Do caterpillars prefer fungal infected
leaves?
María Teresa Fernández de Bobadilla
No.................................................................... 016-21
Supervisor ... Dr. Sybille Unsicker and Franziska Eberl
Study programme ........................ MSc Plant Sciences
Period ................................. March 2016-August 2016
Major Thesis ............................................. ENT-80436
Examiner ................................. Prof. Dr. Marcel Dicke
Copyright© 2016. All rights reserved. No parts of this work may be reproduced, distributed or published in any
form or by any means without the written consent of the author and supervisors.
1
Table of Contents
Abstract ......................................................................................................................................................... 4
Introduction .................................................................................................................................................. 5
Plant defenses against attackers .............................................................................................................. 5
Plant secondary metabolites ................................................................................................................ 6
Leaf rust fungus in poplar ......................................................................................................................... 7
Nutritional aspects for caterpillar choice ................................................................................................. 8
Plant-fungus-insect interactions ............................................................................................................... 8
Research questions ................................................................................................................................. 10
Hypotheses ............................................................................................................................................. 10
Material and Methods ................................................................................................................................ 11
Plants....................................................................................................................................................... 11
Insects ..................................................................................................................................................... 11
Fungus ..................................................................................................................................................... 11
Leaf sampling .......................................................................................................................................... 11
Preference study ..................................................................................................................................... 12
Genomic DNA (gDNA) isolation .............................................................................................................. 13
Leaf chemistry analysis ........................................................................................................................... 13
Salicinoids and other phenolics .......................................................................................................... 13
Defense hormones .............................................................................................................................. 13
Phenolic acids...................................................................................................................................... 13
Sugars .................................................................................................................................................. 14
Amino acids ......................................................................................................................................... 14
Protein extraction ................................................................................................................................... 14
Proteinase inhibitor analysis ................................................................................................................... 14
Statistical analysis ................................................................................................................................... 15
Results ......................................................................................................................................................... 15
Caterpillar preference ............................................................................................................................. 15
Fungal growth ......................................................................................................................................... 16
Leaf chemistry ......................................................................................................................................... 17
Salicinoids and other phenolics .......................................................................................................... 17
Phytohormones................................................................................................................................... 19
2
Phenolic acids...................................................................................................................................... 20
Sugars and mannitol ........................................................................................................................... 20
Amino acids ......................................................................................................................................... 21
Protein content ................................................................................................................................... 23
Proteinase inhibitor content ............................................................................................................... 23
Discussion.................................................................................................................................................... 24
Conclusion ................................................................................................................................................... 32
Acknowledgements..................................................................................................................................... 33
References .................................................................................................................................................. 33
3
Abstract
Poplar trees play important ecological and economical roles as parts of riparian ecosystems and
wood production, respectively. However, poplar growth is constrained by attacks of various
antagonists, mostly being pathogens and insect herbivores. Trees defend themselves against
these attackers via several mechanisms including chemical (phenolics), biochemical (proteinase
inhibitors) or transport (resource allocation) mechanisms. To regulate these different
mechanisms phytohormones are induced or repressed, depending on the kind of attacker.
Antagonists that share the same host can therefore influence each other and facilitate or
suppress the attack of the subsequent antagonist. Even though many studies focused on plant
defense, little is known about the direct or indirect influence that two antagonists have on each
other when they occur at the same host simultaneously.
In order to study the effect of a plant pathogen on the subsequently feeding herbivore, I
infected black poplar (Populus nigra) trees with Melampsora larici-populina (poplar leaf rust)
and monitored the behavior of two different herbivore species. Feeding preference assays with
the generalist Lymantria dispar (gypsy moth) and the specialist Laothoe populi (poplar hawk
moth) were done at different stages of infection, as well as chemical analysis of the leaf
material.
I found that the preference of L. dispar larvae was affected by the fungal infection. At an
early stage of infection, caterpillars preferred to feed from the control plants. Strikingly, the
preference changed towards rust infected leaves at later time points. In contrast, the specialist
herbivore L. populi preferred uninfected leaves at a later stage of infection. Infection by M.
larici-populina moderately induced the phenolic compound catechin, jasmonates, salicylic acid
(SA) and, more strongly, the sugar alcohol mannitol in black poplar leaves. The levels of other
primary and secondary metabolites analyzed were not affected by the infection.
My results highlight the importance of studying the effect of multiple attacks instead of
single attacker scenarios only. I showed that a pathogen strongly changes the behavior of
insects attacking the same host in a species-specific manner. This behavioral change can
crucially shape arthropod communities in an ecosystem to which pathogens are introduced.
Keywords: Pathogen-insect interactions, tree defenses, multiple attacks, black poplar
4
Introduction
Poplars are fast growing, wind-pollinated, early successional trees belonging to the Salicaceae
(Philippe and Bohlmann 2007). Poplars can reproduce asexually and produce massive numbers
of seeds, which makes them rapidly able to colonize disturbed environments and one of the
most productive components of riparian ecosystems (Philippe and Bohlmann 2007). In addition,
poplars are extensively used for wood production for several industrial purposes such as
plywood, sawn timber, pulpwood, fuelwood and biofuels (Nervo et al. 2011). Due to their
ecological and economic importance, there has been an increasing interest on studying the
poplars’ interactions with their biotic environment. Populus nigra (black poplar) is a perfect
model to study these interactions, as it is equipped with a complex phytochemistry, and it is
able to cope with a dynamic herbivore community including several insects, belonging to
different orders and specialization as well as fungi (McCormick et al. 2014a; McCormick et al.
2014b). In addition, the genome of the closely related species P. trichocarpa has been
published, facilitating molecular work (Tuskan et al. 2006). In their natural environment, the
floodplain forests, black poplar trees are under attack of numerous antagonists, including the
generalist insect Lymantria dispar (gypsy moth) , the specialist insect Laothoe populi (poplar
Hawk-moth) and the rust fungus Melampsora larici-populina. These attackers are responsible
for big biomass reduction, especially in plantations.
Plant defenses against attackers
Poplars defend against attackers such as L. dispar, L. populi or M. larici-populina through
several mechanisms that probably work as a highly integrated response. Defense in plants
include reallocation of resources, chemical defenses, protein-based defenses (e.g. proteinase
inhibitors), physical defenses and indirect defenses (i.e. attraction of herbivore´s natural
enemies) (Eyles et al. 2010; War et al. 2014). Some of these mechanisms are constitutive
meaning they are always present as a first line of defense and others are induced upon
herbivore contact. Plant responses are regulated by complex signaling pathways that are
differentially induced depending on the attacker (Pieterse et al. 2012). Generally, plants
respond to chewing insect feeding and necrotrophic pathogen attack by inducing the jasmonic
acid (JA) pathway (Pieterse et al. 2009). In contrast, piercing-sucking insects and biotrophic
pathogens usually induce the salicylic acid (SA) pathway (Pieterse et al. 2009).
Crosstalk between several phytohormones allows the plant to fine-tune the response to
attackers (Pieterse et al. 2012). SA and JA pathway often exhibit negative crosstalk (Erb et al.
2012) and importantly, this can have consequences on plant responses to multiple antagonists.
For example, when a SA inducer (such as M. larici-populina) attacks the plant, caterpillars (such
as L. dispar or L. populi) that feed consecutively on that plant may benefit due to a reduced JA
signaling (Poelman 2015). Insects such as L. dispar or L. populi feeding on poplar are confronted
with plant defense mechanisms and need to decide from which plant to feed, in order to
increase their performance and ultimately their fitness as much as possible. The insect´s
decision on which plant to feed from is made on the basis of several plant traits, such as
secondary metabolites, plant nutrients and physical traits (Schoonhoven et al. 2005).
5
Plant secondary metabolites
During feeding, insects are challenged by plant secondary metabolites (Singer et al. 2014).
While ingesting plant secondary metabolites, insects can compromise their immunological
function. In insects melanization occurs when insect´s immune system recognizes a foreign
object (e.g. parasitoid larvae) and subsequently surrounds it with melanin. Caterpillars of
Junonia coenia (buckeye butterfly) show a weaker melanization response when being reared on
high iridoid glycosides diet (Singer et al. 2014).This is especially striking in the case of J. coenia
caterpillars, which are known to sequester iridoid glycosides from their diet to defend
themselves against predators, and it highlights the importance of diet trade-offs (Singer et al.
2014). Insects develop the ability to detoxify or metabolize plant secondary metabolites in the
gut in order to minimize their detrimental effect (Roy et al. 2016). Specialist insects most likely
rely on sequestration or detoxification of plant secondary metabolites of their host (plant)
species (Roy et al. 2016). Generalist herbivores are exposed to a wide range of diverse plant
toxins and need therefore to detoxify plant secondary metabolites by chemical modification,
degradation and excretion (Roy et al. 2016).
Phenolics are the major secondary metabolites in the Salicaceae and are well known for
anti-herbivores defense in poplars (Boeckler et al. 2013; Philippe and Bohlmann 2007). Poplars
are very rich in two groups of phenolics: phenolic glycosides and flavan-3-ol oligomers (also
called condensed tannins or proanthocyanidins) (Boeckler et al. 2013). In addition, Salicaceae
species contain phenolic acids (e.g. caffeic acid derivatives) with a possible role against
herbivorous insects (Lindroth and Peterson 1988). The role of condensed tannins against insect
herbivores is not fully understood yet. The simplest salicinoid (phenolic glycoside) is salicin, and
therefore as proposed by Boeckler et al. (2011) I will use in this manuscript the term salicinoids
instead of phenolic glycosides. Many Salicaceae species contain salicin as a basic element from
where approximately 20 other more complex compounds are formed by esterification of one or
more hydroxyl groups with various organic acids (Boeckler et al. 2011). Salicinoids are some of
the most abundant secondary metabolites known in plant tissues (up to 30% of plant dried
weight) (Boeckler et al. 2011). Salicinoid levels are influenced by plant genotype, ontogeny, and
also by external factors such as abiotic and biotic stress (Boeckler et al. 2011). Although
salicinoids are constitutively present in Salicaceae species, they are also induced after herbivore
feeding (Philippe and Bohlmann 2007). However, in black poplar salicinoids seem to act as a
constitutive defense (Boeckler et al. 2013). Most studies report that salicinoids are feeding
deterrents and reduce fitness of generalist insects but can stimulate feeding and oviposition of
specialists and increase their performance. Accordingly, caterpillars of L. dispar are deterred
and negatively affected by high levels of salicinoids in black poplar with a prolonged
developmental time, reduced pupal weight and decline in number of eggs (Boeckler et al. 2011;
Boeckler et al. 2013; Philippe and Bohlmann 2007).
In addition to chemical defenses, poplars are provided with biochemical defenses i.e.
proteins or enzymes with direct defense activity against insect herbivores (Philippe and
Bohlmann 2007). These anti-digestive proteins lead to insect starvation, slow down insect
development and increase time of exposure to natural enemies. Kunitz-type serine proteinase
inhibitors (KPIs) are among the best described plant gene families involved in defense against
insects. KPIs are small proteins present in poplar that bind and inhibit digestive enzymes in the
insect gut, leading to a reduced effectiveness of digestion and amino acid deficiency (Philippe
6
and Bohlmann 2007). Importantly, KPIs are among the most upregulated defense genes in
response to damage or herbivore feeding in poplar (Philippe and Bohlmann 2007).
Leaf rust fungus in poplar
Besides insect herbivores, poplars have to cope with fungal pathogens. The rust fungus
Melampsora larici-populina is the main disease affecting poplar in Europe, causing premature
defoliation, mortality of young trees and biomass reduction, leading to big economic loss in
plantations (Duplessis et al. 2011; Hacquard et al. 2010; Hacquard et al. 2011). Nowadays
almost all poplar genotypes are susceptible to this rust fungus (Hacquard et al. 2011) and it is
therefore crucial to understand the mechanisms behind its infection cycle. M. larici-populina is
a basidiomycete biotrophic pathogen (Hacquard et al. 2011). This leaf rust has a complex
heteroecious macrocyclic lifestyle, while its biological cycle is completed on two different hosts
and contains five different spore forms (Hacquard et al. 2011).
In early spring, diploid teliospores (2n) that overwintered in decayed poplar leaves
produce haploid basidiospores (n) (Hacquard et al. 2011). Through wind, basidiospores reach
larch needles and produce pycniospores (n) (Hacquard et al. 2011). Fusion of opposite
pycniospore types leads to aecia and dikaryotic aeciospores (n+n, sexual phase) (Hacquard et al.
2011). These wind-born aeciospores land on poplar, where uredinia are created (Hacquard et
al. 2011). Uredinia are orange pustules on the abaxial epidermis of poplar leaves that contain
the urediniospores, and give the characteristic rust color. Urediniospores are released from
uredinia over very large distances. Several vegetative infection cycles can be completed on
poplar leaves during spring and summer. In autumn, black telia pustules containing teliospores
(n+n) are produced in senescent poplar leaves and the cycle is completed (Hacquard et al.
2011).
After aeciospores land on the abaxial epidermis of poplar leaves, germ tubes are
produced and penetrate through stomata within the first 6 hours. Approximately 1 day post
infection (dpi) the first haustoria differentiate (Hacquard et al. 2011). Haustoria are structures
characteristic from biotrophic fungi that are crucial for the parasitic relationship. They are
responsible for nutrient uptake and seem to serve biosynthetic duties, host suppression and
redirecting of host´s metabolic flow (Voegele and Mendgen 2011). At 4 dpi, there is a dramatic
increase in fungal biomass (more than 30-fold) inside the parenchyma cells (Hacquard et al.
2010; Hacquard et al. 2011). At 7 dpi the leaf abaxial area is covered by orange pustules
(uredinium) containing the urediniospores (Hacquard et al. 2010). The pressure generated by
the fungi breaks the abaxial epidermis, and large amounts of newly generated urediniospores
are released and spread by the wind and rain to other poplars upon 10 dpi.
Similar to insect attack, pathogen infection induces plant signaling cascades that
activate several defenses responses. Plant responses against pathogens have similarities with
plant responses to herbivores, including synthesis of phytohormones such as salicylic acid (SA),
jasmonic acid (JA) or ethylene (ET). In a compatible interaction, the host immune system is
disrupted by the fungus leading to pathogen growth and development resulting in disease
(Major et al. 2010). At early stages of infection (1, 2 dpi) M. larici-populina induces only a few
transcriptional changes on poplar (Duplessis et al. 2009). At 6-9 dpi, genes associated with
photosynthesis are downregulated, whereas genes associated with respiration and
carbohydrate metabolisms are upregulated (Major et al. 2010). At 7 dpi the defense response is
7
finally measurable, large number of transcripts encoding enzymes of flavonoid pathways are
upregulated (Duplessis et al. 2009). At later time points there is an accumulation of
anthocyanidins, lignin, pectin and hydrogen peroxide around infection sites (Duplessis et al.
2009).
A study by Hacquard et al. (2010) on the fungus´ transcriptome, allowed unraveling the
differentially induced transcripts during the biotrophy phase of rust on poplar (from 0 dpi to 6
dpi) and the sporulation phase (from 7 dpi on). In the biotrophic phase there is an induction of
enzymes necessary for nutrient uptake (e.g. amino acid permease, enzymes involved in hexose
transport) and host defense suppression (small secreted proteins, SSPs), while in the
sporulation area there is induction of transcripts involved in cell cycle, degradation of plant cell
wall, enzymes involved in prevention of oxidative stress and strong expression of several
transporters in the urediniospores (Hacquard et al. 2010).
Nutritional aspects for caterpillar choice
Due to its immobile nature, M. larici-populina is passively transported by wind or other vectors
to their host plants. In contrast, insects such as L. dispar and L. populi are mobile and can
choose their host plant. Insects choose their host plant on basis of secondary metabolites and
nutritional value (Schoonhoven et al. 2005). It has been often argued that in insect herbivores
there is a resource mediated trade-off among different vital functions (Singer et al. 2014).
Animals contain a finite pool of resources that must be allocated towards growth, reproduction
and defense. In this context feeding behavior and diet strongly determine where resources will
be allocated. It has been hypothesized, that adaptive feeding behavior can alleviate trade-offs
in allocation through alteration of food quantity or quality (Singer et al. 2014). This is crucial
especially to immature insects, as they have a higher vulnerability to parasitism and disease.
Nutrients in diet generally and protein and amino acids specifically, are thought to be
crucial for the trade-off between growth and immunological defense (Singer et al. 2014). For
example, the total concentration and ratio of different hemocytes in the insect, is dietdependent (Vogelweith et al. 2016). This is remarkable as hemocytes are cells belonging to the
insect´s immune system responsible for coagulation, phagocytosis and encapsulation, which
highlights the role of insect´s diet on resistance against pathogens and natural enemies
(Vogelweith et al. 2016). In addition to defense against natural enemies, the insect’s diet also
affects its performance. Protein-carbohydrate content ingested by caterpillars affects pupal
performance, egg production and population size among other insect´s fitness parameters
(Cotter et al. 2011; Roeder et al. 2014). Remarkably, insects are able to select the proteincarbohydrate ratio that maximizes their lifetime performance (Roeder et al. 2014).
Plant-fungus-insect interactions
Interactions of insects and poplars in nature are complex as there are numerous other
antagonists that may modify the phytochemical landscape affecting the insect´s behavior. M.
larici-populina is one of the most dominant antagonists in several black poplar genotypes.
Therefore it is crucial to understand if infection of this pathogen affects other herbivores
feeding in the same host, such as L. dispar and L. populi. In summer L. dispar and L. populi share
the black poplar host -and may interact directly and indirectly- with the rust fungus M. laricipopulina. The rust fungus decreases plant reproduction and growth, activates plant defenses
8
and consequently may influence the behavior of the insect herbivores. Interactions between
them can have facilitative, inhibitory or neutral effect on each other. Infection by M. laricipopulina in the field is patchy, and it is uncommon for all leaves on a plant to be infected, which
means that herbivorous insects have the option to choose between healthy and infected
leaves. Being that infection by M. larici-populina induces several phenotypic changes in the
plant, it is to expect, that the feeding behavior of insect herbivores will be affected by infection.
Furthermore, given that plant phenotypic changes induced by the fungus depend on the time
passed since initial infection (Duplessis et al. 2011) we may expect that herbivore feeding
behavior will change depending on the fungal development on the leave.
Fungal infection may affect insect preference and performance directly as fungal tissue
contains substantial amounts of nutrient reserves, such as lipids, glycogen, trehalose and
vitamins (Moore-Landecker 2011). There are several examples of insect species preferring or
being specialized on fungal tissue (Lewis 1979; Mondy and Corio-Costet 2004; Wandeler and
Bacher 2006). For example, the generalist grasshopper Melanoplus differentialis preferred to
feed from Helianthus annutus (sunflower) leaf tissue infected by the rust fungus Puccinia
helianthii than from healthy leaves (Lewis 1979). Nevertheless, the majority of studies do not
demonstrate a direct effect of fungal infection on insects, being that the effect observed might
be explained by plant-mediated changes. However, one study did demonstrate a direct effect of
a fungus on an insect herbivore: larval performance of the moth Lobesia botrana increased
when feeding on artificial diet containing the fungus plant pathogen Botrytis cinerea (Mondy
and Corio-Costet 2004).
Fungal infection can also influence insect feeding behavior indirectly through changes in
the host-plant (Simon and Hilker 2005). It has been proven for several systems that rust fungi
stimulate the transport of sugars to the infection site (Voegele and Mendgen 2011) which
implies a shift of nutrients from systemic leaves to rust-infected leaves. Photo assimilates can
be converted into specific fungal products (e.g. mannitol, arabitol, trehalose, glycogen,
glucomannan and lipids) some of which might be used by insects as oviposition and feeding
stimulants (Hatcher and Ayres 1997). Insect preference might also be influenced by fungalinduced modulation of plant defenses. Plant responses to a SA inducer (e.g. biotrophic
pathogen such as M. larici-populina) might interfere with plant defense against a chewing
insect such as L. dispar and L. populi. Moreover, insect feeding in poplar induces KTIs from
groups A and B and both KTIs proteinase inhibitors are downregulated by Melampsora infection
(Miranda et al. 2007). Consequently, insects may prefer to feed from rust-infected low protein
inhibitor content leaves.
Most of the studies on plant defenses have focused on herbaceous species or shortlived perennials, however, much less is known about trees, although they are also hosts of
numerous herbivores. Even though trees and herbaceous species share several traits, trees
have some distinctive characteristics. Generally, trees have much longer lifespans, are much
larger, and are provided with special structures related to secondary growth (Eyles et al. 2010).
Consequently, some findings from herbaceous species might not apply to trees. Furthermore,
most studies focus on plant-pathogen, pathogen-pathogen or insect-insect interactions. There
is scant research done addressing the effect of plant pathogens on insect herbivores, although
these interactions might be important drivers of community dynamics (Tack and Dicke 2013). In
nature, plants have to cope with simultaneous or sequential antagonists of diverse origin. Plant
9
defenses are differentially induced depending on the attacker. Consequently, attack by one
antagonist can drastically change plant responses to a subsequent antagonist. However, most
studies are very simplistic and focus in pair-wise interactions and the influence of one attacker
on a subsequently herbivore has been rarely studied.
I want to contribute unraveling the complex plant-antagonists interactions. Therefore,
the objective of this study was to address whether a tree pathogen influences the preference of
herbivorous insects, and the mechanisms involved behind. I chose the ecologically and
economically important tree species P. nigra (black poplar) and its highly detrimental
pathogenic fungus M. larici-populina. I addressed if fungal infection affects the behavior (i.e.
feeding preference) of two caterpillars responsible for high defoliation damage in black poplar:
the generalist herbivore L. dispar and the specialist insect L. populi. In addition, for L. dispar I
included a temporal dimension and investigated whether the feeding behavior depends on the
fungal development in the leaf. Furthermore, I analyzed whether differences in herbivore
behavior can be explained by changes in plant quality. As a measure of plant quality I
investigated different plant defense traits that have been shown to affect insect preference
and/or performance including leaf content of defense hormones, salicinoids, phenolic acids or
protein inhibitors. Moreover, I measured plant traits that have been linked with the plant´s
nutritional value for herbivorous insects such as sugar, protein or amino acid content.
Research questions
I.
II.
III.
IV.
V.
Is the preference of the generalist insect L. dispar and of the specialist insect L. populi
affected by rust infection on black poplar?
Is the preference of the specialist insect L. populi affected in a different way than the
generalist insect L. dispar?
Are the effects of rust infection on the feeding activity of L. dispar dependent on the
time that has passed since initial fungal infection?
Are poplar phytohormones, salicinoids, phenolic acids, amino acids and sugars changing
after rust infection and during the course of the experiment?
Do these changes explain caterpillar feeding activity?
Hypotheses
I.
II.
III.
Upon infection with poplar leaf rust M. larici-populina, the plant physiology is modified
(Duplessis et al. 2011). This most likely implies changes in the production of primary
metabolites and defense compounds. Probably some of these changes are important
parameters that caterpillars use to choose a plant. I hypothesize that L. dispar
caterpillars will differently prefer rust-infected from healthy leaves.
Generally, specialist insects are less negatively affected by plant secondary metabolites
than generalist insects (Ali and Agrawal 2012). I expect fungal infection to alter some
plant secondary metabolites and consequently, I hypothesize, that the preference of the
specialist insect L. populi will differ from the preference of the generalist insect L. dispar.
Under laboratory conditions the cycle of rust-infection on a poplar leaf lasts around 7
days, in which many changes occur in both the plant and the fungus. It is well-reported,
that plant metabolic changes induced by pathogen infection depend on the time that
has passed after infection (Duplessis et al. 2011). Consequently, I hypothesize that the
10
IV.
V.
preference of the caterpillar will be affected by the time passed since initial infection by
the rust fungus due to pathogen-induced changes in the leaf chemistry.
Infection by M. larici-populina causes many phenotypic changes in the host plant. In
addition, during plant ontogeny there is a change in many plant traits. I hypothesize that
the content of some important defense traits, as well as plant nutritious value will be
modulated upon infection and with the time course of the experiment e.g.
phytohormones, salicinoids, phenolic acids, amino acids, sugars.
As caterpillar preference is strongly influenced by plant defense compounds and by
plant nutrients (Singer et al. 2014), I hypothesize that some of these parameters will
explain caterpillar feeding behavior.
Material and Methods
Plants
Populus nigra (black poplar) monoclonal trees were grown from cuttings in the greenhouse
with light 16:8 h day:night; temperature 24°C:20°C day:night; relative humidity (RH) 50-60%.
Three days before starting the experiment, plants were transported to the climate chamber and
provided with light 16:8 h day:night , light at 50%, from 6 a.m. to 22 p.m.; temperature
21°C:19°C day:night; RH 75%.
Insects
Lymantria dispar (gypsy moth) eggs kindly provided by Hanna Nadel (US Department of
Agriculture, MA, USA) were stored at 4°C until usage. For hatching, eggs were incubated in a
climate chamber (25°C, 60% RH, 14:10 h day:night) and larvae were reared on artificial diet (MP
Biomedical, Eschwege, Germany) to avoid that preference would be influenced by prior
experience (feeding from control plants). Second instar larvae of similar size were selected for
the preference assays and were starved for 7 h before being used for the preference assays.
Laothoe populi (poplar hawk-moth) old instar non-starved caterpillars were used for the
experiment. To our knowledge, no artificial diet has been developed for this specialist insect.
Therefore larvae were reared the on P. nigra trees at room temperature (RT).
Fungus
Poplar leaf rust fungus (Melampsora larici-populina) was cultivated on black poplar leaves.
Fresh spores from infected trees were collected three days before inoculation and stored at 20°C. Right before inoculation a solution of spores and water (1.5mg/ml) was prepared. Starting
from the second mature apical leaf in the young trees, 10 leaves were sprayed with 0.6
ml/leave on the abaxial side. Control trees were treated the same way but sprayed with water
only. After spraying, each tree was covered with a plastic bag which was properly tied on the
bottom. This was done to prevent the spores from infecting control trees and to keep the
adequate humidity level for the fungal growth.
Leaf sampling
Plants were individually brought in front of the climate chamber and alternating leaf halves
were collected in tubes and immediately frozen in liquid nitrogen. Later, these leaf halves were
11
grounded to a fine powder in the presence of liquid nitrogen and stored at −80 °C for further
analysis. Part of the leaf material was lyophilized before leaf chemistry analysis (see detailed
description of analysis below). For protein extraction fresh tissue was used. Freeze-dried tissue
was used for genomic DNA analysis as well as for the analysis of salicinoids, other phenolics,
phenolic acids, phytohormones, sugars and amino acids.
The rest of the leaves were used for the preference assays directly after leaf sampling
(see detailed description below).
Preference study
Leaf discs (16 mm ⌀) from the remaining leaves were cut and used for preference assays
avoiding the mid-rib. Eight leaf discs were pinned in petri dishes, 4 belonging to each treatment
(distributed alternatingly) (Fig. 1). The petri dishes had a wet filter paper on the bottom, in
contact with the leaves, to avoid desiccation. One caterpillar was situated in the middle of the
petri dish and after 48 h the preference was evaluated by taking photos and analyzing the
removed leaf area with Adobe Photoshop. Both leaf sampling and preference studies were
done at several time points after inoculation with the fungus: 0 days post-infection (dpi), 1 dpi,
4 dpi, 7 dpi, 10 dpi. The same methods were used for the preference assay of L. populi. Late
instar larvae were used, and preference was evaluated only at 10 dpi after 24 h feeding.
Fig. 1. Insects, plants, larval preference bioassay. A) Preference assay in petri dish, 4 leaf discs from a control
Populus nigra (black poplar) tree and 4 from a Melampsora larici-populina –infected (rust-infected) black poplar
nd
tree were distributed alternatingly. B) Lymantria dispar 2 instar caterpillar feeding from one leaf disc from a
control plant. C) Laothoe populi late instar caterpillar feeding from one rust-infected leaf disc. D) Rust-infected leaf
at 10 days post infection with uredinium containing the urediniospores. E) Punch used for cutting 16 mm² leaf discs
(left). Leaf discs prepared for being photographed (right). Leaf area removed was analyzed with Adobe Photoshop.
F) Climate chamber where trees were brought to 3 days before the beginning of the experiment. G) Rust-infected
(left) and control (right) trees shortly before leaf sampling.
12
Genomic DNA (gDNA) isolation
30 mg of freeze-dried tissue was used for the isolation of gDNA using the InviSorb Spin Plant
Mini Kit (STRATEC Biomedical AG, Birkenfeld, Germany) according to manufacturer’s
instructions. DNA concentration was checked using a spectrophotometer (Nano Drop 2000c,
Thermo Scientific, Wilmington, USA). gDNA was diluted in MiliQ water to 100 ng/µl and used
for quantitative real-time (qRT)-PCR. The qRT-PCR was performed on a CFX Connect Real-Time
PCR Detection System (Bio-Rad Laboratories, Munich, Germany) using the Brilliant III Ultra-Fast
SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, USA). Data was analyzed using
the software provided by Bio-Rad. The relative amount of genomic DNA of the Melampsora
larici-populina internal transcribed spacer, ITS (Fw 5’-3’: GCCCGTCAAAAGGTTAGCAGTG, Rev 3’5’: CGAGGGGGGTTTCGTGACATTC) was measured, and normalized to the plant Actin gene
(Ramirez-Carvajal et al. 2008).
Leaf chemistry analysis
As extracting agent methanol containing internal standards (IS) was used: Phenyl-ßglucopyranoside 0.8 mg/ml (IS for salicinoid analysis); 40 ng/ml D 4-SA, D6-JA and D6-ABA, 8
ng/ml 13C6-JA-Ile (IS for phytohormone analysis); 10 ng/ml syringic acid and trifluor methyl
cinnamic acid (IS for phenolic acid analysis). 1 ml extracting agent was added to 10 mg of
freeze-dried tissue and the solution was shaken in a paint shaker (Skandex SO-10m Shaker,
Fluid Management Europe, Sassenheim, The Netherlands) for 30 sec. and short after
centrifuged 1 min at 2000 rpm. This extract was transferred to the wells of a 96 well plate
(Micronic, Lelystad, The Netherlands) and was used for the salicinoid, phytohormones, phenolic
acids, sugar analysis and amino acid analysis, after doing the steps mentioned below.
Salicinoids and other phenolics
Right before analysis 200 µl aliquots of the extracts were mixed with 200 µl MiliQ water before
analysis on an HPLC-UV system. Analysis was performed in the same conditions as explained in
Boeckler et al. (2013).
Defense hormones
A 400 μl aliquot of the extract was analyzed on an API 5000 LC/MS/MS system (AB Sciex,
Framingham, MA, USA) using the chromatographic conditions and mass spectral parameters
described in Vadassery et al. (2012).
Phenolic acids
The extract was analyzed on an API 5000 LC/MS/MS system (Applied Biosystems, Carlsbad, CA,
USA) concentrations of individual compounds were determined in a similar way as with the
phytohormones. 5 µl of each sample-extract were injected onto a C18 column (XDB-C18,
1.8 µm, 4.6x50 mm, Agilent, USA) column connected to a pre-column (C18, 5 µm, 4x3 mm,
Phenomenex, USA). As mobile phases, two solvents, solvent A (0.1 % acetic acid in mili-Q H2O)
and solvent B (acetonitrile) were used. Solvent B was injected in a gradient mode. The
time/concentration for the gradient (min/%) was 0.0/10, 0.5/10, 4.0/90, 4.02/100, 4.5/100,
4.51/10 and 7.0/10 with a constant flow rate of 1100 µl/min. The column oven was set to 25 °C.
13
Sugars
The extract was 1:10 diluted with MiliQ water. As external standards solutions of soluble sugar
mix (glucose, sucrose, fructose) and mannitol were prepared in H2O (20, 10, 5, 2.5, 1.25 µg/ml).
Samples were analyzed on an HPLC system (Agilent 1200 Series, Agilent Technologies, Santa
Clara, USA) coupled to a tandem mass spectrometer (API 3200, Applied biosystems, Foster City,
USA). Separations were performed on an Aphera column (Sigma Aldrich) with H 2O as solvent A
and acetonitrile as solvent B. 5 µl of sample were injected onto the column with a gradient
(min/%B) of 0.0/80, 0.5/80, 13.0/55, 14.0/80 and 18.0/80 with a constant flow rate of 1 ml/min.
The ion Spray voltage applied was -4500V.
Amino acids
The extract was 1:10 diluted with MiliQ water containing 10 µg/mL 13C, 15C labelled amino
acid mix (Isotec, Miamisburg, US) and analyzed on an LC/MS/MS system as described in
(Docimo et al. 2012) with the modification that I used an API 5000 LC/MS/MS system (Applied
Biosystems, Carlsbad, CA, USA) (Applied Biosystems, Carlsbad, CA, USA) using the parameters
explained in Crocoll et al. (2016).
Protein extraction
Analyses of leaf protein content were performed with 10-20 mg fresh (frozen) leaf tissue. 200 µl
extraction buffer (HEPES 25mM, pH 7.2; 3% PVPP; 2% PVP; 0.8% Triton X100; 1mM EDTA) was
added to each sample and shaken at 4°C for 30 min. Samples were centrifuged at 4°C at 15.000
rpm for 10 min. Supernatant was transferred to new tubes and centrifuged again for 4 min. The
pellet was discarded and supernatant was used for the protein analysis. For measuring the
protein content, a Bradford assay was performed: 1 ml dye solution (Bradford protein assay,
BioRad, Munich) in MiliQ water 1:5 was added to 5 µl sample + 10 µl HEPES buffer. The solution
was incubated 5 min at room temperature and then absorbance was measured in the
spectrophotometer. Standards for protein quantification were prepared using bovine serum
albuminum (BSA) of known concentration (1 mg/ml, 0.5 mg/ml, 0.25 mg/ml, 0.125 mg/ml, 0
mg/ml=blank). Dilutions were prepared on HEPES buffer (25mM, pH = 7.2). 1ml dye solution
was added to the standards and incubated for 5 min at room temperature before measuring
absorbance in the spectrophotometer. A standard curve was used to calculate the leaf protein
content.
Proteinase inhibitor analysis
1.8% agar gel was prepared with HEPES-KOH 25mM pH 7.2 buffer and cooled down for 30 min
in a water bath (60°C). Then, 2 µl of trypsin/ml gel were added (0.2 mg/ml trypsin). In order to
allow the gel to solidify, it was kept in the fridge for 2-3 hours. 0.5 cm ⌀ holes were punched out
in the agar gel. 20 mg freeze-dried leaf tissue was used for the extraction of protein inhibitors.
Leaf tissue was washed with 400 µl pre-cooled acetone (-20°C), vortexed and shaken for 30 min
at 4°C. The extract was centrifuged at 15.000 rpm for 15 min. The pellet was dried and resorbed
in 400 µl HEPES extraction buffer (previously described on protein extraction section) and
shaken at 4°C for 30 min. Samples were centrifuged at 4°C, at 15.000 rpm for 10 min. The
supernatant was transferred to new tubes, centrifuged again 4 min, the pellet was discarded
and the supernatant was used for the protein analysis. Samples were loaded on the
14
perforations made on the agar gel and incubated for 22 hours at 4°C. The gel was rinsed with
HEPES-KOH buffer (25mM, pH 7.2, 10mM CaCl2) and stained with a solution of 72 mg Fast Blue
B Salt diluted in 90 ml HEPES-KOH (25mM pH 7.2), to which 60 mg acetylphenylalanine-ßnaphthylester (APNE) in 10 ml dimethylformamide (DMF) were added. The agar was incubated
for 45 min at 37°C, and the staining solution was removed with tap water. Protein inhibitor
content was analyzed by photographing the inhibition zone surrounding every sample and
analyzing the photos with Adobe Photoshop.
Statistical analysis
All data was checked to meet the statistical assumptions of the test used for analysis with SPSS
17.0 (SPSS, Chicago, USA) such as normality and homogeneity of variances. When data did not
meet these assumptions logarithmic transformation was applied or the correspondent non
parametric test (Kruskal-Wallis, Mann-Whitney U Test) was performed. Data from the
preference study with L. dispar were analyzed with a Wilcoxon Signed Ranks Test. For the
analysis of the L. populi preference a paired samples Student’s T-test was used. Data of
salicinoid, phytohormones, phenolic acids, sugars, amino acids, protein content and protein
inhibitor content was analyzed using a general linear model (GLM) with rust infection and time
of infection as fixed factors.
Results
Along the whole results section I describe the effect of two factors in caterpillar choice and in
some plant traits. First I describe the effect of M. larici-populina infection (“rust”). Second I
describe the effect of “time course” of the experiment, as I analyzed all the parameters at the
beginning of the experiment (day 0) and at 1, 4, 7, and 10 days after the beginning of the
experiment. Finally I explain the interaction between both factors (“rust x time course").
Caterpillar preference
The preference of the second instar larvae of the generalist herbivore L. dispar was affected by
fungal infection. At 1 day post infection, caterpillars preferred to feed from the control plants
(Wilcoxon Signed Ranks Test, 1 day: Z=-2.310, P=0.021; Fig. 2). Strikingly, the preference
changed towards rust infected leaves upon 4 days (Wilcoxon Signed Ranks Test, 4 days: Z=2.651, P=0.08; 7 days: Z=-2.315, P=0.021; 10 days: Z=-3.528, P=0.000; Fig. 2).
15
Fig 2. Effect of Melampsora larici-populina rust infection on the preference of second instar Lymantria dispar
caterpillars. Second instar larvae fed from Populus nigra leaf discs during 48h. Assays were repeated at several
time points since the beginning of the experiment. Bars represent means of leaf damage (% leaf area removed
from control vs. rust) ± SEM.*P<0.05, **P<0.01 (Wilcoxon Signed Ranks Test).
In contrast, old instar larvae of the specialist herbivore L. populi preferred to eat from
uninfected leaves at 10 days since the beginning of the experiment (Paired samples T-Test,
t1,15= 2.432, P= 0.028; Fig 3).
Fig 3. Effect of Melampsora larici-populina rust infection on the preference of old instar Laothoe populi larvae.
Larvae fed during 24 h from Populus nigra leaf discs at 10 days since the beginning of the experiment. Bars
represent mean of leaf damage (% removed leaf area control vs rust) ± SEM. *P<0.05 (Paired samples T-test).
Fungal growth
In order to quantify the infection, I measured the relative amount of M. larici-populina genomic
DNA on the poplar leaves by qPCR. The relative amount of M. larici-populina genomic DNA
increased dramatically upon infection and with the time of infection (GLM, rust F1,27=267.067,
P=0.000; time course: F4,27=7.741, P=0.001; Fig. 4). There was interaction between the two
factors (GLM, rust x time course, F3,27=8.953, P=0.001).
16
Fig. 4. Relative amount of
genomic DNA of the
Melampsora
internal
transcribed spacer (ITS) in
the leaves of the Populus
nigra trees during a time
course of 10 days. The
primer works for all
species within the genus
Melampsora. Values were
normalized to the plant
gene
Actin.
Bars
represent means ± SEM
(n=3), (GLM, **P=xy,
***P = xyz).
Leaf chemistry
Salicinoids and other phenolics
Rust infection by M. larici-populina induced the levels of the flavan-3-ol catechin on black
poplar leaves (Mann-Whitney U Test, rust: P1,27=0.028). In contrast, the levels of the salicinoids
and other phenolics analyzed were not affected (GLM, salicin: F1,27=0.001, P=0.973; salicortin:
F1,27=0.024, P=0.878; homalosid D: F1,27=0.001, P=0.973; 6-tremulacin: F1,27=0.789, P=0.386;
rutin: F1,27=0.043, P=0.838; grandidentatin 1,2: F1,27=0.597, P=0.450; PA B1: F1,27=0.367,
P=0.552).
The levels of salicortin, homaloside D, 6-tremulacin, catechin, rutin, proanthocyanidin
B1 (PA B1) and grandidentatin varied among the time course of the experiment (GLM,
salicortin: F4,27=4,395, P=0.012; homalosid D: F4,27=4.539, P=0.010; 6-tremulacin: F4,27=8.584,
P=0.000; rutin: F4,27=7.307, P=0.001; grandidentatin: F4,27=4.789, P=0.008; PA B1: F4,27=12.920,
P=0.000; Kruskal-Wallis, catechin P4,27=0.001; Fig. 5). Only the levels of salicin remained stable
along the time of the experiment (GLM, salicin: F4,27=2.159, P=0.115). There was no interaction
between infection and time course of the experiment for any of the compounds analyzed.
17
18
Fig. 4. Salicinoids and other phenolics: levels and chemical structures. Top) Effect of Melampsora larici-populina
rust infection and time course of 10 days on leaf phenolic content (mg/g leaf dried weight) in Populus nigra. Green
and yellow bars represent control trees (sprayed with water) and rust infected trees (sprayed with a solution of M.
larici-populina.) respectively. Bars represent means ±SEM. n.s.= not significant, *P<0.05, **P<0.01, ***P<0.001 (2way GLM, n= 3 trees). Bottom) Chemical structures of the phenolic compounds analyzed in P. nigra.
Phytohormones
Rust infection by M. larici-populina induced the levels of jasmonates and salicylic acid on black
poplar leaves (GLM jasmonates, F1,27=5.287, P=0.034; Kruskal Wallis, SA P1,27=0.002; Fig. 5). In
contrast, the levels of abscisic acid were not affected by rust infection (GLM ABA: F1,27=2.424,
P=0.137; Fig. 5).
The levels of ABA and jasmonates remained stable among the time course of the
experiment (GLM, jasmonates: F4,27=1.705, P=0.193; ABA F4,27=1.791, P=0.175; Fig. 5). In
contrast, the levels of SA varied with time (Kruskal Wallis, SA P4,27=0.040; Fig. 5).
There was no interaction between infection and days after infection for any of the
compounds analyzed.
Fig. 5. Effect of Melampsora
larici-populina rust infection
over a time course of 10 days
on
leaf
phytohormone
concentrations in Populus
nigra. SA= salicylic acid; ABA=
abscisic acid; jasmonates (the
sum of jasmonic acid (JA),
jasmonoyl-isoleucine (JA-Ile),
cis-12-oxo-phytodienoic acid,
OH-JA, OH-JA-Ile, COOH-JAIle). Bars represent means
±SEM. n.s.= not significant,
*P<0.05, **P<0.01 (2-way
GLM, n= 3 trees).
19
Phenolic acids
Rust infection by M. larici-populina did not influence the levels of any of the phenolic acids
analyzed on black poplar leaves (GLM, cinnamic acid: F1,27=0.100; coumaric acid: F1,27=0.039,
P=0.845; ferulic acid: F1,27=0.032, P=0.860; caffeic acid F1,27=0.331, P=0.572; 3,4-dimethoxy
caffeic acid: F1,27=0.000, P=0.994; gallic acid: F1,27=1.336, P=0.258; Fig. 6).
The levels of coumaric acid, ferulic acid, caffeic acid and 3,4-dimethoxy caffeic acid
varied during the course of the experiment (GLM, coumaric acid: F4,27=4.047, P=0.016; ferulic
acid: F4,27=13.772, P=0.000; caffeic acid: F4,27=3.651, P=0.024; 3,4-dimethoxy caffeic acid:
F4,27=11.197, P=0.000; Fig. 6). In contrast, the levels of cinnamic acid, and gallic acid remained
stable (GLM, cinnamic acid: F4,27=1.893, P=0.155; gallic acid F4,27=0.079, P=0.988; Fig. 6).
There was no interaction between infection and time course of the experiment for any
of the compounds analyzed.
Fig. 6. Effect of Melampsora larici-populina rust infection and time course of experiment on leaf phenolic acid
content (expressed in ng/g dried weight for cinnamic acid, coumaric acid and ferulic acid and in µg/g dried weight
for caffeic acid, 3,4-dimethoxy caffeic acid and gallic acid) in Populus nigra. Bars represent means ±SEM. n.s.= not
significant, *P<0.05, ***P<0.001 (2-way GLM, n= 3 trees)
Sugars and mannitol
The levels of mannitol dramatically increased upon rust infection by M. larici-populina (GLM,
mannitol: F1,27=39.051, P=0.000; Fig. 7). In contrast, rust infection did not affect the content of
glucose, sucrose and fructose in the leaves (GLM glucose, F1,27=1.441, P=0.246; sucrose:
F1,27=0.560, P=0.464; Kruskal-Wallis fructose: P1,27=0.829; Fig. 7).
The levels of fructose and mannitol varied during the time course of the experiment
(Kruskal-Wallis, fructose: P4,27=0.043; GLM mannitol: F4,27=8.910, P=0.000; Fig. 7). In contrast,
the levels of glucose and sucrose remained unvaried (GLM glucose, F4,27=2.936, P=0.05; sucrose:
F4,27=0.149, P=0.961; Fig. 7).
There was interaction between rust infection and time course of the experiment for
mannitol (GLM, mannitol: F1,27=10.016, P=0.000; Fig. 7).
20
Fig. 6. Effect of Melampsora larici-populina rust infection and time course of experiment on leaf sugar and
mannitol content in Populus nigra. Bars represent means ±SEM. n.s.= not significant, *P<0.05, ***P<0.001 (2-way
GLM for glucose, sucrose and mannitol; Kruskal-Wallis for fructose; n= 3 trees)
Amino acids
The rust infection did not alter the levels of free amino acids in the leaves of black poplar (table
1). However, the levels of alanine, aspartate, glutamine, glycine, isoleucine, proline, threonine,
tryptophan, tyrosine and valine varied among the duration of the experiment (GLM, alanine:
F4,27=10.793, P=0.000; glutamine: F4,27=6.891, P=0.002; proline: F4,27=4.692, P=0.009; threonine:
F4,27=12.676, P=0.000; tyrosine: F4,27=4.382, P=0.012. Kruskal-Wallis, aspartate: P4,27=0.001;
isoleucine P4,27=0.007; tryptophan: P4,27=0.041; valine: P4,27=0.001). In contrast the levels of
arginine, asparagine, histidine leucine and lysine remained stable during the 10 days of the
experiment (GLM, arginine: F4,27=0.760, P=0.565; asparagine: F4,27=1.082, P=0.395; histidine:
F4,27=1.108, P=0.383; leucine: F4,27=0.557, P=0.697; lysine: F4,27=1.524, P=0.237). There was no
interaction between the factors for any of the amino acids analyzed.
21
Table 1. Mean value ±SEM of free amino acids (expressed in ng/g of DW) on the healthy and rust-infected leaves of
black poplar, during the time course of the experiment.
Time
0 days
Treatment Control
6111.4±
Alanine
957.3
187.2±
Arginine
37.7
26.3±
Asparagine
4.2
312.6±
Aspartate
10.1
333.5±
Glutamine
72.9
275.8±
Glutamate
39.3
35.0±
Histidine
5.2
35.3±
Isoleucine
3.3
47.5±
Leucine
10.8
109.9±
Lysine
24.4
75.5±
Proline
6.2
158.9±
Serine
16.7
45.5±
Threonine
4.3
113.3±
Tryptophan
1.7
3.1±
Tyrosine
0.8
67.2±
Valine
15.7
Total
1826.4
1 day
Control
7319.0±
330.3
191.7±
27.2
21.4±
2.0
494.7±
88.6
573.4±
114.6
323.5±
41.5
29.4±
7.8
34.7±
5.5
51.5±
10.2
177.7±
42.5
67.4±
3.6
139.1±
5.5
47.9±
4.1
118.3±
0.8
1.0±
0.2
67.0±
9.6
9657.6
Rust
8977.5±
231.7
219.5±
25.5
26.8±
4.7
514.6±
61.9
507.7±
101.6
403.0±
30.4
29.8±
7.3
35.9±
4.6
34.5±
11.5
141.3±
55.8
67.6±
1.0
123.1±
6.7
51.1±
2.4
103.9±
1.4
0.9±
0.1
61.7±
6.8
11298.8
4 days
Control
6779.0±
801.7
182.4±
34.7
25.1±
4.9
417.8±
48.5
415.7±
50.3
255.0±
28.8
40.8±
7.0
35.9±
1.9
59.0±
2.6
147.6±
30.8
60.3±
2.2
105.2±
10.6
33.1±
1.8
120.1±
10.3
3.5±
0.2
36.9±
7.8
8717.3
22
Rust
5375.7±
613.8
160.4±
33.6
21.1±
4.1
353.3±
43.7
357.4±
92.8
232.9±
27.5
23.1±
7.1
39.9±
6.2
37.8±
2.7
132.8±
45.6
56.2±
2.7
95.7±
4.9
30.5±
1.2
114.0±
8.9
1.5±
0.1
33.1±
4.7
7065.5
7 days
Control
4926.0±
487.2
165.3±
30.2
21.7±
0.9
269.2±
20.7
438.9±
98.5
218.6±
31.1
44.3±
8.1
23.2±
7.0
44.2±
15.9
163.1±
24.5
60.2±
3.5
106.2±
7.0
40.9±
6.7
116.1±
10.4
1.4±
1.6
29.3±
10.5
6668.6
Rust
4970.9±
945.3
189.2±
18.4
16.6±
4.2
202.5±
7.0
310.9±
77.6
151.6±
33.9
43.8±
8.7
17.0±
8.1
39.2±
15.8
123.5±
23.3
54.6±
4.5
98.6±
8.1
33.4±
6.7
114.7±
3.7
1.2±
1.5
30.3±
11.4
6397.9
10 days
Control
4153.8±
702.0
176.8±
11.9
16.7±
4.4
278.0±
20.0
293.9±
34.7
171.9±
17.2
30.0±
7.6
20.1±
9.6
29.9±
12.2
117.9±
7.0
51.0±
4.8
86.4±
0.4
31.6±
1.0
118.8±
1.5
1.0±
1.2
23.1±
1.4
5601.0
Rust
3985.0±
326.5
153.1±
21.4
17.7±
7.0
196.1±
53.0
250.6±
48.2
119.1±
14.2
33.9±
7.7
20.7±
16.4
42.0±
7.1
104.3±
3.0
62.3±
5.1
92.5±
10.6
23.0±
1.3
122.9±
3.0
1.6±
0.5
28.3±
3.6
5253.1
Protein content
Rust infection did not affect the leaf protein content. However, there was variation with the
time course of experiment (Mann-Whitney U Test, rust: P1,27=0.071; Kruskal-Wallis, time
course: P4,27=0.023; Fig. 7).
Fig.7. Effect of Melampsora
larici-populina rust infection
and time course of the
experiment on leaf protein
content expressed in mg
protein/g fresh weight (FW)
in Populus nigra. Bars
represent means ±SEM.
n.s.=not significant *P<0.05,
(Mann-Whitney
U
Test
Kruskal-Wallis, n= 3 trees).
Proteinase inhibitor content
Infection by M. larici-populina did not have an effect on the leaf proteinase content on black
poplar. There was not an effect of time course of the experiment either (Kruskal-Wallis, rust:
P1,27=0.824; time course: P4,27= 0.731; Fig. 8).
Fig.8. Effect of Melampsora
larici-populina rust infection
and time course of the
experiment
on
leaf
proteinase inhibitor (PI)
content expressed in ng PI/g
DW in Populus nigra. Bars
represent means ±SEM.
n.s.=not significant *P<0.05,
(Kruskal-Wallis test, n= 2-3
trees).
23
Discussion
I found that infection on black poplar by the rust fungus Melampsora larici-populina strongly
influences the feeding preference of larvae of the generalist herbivore Lymantria dispar and of
the specialists Laothoe populi. For L. dispar the effect of rust infection in the feeding preference
depends on the development of the fungus on the leaf. At the beginning of the infection (1 day
post infection, dpi), caterpillars fed on average 20 % more from the uninfected leaves.
Remarkably, upon 4 dpi, preference shifted towards the rust infected leaves, with a feeding
damage up to 50% higher from infected leaves. In contrast, larvae of the specialist herbivore
Laothoe populi ingested on average 30% more from healthy than from the infected leaves at 10
dpi. In addition, I found that rust infection affected some leaf chemistry traits. The levels of
mannitol, catechin, salicylic acid and jasmonates were induced by rust infection. The levels of
several phenolics, sugars, and proteins varied during the 10 days of the experiment.
The differential preference for infected or healthy leaves that I report is very relevant
since infection in the field is patchy, and caterpillars might migrate to their most preferred trees
or tree parts. In the case of L. dispar this is especially important, as the adult females -although
winged- cannot fly and they normally oviposit very close to their emerging site. In contrast, the
larvae are very mobile and able to migrate from one tree to another, both actively and
passively through wind. Larvae of L. dispar feed and move through their life-time and at the end
choose where to pupate, which will be the emerging site of the adults. The decision where to
pupate is therefore crucial for next generations, and likely has a big effect on population
success. The fact that the rust infection affects the larvae’s preference is hence not only
important for the individual performance but possibly also for the fitness of upcoming
generations. It has been suggested, that the effect of pathogen infection on insects -although
largely unexplored- might affect insect community dynamics (Tack and Dicke 2013).
Other authors reported that fungal infection influences the preference of insect
herbivores (Hatcher et al. 1995; Lewis 1979; Simon and Hilker 2003; Wandeler and Bacher
2006). Interestingly, there are several examples of generalist insects feeding more from fungal
infected leaves, and specialist insects preferring healthy leaves (Al-Naemi and Hatcher 2013;
Hatcher et al. 1995; Rostás et al. 2003; Simon and Hilker 2003; Simon and Hilker 2005),
although there are exceptions (Lappalainen et al. 1995; Rostás and Hilker 2002). One study,
using the generalist beetle Diabrotica undecimpunctata (spotted cucumber beetle) and
cucumber leaves infected with Cladosporium cucumerinum, showed that the insects fed more
from infected leaves than from healthy leaves (Moran 1998). However, adults of the generalist
beetle Phaedon cochleariae avoided feeding and oviposition on cabbage leaves infected by
Alternaria brassicae (Rostás et al. 2002). Infection of Salix x cuspidate (hybrid of S. fragilis and S.
pentandra) by the rust Melampsora-allii-fragilis had a negative effect on larval preference of
the specialist leaf willow beetle Plagiodera versicolora (Simon and Hilker 2003; Simon and
Hilker 2005). Similarly, infection of Cirsium arvense (creeping thistle) with the necrotrophic
fungus Phoma destructive had a negative effect on the feeding and oviposition preference, as
well as on the performance (development time, larval weight, larval and pupal mortality) of the
specialist leaf beetle Cassida rubiginosa (Kruess 2002). Likewise, larvae of the specialist insect
Tyria jacobaea (cinnabar moth) fed more from healthy Senecio vulgaris and Tussilago farfara
plants, than from the same plants infected with the rust fungus Coleosporium tussilaginis
24
(Rostás et al. 2003). Other insect species could not discriminate between healthy and infected
leaves, and therefore it seems to be influenced in species-specific manner (Simon and Hilker
2005). Further research studying the effect of M. larici-populina infection on the performance
of both the generalist L. dispar and the specialist L. populi might help us to understand their
behavior. In addition, further research addressing other insect species (generalists, specialists,
and belonging to different orders) will give more insight, whether we can draw general lines on
specialists-generalists preference, or whether there is a pattern within orders.
In my study, infection by M. larici-populina affects the feeding behavior of the generalist
insect L. dispar and of the specialist insect L. populi in a different way. One explanation for that
result may be the previous feeding experience of the larvae used for the experiment. In order
to avoid changes in behavior due to feeding experience, I reared L. dispar larvae on artificial
diet. However, this was not possible for L. populi larvae, since they are specialists of poplar, and
so far there is no artificial diet developed for this insect. L. populi larvae were reared on control
(i.e. uninfected) black poplar trees. And it is known that experiences acquired at earlier
developmental times can modulate host selection at later stages. Maybe larvae of L. populi
learnt control plants-associated cues and this influenced their feeding preference. Proffit et al.
(2015) showed that feeding experience of larval of Spodoptera littoralis influenced later host
plant preference. Feeding experience even affects attraction of caterpillars to herbivoreinduced plant volatiles (McCormick et al. 2016). Another possibility is that the generalist insect
was affected by the fungal-induced phytochemistry changes in a different way than the
specialist insect. It has been argued that specialist insects are affected by plant defenses in a
different way than generalist insects (Ali and Agrawal 2012).
I found that the preference of L. dispar depended on the fungal development on the
leaf. Although very scant, there is evidence of this being the case for other systems. P.
versicolora strongly avoided eating local infected leaves by the rust M.-allii-fragilis at 8-16 dpi
(Simon and Hilker 2005). However, the leaf beetle avoided feeding from symptom-free
(systemic) infected leaves only after 16 dpi (Simon and Hilker 2005). Moreover, the
performance of Epirrita autumnata (autumnal moth) decreased when reared on trees infected
by the birch rust Melampsoridium botulinum with a strong effect of development of rust on the
leave (Lappalainen et al. 1995). Importantly, the effect of pathogen infection on insect
preference may last seasons. Pristiphora erichsonii (specialist larch sawfly) fed less from trees
that were attacked by the rust fungus Mycosphaerella laricinia the year before (Krause and
Raffa 1992). The temporal factor may be crucial in other fungus-plant-insect interactions, and it
would be interesting if other studies would address this.
There are scarce studies investigating the phytochemical background of plant pathogen
interactions. There is even scarcer evidence on how phytochemical changes induced by a
phytopathogen may affect herbivorous insects. This information is very relevant as pathogen
infection might be an important driver of insect communities. In order to get a better insight on
the reason for a different insect preference between rust infected or healthy leaves, I analyzed
several plant traits. The levels of the condensed tannin catechin remained equal as in control at
early stages of infection. In contrast, at later stages of rust infection catechin levels were higher
than in the control leaves. This pattern matches with the herbivore preference as at 1 dpi
caterpillars preferred to feed from uninfected leaves and later from rust-infected leaves. The
preference towards high content catechin leaves was already reported by Boeckler et al. (2014)
25
who showed that transgenic upregulation of the condensed tannin pathway (higher levels of
catechin) led to an increase in gypsy moth preference and performance, compared to control.
These results were surprising, as condensed tannins were traditionally though to act as antiherbivore defense (Feeny 1968).
Nonetheless, to date there is not yet an agreement on the role of condensed tannins
against herbivorous insects (Barbehenn and Constabel 2011). In the study by Boeckler et al.
(2014), the increased insect performance could be explained by a simultaneous reduction of
the levels of other salicinoids important as anti-herbivore defense such as salicortin (reduced
from 70 mg/g DW to 40-50 mg/g DW) and tremulacin (reduced from 40 mg/g DW to 15-20
mg/g DW). However, in my study, the levels of salicortin and tremulacin were not
downregulated during rust infection. Therefore, the preference towards the rust-infected
leaves is not explained by reduction of these salicinoids. It would be valuable to further
investigate whether catechin itself plays a role in modulating herbivore preference and
performance. Studies adding catechin to artificial diet, or incorporating catechin to the leaves,
and comparing the preference/performance of gypsy moth larvae to that of larvae reared on
low catechin diets will shed a light on the role of catechin on plant-insect-fungal interactions.
Regardless of the finding of (Boeckler et al. 2014) showing that catechin has a positive
effect on caterpillar performance (possibly explained by a reduction in other salicinoids), it has
been often reported that phenolics and other plant secondary metabolites have a negative
effect on the performance of the gypsy moth (Roth et al. 1997). However, there is still
controversy on the role of tannins (such as catechin) in plant-insects interactions (Barbehenn
and Constabel 2011). Many studies proved that despite the polyphagous behavior of the gypsy
moth, its performance is highly affected by the host species and their secondary metabolites.
However, feeding from high-content secondary metabolite plants might benefit the insect in
terms of protection against natural enemies. Parasitoid species lay eggs inside the gypsy moth
and the larvae may be exposed to the secondary metabolites ingested by the caterpillar. Roth
et al. (1997) found 61% weight reduction in gypsy moths reared on salicinoid-enriched diets.
But interestingly, the performance of the gypsy moth parasitoid, Cotesia melanoscela was also
reduced (42% weight reduction, mortality increased by 2.5 fold) when the caterpillar host fed
from high-content salicinoid diets (Roth et al. 1997). The same pattern is found in the generalist
bird insect-predator Poecile atricapillus (black-capped chickadees), who preferably fed on L.
dispar caterpillars reared on low salicinoid levels (Muller et al. 2006). This is remarkable as
insectivorous birds are major predators of insects and P. atricapillus is able to predate all life
stages of L. dispar (contrary to most L. dispar predators).
Despite the negative effect of salicinoids for the caterpillar itself, it might be beneficial
for the insect to feed from high-containing salicinoid leaves, as this might reduce the pressure
from natural enemies. It is often hypothesized, that generalist caterpillars are negatively
affected by plant secondary metabolites, their development will be slower, and as a
consequence they will be longer exposed to natural enemies (Agrawal et al. 1999). However, it
might also be that plant secondary metabolites protect herbivores from being eaten by natural
enemies (e.g. birds or parasitoids). In addition, if the parasitoids reproduce less when the
caterpillar-host has fed from high salicinoid content, this may reduce the natural enemy
pressure for later generations. There are multiple examples showing herbivores that acquire
plant secondary metabolites leading to defense against vertebrate and invertebrate predators,
26
pathogens and parasites (Brower 1958; Dettner 1987). For example monarch butterflies larvae
sequester cardenolides from their milkweed host and this makes the caterpillars distasteful to
birds (Brower 1958). Studies assessing the effect of catechin on insect herbivores and on higher
trophic levels will provide a better understanding of the complexity of interactions between
plants, insect herbivores and their natural enemies.
Importantly, it has been suggested, that insect herbivores may need to combine more
than one plant secondary metabolite in order to be effectively defended against their natural
enemies (Mason and Singer 2015). Mason and Singer (2015) proposed the term `acquired
combinatorial chemical defense´ as the “adaptive use of multiple chemicals of discrete origin
resulting in defense against natural enemies”. For example, predatory ants were deterred by
caterpillars of Grammia incorrupta that fed a mixture of two plants, one containing iridoid
glycosides and the other containing pyrrolizine alkaloids (Mason and Singer 2015). Remarkably,
the presence of both chemicals was needed in order to deter the natural enemy (Mason and
Singer 2015). If this is true for other systems we might have underseen the final effect of
secondary metabolites on the herbivore. Probably there are more examples where a single
metabolite is detrimental for the herbivore, but in combination with other secondary
metabolite(s), the herbivore benefits if we include natural enemies in the picture. This adds
another level of complexity to herbivore-plant interactions. L. dispar is a generalist insect and
feeds from plants containing diverse secondary metabolites. Possibly caterpillars make use of
some of the secondary metabolites (alone or mixed) as a defense against natural enemies. The
mechanisms could include sequestration, regurgitation or accumulation in the integument
among others.
In addition to a possibly lower natural enemy performance on caterpillars feeding from
rust infected leaves, it could be the case that natural enemies of L. dispar are less attracted to
the volatiles of infected plants. It has been reported that M. larici-populina infection reduces
the emission of plant volatiles on black poplar (Eberl et al., unpublished results). In our case,
detection of poplar volatiles by natural enemies of the gypsy moth is probably reduced when
the plants are infected. If natural enemies of the gypsy moth are less attracted to the volatiles
of healthy trees the predation/parasitism pressure may decrease on infected trees, explaining
why it would be beneficial for the caterpillars to feed on “lower perfume” plants. Even though
infection in the field is not homogeneous this could be a factor modulating caterpillar
abundance, as some trees are more infected than others and possibly are differentially
attractive to L. dispar´s natural enemies. Experiments exploring whether L. dispar
predators/parasitoids are less attracted to infected trees would help to answer this question.
Although not so much evidence as compared to herbivore feeding, some literature
suggests that pathogen infection changes the volatile blend of the plant with an effect on insect
herbivores. Larvae of L. dispar are able to differentiate between the volatiles of healthy or rustinfected plants, and they are also more attracted towards volatiles from infected trees (Eberl et
al., unpublished results). This suggests that the larvae would be able to detect infected trees
from the distance, and could “face” their migration towards them. In addition, a recent study
corroborates that gypsy moth caterpillars are able to discriminate between different black
poplar volatiles and that feeding experience influences their preference (McCormick et al.
2016). Supporting a higher insect attraction towards infected plants, Fusarium infection of
maize leaves induced the release of several green leaf volatiles that were attractive to the leaf
27
beetle Oulema melanopus (Piesik et al. 2011). Likewise, infection on Silene latifolia by the
anther smut fungus Microbotryum violaceum changed the volatiles profile of the plant (Dotterl
et al. 2009). But the volatiles of Vitis vinifera plants infected with Botrytis cinerea were less
attractive to the Lobesia botrana (grapevine moth) than the volatiles of healthy plants (Tasin et
al. 2012).
There is even scarcer research addressing how the pathogen-induced change in plant
volatiles affects the attraction of higher trophic levels. Rostás et al. (2006) showed that Zea
mays (maize) seedlings suffering double attack by the fungus Setosphaeria turcica and larvae of
Spodoptera littoralis emitted around 50% less volatiles, compared with the single attack by the
insect. In this study, the parasitoids Cotesia marginiventris and Microplitis rufiventris showed
similar attraction to the blends of insect-damaged and insect and fungus-damaged plants
(Rostás et al. 2006). Similarly, when Brassica nigra plants were attacked both by the bacterial
pathogen Xanthomonas campestris and by caterpillars of Pieris brassicae, the searching
behavior of the parasitoid Cotesia glomerata was not affected (Ponzio et al. 2014). However, in
this latter study –contrary to our system- they could not separate the volatile emissions of the
plants that were attacked by the insect, from those that suffered attack by both the insect and
the pathogen (Ponzio et al. 2014). Possibly pathogen infection effect on plant volatiles depends
on the pathogen identity and on the plant species.
In this study, the levels of salicylic acid (SA) were also induced by poplar leaf rust
infection. Many studies proved the role of SA on plant defenses against biotrophic pathogens
(Dodds and Rathjen 2010; Pozo et al. 2004). I found that jasmonates levels were also induced
by rust infection. This contrasts with the findings of Duplessis et al. (2009) who reported that
several poplar jasmonate ZIM domain (JAZ) transcripts were upregulated in Melampsorainfected poplar leaves, which indicates suppression of JA signaling (Pauwels and Goossens
2011). My result is surprising, and does not explain the higher preference of the herbivore, as
jasmonates are well-known plant defense hormones regulating defenses against chewing
insects such as L. dispar. Some authors reported that jasmonates are involved in plant defenses
against some biotrophic pathogens as well. For example, Arabidopsis plants with constitutive
activation of the JA signaling pathway were more resistant against the biotrophs Erysiphe
cichoracearum, Erysiphe orontii and Oidium lycopersicum (Ellis et al. 2002). Most studies show a
negative crosstalk between SA and jasmonates (Koornneef and Pieterse 2008). My results
contradict this paradigm, insomuch as there is an induction of both phytohormones. However,
in recent literature there are increasing examples of synergistic interactions between both
phytohormones (Koornneef and Pieterse 2008) or concentration-dependent outcome (Mur et
al. 2006). Surprisingly, there is an induction of SA on the non-infected control plants at 7 dpi.
The plants used for the experiments were grown in the greenhouse, and although I tried to
restrict insect/pathogen contamination, maybe there were individual cases of plants attacked
by aphids or powdery mildew that may have caused elevated SA levels in the control plants at 7
dpi.
The levels of proteinase inhibitor on black poplar leaves were not affected by rust
infection. In contrast, transcriptome analysis of black poplar infected by M. larici-populina
showed repression of proteinase inhibitors (Eberl et al., unpublished results). In addition,
Miranda et al. (2007) reported, that infection by M. medusa on the hybrid Populus trichocarpa x
P. deltoids strongly repressed the expression of genes regulating Kunitz trypsin Inhibitor (KTI).
28
Protein inhibitors such as (KTI) are well known plant defenses against herbivores, as they
reduce digestibility of plant (Philippe and Bohlmann 2007). I expected that infection would
reduce the content of proteinase inhibitors on the leaves, and that this would be one of the
reasons why L. dispar preferred to feed on infected leaves. Possibly the infected plants had a
lower content of proteinase inhibitors than the healthy plants, but I was not able to detect it on
my samples. The black poplar genotype that I used for my experiments is known for containing
lower amounts of leaf proteinase inhibitors than other genotypes. This might have hindered the
quantification and masked interesting trends. Maybe for this genotype another method of
detection is better, such as transcriptome analyses.
I need to mention that in my study, the levels of some plant defense traits analyzed
were much lower than expected in all the samples. A preliminary study using the same study
system (same black poplar genotype and fungus) found that concentrations of phenolics and
phytohormones were double compared to those found in my study (Eberl et al., unpublished
results). In both studies, leaf samples were collected, immediately frozen in liquid nitrogen and
part of it subsequently freeze-dried. One possibility is that in my study there was a problem in
the freeze drying process, and part of the compounds was lost by degradation. This should not
be a problem for comparison between healthy and rust infected leaves, being that if
degradation occurred, this would have had affected both treatments presumably in the same
way. However, the levels of jasmonates on all samples were at the noise level, which
obstructed accurate measurements. This is presumably an explanation for the unexpected
relatively high levels of jasmonates in the infected leaves compared to control leaves.
Furthermore, although for the preference assays I performed 15-30 replicates, for the
compound analysis I only used 3 trees per treatment. This led to a high variation in some of the
traits analyzed that might have masked some interesting effects. It would be worth to repeat
the analysis with a higher number of replicates and making sure there is no degradation during
the freeze-drying process, to see whether more plant traits are affected by the infection and
playing a role in the insect preference.
Infection by M. larici-populina induced the levels of mannitol in the leaves, with a strong
effect of time passed after infection. At 1 and 4 dpi mannitol levels were on average 1.8 and 2.3
higher in infected leaves compared to control leaves. At 7 dpi and 10 dpi, the rust infected
leaves contained respectively 4 and 8 times more mannitol than the uninfected leaves. This
result strongly matches with the preference of L. dispar, and it is therefore tempting to
speculate that the caterpillars of L. dispar are attracted by mannitol. Deposition of sugar
alcohols in spores has been described for a number of fungi, including rust species and it has
been proposed as a mechanism for carbohydrate storage and/or stress protection (Voegele et
al. 2005; Voegele and Mendgen 2011; Voegele et al. 2006). Voegele and Mendgen (2011) also
reported a dramatic increase in mannitol in Vicia faba leaves infected with the rust fungus
Uromyces fabae and large amounts of mannitol in urediniospores. Importantly most plants are
not able to utilize mannitol. The production of mannitol would be a good strategy for the
pathogen to store carbohydrates in a soluble form that is freely diffusible in the mycelium, but
cannot be accessed by the host (Voegele and Mendgen 2011).
To my knowledge, no study so far has investigated, whether L. dispar has taste
receptors responding to mannitol. However, Martin and Shields (2012) reported a receptor
sensitive to the sugar alcohol inositol in L. dispar. Possibly, L. dispar larvae have receptors that
29
respond to mannitol, although this has to be confirmed. Another study reported that mannitol
did not stimulate feeding of caterpillars of Heliothis zea (Schiff et al. 1989). However, when
mannitol replaced sucrose in an artificial diet, the larval utilization efficiencies were not
affected, suggesting that H. zea caterpillars are able to use mannitol (Schiff et al. 1989). Eberl et
al. (unpublished results) studied the preference of L. dispar between black poplar leaves
covered with agar or with agar enriched with mannitol. Interestingly, the caterpillars fed
significantly more from the leaves with a mannitol coating, suggesting that mannitol is detected
and preferred by the caterpillars (Eberl et al., unpublished results). Mannitol might have a
positive effect on caterpillar fitness, but it might also be that it is just a feeding stimulant, with
no effect on the performance (as is the case in humans).
One possibility is that L. dispar larvae use mannitol as cold protection. It has been
suggested that some insects use polyols (e.g. glycerol, sorbitol, mannitol) to prevent from
freezing (Doucet et al. 2009). In Xanthogaleruca luteola (elm leaf beetle) and in Oncopeltus
fasciatus (milkweed bug), glycerol accumulation is correlated with cold resistance. Likewise, in
the overwintering spruce bark beetle, Ips typographus, concentrations of mannitol and sorbitol
drastically increased during the coldest part of the season, suggesting a role in cold protection
(Kostal et al. 2007). It has been suggested that polyols may prevent insects from freezing even
at relatively low concentrations (Kostal et al. 2007). Kostal et al. (2001) injected the polyols
ribitol and sorbitol in the hemolymph of the bug Pyrrhocoris apterus. Interestingly insect´s
survival increased by three-fold (in comparison with untreated insects) when exposed three
days to -14°C (Kostal et al. 2001). The mechanisms behind polyol-mediated cold tolerance are
not well understood. Possibly, it relies on the ability of polyols -such as trehalose and mannitolto scavenge oxygen radicals and preserve native conformation of proteins at cold temperatures
(Benaroudj et al. 2001). Studies assessing the effect of mannitol on caterpillar performance
investigating the role in cold protection would help us understand the above commented
results.
In addition to catechin, phytohormones, and mannitol, the fungus might change
physical plant traits such as leaf toughness or color. The caterpillars used for the experiment
were 2nd instar, and they have weak mouthparts. It is therefore crucial for them to find soft
leaves that they can chew. The content of phenolic acid is often an indication of leaf
lignification and in this study the fungus did not affect them. However it would be interesting to
measure leaf toughness, as it is negatively correlated with herbivore preference and
performance (Malishev and Sanson 2015) and it might be lower in the rust infected leaves. One
study proved that litter colonization by Pycnoporus coccineus (white-rot fungus) decreased leaf
toughness, and positively affected the feeding of invertebrates (Harrop-Archibald et al. 2016). I
am not aware of any study assessing whether a biotroph pathogen reduces leaf toughness.
However, preliminary studies by Eberl et al. (unpublished results) show that although the 2 nd
instar L. dispar larvae prefer to feed from infected leaves, later instar larvae show no
preference. Leaf toughness could be an explanation for this loss of preference. This would also
partly explain why the generalist L. populi did not prefer to feed from the infected leaves. The L.
populi caterpillars used for the experiment were old instar, with well-developed mouthparts.
Possibly feeding from soft tissues is not as crucial for them as for younger larvae. The higher
preference of the specialist insect for the control leaves could be explained by other plant
traits. However, with this study I cannot answer this question. More research is needed in order
30
to investigate the effect of fungal infection on leaf toughness, as this might be a driver of an
enhanced herbivore preference. Possibly, the effects of fungal infection are different depending
on the species involved, and on their relationship.
Color might play a role as well in insect preference. Upon 7 dpi, the infected leaves start
to yellow and at 10 dpi they acquire the typical rust color that gives the name to the fungus.
There are several studies indicating that butterflies have a highly developed color vision, and
some even show that they are attracted to yellow (Yurtsever et al. 2010). Importantly, it has
been suggested that leaf color may indicate concentration of plant secondary metabolites
(Green et al. 2015). This has been proven for Brassica oleracea, where leaf color and brightness
(according to herbivore spectral sensitivities), correlates with glucosinolate levels and Pieris
rapae and Brevicoryne brassicae abundance in the field (Green et al. 2015). However, the same
study was unable to prove a different attraction of the insects based on leaf color in the
greenhouse (Green et al. 2015). Nonetheless, there is no evidence of larvae of L. dispar being
able to detect yellow or being attracted to yellow. It could be, however, that they are able to
differentiate between the color of healthy and infected leaves but that they learn by
association, that the yellow rust infected leaves have a higher content of some of the nutrients
beneficial for them. It would be interesting to address whether the caterpillars are attracted to
the color spectra of the infected leaves, and whether this is an innate or learned behavior.
Notwithstanding the lack of effect of the rust infection on the salicinoids, other
phenolics, proteins and amino acids, the levels of some compounds changed with the ontogeny
of the P. nigra plants. The levels of salicortin, homalosid D, 6-tremulacin, rutin and
grandidentatin decreased with the plant ontogeny. In contrast, the levels of catechin and
proanthocyanidin B1 (PA B1) increased. It has been reported that levels of salicinoids in the
Salicaceae exponentially decrease with tree age (Boeckler et al. 2013; Donaldson et al. 2006).
Another study showed the opposite trend in Salix sericea, where the levels of salicinoids in 7-14
week old seedlings are low and increase with plant ontogeny (Fritz et al. 2001). It has been
suggested that de novo synthesis as well as transportation from other tissues are important
drivers of the shift of salicinoids with plant age (Boeckler et al. 2013). It has also been shown,
that some herbivores prefer to feed from old trees that have a lower content of salicinoids,
even though they are less nutritious than young trees. In addition to phenolics, the levels of
several amino acids as well as the levels of protein also varied with the plant development.
Most of the amino acids analyzed decreased with the course of the experiment. In plants,
including the closely related Populus tremula, there is often a decrease in leaf nitrogen with
plant age, associated with allocation to growing leaves (Niinemets et al. 2004). Probably the
variations in some defense compounds, proteins and amino acids are related with the plant
development, and reallocation to other plant parts.
I speculated how the insect could benefit from feeding on infected leaves. One obligate
next question is whether the fungus benefits from making the black poplar trees more
attractive to L. dispar larvae. Possibly, the fungus benefits if the insect acts as a vector. There
are some reports of insects acting as vectors of fungal transmission. The weevil beetle
Ceratapion onopordi transmits and induces systemic infections of the rust fungus Puccinia
punctiformis in the creeping thistle Cirsium arvense (Wandeler and Bacher 2006). In addition,
Lepidoptera larvae have been identified as the major vector of the fungus Pestalotiopsis in oil
plantations (Elaeis guineensis) in Colombia (Martinez and Plata-Rueda 2013). Gypsy moth larvae
31
are very hairy, and M. larici-populina spores are caught between the body hairs and possibly
transmitted to other plant parts/trees. In addition, when insects feed from infected leaves they
also ingest the uredinium. So far, no study explored whether the insect can digest the spores,
but it could be that the spores are excreted with the frass. The frass falls to the leaves near the
feeding spot of the insect, and often falls to the floor when it is windy or rainy. This can help
further spread of the spores when after decomposition they are rain- and wind-transported to
other trees. It could even be transmitted by higher trophic levels, in case predators (e.g. birds)
would eat larvae that contains spore in the hairs or guts. Some plant changes induced by the
fungus (e.g. higher mannitol content in the infected leaves) could be a fungus strategy to
storage carbohydrates, with the secondary function of insect vector attraction. However, this
has to be further investigated, as there is no evidence of L. dispar acting as vector for M. laricipopulina.
Another possibility is that the plant benefits from being more attractive to insect, if the
insect acts as a biological control of the pathogen. Insects eating the fungal tissue may reduce
the infection and the modified more attractive volatile blend, could be a “cry for help”. This
could only be true if the damage performed by the pathogen overpasses the damage inflected
by the insect feeding. This is mere speculation, as to our knowledge, no study reported that an
herbivore insect could help the plant to get rid of a pathogen. Nonetheless, it would be
interesting to address whether insect feeding reduces the development of the infection, and if
this has positive consequences to plant fitness.
Conclusion
I found that poplar infection by the rust fungus M. larici-populina affects the feeding preference
of the generalist insect L. dispar and of the specialist insect L. populi in a different way. In
addition, the effect of rust infection on L. dispar preference depends on the development of the
fungus on the leave. I proposed some mechanisms that could explain the different preference
between healthy and rust infected leaves in L. dispar. The increased mannitol on the infected
leaves gives the best explanation for the increased preference, as it shows the strongest
induction among all phytochemical parameters analyzed. Mannitol may act as a feeding
stimulant being that it tastes similar to sucrose and for example it is used as a low caloric
sweetener for human consumption (Grembecka 2015). Moreover, the higher content of
catechin in the rust infected leaves could have a direct and indirect effect on natural enemies,
reducing the predation/parasitism rate. To date most studies address pair-wise interactions or
focus in insect-insect or pathogen-pathogen interactions. I show that a pathogen strongly
changes the behavior of insects attacking the same host in a species-specific manner. My study
highlights the importance of studying the effect of one plant attacker on a consecutive
herbivore. In addition I show that it is essential to investigate the effect of phytopathogens on
insect herbivores. Synergistics effects of phytochemical and nutritional changes as a
consequence of pathogen infestation may have a remarkable effect on herbivore behavior. This
behavioral change can crucially shape arthropod communities in an ecosystem to which
pathogens are introduced.
32
Acknowledgements
I thank Michael Reichelt for his support in the phytochemistry analysis, Sandra Lackner for the
protein inhibitor extraction method and Beate Rhote for helping with the protein inhibitor
extraction.
References
Agrawal AA, Gorski PM, Tallamy DW (1999) Polymorphism in plant defense against herbivory:
Constitutive and induced resistance in Cucumis sativus. Journal of Chemical Ecology 25:22852304.
Al-Naemi F, Hatcher PE (2013) Contrasting effects of necrotrophic and biotrophic plant pathogens on
the aphid Aphis fabae. Entomologia Experimentalis et Applicata 148:234-245.
Ali JG, Agrawal AA (2012) Specialist versus generalist insect herbivores and plant defense. Trends in
Plant Science 17:293-302.
Barbehenn RV, Constabel CP (2011) Tannins in plant-herbivore interactions. Phytochemistry 72:15511565.
Benaroudj N, Lee DH, Goldberg AL (2001) Trehalose accumulation during cellular stress protects cells
and cellular proteins from damage by oxygen radicals. Journal of Biological Chemistry
276:24261-24267.
Boeckler GA, Gershenzon J, Unsicker SB (2011) Phenolic glycosides of the Salicaceae and their role as
anti-herbivore defenses. Phytochemistry 72:1497-1509.
Boeckler GA, Gershenzon J, Unsicker SB (2013) Gypsy moth caterpillar feeding has only a marginal
impact on phenolic compounds in old-growth black poplar. Journal of Chemical Ecology 39:13011312.
Boeckler GA, Towns M, Unsicker SB, Mellway RD, Yip L et al. (2014) Transgenic upregulation of the
condensed tannin pathway in poplar leads to a dramatic shift in leaf palatability for two treefeeding Lepidoptera. Journal of Chemical Ecology 40:150-158.
Brower JV (1958) Experimental Studies of Mimicry in Some North American Butterflies: Part I. The
Monarch, Danaus Plexippus, and Viceroy, Limenitis archippus archippus. Evolution 12:32-47.
Cotter SC, Simpson SJ, Raubenheimer D, Wilson K (2011) Macronutrient balance mediates trade-offs
between immune function and life history traits. Functional Ecology 25:186-198.
Crocoll C, Mirza N, Reichelt M, Gershenzon J, Halkier BA (2016) Optimization of Engineered Production
of the Glucoraphanin Precursor Dihomomethionine in Nicotiana benthamiana. Front Bioeng
Biotechnol 4:14.
Dettner K (1987) Chemosystematics and evolution of beetle chemical defenses. Annual Review of
Entomology 32:17-48.
Docimo T, Reichelt M, Schneider B, Kai M, Kunert G et al. (2012) The first step in the biosynthesis of
cocaine in Erythroxylum coca: the characterization of arginine and ornithine decarboxylases.
Plant Molecular Biology 78:599-615.
Dodds PN, Rathjen JP (2010) Plant immunity: towards an integrated view of plant-pathogen
interactions. Nature Review Genetics 11:539-548.
Donaldson JR, Stevens MT, Barnhill HR, Lindroth RL (2006) Age-related shifts in leaf chemistry of clonal
aspen (Populus tremuloides). Journal of Chemical Ecology 32:1415-1429.
Dotterl S, Jurgens A, Wolfe L, Biere A (2009) Disease Status and Population Origin Effects on Floral
Scent: Potential Consequences for Oviposition and Fruit Predation in A Complex Interaction
Between A Plant, Fungus, and Noctuid Moth. Journal of Chemical Ecology 35:307-319.
33
Doucet D, Walker VK, Qin W (2009) The bugs that came in from the cold: molecular adaptations to low
temperatures in insects. Cellular Molecular Life Science 66:1404-1418.
Duplessis S, Hacquard S, Delaruelle C, Tisserant E, Frey P et al. (2011) Melampsora larici-populina
Transcript Profiling During Germination and Timecourse Infection of Poplar Leaves Reveals
Dynamic Expression Patterns Associated with Virulence and Biotrophy. The American
Phytopathological Society 7:808–818.
Duplessis S, Major I, Martin F, Séguin A (2009) Poplar and Pathogen Interactions: Insights from Populus
Genome-Wide Analyses of Resistance and Defense Gene Families and Gene Expression Profiling.
Critical Reviews in Plant Sciences 28:309-334.
Ellis C, Karafyllidis L, Turner JG (2002) Constitutive activation of jasmonate signaling in an Arabidopsis
mutant correlates with enhanced resistance to Erysiphe cichoracearum, Pseudomonas syringae,
and Myzus persicae. Molecular Plant-Microbe Interactions 15:1025-1030.
Erb M, Meldau S, Howe GA (2012) Role of phytohormones in insect-specific plant reactions. Trends in
Plant Science 17:250-259.
Eyles A, Bonello P, Ganley R, Mohammed C (2010) Induced resistance to pests and pathogens in trees.
New Phytologist 185:893-908.
Feeny PP (1968) Effect of oak leaf tannins on larval growth of winter moth Operophtera brumata.
Journal of Insect Physiology 14:805-817.
Fritz RS, Hochwender CG, Lewkiewicz DA, Bothwell S, Orians CM (2001) Seedling herbivory by slugs in a
willow hybrid system: developmental changes in damage, chemical defense, and plant
performance. Oecologia 129:87-97.
Green JP, Foster R, Wilkins L, Osorio D, Hartley SE (2015) Leaf Colour as a Signal of Chemical Defence to
Insect Herbivores in Wild Cabbage (Brassica oleracea). PLoS ONE 10:1-20.
Grembecka M (2015) Sugar alcohols-their role in the modern world of sweeteners: a review. European
Food Research and Technology 241:1-14.
Hacquard S, Delaruelle C, Legué V, Tisserant E, Kohler A et al. (2010) Laser Capture Microdissection of
Uredinia Formed by Melampsora larici-populina Revealed a Transcriptional Switch Between
Biotrophy and Sporulation. The American Phytopathological Society.
Hacquard S, Petre B, Frey P, Hecker A, Rouhier N et al. (2011) The poplar-poplar rust interaction:
insights from genomics and transcriptomics. Journal of Pathology 2011:11.
Harrop-Archibald H, Didham RK, Standish RJ, Tibbett M, Hobbs RJ (2016) Mechanisms linking fungal
conditioning of leaf litter to detritivore feeding activity. Soil Biology & Biochemistry 93:119-130.
Hatcher PE, Ayres PG (1997) Indirect interactions between insect herbivores and pathogenic fungi on
leaves, Oxford
Hatcher PE, Paul ND, Ayres PG, Whittaker JB (1995) Interactions between Rumex spp, herbivores and a
rust fungus. The effect of Uromyces rumicis infection on leaf nutritional quality. Functional
Ecology 9:97-105.
Koornneef A, Pieterse CMJ (2008) Cross talk in defense signaling. Plant Physiology 146:839-844.
Kostal V, Zahradnikova H, Simek P, Zeleny J (2007) Multiple component system of sugars and polyols in
the overwintering spruce bark beetle, Ips typographus. Journal of Insect Physiology 53:580-586.
Kostal Vr, Slachta M, Petr Simek (2001) Cryoprotective role of polyols independent of the increase in
supercooling capacity in diapausing adults of Pyrrhocoris apterus (Heteroptera: Insecta).
Comparative Biochemistry and Physiology B, pp 365-374
Krause SC, Raffa KF (1992) Comparison of insect, fungal, and mechanically induced defoliation of larch:
effects on plant productivity and subsequent host susceptibility. Oecologia 90:411-416.
Kruess A (2002) Indirect interaction between a fungal plant pathogen and a herbivorous beetle of the
weed Cirsium arvense. Oecologia 130:563-569.
34
Lappalainen J, Helander ML, Palokangas P (1995) The performance of the autumnal moth is lower on
trees infected by birch rust. Mycological Research 99:994-996.
Lewis A (1979) Feeding preference for diseased and wilted sunflower in the grasshopper, Melanoplus
differentialis. Entomologia Experimentalis et Applicata 26:202–207.
Lindroth RL, Peterson SS (1988) Effects of Plant Phenols on Performance of Southern Armyworm Larvae.
Oecologia 75:185-189.
Major IT, Nicole MC, Duplessis S, Seguin A (2010) Photosynthetic and respiratory changes in leaves of
poplar elicited by rust infection. Photosynthesis Research 104:41-48.
Malishev M, Sanson GD (2015) Leaf mechanics and herbivory defence: How tough tissue along the leaf
body deters growing insect herbivores. Austral Ecology 40:300-308.
Martin TL, Shields VDC (2012) Detection of alkaloids and carbohydrates by taste receptor cells of the
galea of gypsy moth larvae, Lymantria dispar (L.). Arthropod-Plant Interactions 6:519-529.
Martinez LC, Plata-Rueda A (2013) Lepidoptera vectors of Pestalotiopsis fungal disease: first record in
oil palm plantations from Colombia. International Journal of Tropical Insect Science 33:239-246.
Mason PA, Singer MS (2015) Defensive mixology: combining acquired chemicals towards defence.
Functional Ecology 29:441-450.
McCormick AC, Boeckler GA, Kollner TG, Gershenzon J, Unsicker SB (2014a) The timing of herbivoreinduced volatile emission in black poplar (Populus nigra) and the influence of herbivore age and
identity affect the value of individual volatiles as cues for herbivore enemies. BMC Plant Biology
14:304.
McCormick AC, Irmisch S, Reinecke A, Boeckler GA, Veit D et al. (2014b) Herbivore-induced volatile
emission in black poplar: regulation and role in attracting herbivore enemies. Plant Cell Environ
37:1909-1923.
McCormick AC, Reinecke A, Gershenzon J, Unsicker SB (2016) Feeding Experience Affects the
Behavioral Response of Polyphagous Gypsy Moth Caterpillars to Herbivore-induced Poplar
Volatiles. Journal of Chemical Ecology 42:382-393.
Miranda M, Ralph SG, Mellway R, White R, Heath MC et al. (2007) The Transcriptional Response of
Hybrid Poplar (Populus trichocarpa x P. deltoides) to Infection by Melampsora medusae Leaf
Rust Involves Induction of Flavonoid Pathway Genes Leading to the Accumulation of
Proanthocyanidins. The American Phytopathological Society 20:816–831.
Mondy N, Corio-Costet M-F (2004) Feeding insects with a phytopathogenic fungus influences their
diapause and population dynamics. Ecological Entomology 29:711–717.
Moore-Landecker E (2011) Fungal Spores. eLS. John Wiley & Sons, Ltd: Chichester.
Moran PJ (1998) Plant-Mediated Interactions between Insects and a Fungal Plant Pathogen and the Role
of Plant Chemical Responses to Infection. Oecologia 4:523-530.
Muller MS, McWilliams SR, Podlesak D, Donaldson JR, Bothwell HM et al. (2006) Tri-trophic effects of
plant defenses: chickadees consume caterpillars based on host leaf chemistry. Oikos 114:507517.
Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific
interactions between salicylate and jasmonate signaling include synergy, antagonism, and
oxidative stress leading to cell death. Plant Physiology 140:249-262.
Nervo G, Coaloa D, Vietto L, Giorcelli A, Allegro G (2011) Current situation and prospects for European
poplar culture: the role of Italian research. Tercer Congreso Internacional de Salicáceas en
Argentina. Argentina
Niinemets U, Kull O, Tenhunen JD (2004) Within-canopy variation in the rate of development of
photosynthetic capacity is proportional to integrated quantum flux density in temperate
deciduous trees. Plant Cell and Environment 27:293-313.
35
Pauwels L, Goossens A (2011) The JAZ proteins: a crucial interface in the jasmonate signaling cascade.
Plant Cell 23:3089-3100.
Philippe RN, Bohlmann J (2007) Poplar defense against insect herbivores. Canadian Journal of Botany
85:1111-1126.
Piesik D, Lemnczyk G, Skoczek A, Lamparski R, Bocianowski J et al. (2011) Fusarium infection in maize:
Volatile induction of infected and neighboring uninfected plants has the potential to attract a
pest cereal leaf beetle, Oulema melanopus. Journal of Plant Physiology 168:1534-1542.
Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM (2009) Networking by small-molecule
hormones in plant immunity. Nature Chemical Biology 5:308-316.
Pieterse CMJ, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SCM (2012) Hormonal
Modulation of Plant Immunity. In: Schekman R (ed) Annual Review of Cell and Developmental
Biology, 28. Annual Reviews, Palo Alto, pp 489-521
Poelman EH (2015) From induced resistance to defence in plant-insect interactions. Entomologia
Experimentalis et Applicata 157:11-17.
Ponzio C, Gols R, Weldegergis BT, Dicke M (2014) Caterpillar-induced plant volatiles remain a reliable
signal for foraging wasps during dual attack with a plant pathogen or non-host insect herbivore.
Plant Cell and Environment 37:1924-1935.
Pozo MJ, Van Loon LC, Pieterse CMJ (2004) Jasmonates - Signals in plant-microbe interactions. Journal
of Plant Growth Regulation 23:211-222.
Proffit M, Khallaf MA, Carrasco D, Larsson MC, Anderson P (2015) 'Do you remember the first time?'
Host plant preference in a moth is modulated by experiences during larval feeding and adult
mating. Ecology Letters 18:365-374.
Ramirez-Carvajal GA, Morse AM, Davis JM (2008) Transcript profiles of the cytokinin response regulator
gene family in Populus imply diverse roles in plant development. New Phytologist 177:77-89.
Roeder KA, Behmer ST, Davidowitz G (2014) Lifetime consequences of food protein-carbohydrate
content for an insect herbivore. Functional Ecology 28:1135-1143.
Rostás M, Bennett R, Hilker M (2002) Comparative physiological responses in Chinese cabbage induced
by herbivory and fungal infection. Journal of Chemical Ecology 28:2449-2463.
Rostás M, Hilker M (2002) Asymmetric plant-mediated cross-effects between a herbivorous insect and a
phytopathogenic fungus. Agricultural and Forest Entomology 4:223-231.
Rostás M, Simon M, Hilker M (2003) Ecological cross-effects of induced plant responses towards
herbivores and phytopathogenic fungi. Basic and Applied Ecology 4:46-62.
Rostás M, Ton J, Mauch-Mani B, Turlings TC (2006) Fungal infection reduces herbivore-induced plant
volatiles of maize but does not affect naive parasitoids. Journal of Chemical Ecology 32:18971909.
Roth S, Knorr C, Lindroth RL (1997) Dietary phenolics affects performance of the gypsy moth
(Lepidoptera: Lymantriidae) and its parasitoid Cotesia melanoscela (Hymenoptera: Braconidae).
Environmental Entomology 26:668-671.
Roy A, Walker WB, Vogel H, Chattington S, Larsson MC et al. (2016) Diet dependent metabolic
responses in three generalist insect herbivores Spodoptera spp. Insect Biochemistry and
Molecular Biology 71:91-105.
Schiff NM, Waldbauer GP, Friedman S (1989) Response of last instar Heliothis zea larvae to
carbohydrates - Stimulation of Biting, nutritional value. Entomologia Experimentalis et Applicata
52:29-37.
Schoonhoven LM, van Loon JJA, Dicke M (2005) Insect-Plant Biology, 2nd edn. Oxford University Press,
Oxford
Simon M, Hilker M (2003) Herbivores and pathogens on willow: do they affect each other? Agricultural
and Forest Entomology 5:275-284.
36
Simon M, Hilker M (2005) Does Rust Infection of Willow Affect Feeding and Oviposition Behavior of
Willow Leaf Beetles? Journal of Insect Behavior 18:115-129.
Singer MS, Mason PA, Smilanich AM (2014) Ecological immunology mediated by diet in herbivorous
insects. Integrative and Comparative Biology 54:913-921.
Tack AJM, Dicke M (2013) Plant pathogens structure arthropod communities across multiple spatial and
temporal scales. Functional Ecology 27:633-645.
Tasin M, Knudsen GK, Pertot I (2012) Smelling a diseased host: grapevine moth responses to healthy
and fungus-infected grapes. Animal Behaviour 83:555-562.
Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I et al. (2006) The genome of black cottonwood,
Populus trichocarpa (Torr. & Gray). Science 313:1596-1604.
Vadassery J, Reichelt M, Hause B, Gershenzon J, Boland W et al. (2012) CML42-Mediated Calcium
Signaling Coordinates Responses to Spodoptera Herbivory and Abiotic Stresses in Arabidopsis.
Plant Physiology 159:1159-1175.
Voegele RT, Hahn M, Lohaus G, Link T, Heiser I et al. (2005) Possible roles for mannitol and mannitol
dehydrogenase in the biotrophic plant pathogen Uromyces fabae. Plant Physiology 137:190-198.
Voegele RT, Mendgen KW (2011) Nutrient uptake in rust fungi: how sweet is parasitic life? Euphytica
179:41-55.
Voegele RT, Wirsel S, Moll U, Lechner M, Mendgen K (2006) Cloning and characterization of a novel
invertase from the obligate biotroph Uromyces fabae and analysis of expression patterns of host
and pathogen invertases in the course of infection. Molecular Plant-Microbe Interactions
19:625-634.
Vogelweith F, Moret Y, Monceau K, Thiery D, Moreau J (2016) The relative abundance of hemocyte
types in a polyphagous moth larva depends on diet. Journal of Insect Physiology 88:33-39.
Wandeler H, Bacher S (2006) Insect-transmitted urediniospores of the rust Puccinia punctiformis cause
systemic infections in established Cirsium arvense plants. Phytopathology 96:813-818.
War AR, Paulraj MG, Ahmad T, Buhroo AA, Hussain B et al. (2014) Mechanisms of plant defense against
insect herbivores. Plant Signaling & Behavior 7:1306-1320.
Yurtsever S, Okyar Z, Guler N (2010) What colour of flowers do Lepidoptera prefer for foraging?
Biologia 65:1049—1056.
37