This information is current as
of July 28, 2017.
The Alternatively Spliced Domain TnFnIII
A1A2 of the Extracellular Matrix Protein
Tenascin-C Suppresses Activation-Induced T
Lymphocyte Proliferation and Cytokine
Production
Marta D. Puente Navazo, Danila Valmori and Curzio Rüegg
J Immunol 2001; 167:6431-6440; ;
doi: 10.4049/jimmunol.167.11.6431
http://www.jimmunol.org/content/167/11/6431
Subscription
Permissions
Email Alerts
This article cites 74 articles, 31 of which you can access for free at:
http://www.jimmunol.org/content/167/11/6431.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2001 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
References
The Alternatively Spliced Domain TnFnIII A1A2 of the
Extracellular Matrix Protein Tenascin-C Suppresses
Activation-Induced T Lymphocyte Proliferation and Cytokine
Production1
Marta D. Puente Navazo,* Danila Valmori,† and Curzio Rüegg2*
I
t is generally accepted that the immune system is capable of
eliminating cancer cells from the organism. The concept of
antitumor immunity was originally fostered by the observation that tumor cells transplanted into immunodeficient mice grow
to form large tumors whereas the same cells transplanted to immunocompetent animals are rejected (1, 2). This concept was recently reinforced by the identification and characterization of tumor-associated Ags (TAA)3 and TAA-specific CTLs present in
cancer patients and healthy individuals (3). Despite these observations, however, it is clear that lymphocytes present in the tumor
stroma are often unable to completely eliminate tumor cells possibly due to tumor-induced immunosuppression (4, 5). Among
other mechanisms, we have reported that an increased expression
*Centre Pluridisciplinaire d’Oncologie, University of Lausanne Medical School, Lausanne, Switzerland; and †Division of Onco-Immunology, Ludwig Institute for Cancer
Research, Lausanne Branch, Lausanne University Hospital, Lausanne, Switzerland
Received for publication June 14, 2001. Accepted for publication October 3, 2001.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by grants from the Swiss National Science Foundation
(31-52946.97) and the Swiss Cancer League (943-09). C.R. is recipient of a
SCORE-A award (32-41611.94) from the Swiss National Science Foundation.
2
Address correspondence and reprint requests to Dr. Curzio Rüegg, Laboratory of the
Centre Pluridisciplinaire d’Oncologie, c/o Swiss Institute for Experimental Cancer
Research, 155 Chemin des Boveresses, CH-1066 Epalinges, Switzerland. E-mail address: [email protected]
3
Abbreviations used in this paper: TAA, tumor-associated Ag; DAPI, 4⬘,6⬘-diamidino-2-phenylindole, dihydrochloride; ECM, extracellular matrix; EGF, epidermal
growth factor; FRED, fibrinogen-related domain; TnFnIII, fibronectin type III repeat
of tenascin-C; IPTG, isopropyl ␤-D-thiogalactoside; hrIL-2, human recombinant
IL-2; iIFN-␥, intracellular IFN-␥.
Copyright © 2001 by The American Association of Immunologists
of tenascin-C in the tumor stroma might play a role in tumorinduced immunosuppression (6).
Tenascin-C is a hexameric protein member of the tenascin family of extracellular matrix (ECM) proteins which also includes tenascin-X, -Y, -R, and -W (7). Each human tenascin-C subunit
consists of an N-terminal region forming coiled coil structures and
interchain disulfide bonds essential for subunit oligomerization; 14
and half epidermal growth factor (EGF)-like domains, a variable
number of fibronectin type III (TnFnIII) repeats, and a C-terminal
fibrinogen-related domain (FRED) (7–10). Alternative mRNA
splicing within the TnFnIII repeats region can generate different
tenascin-C isoforms. There are eight conserved TnFnIII repeats
(designated by numbers 1– 8) and up to seven alternatively spliced
TnFnIII repeats (designated by letters A–D) inserted between the
conserved repeats 5 and 6 (11). The small tenascin-C variant lacking the alternative spliced TnFnIII domains is present in static
tissues such as cartilage (12), whereas the large isoforms containing the alternatively spliced TnFnIII domains in various combinations are found in tissues containing migrating cells (13) or undergoing remodeling, such as healing wounds and tumor stroma
(14 –16). Tenascin-C is strongly expressed during embryonic development, in particular during morphogenesis of the myoskeletal
system, connective tissue, and the vasculature (17) and at the borders of epithelial-mesenchymal transition (18). Tenascin-C is expressed by glial cells in the developing central nervous system (19)
and by Schwann cells in the peripheral nervous system (7). In
normal adult tissues, tenascin-C expression is mostly restricted to
the bone marrow (20), thymus, spleen, and lymph nodes, in particular in T lymphocyte-dependent zones (21). Increased tenascin-C expression is observed in chronically inflamed tissues,
0022-1767/01/$02.00
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
Several lines of evidences have suggested that T cell activation could be impaired in the tumor environment, a condition referred
to as tumor-induced immunosuppression. We have previously shown that tenascin-C, an extracellular matrix protein highly
expressed in the tumor stroma, inhibits T lymphocyte activation in vitro, raising the possibility that this molecule might contribute
to tumor-induced immunosuppression in vivo. However, the region of the protein mediating this effect has remained elusive. Here
we report the identification of the minimal region of tenascin-C that can inhibit T cell activation. Recombinant fragments corresponding to defined regions of the molecule were tested for their ability to inhibit in vitro activation of human peripheral blood
T cells induced by anti-CD3 mAbs in combination with fibronectin or IL-2. A recombinant protein encompassing the alternatively
spliced fibronectin type III domains of tenascin-C (TnFnIII A–D) vigorously inhibited both early and late lymphocyte activation
events including activation-induced TCR/CD8 down-modulation, cytokine production, and DNA synthesis. In agreement with this,
full length recombinant tenascin-C containing the alternatively spliced region suppressed T cell activation, whereas tenascin-C
lacking this region did not. Using a series of smaller fragments and deletion mutants issued from this region, we have identified
the TnFnIII A1A2 domain as the minimal region suppressing T cell activation. Single TnFnIII A1 or A2 domains were no longer
inhibitory, while maximal inhibition required the presence of the TnFnIII A3 domain. Altogether, these data demonstrate that the
TnFnIII A1A2 domain mediate the ability of tenascin-C to inhibit in vitro T cell activation and provide insights into the immunosuppressive activity of tenascin-C in vivo. The Journal of Immunology, 2001, 167: 6431– 6440.
6432
IDENTIFICATION OF THE IMMUNOSUPPRESSIVE DOMAIN OF TENASCIN-C
Materials and Methods
Reagents
Human natural tenascin-C purified from U251-MG glioma cells, consisting
mostly of the large isoform, was purchased from Life Technologies (Basle,
Switzerland). Human recombinant large and small tenascin-C isoforms
were kindly provided by Dr. L. Zardi (Istituto Nazionale dei Tumori,
Genoa, Italy) (49). Recombinant chicken tenascin-C variants consisting of
EGF repeats or FRED only were kindly provided by Dr. R. Chiquet-Ehrismann (Friedrich Miescher Institute, Basel, Switzerland) (34). The bacterial
expression vector pET11 containing the cDNAs encoding for these fragments were kindly provided by Dr. H. Erikson (University of North Carolina, Chapel Hill, NC). Human plasma fibronectin was from Sigma (St.
Louis, MO). Purified anti-CD3 mAb (clone UCHT1) was from Beckman
Coulter (Fullerton, CA). PE-labeled anti-CD3 mAb (clone HIT3a), FITC
anti-IFN-␥ mAb (clone 4S.B3), and PerCP-labeled anti-CD8 mAb (clone
HIT8a) were obtained from BD PharMingen (BD Biosciences, Basle, Switzerland). IMDM and RPMI 1640 cell culture medium and FCS were obtained from Life Technologies. The medium supplement Nutridoma NS
was from Roche Molecular Biochemicals (Rotkreuz, Switzerland). Human
recombinant IL-2 (hrIL-2) was kindly provided by Dr. M. Nabholz (Swiss
Institute for Experimental Cancer Research, Epalinges, Switzerland). Tis-
sue culture plastic-ware were from Falcon (BD Biosciences). Nylon wool
was from Polysciences (Eppelheim, Germany). Anti-6His mAb and NiNTA resin were purchased from Qiagen (Basle, Switzerland). The bacterial
expression vector pRSET-A was from Invitrogen (Leek, The Netherlands),
and pGEX-2T was from Amersham Pharmacia Biotech (Düberdorf, Switzerland). pGEM-Teasy vector was from Promega (Madison, WI). Isopropyl ␤-D-thiogalactoside (IPTG) was from Eurogentec (Seraing, Belgium).
4⬘,6⬘-Diamidino-2-phenylindole, dihydrochloride (DAPI) was obtained
from Molecular Probes (Leiden, The Netherlands). Orthopermeafix was
from Ortho (Raritan, NJ). Lysozyme, imidazole, brefeldin A, DNase I,
Histopaque, and chloramphenicol were obtained from Sigma. [methyl3
H]Thymidine was from Hartmann Analytic (Zurich, Switzerland). 51Cr
was from NEN (Zaventem, Belgium).
Production of recombinant human tenascin-C fragments
The human recombinant tenascin-C fragments used in initial experiments
were previously described by Aukhil et al. (11). TnFnIII 1– 8 contains all
the constant TnFnIII repeats. TnFnIII All includes eight constant TnFnIII
repeats and seven alternatively spliced repeats (A1, A2, A3, A4, B, C, and
D) inserted between TnFnIII repeats 5 and 6. TnFnIII 1–5 consists of the
first five constant TnFnIII repeats. TnFnIII 6 – 8 consists of the last three
constant TnFnIII repeats. TnFnIII A–D contains the seven alternatively
spliced domains. Expression and purification of recombinant proteins
were conducted as described elsewhere (11, 38). To produce recombinant
proteins containing consecutive TnFnIII repeats of the alternative spliced
region, we generated the corresponding cDNAs by PCR using pET11TnFnIII A–D as template and the primers shown in Table I. Restriction
sites were included in the primers to facilitate directional cloning. PCR
products were first cloned into the pGEM-Teasy vector for confirmatory
sequencing (Swiss Institute for Experimental Cancer Research sequencing
core facility) and subcloned into the BamHI and HindIII sites of the pRSET-A expression vector. For protein expression, single colonies of
BL21(DE3)LysS cells transformed with the different expression constructs
were grown at 37°C in 5 ml LB medium containing 200 ␮g/ml ampicillin
and 35 ␮g/ml chloramphenicol for 8 h. Bacteria were then centrifuged,
resuspended in 1 l LB medium (containing 200 ␮g/ml ampicilin), and
cultured at 37°C until the OD600 reached 0.5– 0.6, and induction was
started by adding 1 mM IPTG. When OD600 reached 0.8 –1.0, bacteria were
collected by centrifugation and resuspended in 12 ml lysis buffer (50 mM
NaH2PO4 (pH 8.0), 300 mM NaCl, 20 mM imidazole). Lysis of bacteria
was conducted by treatment with 10 ␮g/ml lysozyme, 10 cycles of sonication (10 s/cycle), and 5 cycles of freezing in dry ice and thawing at 37°C.
This suspension was centrifuged at 15,000 ⫻ g for 30 min at 4°C, and the
supernatant was mixed with Ni-NTA slurry (5 ml resin/1 ml lysate) and
incubated under agitation for 1 h at 4°C. The cell lysate/Ni-NTA slurry
mixture was packed into a column and washed with 2 ⫻ 15 ml washing
buffer (50 mM NaH2PO4 (pH 8.0), 300 mM NaCl, 20 mM imidazole).
Recombinant proteins were eluted using elution buffer (50 mM NaH2PO4
(pH 8.0), 300 mM NaCl, 250 mM imidazole). The fractions containing the
purified proteins (as determined by SDS-PAGE) were dialyzed against
1000 volumes of PBS. All recombinant proteins except TnFnIII A2A3A4
were purified under native conditions. TnFnIII A2A3A4 was purified under
denaturing conditions by resuspending the induced bacteria in 12 ml 8 M
urea, 0.1 M NaH2PO4, 10 mM Tris (pH 8.0) (lysis buffer II). Cells were
then lysed by 10 sonication cycles and 5 freezing and thawing cycles. The
soluble fraction was then mixed with the Ni-NTA resin (5 ml resin/1 ml
lysate) for 1 h at 4°C. The resin was packed into a column, washed twice
with 15 ml washing buffer II (8 M urea, 0.1 M NaH2PO4, 10 mM Tris (pH
6.3)), and eluted with 4 ⫻ 2 ml elution buffer II (8 M urea, 0.1 M
NaH2PO4, 10 mM Tris (pH 5.9)) and 4 ⫻ 2 ml elution buffer III (8 M urea,
0.1 M NaH2PO4, 10 mM Tris (pH 4.5)). Eluted proteins were refolded by
dilution into a folding buffer (50 mM Tris (pH 7.5), 500 mM NaCl, 10 mM
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, and 2 mM
DTT), concentrated using a membrane concentrator, and subsequently dialyzed against PBS. These refolding conditions have been successfully
used to refold TnFnIII repeats to their native conformation (50).
Single TnFnIII repeats were expressed as GST fusion proteins to gain
stability. Inserts coding for the single TnFnIII repeats were generated by
PCR using specific primers (Table I). PCR products were subcloned into
pGEM-Teasy, sequenced, and subcloned into the BamHI and HindIII sites
of a modified pGEX-2T vector containing a sequence coding for an Nterminal GST and a C-terminal 6His tag (pGEXT-6His). These constructs
were then used to transform XL1B cells. Expression of recombinant proteins was conducted as above except that induction was conducted in 200
␮M IPTG overnight at 30°C. These recombinant proteins were purified
under denaturing conditions and subsequently refolded by dilution as described above for fragment TnFnIII A2A3A4.
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
mainly in areas rich in CD4⫹ memory T cells (22). Highly increased tenascin-C deposition is found at sites of angiogenesis, in
healing wounds and in the stroma of malignant tumors (23), including breast (16), glioma (24), melanoma (25), endometrial adenocarcinoma (26), ovarian cancers (27), and Hodgkin’s lymphoma (28). Tenascin-C is present in the serum of healthy
individuals and, at elevated concentrations, in cancer patients and
in acute inflammation (29, 30).
Several functions have been attributed to tenascin-C through in
vitro experiments. In particular, promotion or suppression of cell
adhesion, migration, and proliferation (as reviewed by Crossin
(31)). Functional-structural analysis have revealed that many of
these functions are mediated by defined tenascin-C domains interacting with ECM proteins or cell surface receptors (32). For example, the EGF type repeats prevent adhesion of L929 mouse fibroblasts (33) and induce neurite outgrowth (34). The TnFnIII 2– 6
repeats promote migration of C6 glioma cells, and the TnFnIII 3
repeat induces glioma attachment and spreading (35). The TnFnIII
domains 1–5 and 6 – 8 support adhesion and induce proliferation of
human hemopoietic cells (36). One or more of the TnFnIII 1–5
repeats bind to fibronectin (37) and thereby inhibit attachment of
primary fibroblasts and T lymphocytes to immobilized fibronectin
(37, 38). The alternatively spliced region, TnFnIII A–D, induces
loss of focal adhesions and inhibits proliferation of endothelial
cells through interaction with annexin II (39 – 41), supports attachment of mouse embryonic neurones (34), mediates neurite outgrowth and guidance (42), and promotes proliferation of hemopoietic precursors cells in the bone marrow (36). The FRED of
tenascin-C promotes endothelial cell adhesion and sprouting
through interaction with ␣2␤1 and ␣V␤3 integrins (43, 44). We and
other have reported that tenascin-C inhibits in vitro T cell activation induced by natural Ags (i.e., tetanus toxoid and purified protein derivative of tuberculin) or alloantigens (6), immobilized antiCD3 mAb, and fibronectin (45) or by anti-CD28, ICAM-1, or
laminin (46). The putative role of tenascin-C in inhibiting T cell
activation in vivo is supported by the observation that tenascin-Cdeficient mice develop severe dermatitis in response to hapten sensitization (47) as well as progressive inflammation and glomerular
damage in an experimental model of venom-induced glomerulonephritis (48).
The tenascin-C region that suppresses T lymphocyte activation
has not been identified yet. Here we report that the first two
TnFnIII repeats of the alternative spliced region of tenascin-C inhibits in vitro T cell activation induced by anti-CD3 mAbs and
immobilized fibronectin or soluble IL-2.
The Journal of Immunology
6433
Table I. PCR primers used for the generation of recombinant proteins issued from the alternatively spliced
domain of human tenascin-C
Recombinant Protein
Primers (5⬘–3⬘)
A1-F: ATGGATCCGAACAAGCCCCTGAGCTGGAA
A3-R: GGAAGCTTTGTGACGACCTCTACAGCA AGG
TnFnIII A2A3A4
A2-F: ATGGATCCGGGGAAACTCCCAATTTGGGAGAG
A4-R: GGAAGCTTTGTGGAGGCCTCAGCAGAGAGT
TnFnIII A3A4B
A3-F: ATGGATCCGAGGAGGTTCCAGATATGGGAAAC
B-R: GGAAGCTTT GTC GTGGCTGTGGCACTGATG
TnFnIII A4BC
A4-F: ATGGATCCGAGGATCTCCCACAGCTGGGAGAT
C-R: GGAAGCTTTGTAACAATCTCAGCCCTCAAG G
TnFnIII BCD
B-F: CGGGATCCGCCAAAGAACCTGAAATTGGAAAC
D-R: GGAAGCTTTGTTGTTGCTATAGCACTGACTGTC
GST-TnFnIII A1
A1-F: ATGGATCCGAACAAGCCCCTGAGCTGGAA
A1-R: TAAAGCTTTGTGGAGGCCTCAGCAGAGAG
GST-TnFnIII A2
A2-F: ATGGATCCGGGGAAACTCCCAATTTGGGAGAG
A2-R: GGAAGCTTCTCTGTCAAGACTTCAACAGAGAG
GST-TnFnIII A3
A3-F: ATGGATCCGAGGAGGTTCCAGATATGGGAAAC
A3-R: GGAAGCTTTGTGACGACCTCTACAGCAAGG
TnFnIII A–D
A1-F: ATGGATCCGAACAAGCCCCTGAGCTGGAA
D-R: GGAAGCTTTGTTGTTGCTATAGCACTGACTGTC
TnFnIII A–D⌬A1
A2-F: ATGGATCCGGGGAAACTCCCAATTTGGGAGAG
D-R: GGAAGCTTTGTTGTTGCTATAGCACTGACTGTC
TnFnIII A–D⌬A1A2
A3-F: ATGGATCCGAGGAGGTTCCAGATATGGGAAAC
D-R: GGAAGCTTTGTTGTTGCTATAGCACTGACTGTC
TnFnIII A–D⌬A1A2A3
A4-F: ATGGATCCGAGGATCTCCCACAGCTGGGAGAT
D-R: GGAAGCTTTGTTGTTGCTATAGCACTGACTGTC
TnFnIII A1A2
A1-F: ATGGATCCGAACAAGCCCCTGAGCTGGAA
A2-R: GGAAGCTTCTCTGTCAAGACTTCAACAGAGAG
Purified recombinant proteins were analyzed for relative molecular
mass, purity, and the absence of degradation by SDS-PAGE/Coomassie
blue staining and Western blotting analysis.
harvesting cells onto glass fiber filters (Wallac, Turku, Finland) and counting using a scintillation counter (Wallac).
T cell isolation and activation
Flow cytometry analysis
Venous blood from healthy donors was collected using a Vacutainer (BD
Biosciences) and anticoagulated with lithium heparin. PBMC were isolated
by density gradient centrifugation on Histopaque 1.077. PBMC were resuspended in RPMI 1640 with 10% FCS and incubated on plastic 25-cm2
culture flasks for 1 h at 37°C to remove monocytes by adherence. T lymphocytes were enriched using nylon wool columns as described (51). Purified T lymphocytes were ⬎90% CD3⫹ as assessed by flow cytometry. T
cells were washed three times with RMPI 1640 with 10% FCS and resuspended in IMDM supplemented with 1% Nutridoma NS.
For anti-CD3 mAb/fibronectin-mediated T cell activation, 96-well tissue
culture plates were coated with the anti-CD3 mAb UCHT1 (1 ␮g/ml in
PBS) overnight at 4°C. Wells were then washed once with PBS and incubated with plasma fibronectin (10 ␮g/ml in PBS) for 3 h at 37°C. For
anti-CD3 mAb/IL-2-mediated T cell activation, wells were coated only
with anti-CD3 mAb. Wells were then washed twice before T lymphocytes
were added (1.5 ⫻ 105 cells/well in IMDM containing 1% Nutridoma NS)
alone or together with natural tenascin-C or recombinant tenascin-C fragments. For anti-CD3 mAb/IL-2-mediated T cell activation, 20 U/ml hrIL-2
were added with the cells. After 3 days of culture at 37°C under 5% CO2,
1 ␮Ci [methyl-3H]thymidine was added to each well during the last 16 h of
culture to detect DNA synthesis.
For alloantigen-induced activation (MLR), 105 PBMC from two nonmatched donors were mixed in each well. T cell proliferation was quantified at day 4 by adding 1 ␮Ci [methyl-3H]thymidine to each well during the
last 8 h of culture. [methyl-3H]Thymidine incorporation was quantified by
T lymphocytes were cultured for 24 h in the presence or absence of recombinant tenascin-C fragments in 24-well tissue culture plates previously
coated with anti-CD3 mAb UCHT1 (1 ␮g/ml in PBS) and fibronectin (10
␮g/ml in PBS). Cells were then collected and incubated with PE-labeled
anti-CD3 (HIT3a, 20 ␮g/ml) and PerCP-labeled anti-CD8 (HIT3b, 20 ␮g/
ml) mAbs for 20 min at 4°C. Cells were then washed twice with PBS, 1%
BSA and resuspended in PBS. DAPI (10 ␮g/ml) was added to cell suspension 10 min before acquisition with a FACSCalibur cytofluorometer
and CellQuest software (BD Biosciences). Typically, 105 events were
acquired.
Cytokine production
TNF secretion by activated T cells (52) was measured in the culture supernatants after 72 h of culture by a bioassay using the TNF-sensitive cell
line WEHI-164 as described (53). Production of intracellular IFN-␥ was
measured by flow cytometry. T cells were activated for 6 h with immobilized anti-CD3 mAbs and fibronectin in the presence of 10 ␮g/ml brefeldin
A to inhibit cytokine secretion. Cells were then collected and fixed/permeabilized for 40 min at room temperature using Orthopermeafix solution.
After three washes with PBS, 1% BSA, the cell suspension was incubated
with for 30 min at 4°C with 10 ␮g/ml FITC-conjugated anti-IFN-␥ mAb.
After two washes with PBS, 1% BSA, cells were resuspended in PBS and
analyzed on a FACScan using CellQuest software (BD Biosciences).
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
TnFnIII A1A2A3
6434
IDENTIFICATION OF THE IMMUNOSUPPRESSIVE DOMAIN OF TENASCIN-C
SDS-PAGE and Western blotting
For protein analysis, 50-␮l samples were resolved by 7.5–12.5% SDSPAGE following standard protocols and stained with Coomassie brilliant
blue R250 (Bio-Rad, Glattbrugg, Switzerland). For Western blotting, material resolved by SDS-PAGE was blotted onto Immobilon-P membranes
(Millipore, Volketswil, Switzerland). Membranes were sequentially incubated in 5% dry milk for 1 h at room temperature, with anti-6His mAb
(1/1000; Clontech, Palo Alto, CA) for 2 h at room temperature, and with
1 ␮g/ml HRP-labeled secondary Ab (DAKO, Zug, Switzerland) for 1 h at
room temperature. The ECL system was used for detection (Amersham
Pharmacia Biotech).
CTL assay
Results
A recombinant tenascin-C fragment encompassing the
alternatively spliced domain TnFnIII A–D inhibits T lymphocyte
activation
Natural tenascin-C subjected to plasmin-mediated proteolysis retains its ability to inhibit T lymphocyte activation elicited by tetanus toxoid or alloantigens (57), raising the possibility that the
immunosuppressive activity may be ascribed to a well-defined region of the molecule. On the basis of these considerations, we
initiated experiments aimed at mapping the immunosuppressive
region on tenascin-C by using recombinant fragments encompassing various regions of the molecule. To this purpose, we tested the
effect of recombinant tenascin-C fragments on the activation of
freshly purified peripheral blood T cells (⬎90% CD3⫹) stimulated
with plastic-immobilized anti-CD3 mAb and fibronectin or with
immobilized anti-CD3 mAb and soluble hrIL-2. T cell activation
was determined after 72 h culture in serum-free medium by measuring DNA synthesis. Both T cell activation assays were sensitive
to inhibition caused by soluble natural human tenascin-C purified
from the U251-MG glioma cell line (Fig. 1) at concentrations similar to those reported by other using the same assay (45, 46). This
inhibitory effect was specific for tenascin-C, because addition of
equivalent amounts of soluble plasma fibronectin had no effect on
anti-CD3 mAb/fibronectin-mediated T cell activation (Fig. 1A)
while it had a costimulatory effect on anti-CD3 mAb/hrIL-2 induced activation (Fig. 1B).
We initiated the structural-functional analysis of tenascin-C by
testing the effects of the EGF repeats and of the FRED on T cell
activation. To this purpose, we used recombinant tenascin-C molecules expressed in mammalian cells consisting of the coiled-coilsforming region and the EGF repeats or the FRED only (34). Consistently, these molecules did not inhibit T cell activation (data not
shown). The EGF repeats or the FRED were therefore not further
investigated, and we concentrated our efforts on the analysis of the
TnFnIII domains. A bacterial recombinant protein containing all
15 TnFnIII repeats, i.e., the 8 constant and the 7 alternatively
spliced repeats, referred to as TnFnIII All, efficiently inhibited T
cell activation elicited by both anti-CD3 mAbs/fibronectin and antiCD3/hrIL-2 (Fig. 2, A and B). In contrast a recombinant protein
FIGURE 1. Natural tenascin-C inhibits T lymphocyte activation. T lymphocytes were activated by immobilized anti-CD3 mAb and fibronectin (A)
or by immobilized anti-CD3 and rhIL2 (B) in the presence of the indicated
amounts of soluble plasma fibronectin and glioma-derived tenascin-C. T
cell activation was evaluated by measuring [methyl-3H]thymidine incorporation at 72 h after activation. Data are representative of three independent
experiments, and each point is the mean of quintuplicate determinations
(SD ⱕ15%).
encompassing the eight constant TnFnIII repeats (TnFnIII 1– 8)
was ineffective, suggesting that the immunosuppressive activity
was contained within the alternatively spliced region of tenascin-C. To collect direct evidence supporting this possibility, we
tested a recombinant fragment consisting of the alternatively
spliced TnFnIII repeats (referred to as TnFnIII A–D) and recombinant fragments containing the constant TnFnIII repeats 1–5 (TnFnIII 1–5) or 6 – 8 (TnFnIII 6 – 8). These experiments demonstrated that TnFnIII A–D efficiently inhibited T cell proliferation
elicited by anti-CD3 mAb/fibronectin or anti-CD3/hrIL-2, whereas
TnFnIII 1–5 or TnFnIII 6 – 8 did not have any inhibitory activities
(Fig. 2, C and D). Taken together, these results indicate that the
inhibitory activity on T cell activation previously described for
natural tenascin-C is contained within its alternatively spliced
region.
TnFnIII A1A2 repeats are essential to inhibit T lymphocyte
activation
The alternatively spliced region of tenascin-C consists of seven
TnFnIII domains, i.e., A1, A2, A3, A4, B, C, and D. To identify
which one of these domains is essential for suppressing T cell
activation, we produced recombinant proteins encompassing three
consecutive TnFnIII repeats in an overlapping manner (see Fig.
3A). These proteins were generated using the pRSET-A expression
vector and contained a 6His tag at their N-terminal ends enabling
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
Human CD8⫹ T cell clones specific for peptides Melan-A 26 –35 (EAA
GIGILTV) and tyrosinase 368 –376 (YMDGTMSQV) were derived from
melanoma patients as previously described (54, 55). Ag-specific cytolytic
activity of T cell clones in the presence of tenascin-C recombinant fragments was measured using the chromium release assay as described (56).
Briefly, target cells (T2, a lymphoblastoid cell line) were labeled with 51Cr
in Tris-Dulbecco buffer supplemented with 2 mg/ml BSA for 1 h at 37°C.
Labeled target cells (1000 cells in 50 ␮l) were then incubated with various
concentrations of the antigenic peptide (50 ␮l) for 15 min at room temperature before the addition of CTL clones at a E:T ratio of 10:1. 51Cr
release into the culture supernatant was measured after incubation for 4 h
at 37°C using a Packard scintillation counter (Packard BioScience, Zurich,
Switzeland). The percent specific lysis was calculated as: 100 ⫻ [(experimental ⫺ spontaneous release)/(total ⫺ spontaneous release)].
The Journal of Immunology
6435
purification by Ni-NTA affinity chromatography (Fig. 3B). Recombinant proteins were not toxic for T lymphocytes or the human
lymphoblastoid cell line T2 as assessed by trypan blue exclusion,
by chromium release assay, and by DAPI staining and flow cytometry analysis (data not shown). When tested in the anti-CD3
mAb/fibronectin T cell activation assay, fragments TnFnIII
A1A2A3 and TnFnIII A2A3A4 inhibited T cell activation in a
dose-dependent manner, whereas fragments TnFnIII A3A4B,
TnFnIII A4BC, and TnFnIII BCD were ineffective (Fig. 3C).
These data indicate that the TnFnIII domains A1 and A2 play a
crucial role in mediating the immunosuppressing activity of
tenascin-C.
To seek further evidence supporting the role of the repeats A1
and A2 on the immunosuppressive function of tenascin-C, we produced TnFnIII A–D lacking the TnFnIII domains A1 (TnFnIII
A–D⌬ A1), A1, and A2 (TnFnIII A–D⌬A1A2) or A1, A2, and A3
(TnFnIII A–D⌬A1A2A3), as well as a recombinant fragment consisting of domains A1 and A2 only (termed TnFnIII A1A2; see
Fig. 4A). The 6His-tagged TnFnIII A–D protein purified by NiNTA affinity chromatography inhibited T cell activation (Fig. 4C)
like the untagged TnFnIIIA–D, purified by ammonium sulfate precipitation and MonoQ chromatography, suggesting that the 6His
tag did not contribute to inhibit T cell activation. The deletion
mutants TnFnIII A–D⌬A1, TnFnIII A–D⌬A1A2, and TnFnIII
A–D⌬A1A2A3 did not inhibit T cell activation. Fragment TnFnIII
A1A2 inhibited T cell activation by 60% at 800 nM, whereas fragment TnFnIII A1A2A3 effectively blocked activation by ⬎90% at
the same dose (Fig. 4C).
To identify which of these two TnFnIII domains was essential
for suppressing T cell activation, we generated recombinant proteins consisting of the single TnFnIII repeat A1, A2, and A3. These
FIGURE 3. Inhibition of T cell activation by recombinant proteins issued from the alternatively spliced domain of tenascin-C. A, Schematic
diagram of the structure of small recombinant proteins encompassing three
adjacent domains of the TnFnIII A–D region. B, SDS-PAGE analysis of
the purified material to demonstrate the correct size and purity of the recombinant proteins. The gel is stained with Coomassie blue. C, Effect of
the small recombinant proteins issued from the TnFnIII A–D region on T
cell activation elicited by anti-CD3 mAbs and fibronectin. T cell activation
was evaluated by measuring [methyl-3H]thymidine incorporation at 72 h
after activation. Data are representative of five independent experiments,
and each point is the mean of quintuplicate determinations (SD ⱕ15%).
domains were expressed as GST fusion proteins to assure optimal
expression and stability and carried a 6His tag at their C terminus
(Fig. 5A). Addition of GST-TnFnIII A1, GST-TnFnIII A2, or
GST-TnFnIII A3 fusion proteins, or combinations thereof, to the
anti-CD3 mAb/fibronectin T cell activation assays did not have
any detectable inhibitory effect (Fig. 5C).
Taken together, these results demonstrate that TnFnIII A1A2 is
the smallest region of tenascin-C that retains the ability to inhibit
in vitro T lymphocyte activation. Maximal inhibition, however,
required the presence of the TnFnIII domain A3.
TnFnIII A–D and TnFnIII A1A2A3 inhibit activation-induced
down-modulation of the TCR complex
Tenascin-C inhibits T cell activation when present at time of stimulation but not when cells are already proliferating (6), suggesting
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
FIGURE 2. A recombinant tenascin-C fragment corresponding to the
alternatively spliced region of tenascin-C inhibits T lymphocyte activation.
T lymphocytes were activated by immobilized anti-CD3 mAb and fibronectin (A and C) or anti-CD3 mAb and rhIL2 (B and D) in the presence
of the recombinant tenascin-C fragments encompassing the fibronectin
type III domains: TnFnIII All, 1– 8, 1–5, A–D, and 6 – 8. T cell activation
was evaluated by measuring [methyl-3H]thymidine incorporation at 72 h
after activation. Data are representative of five independent experiments,
and each point is the mean of quintuplicate determinations (SD ⱕ15%).
6436
IDENTIFICATION OF THE IMMUNOSUPPRESSIVE DOMAIN OF TENASCIN-C
that it affects early events in the T cell activation cascade. To
collect direct evidence supporting this possibility, we studied the
effect of recombinant tenascin-C fragments on activation-induced
internalization of the TCR/CD3 complex, a phenomenon also
known as TCR down-modulation. This is one of the earliest events
following TCR/CD3-dependent T cell activation, and it was shown
to closely reflect the magnitude of the resulting activation (58).
CD3 expression at the T lymphocyte surface was measured by
staining cells with FITC-labeled anti-CD3 mAb (clone HIT-3a)
and flow cytometry analysis 24 h after stimulation with immobilized anti-CD3 mAb and fibronectin. T cell activation by anti-CD3
mAb and fibronectin caused a complete down-regulation of CD3
from the cell surface (Fig. 6). Addition of soluble TnFnIII A–D or
TnFnIII A1A2A3 to the T cell activation assays greatly suppressed
activation-induced CD3 down-regulation. In contrast, addition of the
noninhibitory fragment TnFnIII A–D⌬A1A2A3 had only minimal
effects on CD3 down-modulation (Fig. 6). The addition of TnFnIII
A–D and TnFnIII A1A2A3 also affected the activation-induced
down-regulation of CD8, whereas TnFnIII A–D⌬A1A2A3 had no
any effect (Table II).
The alternatively spliced domain of tenascin-C inhibits
activation-induced cytokine production by activated T
lymphocytes
TNF and IFN-␥ are two major cytokines produced by activated T
lymphocytes which play a critical role in the development of cellular immunity and in the activation of CTLs (59). We therefore
measured the effect of the inhibitory tenascin-C fragments on the
release of TNF and IFN-␥ by activated T cells. T lymphocyte
activation by immobilized anti-CD3 mAb/fibronectin in the presence of the recombinant fragments TnFnIII A–D and TnFnIII
A1A2A3 resulted in the complete inhibition of TNF release,
whereas fragment TnFnIII A–D⌬A1A2A3 had no effect. The inhibition was complete, because the levels of TNF released by T
cells activated in the presence of these fragments were identical
with those found in the supernatant of nonactivated cells (Fig. 7A).
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
FIGURE 4. The TnFnIII A1A2 domain inhibits T cell activation. A,
Schematic diagram of the structure of the recombinant deletion mutants
and the two-domains protein issued from the TnFnIII A–D region. B, SDSPAGE analysis of the purified material to demonstrate the correct size and
purity of the recombinant proteins. The gel is stained with Coomassie blue.
C, Effect of the recombinant TnFnIII A1A2 protein and deletion mutants
issued from the TnFnIII A–D region on T cell activation elicited by antiCD3 mAbs and fibronectin. T cell activation was evaluated by measuring
[methyl-3H]thymidine incorporation at 72 h after activation. Data are representative of three independent experiments, and each point is the mean of
quintuplicate determinations (SD ⱕ15%).
FIGURE 5. Single-domain TnFnIII A1 or TnFnIII A2 does not inhibit
T lymphocyte activation. A, Schematic diagram of the structure of the
GST-TnFnIII single-domain fusion proteins. B, SDS-PAGE analysis of the
purified material to demonstrate the correct size and purity of the recombinant proteins. The gel is stained with Coomassie blue. C, Effect of GSTTnFnIII fusion proteins on T cell activation elicited by anti-CD3 mAb and
fibronectin. T cell activation was evaluated by measuring [methyl-3H]thymidine incorporation at 72 h after activation. Data are representative of
three independent experiments, and each point is the mean of quintuplicate
determinations (SD ⱕ15%).
The Journal of Immunology
6437
FIGURE 7. Recombinant TnFnIII A–D and TnFnIII A1A2A3 prevent
activation-induced TCR/CD3 complex down-modulation. T lymphocytes
were stimulated with immobilized anti-CD3 mAbs and fibronectin in medium alone or in the presence of 800 nM TnFnIII A–D, TnFnIII A1A2A3
or TnFnIII A–D⌬A1A2A3. After 24 h of culture cells were collected,
stained with direct-labeled anti-CD3 mAbs, and analyzed by flow cytometry. u, Fluorescence in the absence of Abs. Data are representative of
three independent experiments.
To assess the effect of these tenascin-C fragments on IFN-␥ production, we measured the expression of intracellular IFN-␥
(iIFN-␥) in resting and activated T cells. The expression levels of
iIFN-␥ in T cells activated with anti-CD3 mAb/fibronectin in the
presence of TnFnIII A–D or TnFnIII A1A2A3 were lower than
iIFN-␥ levels in T cells activated in the absence of tenascin-C
fragments or in the presence of TnFnIII A–D⌬A1A2A3 (Fig. 7B).
These data indicate that the alternatively spliced region of tenascin-C and the smaller fragment TnFnIII A1A2A3 efficiently
suppress the expression of TNF and IFN-␥ cytokines
say. None of the recombinant fragments tested (i.e., TnFnIII A–D,
TnFnIII A1A2A3, and TnFnIII A–D⌬A1A2A3) had any effects on
the lysis of T2 target cells by Melan-A or tyrosinase-specific CTL
clones (Fig. 8). These results demonstrate that the tenascin-C fragments do not inhibit cytotoxic activity of T cells and confirm our
original data obtained with natural tenascin-C.
The alternatively spliced domain of tenascin-C does not affect
cytolytic activity
We have previously reported that natural tenascin-C does not affect
the cytolytic effector function of T cells (6). We therefore assessed
the effect of the above characterized recombinant tenascin-C fragment on the lysis of target cells by CTL clones specific for the
TAA Melan-A or anti-tyrosinase using the chromium release as-
Table II. Flow cytometry analysis of CD3 and CD8 expression by T
lymphocytes activated in the presence of TnFnIII recombinant proteinsa
Mean Fluorescence
Intensity
Unactivated T cells
Activated T cells
Control
TnFnIII A–D
TnFnIII A1A2A3
TnFnIII A–D⌬A1A2A3
a
CD3
CD8
272.7
45.7
3.2
41.0
72.4
9.3
25.7
49.1
55.5
31.7
Data are representative of three independent experiments.
FIGURE 8. The recombinant tenascin-C fragments TnFnIII A–D and
TnFnIII A1A2A3 do not inhibit the cytolytic activity of CTL clones. The
cytolytic activity of a CTL clone specific for tyrosinase (clone 34; A) or
Melan-A (clone 0.3/3; B) was tested against T2 target cells labeled with
tyrosinase peptide at increasing concentrations in the absence of presence
of recombinant TnFnIII fragments as indicated. Cytolytic activity was measured using the 51Cr release assay. Results are expressed as percent specific
lysis (100 ⫻ (experimental ⫺ spontaneous release/total ⫺ spontaneous
release)). Data are representative of two independent experiments, and
each point is the mean of triplicate determinations (SD ⬍10%).
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
FIGURE 6. Recombinant TnFnIII A–D and TnFnIII A1A2A3 inhibit
TNF (A) and IFN-␥ (B) production by T lymphocytes activated with immobilized anti-CD3 mAb and fibronectin. TNF was measured in the cell
culture supernatant 72 h after activation using the WEHI-164 bioassay.
IFN-␥ was detected intracellularly (iIFN␥) by staining permeabilized T
cells with a direct labeled anti-IFN-␥ mAbs 6 h after activation, analysis by
flow cytometry. Values are expressed as mean fluorescent intensity (MFI).
Data are representative of three independent experiments.
6438
IDENTIFICATION OF THE IMMUNOSUPPRESSIVE DOMAIN OF TENASCIN-C
In addition, neither TnFnIII A–D nor TnFnIII A1A2A3 affected
down-regulation of CD3/CD8 in tyrosinase specific CTL clones
activated with specific peptides, or in Melan-A and flu-specific
CTL clones incubated on immobilized anti-CD3 mAbs and fibronectin (data not shown). This suggested that TnFnIII A–D inhibits activation only of ex vivo peripheral blood T lymphocytes
but not of preactivated Ag-specific CTL clones, consistent with the
hypothesis that tenascin-C affects the earliest events of T cell
activation.
The large but not the small tenascin-C isoform inhibits T
lymphocytes activation
Discussion
This work was initiated with the purpose of identifying the region
of tenascin-C responsible for the inhibition of T cell activation
previously reported by us and others (6, 45, 46). Here we report
that: 1) the alternatively spliced region of tenascin-C (i.e., TnFnIII
A–D) is essential for inhibiting T cell activation; 2) within TnFnIII
A–D, TnFnIII A1A2 is the minimal region retaining the ability to
inhibit T cell activation; and 3) the TnFnIII A–D region and derived fragments also suppress activation-induced TCR down-regulation and TNF and IFN-␥ secretion by freshly isolated peripheral
blood T cells but do not inhibit neither activation-induced CD3 and
CD8 down-regulation nor cytolytic activity of Ag-specific CTLs
clones.
FIGURE 9. The large but not the small tenascin-C isoform inhibits T
lymphocyte activation. In this assay, T cell activation was induced in a
mixed leukocyte reaction (alloantigen-induced activation) using PBMC
from two nonmatched donors, in the absence or presence of full length
recombinant large or small tenascin-C isoforms. T cell activation was evaluated by measuring [methyl-3H]thymidine incorporation at 96 h after activation. Data are representative of two independent experiments.
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
To confirm that the TnFnIII A–D region suppresses T cell activation in the context of the whole tenascin-C molecule, we tested the
effects of two full length recombinant tenascin-C molecules produced in mammalian cells, the first containing the TnFnIII A–D
domain (tenascin-C large isoform) and the second lacking it (tenascin-C small isoform) (49) on alloantigen-induced T cell activation. In these experiments, the large but not the small isoform
suppressed T cell activation in a dose-dependent manner (Fig. 9).
Thus, these results confirm the results obtained with gliomaderived natural tenascin-C (consisting mostly of the large isoform)
and are consistent with the essential role of TnFnIII A–D in the
inhibition of T cell activation.
The fibronectin type III repeats region is one of the best studied
regions of tenascin-C, and a number of activities have been attributed to it. In general, the TnFnIII domains 1–5 and 6 – 8 promote
cell adhesion, spreading, and migration of many different cells,
including glioma (35), hemopoietic cells (36), endothelial cells
(43), neurones (60), and mammary epithelial cells (61). The third
TnFnIII repeat bears binding sites for integrin ␣V␤3, ␣V␤6, and
␣9␤1 (62) and thereby plays a key role in promoting integrindependent cell adhesion and migration. The alternatively spliced
region, TnFnIII A–D, supports attachment of neurons (34), induces
neurite outgrowth and guidance (42), and promotes proliferation of
hemopoietic precursor bone marrow cells (36). TnFnIII A–D was
also reported to promote the dissolution of focal adhesions and to
inhibit proliferation of endothelial cells by binding to annexin II
(39 – 41). Within the TnFnIII A–D, TnFnIII A1–A4 promotes neurite outgrowth, whereas TnFnIII D may play a role in neurite guidance (63).
The main contribution of this work is the identification of the
TnFnIII domains A1A2 as the smallest region of tenascin-C able to
inhibit T cell activation. Although this result implicates for the first
time a specific region of tenascin-C in its immunosuppressive activity, it also raises new questions about the role of the individual
TnFnIII domains in mediating this effect. The fact that TnFnIII
domains A1A2 are active when expressed together but not when
expressed individually (and tested either alone or together) suggests that the formation of the inhibitory domain requires the concerted action of at least two contiguous TnFnIII repeats. Strikingly,
TnFnIII A1 is essential for the inhibitory activity of the sevendomain fragment TnFnIII A–D, but not of a shorter fragment consisting of three domains only (i.e., TnFnIII A2A3A4), suggesting
that the physical context in which the TnFnIII repeats are present
may also have a profound influence on the formation of this activity. This concept is further supported by the observation that
addition of domain A3 substantially enhances the inhibitory activity of TnFnIII A1A2. Also, it has been reported that TnFnIII repeats are highly elastic (64) and can undergo conformational
changes in response to tensional forces transduced by adjacent
domains, resulting in altered affinity for the cognate receptors (65,
66). Also, the A1–A4 domains in human tenascin-C are ⬎90%
homologous to each other as are generated by a recent reduplication of one single fibronectin type III repeat (67). This raises the
possibility that some redundant or overlapping activities may exist
within these highly homologous domains.
The mapping of the immunosuppressive domain of tenascin-C
within TnFnIII A–D is of considerable interest in the context of
tumor stroma and tissue remodeling. Indeed, the tenascin-C large
variant is highly expressed in the stroma of malignant tumors, a
site in which T cells have been shown to be immunosuppressed
(5). Strikingly, the alternatively spliced region of tenascin-C is
highly sensitivity to degradation by matrix metalloproteinases and
serine proteinases (68). This may represent a mechanism by which
to modulate the immunosuppressive activity of tenascin-C at tissue
sites. This possibility is also consistent with the presence of numerous potential sites for N-glycosylation within the TnFnIII repeats A1, A2, A3, and A4 (69). Carbohydrate side chains may
protect this region against proteolytic processing and thereby promote its immunosuppressive activity. Thus, changes in tenascin-C
glycosylation and proteolytic activities might contribute to the
control of tenascin-C degradation and thereby to the regulation of
its immunosuppressive activity at tissue sites. In addition, one important conclusion from these findings is that the previously described ability of TnFnIII 1–5 to inhibit T cell adhesion to fibronectin (38) does not interfere with T cell activation (70).
The Journal of Immunology
Acknowledgments
We thank Dr. F. J. Lejeune for continuous support, Drs. L. Zardi and R.
Chiquet-Ehrismann for providing recombinant tenascin-C protein, Dr.
H. P. Erickson for providing tenascin-C expression plasmids, P. Batard for
help in flow cytometry analysis, and N. Montandon for help with the CTL
assay and TNF bioassay.
References
1. Boon, T., J.-C. Cerottini, B. Van den Eynde, P. van der Bruggen, and A. V. Pel.
1994. Tumor antigens recognized by T lymphocytes. Annu. Rev. Immunol. 12:
337.
2. Kripkle, M. L. 1981. Immunologic mechanisms in UV radiation carcinogenesis.
Adv. Cancer Res. 34:69.
3. Rosenberg, S. A. 2000. Identification of cancer antigens: impact on development
of cancer immunotherapies. Cancer J. Sci. Am. 6:S200.
4. Miescher, S., M. Stoeck, L. Qiao, C. Barras, L. Barrelet, and V. von Fliedner.
1988. Proliferative and cytolytic potentials of purified human tumor-infiltrating T
lymphocytes: impaired response to mitogen-driven stimulation despite T-cell receptor expression. Int. J. Cancer 42:659.
5. Ganss, R., and D. Hanahan. 1998. Tumor microenvironment can restrict the effectiveness of activated antitumor lymphocytes. Cancer Res. 58:4673.
6. Rüegg, C. R., R. Chiquet-Ehrismann, and S. S. Alkan. 1989. Tenascin, an extracellular matrix protein, exerts immunomodulatory activities. Proc. Natl. Acad.
Sci . USA 86:7437.
7. Jones, F. S., and P. L. Jones. 2000. The tenascin family of ECM glycoproteins:
structure, function, and regulation during embryonic development and tissue remodeling. Dev. Dynam. 218:235.
8. Nies, D. E., T. J. Hemesath, J.-H. Kim, J. R. Gulcher, and K. Stefansson. 1991.
The complete cDNA sequence of human hexabrachion (tenascin). J. Biol. Chem.
266:2818.
9. Siri, A., B. Carnemolla, M. Saginatti, A. Leprini, G. Casari, F. Baralle, and
L. Zardi. 1991. Human tenascin: primary structure, pre-mRNA splicing patterns
and localization of the epitopes recognized by two monoclonal antibodies. Nucleic Acids Res. 19:525.
10. Erickson, H. P., and M. A. Bourdon. 1989. Tenascin: an extracellular matrix
protein prominent in specialized embryonic tissues and tumors. Annu. Rev. Cell
Biol. 5:71.
11. Aukhil, I., P. Joshi, Y. Yan, and H. P. Erickson. 1993. Cell- and heparin- binding
domains of the hexabrachion arm identified by tenascin expression proteins.
J. Biol. Chem. 268:2542.
12. Mackie, E. J., and R. P. Tucker. 1992. Tenascin in bone morphogenesis: expression by osteoclasts and cell type-specific expression of splice variants. J. Cell Sci.
103:765.
13. Derr, L. B., R. Chiquet-Ehrismann, R. Gandour-Edwards, J. Spence, and
R. P. Tucker. 1997. The expression of tenascin-C with the AD1 variable in embryonic tissues, cell lines and tumors. Differentiation 62:71.
14. Dueck, M., S. Riedl, U. Hinz, A. Tandara, P. Möller, C. Herfarth, and A. Faissner.
1999. Detection of tenascin-C isoforms in colorectal mucosa, ulcerative colitis,
carcinoma and liver metastasis. Int. J. Cancer 82:477.
15. Mighell, A. J., J. Thompson, W. J. Hume, A. F. Markham, and P. A. Robinson.
1997. Human tenascin-C: identification of a novel type III repeat in oral cancer
and novel splice variants in normal. malignant, and reactive oral mucosa. Int. J.
Cancer 72:236.
16. Borsi, L., B. Carnemolla, G. Nicolo, B. Spina, G. Tanara, and L. Zardi. 1992.
Expression of different tenascin isoforms in normal, hyperplastic and neoplastic
human breast tissues. Int. J. Cancer 52:688.
17. Chiquet, M., and D. M. Fambrough. 1984. Chick myotendinous antigen II: a
novel extracellular glycoprotein complex consisting of large disulfide-linked subunits. J. Cell Biol. 98:1937.
18. Ekblom, P., and E. Aufderheide. 1989. Stimulation of tenascin expression in
mesenchyme by epithelial-mesenchymal interactions. Int. J. Dev. Biol. 33:71.
19. Yuasa, S. 1996. Bergmann glial development in the mouse cerebellum as revealed by tenascin expression. Anat. Dev. 194:223.
20. Klein, G., S. Beck, and C. A. Muller. 1993. Tenascin is a cytoadhesive extracellular matrix component of the human hematopoietic microenvironment. J. Cell
Biol. 123:914.
21. Castano-Velez, E., P. Biberfeld, and M. Patarroyo. 1995. Extracellular matrix
(ECM) proteins collagen I, III, and IV, laminin, fibronectin, vitronectin, thrombospondin, tenascn and their integrin receptors of the ␤1 and ␤3 subfamilies
showed characteristic patterns of distribution in different compartments of nonreactive and reactive lymph nodes. Immunology 86:270.
22. Chilosi, M., M. Lestani, A. Benedetti, L. Montagna, S. Pedron, A. Scarpa,
F. Menestrina, S. Hirohashi, G. Pizzolo, and G. Semenzato. 1993. Constitutive
expression of tenascin in T-dependent zones of human lymphoid tissues.
Am. J. Pathol. 143:1348.
23. Mackie, E. J., W. Halfter, and D. Liverani. 1988. Induction of tenascin in healing
wounds. J. Cell Biol. 107:2757.
24. Castellani, P., A. Dorcaratto, A. Siri, L. Zardi, and G. L. Viale. 1995. Tenascin
distribution in human brain tumours. Acta Neurochir. 136:44.
25. Geffrottin, C., V. Horak, F. Créchet, Y. Tricaud, C. Lethias, S. Vincent-Naulleau,
and P. Vielh. 2000. Opposite regulation of tenascin-C and tenascin-X in MeLiM
swine heritable cutaneous malignant melanoma. Biochim. Biophys. Acta 1524:
196.
26. Vollmer, G. n., M. I. Tan, W. Wünsche, and K. Frank. 1997. Expression of
tenascin-C by human endometrial adenocarcinoma and stroma cells: heterogeneity of splice variants and induction by TGF-␤. Biochem. Cell Biol. 75:759.
27. Wilson, K. E., S. P. Langdon, A. M. Lessells, and W. R. Miller. 1996. Expression
of the extracellular matrix protein tenascin in malignant and benign ovarian tumours. Br. J. Cancer 74:999.
28. Soini, Y., M. Alavaikko, V.-V. Lehto, and I. Virtanen. 1992. Tenascin in reactive
lymph nodes and in malignant melanoma. Pathol. Res. Pract. 188:1078.
29. Schenk, S., D. Liénard, J. Gérain, M. Baumgartner, and F. J. Lejeune. 1995.
Rapid increase in plasma tenascin-C concentration after isolated limb perfusion
with high dose tumor necrosis factor (TNF), interferon ␥ (IFN␥) and melphalan
for regionally advanced tumors. Int. J. Cancer 63:665.
30. Schenk, S., J. Muser, G. Vollmer, and R. Chiquet-Ehrismann. 1995. Tenascin-C
in serum: an acute-phase protein or a carcinoma marker? Int. J. Cancer 60:145.
31. Crossin, K. L. 1996. Tenascin: a multifunctional extracellular matrix protein with
a restricted distribution in development and disease. J. Cell. Biochem. 61:592.
32. Orend, G., and R. Chiquet-Ehrismann. 2000. Adhesion modulation by antiadhesive molecules of the extracellular matrix. Exp. Cell Res. 261:105.
33. Spring, J., K. Beck, and R. Chiquet-Ehrismann. 1989. Two contrary functions of
tenascin: dissection of the active sites by recombinant tenascin fragments. Cell
59:325.
34. Fischer, D., M. Brown-Lüdi, T. Schulthess, and R. Chiquet-Ehrismann. 1997.
Concerted action of tenascin-C domains in cell adhesion, anti-adhesion and promotion of neurite outgrowth. J. Cell Sci. 115.
35. Philips, G. R., L. A. Krushel, and K. L. Crossin. 1998. Domains of tenascin
involved in glioma migration. J. Cell Sci. 111:1095.
36. Seiffert, M., S. C. Beck, F. Schermutzi, C. A. Müller, H. P. Erickson, and
G. Klein. 1998. Mitogenic and adhesive effects of tenascin-C on human hematopoietic cells are mediated by various functional domains. Matrix Biol. 17:47.
37. Chung, C. Y., L. Zardi, and H. P. Erickson. 1995. Binding of tenascin-C to
soluble fibronectin and matrix fibrils. J. Biol. Chem. 270:29012.
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
Although we present here evidence showing that the TnFnIII
domains A1 and A2 are critically involved in inhibiting T cell
activation, we still have little knowledge on how this effect is mediated. To further understand the molecular mechanism by which
tenascin-C inhibits T cell activation, it will be essential to identify
the receptor and signaling pathway that are specifically engaged or
inhibited by tenascin-C. The observation that recombinant tenascin-C fragments inhibit activation-induced TCR down-regulation
may provide useful insights into this question. It has been proposed
that the extent of TCR down-regulation is determined by the number of TCR triggered in response to activatory stimuli and closely
reflects the magnitude of the induced T cell effector functions such
as cytokine production and proliferation (71). Two distinct early
signaling events are involved in T cell activation and TCR downmodulation: the tyrosine kinases p59fyn and p56lck; and the protein
kinase C pathways (72). Because tenascin-C does not prevent T
cell activation induced by the synthetic protein kinase C agonist
PMA (6, 45), the possibility that tenascin-C interferes with p59fyn
and/or p56lck-dependent signaling events should be explored. Because both p59fyn and p56lck also promote CD8 association with
the TCR complex (73), this hypothesis would be consistent with
the suppressed CD8 down-regulation by tenascin-C. Intriguingly,
there is direct experimental evidence indicating that p59fyn and
p56lck function is abrogated in T lymphocytes of tumor-bearing
mice (74). Alternatively, the small GTP-binding protein Rho
should also be considered as a putative target of the tenascin-C
effect. Inhibition of Rho in T lymphocytes suppresses T cell proliferation induced by anti-CD3 mAbs and fibronectin (75), and tenascin-C was shown to suppress Rho activation in fibroblasts (76).
In conclusion, we have identified the TnFnIII A1A2 domain
within the alternatively spliced region of tenascin-C as the smallest
region of the molecule able to suppress activation-induced T cell
proliferation and cytokine secretion. This results will be helpful to
further study the immunosuppressive activity of tenascin-C, in particular to identify the receptor and signaling pathway affected by
tenascin-C, as well as to design and generate antagonistic molecules to neutralize tenascin-C immunosuppressive activity in malignant tumors. Such a reagent may prove helpful to increase the
effectivity of anticancer immunotherapy approaches that are currently being developed and tested in the clinics.
6439
6440
IDENTIFICATION OF THE IMMUNOSUPPRESSIVE DOMAIN OF TENASCIN-C
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
urokinase-type plasminogen activator and effect on T lymphocyte adhesion, activation and cell clustering. J. Immunol. 158:1051.
Weiss, A., and D. R. Littman. 1994. Signal transduction by lymphocyte antigen
receptors. Cell 76:263.
Constant, S. L., and K. Bottomly. 1997. Induction of Th1 and Th2 CD4⫹ cells
responses: the alternative approaches. Annu. Rev. Immunol. 15:297.
Götz, B., A. Scholze, A. Clement, A. Joester, K. Schütte, F. Wigger, R. Frank,
E. Spiess, P. Ekblom, and A. Faissner. 1996. Tenascin-C contains distinct adhesive, anti-adhesive, and neurite outgrowth promoting sites for neurons. J. Cell
Biol. 132:681.
Jones, P. L., N. Boudreau, C. A. Myers, H. P. Erickson, and M. J. Bissell. 1995.
Tenascin-C inhibits extracellular matrix-dependent gene expression in mammary
epithelial cells. Localization of active regions using recombinant tenascin fragments. J. Cell Sci. 108:519.
Yokosaki, Y., H. Monis, J. Chen, and D. Sheppard. 1996. Differential effects of
the integrins ␣9␤1, ␣v␤3 and ␣v␤6 on cell proliferative responses to tenascin.
J. Biol. Chem. 271:24144.
Meiners, S., E. M. Powell, and H. M. Geller. 1999. Neurite outgrowth promotion
by the alternatively spliced region of tenascin-C is influenced by cell-type specific
binding. Matrix Biol. 18:75.
Oberhauser, A. F., P. E. Marszalek, H. P. Erikson, and J. M. Fernandez. 1998.
The molecular elasticity of the extracellular matrix protein tenascin. Nature 393:
181.
Hamill, S. J., A. E. Meekhof, and J. Clarke. 1998. The effect of boundary selection on the stability and folding of the third fibronectin type III domain from
human tenascin. Biochemistry 37:8071.
Kramer, A., H. Lu, B. Isralewitz, K. Schulten, and V. Vogel. 1999. Forced unfolding of the fibronectin type III module reveals a tensile molecule recognition
switch. Proc. Natl. Acad. Sci. USA 96:1351.
Gulcher, J. R., D. E. Nies, M. J. Alexakos, N. A. Ravikant, M. E. Sturgill,
L. S. Marton, and K. Stefansson. 1991. Structure of the human hexabrachion
(tenascin) gene. Proc. Natl. Acad. Sci. USA 88:9438.
Imai, K., M. Kusakabe, T. Sakakura, I. Nakanishi, and Y. Okada. 1994. Susceptibility of tenascin to degradation by matrix metalloproteinases and serine proteinases. FEBS Lett. 352:216.
Gulcher, J. R., D. E. Nies, L. S. Marton, and K. Stefansson. 1989. An alternatively spliced region of the human hexabrachion contains a repeat of potential
N-glycosylation sites. Proc. Natl. Acad. Sci. USA 86:1588.
Shimizu, Y., G. A. van Seventer, K. J. Horgan, and S. Shaw. 1990. Costimulation
of proliferative response of resting CD4⫹ T cells by the interaction of VLA-4 and
VLA-5 with fibronectin or VLA-6 with laminin. J. Immunol. 145:59.
Viola, A., and A. Lanzavecchia. 1996. T cell activation determined by the T cell
receptor number and tunable threshold. Science 273:104.
Lauritsen, J. P. H., M. D. Christensen, J. Dietrich, J. Kastrup, N. Odum, and
C. Geisler. 1998. Two distinct pathways exist for down-regulation of the TCR.
J. Immunol. 161:260.
Hardy, K., and G. Chaudhri. 1997. Activation and signal transduction via mitogen-activated protein (MAP) kinases in T lymphocytes. Immunol. Cell Biol. 75:
528.
Mizoguchi, H., J. J. O’Shea, D. L. Longo, C. M. Loeffler, D. W. McVicar, and
A. C. Ochoa. 1992. Alterations in signal transduction molecules in T lymphocytes
from tumor-bearing mice. Science 258:1795.
Woodside, D. G., D. K. Wooten, and B. W. McIntyre. 1998. Adenosine diphosphate (ADP)-ribosylation of the guanosine triphosphatase (GTPase) Rho in resting peripheral blood human T lymphocytes results in pseudopodial extension and
the inhibition of T cell activation. J. Exp. Med. 188:1211.
Wenk, M. B., K. S. Midwood, and J. E. Schwarzbauer. 2000. Tenascin-C suppresses Rho activation. J. Cell Biol. 150:913.
Downloaded from http://www.jimmunol.org/ by guest on July 28, 2017
38. Hauzenberger, D., P. Olivier, D. Gundersen, and C. Rüegg. 1999. Tenascin-C
inhibits ␤1 integrin-dependent T lymphocyte adhesion to fibronectin through the
binding of its fnIII 1–5 repeats to fibronectin. Eur. J. Immunol. 29:1435.
39. Murphy-Ullrich, J. E., V. A. Lightner, I. Aukhil, Y. Z. Yan, and H. P. Erickson.
1991. focal adhesion integrity is downregulated by the alternatively spliced domain of human tenascin. J. Cell Biol. 115:1127.
40. Chung, C. Y., and H. P. Erickson. 1994. Cell surface annexin II is a high affinity
receptor for the alternatively spliced segment of tenascin-C. J. Cell Biol. 126:539.
41. Chung, C. Y., J. E. Murphy-Ullrich, and H. P. Erickson. 1996. Mitogenesis, Cell
Migration, and Loss of Focal Adhesions induced by Tenascin-C interacting with
its cell surface receptor, annexin II. J. Cell Biol. 7:883.
42. Meiners, S., M. L. T. Mercado, M. S. A. Nur-e-Kamal, and H. M. Heller. 1999.
Tenascin-C contains domains that independently regulate neurite outgrowth and
neurite guidance. J. Neurosci. 19:8843.
43. Sriramarao, P., M. Mendler, and M. A. Bourdon. 1993. Endothelial cell attachment and spreading on human tenascin is mediated by ␣2␤1 and ␣v␤3 integrins.
J. Cell Sci. 105:1001.
44. Schenk, S., R. Chiquet-Ehrismann, and E. J. Battegay. 1999. The fibrinogen
globe of tenascin-C promotes basic fibroblast growth factor-induced endothelial
cell elongation. Mol. Biol. Cell 10:2933.
45. Hemesath, T. J., L. S. Marton, and K. Stefansson. 1994. Inhibition of T cell
activation by the extracellular matrix protein tenascin. J. Immunol. 152:5199.
46. Hibino, S., K. Kato, S. Kudoh, H. Yagita, and K. Ukumura. 1998. Tenascin
suppresses CD3-mediated T cell activation. Biochem. Biophys. Res. Commun.
250:119.
47. Koyama, Y., M. Kusubata, A. Yoshiki, N. Hiraiwa, T. Ohashi, S. Irie, and
M. Kusakabe. 1998. Effect of tenascin-C deficiency on chemically induced dermatitis in the mouse. J. Invest. Dermatol. 111:930.
48. Nakao, N., N. Hiraiwa, A. Yoshiki, F. Ike, and M. Kusakabe. 1998. Tenascin-C
promotes healing of Habu-snake venom-induced glomerulonephritis: studies in
knockout congenic mice and in culture. Am. J. Pathol. 152:1237.
49. Carnemolla, B., L. Borsi, G. Bannikov, S. Troyanovsky, and L. Zardi. 1992.
Comparison of human tenascin expression in normal, simian-virus-40-transformed and tumor-derived cell lines. Eur. J. Biochem. 205:561.
50. Plaxco, K. W., C. Spitzfaden, I. D. Campbell, and C. M. Dobson. 1996. Rapid
refolding of a proline-rich all ␤-sheet fibronectin type III module. Proc. Natl.
Acad. Sci. USA 93:10703.
51. Greaves, M. F., G. Janossy, and P. Curtis. 1976. Purification of human lymphocytes using nylon fiber columns. In In Vitro Methods in Cell-Mediated and Tumor
Immunity. B. R. Bloom and J. R. David, eds. Academic Press, New York, p. 217.
52. Valmori, D., V. Dutoit, V. Rubio-Godoy, C. Chambaz, D. Lienard, P. Guillaume,
P. Romero, J. C. Cerottini, and D. Rimoldi. 2001. Frequent cytolytic T-cell responses to peptide MAGE-A10(254 –262) in melanoma. Cancer Res. 61:509.
53. Espevik, T., and J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164
clone 13 for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J. Immunol. Methods 95:99.
54. Valmori, D., M. J. Pittet, C. Vonarbourg, D. Rimoldi, D. Lienard, D. Speiser,
R. Dunbar, V. Cerundolo, J. C. Cerottini, and P. Romero. 1999. Analysis of the
cytolytic T lymphocyte response of melanoma patients to the naturally HLAA*0201-associated tyrosinase peptide 368 –376. Cancer Res. 59:4050.
55. Valmori, D., N. Gervois, D. Rimoldi, J. F. Fonteneau, A. Bonelo, D. Lienard,
L. Rivoltini, F. Jotereau, J. C. Cerottini, and P. Romero. 1998. Diversity of the
fine specificity displayed by HLA-A*0201-restricted CTL specific for the immunodominant Melan-A/MART-1 antigenic peptide. J. Immunol. 161:6956.
56. Valmori, D., J. F. Fonteneau, C. M. Lizana, N. Gervois, D. Liénard, D. Rimoldi,
C. V. Jongeneel, F. Jotereau, J.-C. Cerottini, and P. Romero. 1998. Enhanced
generation of specific tumor-reactive CTL in vitro by selected Melan-A/MART-1
immunodominant peptide analogs. J. Immunol. 161:1750.
57. Gundersen, D., C. n. Trân-Thang, B. Sordat, F. Mourali, and C. Rüegg. 1997.
Plasmin-induced proteolysis of tenascin-C: modulation by T lymphocyte-derived