the TJ but colocalized
with the ER marker calreticulin. Given that these three variants are
expressed in vivo, it will be of interest to determine in future
experiments, if they possess any regulatory function. For example,
cis-dimerization with functional isoforms could regulate surface
expression levels of functional claudin-10 isoforms.
Implications for renal physiology
The high PNa caused by the presence of claudin-10b contributes
directly to the lumen positive potential within the TAL, because of
the formation of a lumen positive dilution potential, especially in
the cortical segment of the TAL (Greger, 1981). This increases the
driving force for the resorption of other cations, especially Ca2+
and Mg2+. As both PCa and PMg are increased in the presence of
claudin-10b, this isoform appears to be of major importance to the
resorption of divalent cations. Potential interactions between
claudin-10b and the two claudins that have already been linked to
Mg2+ resorption, claudin-16 and 19 (Müller et al., 2003; Kausalya
et al., 2006; Hou et al., 2008) (for a review, see van de Graaf et al.,
2007) are therefore highly interesting and will be subject of future
experiments.
When extrapolating Eisenman sequence X observed in Cldn10btransfected cell layers to estimate the H+ permeability (Eisenman,
1962), it seems very probable that Cldn10b-transfected cell layers
are considerably more permeable to H+ than control or Cldn10atransfected cell layers. Such a paracellular H+ permeability in the
TAL has for example been postulated as part of a model for
ammonium uptake (Kikeri et al., 1989). Unfortunately H+
permeability could not be investigated directly, as this would involve
the application of a pH gradient across the cell layer. Changing the
extracellular pH, however, is known to affect the paracellular cation
selectivity by titrating the electrical charge (Cereijido et al., 1978)
and adhesion (Lim et al., 2008) of TJ proteins, and thus would affect
the parameter to be determined in the present case.
Comparison of the findings in MDCK-C7 cells with those in
MDCK-II cells underlines the strong influence of the presence of
endogenous claudins on the permeability induced by transfected
exogenous claudins previously demonstrated by Van Itallie et al.
(Van Itallie et al., 2003). The major difference between the
endogenous claudins of the two MDCK cell lines is the presence
of claudin-2 in MDCK-II but not in MDCK-C7 cells (western blot
analyses on claudins-1 to 5 and claudin-7; S.M.K., unpublished
results). Claudin-2 is known to act as a paracellular cation pore
(Amasheh et al., 2002).
The effect of claudin-10a on anion permeability was enhanced
by the presence of claudin-2 in MDCK-II cells, whereas the effect
of claudin-10b on cation permeability was masked by claudin-2.
As claudin-2 is not present in nephron segments distal to the thin
descending limb of Henle’s loop (Kiuchi-Saishin et al., 2002), such
an interaction should be of no relevance to the function in these
distal nephron segments, but may be of importance in the PCT.
Future studies will have to address how other endogenous claudins
present in MDCK cells may contribute to the observed effects.
Conclusions
In conclusion, six claudin-10 variants have been found in human
and mouse. In these variants, the presence (claudin-10a, claudin10a_v1, claudin-10b) or absence (claudin-10a_v2, claudin-10a_v3,
claudin-10b_v1) of exon 4 determines, whether the claudin is
localized in the TJ or retained in the endoplasmic reticulum,
respectively. The presence of either exon 1a or 1b determines,
whether expression of the resulting claudin-10 variants is restricted
to kidney and uterus (claudin-10a, claudin-10a_v1, claudin-10a_v2,
claudin-10a_v3) or whether expression is ubiquitous (claudin-10b,
claudin-10b_v1). Within the kidney, the segments of the nephron
investigated in the present study express either exclusively exon
1a-containing variants (PCT, CCD), or exon 1b-containing variants
(IMCD), or both (mTAL, OMCD).
Of the three claudin-10 variants localized in the TJ, two (claudin10a, claudin-10b) had direct effects on the ion selectivity of the
paracellular pathway, when overexpressed in MDCK cells. Both
claudin-10 variants appear to increase the field-strength of the ion
binding site within the paracellular pore, thus favouring the passage
of ions with small dehydrated ion radius. In the case of claudin10a, this effect relates to anions, in claudin-10b, to cations. Claudin10a_v1 has no direct effect, but modulates claudin-10a effects on
organic anion permeability.
Comparison of results in different expression systems shows that
the magnitude of claudin-10 effects on paracellular ion permeability
depends strongly on the endogenous claudins present in these cells.
This is of great importance for the ubiquitously distributed claudin10b, which thus qualifies as a potent cation channel in tissues not
expressing claudin-2.
Materials and Methods
Cldn10 variant and isoform nomenclatures are given in Table 1.
RT-PCR and cloning of cldn10 variants
Total RNA was extracted from mouse and human kidney using TRIzol reagent
(Invitrogen, Carlsbad, CA), according to the protocol described by the manufacturer.
Kidney cDNA was synthesized from 2 μg total RNA using Omniscript Reverse
Transcriptase (Qiagen, Hilden, Germany) in a 20 μl reaction volume.
PCRs were performed with Phusion DNA polymerase (Finnzymes, Espoo, Finland)
unless otherwise specified. PCR products were cloned into pGEM-T easy according
to the manufacturer’s instructions (Promega, Madison, WI) and sequenced.
There are some amino acid differences between published mouse Cldn10 sequences.
Compared with the mouse genomic database (NCBI build 37, July 2007), our clones
have one non-silent nucleotide difference, resulting in one amino acid difference
T217A or T219A for variants a and b, respectively. The sequence resulting in the
Thr to Ala amino acid change was found in the majority of Cldn10 messengers in
the NCBI nucleotide database. Therefore, we have assumed this to be the most
prevalent sequence.
Cldn10 isoform localization and function
Molecular cloning of human CLDN10a and CLDN10b cDNA was performed by
PCR with respective forward primers (5⬘-GCGGCGCGACATGTCCAGG-3⬘, 5⬘CCGGCGGCATGGCTAGCA-3⬘) and reverse primer (5⬘-CGAGCTCTTTTAGACATAAGC-3⬘) using human kidney cDNA as template. Cycling conditions were
30 seconds at 96°C, 30 seconds at 58°C (CLDN10a) or 60°C (CLDN10b) and 90
seconds at 72°C for 35 cycles with an initial denaturation of 1 minute and final
extension of 10 minutes. The resulting PCR products encompassing the complete
CLDN10a and CLDN10b coding sequences were cloned into pTOPO (Invitrogen).
The human CLDN10 variant with a deletion of the last 57 nucleotides of exon 1a
(CLDN10a_v1) was amplified using forward primer 5⬘-GATGAACTGCGCAGGTTATATA-3⬘ and reverse primer 5⬘-AGATGTGGCCCCGTTGTATG-3⬘
under the following cycling conditions: 10 seconds at 98°C, 30 seconds at 65°C and
15 seconds at 72°C for 35 cycles with an initial denaturation of 30 seconds and final
extension of 10 minutes.
Journal of Cell Science
Generation of expression constructs
To obtain expression constructs for each mouse Cldn10 variant, primers were designed
to introduce a 5⬘ KpnI restriction site, a Kozak sequence (underlined in the following
sequence) and an in frame N-terminal HA epitope tag (ACCATGGCTTACCCATACGATGTTCCAGATTACGCT) to replace the start ATG and a 3⬘ XbaI site. After PCR
on mouse kidney cDNA, the amplicons were cloned into pGEM-T easy and
subcloned into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA)
using the KpnI and XbaI restriction sites.
Expression clones that lack exon 4 were created using a PCR-based strategy: both
the region 5⬘ and 3⬘ of exon 4, both with 12 base pairs overlap, were amplified
separately using the full length constructs as template. These PCR products were
then used together as a template in a second PCR. Subsequent subcloning into pcDNA3
was carried out as described above.
To obtain expression constructs for all Cldn10 variants with an inactivating mutation
of the PDZ-binding motif, a PCR was performed on the existing expression
constructs, using the reverse primer 5⬘-CGTCTAGATTACGCCGCGGCATTTTTATCAAACTGTTTTG-3⬘ that changed TyrVal(stop) into AlaAla(stop).
Human CLDN10a and b were similarly subcloned into eukaryotic expression
vectors using the 5⬘ HindIII and 3⬘ XbaI restriction sites for pFLAG-CMV4 (Sigma
Aldrich, St Louis, MO) and for a modified pcDNA3.1 vector (a generous gift from
Otlmar Huber, Charité, Berlin), tagging the N-terminus of claudin-10 with yellow
fluorescent protein (YFP).
All expression constructs were sequence verified and primer sequences that are
not mentioned are available upon request.
1515
serum, 100 U/ml penicillin and 100 μg/ml streptomycin (PAA). Cells were cultured
at 37°C in a humidified 5% CO2 atmosphere.
MDCK-II and MDCK-C7 cells were either transiently or stably transfected with
mouse Cldn10 variant constructs using Lipofectamine 2000 (Invitrogen, Gaithersburg,
MD) or with human CLDN10 variant constructs employing the Lipofectamine plus
method (Gibco BRL, Invitrogen) as previously described by Kausalya et al. (Kausalya
et al., 2006), Müller et al. (Müller et al., 2003) and Amasheh et al. (Amasheh et al.,
2002), respectively. G418-resistant cell clones were screened for claudin-10 expression
by western blot analysis which was carried out as described in detail by Amasheh et
al. (Amasheh et al., 2002). Briefly, membrane protein was extracted (membrane lysis
buffer: 20 mM Tris, 5 mM MgCl2, 1 mM EDTA, 0.3 mM EGTA, protease inhibitors;
Complete EDTA-free, Boehringer, Mannheim, Germany) and separated by SDSPAGE (12.5%, 10 μg protein/lane). Claudin-10 was detected by immunoblotting,
employing antibodies raised against human claudin-10 (Zymed Laboratories,
Invitrogen Immunodetection, San Francisco, CA), against the FLAG-tag or against
the HA-tag (Sigma Aldrich, St Louis, MO), as appropriate. To exclude secondary
effects through changes in the expression of endogenous claudins, western blots were
also probed for claudins 1-5, 7 and 8 (see supplementary material Fig. S3).
Positive clones were screened further by immunocytochemistry as described below,
to ensure appropriate localization of claudin-10. MDCK-C7 cells mock-transfected
with respective empty vectors served as controls.
Immunocytochemistry
Transiently transfected MDCK-II cells were grown on coverslips and processed for
confocal microscopy as previously described (Müller et al., 2003; Kausalya et al.,
2006) using rat anti-HA (Roche; 1:100), rabbit anti-calreticulin (ABR; 1:300), and
rabbit anti-ZO-1 (Zymed; 1:200) antibodies and suitable fluorescently labeled
secondary antibodies (Invitrogen).
Stably transfected MDCK-C7 and MDCK-II cells were grown on transparent culture
plate inserts (pore size 0.4 mm, effective area 0.6 cm2; Millicell-PCF, Millipore,
Bedford, MA). Cells were rinsed with PBS, fixed with methanol or 2%
paraformaldehyde in PBS, and permeabilized with PBS containing 0.5% Triton X100. No differences resulting from the two fixation methods were observed. Primary
antibodies employed were mouse anti-occludin and rabbit anti-claudin 10 (Zymed).
Concentrations of primary antibody were 10 mg/ml. Secondary antibodies Alexa Fluor
488 goat anti-mouse and Alexa Fluor 594 goat anti-rabbit (both used at concentrations
of 2 mg/ml) were purchased from Molecular Probes (Eugene, OR). DAPI (4⬘,6diamidino-2-phenylindole dihydrochloride; 1 mM) was used to stain cell nuclei.
Fluorescence images were obtained with a confocal microscope (Zeiss LSM510, Jena,
Germany) using excitation wavelengths of 543 nm, 488 nm and 405 nm.
Semi-quantitative PCR on multiple tissue mouse cDNA panels
PCRs were performed on MTC mouse Panels I and III from Clontech (Mountain
View, CA) using forward primer 5⬘-TCCAACGAATGGAAAGTGACC-3⬘ and
either reverse primer 5⬘-TCTCCTTCTCCGCCTTGATAC-3⬘ to obtain
Cldn10a/Cldn10a_v1 or reverse primer 5⬘-CGTTGTATGTGTAGCCCATTTTTT-3⬘
to obtain Cldn10a_v2/Cldn10a_v3 and forward primer 5⬘-TCGCCTTCGTAGTCTCCATC-3⬘ and reverse primer 5⬘-TCTCCTTCTCCGCCTTGATAC-3⬘ to
amplify Cldn10b.
Cycling conditions for Cldn10a/Cldn10a_v1 were: 10 seconds at 98°C, 30 seconds
at 62°C and 20 seconds at 72°C for 35 cycles, for Cldn10a_v2/Cldn10a_v3:
10 seconds at 98°C, 30 seconds at 68°C and 16 seconds at 72°C and for
Cldn10b: 10 seconds at 98°C, 30 seconds at 62°C and 20 seconds at 72°C. Initial
denaturations of 30 seconds and final extensions of 10 minutes were included. PCR
volumes were 50 μl and 5 μl samples were taken after 25 and 30 cycles.
RT-PCR on dissected mouse nephron segments
Kidneys used for microdissection were taken from 12-week-old male C57BL/6J mice.
Tubular segments were isolated and first strand cDNA was made as described
previously (Stehberger et al., 2003; Smith et al., 2005). Although PCT (proximal
convoluted tubule, mTAL medullary thick ascending limb of Henle’s loop), CCD,
OMCD and IMCD (cortical, outer and inner medullary collecting duct) were
unequivocally identified, glomeruli appeared to be contaminated with macula densa
and/or DCT material (judged from the presence of NKCC2 and NCC mRNA) and
were therefore omitted from the present analyses.
Samples of the cDNA preparations were checked by TaqMan real-time PCR for
their Hprt1 Ct values to estimate relative concentrations. Individual cDNA amounts
used in the actual PCR were adjusted accordingly. Used primer pairs and cycling
conditions were identical to those described above, except that the number of cycles
was now 40. The β-actin controls were amplified using Taq polymerase with forward
primer 5⬘-GGGCTGTATTCCCCTCCATC-3⬘ and reverse primer 5⬘-CTCCGGAGTCCATCACAATG-3⬘ under the following cycling conditions: 10 seconds at 94°C,
30 seconds at 57°C and 25 seconds at 72°C for 36 cycles with an initial denaturation
of 10 seconds and final extension of 7 minutes.
Cell culture and transfection
Monolayers of cells of the high resistance MDCK-C7 (Gekle et al., 1994) strain and
the low resistance MDCK-II strain were grown in 25 cm2 culture flasks containing
MEM-EARLE (PAA, Pasching, Austria), supplemented with 10% (v/v) fetal bovine
Pull-down experiments
Peptides corresponding to the 11 C-terminal amino acids of wild-type or mutant
Cldn10 (last two amino acids mutated to alanine) were custom synthesized and coupled
to Dynabeads (Dynal) by Biogenes, Germany. The pull-down experiment was
performed essentially as described by Müller et al. (Müller et al., 2003) but with
some modifications. Briefly, to construct Myc-tagged human ZO-1 PDZ domain
cDNA, PDZ domains (amino acids 1-507 of ZO-1) were fused in frame to an Nterminal Myc tag in pGBKT7 vector (Clontech) as described by Kausalya et al.
(Kausalya et al., 2001). Subsequently, Myc-tagged PDZ domains were generated by
in vitro transcription and translation (Quick coupled T7 TNT: Promega). 10 μl of the
product was incubated with peptide-coupled Dynabeads (2-10 μg peptide) for 2 hours
at 4°C in binding buffer (25 mM Tris, pH 7.5, 50 mM NaCl and 0.1% Tween 20; or
0.1% Triton X-100, 20 mM MgCl2 and 1 mM DTT). Beads were then rinsed with
washing buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.1% Tween 20, or
0.1% Triton X-100, 20 mM MgCl2, and 1 mM DTT) and were resuspended in SDS
sample buffer. Bound ZO-1 PDZ domains were analyzed by SDS-PAGE and western
blotting and detected using mouse anti Myc antibodies (Roche).
Electrophysiology
For electrophysiological measurements and molecular analyses, epithelial cell
monolayers were grown on culture plate inserts (pore size 0.45 μm, effective area
0.6 cm2; Millicell-HA). Confluent cell layers were used on days 5-7 after seeding.
Inserts were mounted in Ussing chambers specially designed for insertion of Millicell
filters (Kreusel et al., 1991), and water-jacketed gas lifts were filled with 10 ml
circulating fluid on each side. The standard bath solution contained: 119 mM NaCl,
21 mM NaHCO3, 5.4 mM KCl, 1.2 mM CaCl2, 1 mM MgSO4, 3 mM Hepes, and
10 mM D(+)-glucose. The solution was constantly bubbled with 95% O2 and 5%
CO2, to ensure a pH value of 7.4 at 37°C. Resistance of bath solution and filter support
(Rfilter) was measured before each single experiment and subtracted.
To determine ion permeabilities, 5 ml of the standard bath solution on either the
apical or the basolateral side of the cell layer was replaced by one of the solutions
listed in Table 2. Resulting potentials were corrected for liquid junction potentials
which were determined in analogous experiments using empty filter supports. Liquid
junction potentials may be greatly affected by the freshness of agar bridges used, so
that errors cannot be completely excluded. Although this would affect total
permeabilities, it would not change the relative differences between the clones
investigated and would thus be irrelevant to the general conclusions.
1516
Journal of Cell Science 122 (10)
Table 2. Solutions*
Solution
1
2
3
4
5
6
7
8
9
10
11
12
13
14
NaCl
NaHCO3
119
21
21
21
21
21
21
Mannitol
XY
238
119 LiCl
119 RbCl
119 CsCl
140
280
93.3 SrCl2
93.3 BaCl2
140 NaNO3
140 sodium pyruvate
KCl
CaCl2
MgCl2/MgSO4
HEPES
Glucose
5.4
5.4
5.4
124.4
5.4
5.4
5.4
5.4
5.4
5.4
5.4
5.4
5.4
5.4
1.2
1.2
1.2
1.2
1.2
1.2
1.2
1.2
1.2
94.5
1.2
1.2
1.2
1.2
1 (MgSO4)
1 (MgSO4)
1 (MgSO4)
1 (MgSO4)
1 (MgSO4)
1 (MgSO4)
1 (MgSO4)
1 (MgCl2)
94.3 (MgCl2)
1 (MgCl2)
1 (MgCl2)
1 (MgCl2)
1 (MgCl2)
1 (MgCl2)
3
3
3
3
3
3
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
Journal of Cell Science
*All values are mM.
The permeability ratio, PNa/PCl was calculated using Eqn 1, from ‘dilution
potentials’ resulting from the replacement of NaCl by mannitol (Table 2, solutions 1
and 2). Absolute permeabilities for Na+ and Cl– (PNa, PCl) were calculated according
to Eqn 2 (see Hou et al., 2005), using the PNa/PCl calculated from Eqn 1 and the
transepithelial resistance determined during the same experiment.
Relative permeabilities for monovalent cations X+, PX/PNa, were calculated from
‘biionic potentials’ resulting from the replacement of NaCl with the respective chloride
salt of the cation (Table 2, solutions 3-6), using the average PNa/PCl calculated from
dilution potentials of the appropriate cell type, employing Eqn 3.
To determine permeabilities for divalent cations, X2+, from analogous biionic
experiments, standard conditions had to be changed to bicarbonate-free conditions
(Table 2, solution 7), to avoid precipitation. 5 ml of this solution on the basolateral
side was exchanged for 5 ml of a solution in which NaCl was iso-osmotically replaced
by mannitol (Table 2, solution 8). The resulting dilution potential was used to
determine PNa/PCl as described above. Subsequently, 5 ml of solution on the apical
side was replaced with the appropriate solution (Table 2, solution 9-12). The potential
difference between the original condition (140 mM Na+ on the apical and basolateral
side) and the final condition (70 mM Na+ on both sides, mannitol on the basolateral
side versus chloride salt of a divalent cation on the apical side) was used to calculate
relative permeabilities, PX/PNa, from Eqn 4. Absolute permeabilities, PX were
calculated, using the PNa determined within the same experiment. It proved impossible
to do the reverse of this experiment (i.e. mannitol on the apical side, divalent cation
on the basolateral side), because an increase in basolateral divalent cation concentration
elicited transcellular Cl– secretion by activating the basolateral calcium sensing
receptor, thus distorting the recorded biionic potential signal.
Relative permeabilities for monovalent anions Y– were also carried out under
bicarbonate-free conditions, employing two different methods. Method a: relative
permeabilities, PY/PNa, were calculated from ‘dilution potentials’ resulting from the
replacement of NaY (Table 2, solution 7, 13, or 14) with mannitol (Table 2, solution
8), using Eqn 5. Method b: relative permeabilities, PY/PCl, were calculated from
‘biionic potentials’ resulting from the replacement of NaCl (Table 2, solution 7) with
the respective sodium salt of the anion (Table 2, solution 13 or 14), using the average
PNa/PCl calculated from dilution potentials, employing Eqn 6.
Absolute permeabilities of Na+ and Cl–
PCl =
G
⎡⎣ NaCl ⎤⎦
PNa = PCl ⋅
⋅
R ⋅T
1
⋅
,
F 2 1 + PNa PCl
PNa
G
R ⋅T
1
P
=
⋅
⋅
⋅ Na ,
PCl
⎡⎣ NaCl ⎤⎦ F 2 1 + PNa PCl PCl
(2)
where G is transepithelial conductance [1/(transepithelial resistance)].
Relative permeability of a monovalent cation X
(
)
aNa − ap + PCl PNa ⋅aCa − bl − 10( ΔE / s ) ⋅ aNa − bl + PCl PNa ⋅aCl − ap
Px
=
.
PNa
10( ΔE / s ) ⋅ aX − bl − aX − ap
(3)
Relative permeability of a divalent cation X
Px
− nNa − PCl PNa ⋅ nCl ⋅ zCl
=
PNa
nx ⋅ zx
with
n= z⋅
(4)
z ( ΔE / s )
− aap
ΔE abl ⋅10
⋅
,
z ( ΔE / s )
s
10
−1
where a is the respective activity and z, the respective charge number.
Relative permeability of a monovalent anion Y
Method a (constant, low [Cl–], contribution assumed to be negligible):
aNa − ap − 10( ΔE / s ) ⋅ aNa − bl
PY
=
.
PNa
10( ΔE / s ) ⋅ aY − ap − aY − bl
(5)
Method b (constant [Na+]):
Equations
(
s = 2.303 ⋅
R ⋅T
F
)
PNa PCl ⋅aNa − ap + aCl − bl − 10( ΔE / s ) ⋅ PNa PCl ⋅aNa − bl + aCl − ap
PY
=
.
PCl
10( ΔE / s ) ⋅ aY − ap − aY − bl
General
ΔE = Ebl – Eap (corrected for liquid junction potentials):
(6)
,
where R is the universal gas constant, T is absolute temperature, F, is the Faraday
constant.
aIon-ap and aIon-bl, are apical and basolateral ion activities, respectively, calculated
from the modified Debye-Hückel formalism and constants published by Meier (Meier,
1982).
Relative permeabilities of Na+ and Cl–
10( ΔE / s ) ⋅ aCl − ap − aCl − bl
PNa
=
.
PCl
aNa − ap − 10( ΔE / s ) ⋅ aNa − bl
(1)
We would like to thank Carsten Wagner and Ana Velic (Institute of
Physiology, University of Zürich) for microdissection of nephron
segments. Valuable technical assistance from Detlef Sorgenfrei and
Christina Papadopoulos (Institute of Clinical Physiology, Charité,
Berlin) is gratefully acknowledged. This study was financially supported
by the Agency for Science and Technology (A*STAR), Singapore to
W.H., by the European Union (European Renal Genome Project
EuReGene, FP6 05085 and EUNEFRON, FP7) to D.M., by the
German Research Foundation (DFG GU447/11-1) and by the
Sonnenfeld-Stiftung to D.G.
Cldn10 isoform localization and function
Journal of Cell Science
References
Amasheh, S., Meiri, N., Gitter, A. H., Schöneberg, T., Mankertz, J., Schulzke, J. D.
and Fromm, M. (2002). Claudin-2 expression induces cation-selective channels in tight
junctions of epithelial cells. J. Cell Sci. 115, 4969-4976.
Cereijido, M., Robbins, E. S., Dolan, W. J., Rotunno, C. A. and Sabatini, D. D. (1978).
Polarized monolayers formed by epithelial cells on a permeable and translucent support.
J. Cell Biol. 77, 853-880.
Diamond, F. M. and Wright, E. M. (1969). Biological membranes: the physical basis of
ion and nonelectrolyte selectivity. Annu. Rev. Physiol. 31, 581-646.
Eisenman, G. (1962). Cation selective glass electrodes and their mode of operation. Biophys.
J. 2, 259-323.
Gekle, M., Wünsch, S., Oberleithner, H. and Silbernagl, S. (1994). Characterization of
two MDCK-cell subtypes as a model system to study principal cell and intercalated cell
properties Pflügers Arch. 428, 157-162.
Greger, R. (1981). Cation selectivity of the isolated perfused cortical thick ascending limb
of Henle’s loop of rabbit kidney. Pflügers Arch. 390, 30-37.
Guan, X., Inai, T. and Shibata, Y. (2005). Segment-specific expression of tight junction
proteins, claudin-2 and -10, in the rat epididymal epithelium. Arch. Histol. Cytol. 68,
213-225.
Hashizume, A., Ueno, T., Furuse, M., Tsukita, S., Nakanishi, Y. and Hieda, Y. (2004).
Expression patterns of claudin family of tight junction membrane proteins in developing
mouse submandibular gland. Dev. Dyn. 231, 425-431.
Holmes, J. L., Van Itallie, C. M., Rasmussen, J. E. and Anderson, J. M. (2006). Claudin
profiling in the mouse during postnatal intestinal development and along the
gastrointestinal tract reveals complex expression patterns. Gene Expr. Patterns 6, 581588.
Hou, J., Paul, D. L. and Goodenough, D. A. (2005). Paracellin-1 and the modulation of
ion selectivity of tight junctions. J. Cell Sci. 118, 5109-5118.
Hou, J., Renigunta, A., Konrad, M., Gomes, A. S., Schneeberger, E. E., Paul, D. L.,
Waldegger, S. and Goodenough, D. A. (2008). Claudin-16 and claudin-19 interact and
form a cation-selective tight junction complex. J. Clin. Invest. 118, 619-628.
Inai, T., Sengoku, A., Guan, X., Hirose, E., Iida, H. and Shibata, Y. (2005). Heterogeneity
in expression and subcellular localization of tight junction proteins, claudin-10 and -15,
examined by RT-PCR and immunofluorescence microscopy. Arch. Histol. Cytol. 68,
349-360.
Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M. and Tsukita, S. (1999). Direct
binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the
COOH termini of claudins. J. Cell Biol. 147, 1351-1363.
Kausalya, P. J., Reichert, M. and Hunziker, W. (2001). Connexin45 directly binds to
ZO-1 and localizes to the tight junction region in epithelial MDCK cells. FEBS Lett.
505, 92-96.
Kausalya, P. J., Amasheh, S., Günzel, D., Wurps, H., Müller, D., Fromm, M. and
Hunziker, W. (2006). Disease-associated mutations affect intracellular traffic and
paracellular Mg2+ transport function of claudin-16. J. Clin. Invest. 116, 878-891.
1517
Kikeri, D., Sun, A., Zeidel, M. L. and Hebert, S. C. (1989). Cell membranes impermeable
to NH3. Nature 339, 478-480.
Kiuchi-Saishin, Y., Gotoh, S., Furuse, M., Takasuga, A., Tano, Y. and Tsukita, S. (2002).
Differential expression patterns of claudins, tight junction membrane proteins, in mouse
nephron segments. J. Am. Soc. Nephrol. 13, 875-886.
Kreusel, K. M., Fromm, M., Schulzke, J. D. and Hegel, U. (1991). Cl– secretion in
epithelial monolayers of mucus-forming human colon cells (HT-29/B6). Am. J. Physiol.
261, C574-C582.
Lim, T. S., Vedula, S. R., Hui, S., Kausalya, P. J., Hunziker, W. and Lim, C. T. (2008).
Probing effects of pH change on dynamic response of Claudin-2 mediated adhesion
using single molecule force spectroscopy. Exp. Cell Res. 314, 2643-2651.
Meier, P. C. (1982). Two parameter Debye-Hückel approximation for the evaluation of
mean activity coefficients of 109 electrolytes. Anal. Chim. Acta 136, 363-368.
Müller, D., Kausalya, P. J., Claverie-Martin, F., Meij, I. C., Eggert, P., Garcia-Nieto,
V. and Hunziker, W. (2003). A novel claudin-16 mutation associated with childhood
hypercalciuria abolishes binding to ZO-1 and results in lysosomal mistargeting. Am. J.
Hum. Genet. 73, 1293-1301.
Ohta, H., Adachi, H., Takiguchi, M. and Inaba, M. (2006). Restricted localization of
claudin-16 at the tight junction in the thick ascending limb of Henle’s loop together with
claudins 3, 4, and 10 in bovine nephrons. J. Vet. Med. Sci. 68, 453-463.
Smith, A. N., Jouret, F., Bord, S., Borthwick, K. J., Al-Lamki, R. S., Wagner, C. A.,
Ireland, D. C., Cormier-Daire, V., Frattini, A., Villa, A. et al. (2005). Vacuolar H+ATPase d2 subunit: molecular characterization, developmental regulation, and
localization to specialized proton pumps in kidney and bone. J. Am. Soc. Nephrol. 16,
1245-1256.
Stehberger, P. A., Schulz, N., Finberg, K. E., Karet, F. E., Giebisch, G., Lifton, R. P.,
Geibel, J. P. and Wagner, C. A. (2003). Localization and regulation of the ATP6V0A4
(a4) vacuolar H+-ATPase subunit defective in an inherited form of distal renal tubular
acidosis. J. Am. Soc. Nephrol. 14, 3027-3038.
van de Graaf, S. F. J., Bindels, R. J. M. and Hoenderop, J. G. J. (2007). Physiology
of epithelial Ca2+ and Mg2+ transport. Rev. Physiol. Biochem. Pharmacol. 158, 77160.
Van Itallie, C. M. and Anderson, J. M. (2006). Claudins and epithelial paracellular
transport. Annu. Rev. Physiol. 68, 403-429.
Van Itallie, C. M., Fanning, A. S. and Anderson, J. M. (2003). Reversal of charge
selectivity in cation or anion-selective epithelial lines by expression of different claudins.
Am. J. Physiol. Renal Physiol. 285, F1078-F1084.
Van Itallie, C. M., Rogan, S., Yu, A., Vidal, L. S., Holmes, J. and Anderson, J. M.
(2006). Two splice variants of claudin-10 in the kidney create paracellular pores with
different ion selectivities. Am. J. Physiol. Renal Physiol. 291, F1288-F1299.
Wen, H., Watry, D. D., Marcondes, M. C. and Fox, H. S. (2004). Selective decrease in
paracellular conductance of tight junctions: role of the first extracellular domain of
claudin-5. Mol. Cell. Biol. 24, 8408-8417.