Carcinogenesis vol.28 no.2 pp.404–413, 2007
doi:10.1093/carcin/bgl162
Advance Access publication September 4, 2006
The Akt inhibitor deguelin, is an angiopreventive agent also acting
on the NF-kB pathway
Raffaella Dell’Eva1,†, Claudia Ambrosini1,†,
Simona Minghelli2, Douglas M.Noonan3,
Adriana Albini1, and Nicoletta Ferrari1
1
Molecular Oncology Laboratory, National Institute for Cancer Research,
Largo R. Benzi 10, 2Centro di Biotecnologie Avanzate, Genova 16132,
Italy and 3Department of Clinical and Biological Sciences, University of
Insubria, Varese 21100, Italy
To whom correspondence should be addressed. Tel: +39 010 5737 406;
Fax: +39 010 5737 231;
Email: [email protected]
Several natural compounds, especially plant products and
dietary constituents, are able to exhibit ‘angiopreventive’
(anti-angiogenic chemoprevention) activities both in vitro
and in vivo. Deguelin is a rotenoid of the flavonoid family
with chemopreventive activities able to decrease tumor
incidence in animal models for lung, colon, mammary
and skin carcinogenesis through Akt inhibition. Here
we show that deguelin belongs to the ‘angiopreventive’
molecules and provide evidence for molecular events
associated with its anti-angiogenic properties. The data
show that deguelin inhibits HUVE cells growth by
inducing cell-cycle arrest in the G0/G1 phase and in the
absence of apoptosis. Growth arrest is associated with
induction of p21 and p53 and decreased survivin levels.
Deguelin also interferes with several points in the
angiogenic process, including inhibition of endothelial
cell migration, invasion and metalloprotease production,
and potently inhibits in vivo angiogenesis and vascular
tumor growth. In addition to Akt, the nuclear factorkappaB (NF-kB) kinase pathway, which plays a critical
role in the regulation of inflammation, vascular homeostasis and angiogenesis, was also repressed by deguelin
even in the presence of inflammatory stimuli such as
tumor necrosis factor-a (TNF-a). These findings reveal a
new therapeutic potential for deguelin in angioprevention
and anti-angiogenic therapy.
Introduction
Several natural compounds, particularly plant products and
dietary constituents, have been found to exhibit chemopreventive activities both in vitro and in vivo (1,2). They
show different mechanisms of action including cell growth
suppression, modulation of cell differentiation and induction
of apoptosis. Some rotenoids, which constitute a class of
compounds from the plant-derived flavonoid family, have
been shown to exert chemopreventive activity (3). Deguelin,
a rotenoid isolated from several plant species including
Abbreviations: COX-2, cyclooxygenase-2; IL-8, interleukin-8; MMP, matrix
metalloproteinases; NF-kB, nuclear factor-kappaB; PI3K, phosphatidylinositol 3-kinase; TNF-a, tumor necrosis factor-a.
†
These authors contributed equally to this work.
#
Mondulea sericea (Leguminosae), has been shown to be
effective in reducing the incidence of tobacco-induced lung
tumorigenesis (4) and chemically induced skin tumors
in mice (5), mammary tumors in rats (5), colonic aberrant
crypt foci in mice (6) and preneoplastic lesion formation in
mouse mammary gland in organotypic culture (3,7). The
mechanisms through which deguelin inhibits carcinogenesis
are not fully elucidated; various activities have been
described including suppression of ornithine decarboxylase
(ODC) (3), induction of apoptosis by dysregulation of the
cell-cycle checkpoint protein retinoblastoma (8), inhibition of mitochondrial bioenergetics (9), down-regulation of
cyclooxygenase-2 (COX-2) expression (10) and decreased
activity of the phosphatidylinositol 3-kinase (PI3K)/Akt
pathway (4,11). We observed that several agents shown to
have chemopreventive activity in experimental test systems
and/or clinical trials all show significant anti-angiogenic
activities as a key common target, a concept we termed
‘angioprevention’ (12). We propose that among the diverse
mechanisms of carcinogenesis inhibitors, the anti-angiogenic
activity of chemopreventive compounds is a common and
critical effect repressing cancer by blocking or retarding
tumor vasculature development. Several different overlapping categories of mechanisms leading to angiogenesis
inhibition can be discerned; these include inhibition of
COX-2 as is the case for non-steroidal anti-inflammatory
drugs (NSAIDs) and N-acetyl-L-cysteine (NAC) (13). Inhibition of matrix metalloproteinases (MMPs), required for
endothelial cell invasion, also appears to be a common target
of active chemopreventive agents (14,15). One crucial point
in common with many of these substances is the PI3K–Akt
signaling axis (16). This pathway is activated by a variety of
stimuli in endothelial cells and regulates multiple steps in
angiogenesis, including endothelial cell survival, migration
and invasion (17). Gene targeting of Akt1 modifies angiogenesis in murine models (18,19), further emphasizing the
crucial role of Akt in angiogenesis. Since deguelin inhibits
Akt and Akt is critical for angiogenesis, we investigated
whether deguelin shows angiopreventive properties.
Here we demonstrate that deguelin inhibits endothelial cell
growth, migration and Matrigel invasion. In vivo analyses
confirm that deguelin potently inhibits angiogenesis. The
basal levels of Akt were repressed by deguelin in endothelial
cells, similar to that seen for tumor cells (4,11). We have
previously observed that inhibition of nuclear factor-kappaB
(NF-kB), a pro-inflammatory transcription factor associated
with angiogenesis, is also a target of angiopreventive
compounds (20). NF-kB appears to be the final target of
the anti-angiogenic activity of deguelin, as tumor necrosis
factor-a (TNF-a)-induced IkB kinase activities were downregulated by deguelin. NF-kB is known to regulate
transcription of genes responsible for growth and survival
as well as apoptosis inhibition: the regulation of Akt and
NF-kB activity by deguelin led to increased expression of the
The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]
404
Deguelin inhibition of angiogenesis
mitosis inhibitor p21 and the p53 tumor suppressor gene
while repressing the anti-apoptotic survivin. Together, these
findings identify pleiotropic mechanisms for anti-angiogenic
efficacy of deguelin, and suggest potential application in
angioprevention and anti-angiogenic therapy.
Materials and methods
Cell culture and chemicals
Endothelial HUVE cells were obtained from the ATCC (Rockville, MD) and
cultivated on gelatin coated plates (1% in phosphate-buffered saline; PBS) in
M199 containing 10% heat-inactivated fetal calf serum (FCS), 100 mg/ml
heparin, 10 ng/ml aFGF, 10 ng/ml bFGF, 10 ng/ml EGF and 10 mg/ml
hydrocortisone. HMVECad and HAEC were from Cascade (Portland,
Oregon) and cultivated in MVGS supplemented Medium 131 (HMVECad)
or LSGS supplemented Medium 200 (HAEC; Cascade). K562 and U937
were from ATCC and cultivated in RPMI containing 10% heat-inactivated
FCS. The previously described KS-IMM cell line, isolated in our laboratory
from a kidney transplanted immuno-suppressed patient (21) was grown in
RPMI containing 10% FCS. Deguelin (Sigma, Milano, Italy) was dissolved
in dimethyl sulfoxide (DMSO) at a stock concentration of 2 mM and stored
in aliquots at 20 C.
Cell proliferation, apoptosis and FACS analysis for cell cycle distribution
To study cell growth, 2000 HUVE cells per well were seeded in 96-well
plates and grown in complete medium or treated with various concentrations
of deguelin. Media were changed every 48 h. The number of viable cells was
measured with the crystal violet assay. Briefly, after fixation and staining in a
solution of 0.75% crystal violet, 0.35% sodium chloride, 32% ethanol and
3.2% formaldehyde, the cells were dissolved in 50% ethanol, 0.1% acetic
acid and read at 595 nm. To measure any enrichment of cytoplasmic histoneassociated-DNA-fragments after deguelin treatment, a commercially available kit was employed (Cell Death Detection ELISA, Roche, Mannheim,
Germany) using 24-well plates seeded with 30 000 HUVE cells per well and
grown in complete medium containing various concentrations of deguelin.
FACS analysis for cell-cycle distribution was carried out on HUVE cells
grown in regular medium for 24 h in the absence or presence of deguelin at
different concentrations. At the end of treatments, 500 000 cells were washed
in PBS and suspended in 0.5 ml of hypotonic propidium iodide (PI) solution
(50 mg/ml PI, 0.1% Triton X-100, in 4 mM sodium citrate buffer) and
incubated for >1 h at 4 C in the dark. Cell-cycle distribution was then
analyzed by flow cytometry (FACSORT, Becton Dickinson) and percentage
of cells in different phases of cell cycle was determined by ModFit LT cell
cycle analysis software.
Matrigel morphogenesis assay
A 24-microwell plate, prechilled at 20 C, was carefully filled with 300 ml/
well of liquid Matrigel (10 mg/ml) at 4 C with a prechilled pipette, avoiding
bubbles. The Matrigel was polymerized for 1 h at 37 C, and HUVE cells
(70 000 cells/well) were suspended in regular medium in the absence or
presence of different concentrations of deguelin and carefully layered on the
top of polymerized Matrigel. The effects on the growth and morphogenesis
of endothelial cells were recorded after 6 and 24 h with an inverted
microscope (Leitz DM-IRB) equipped with CCD optics and a digital analysis
system.
Chemotaxis and invasion assays
Chemotaxis and chemoinvasion assays on HUVE cells were carried out in
Boyden chambers as described previously (22). The cells (5 · 104), were
extensively washed with PBS, re-suspended in serum-free media (SFM) and
placed in the upper compartment with or without deguelin. The two
compartments of the Boyden chamber were separated by a 12 mm pore-size
polycarbonate filters coated with 5 mg/ml of collagen IV for the chemotaxis
assay or with Matrigel (15 mg/ml), a reconstituted basement membrane, for
the invasion assay. Supernatants from NIH3T3 cells (NIH3T3-CM) were
used as chemoattractants in the lower chamber. After 6 h of incubation at
37 C in 5% CO2, the filters were recovered, the cells on the upper surface
were mechanically removed and those on the lower surface were fixed and
stained. The migrated cells were counted in 5–10 fields for each filter under a
microscope. The experiments were performed in triplicate and repeated three
times.
Gelatin zymography
Supernatants of cells from the invasion assay were centrifuged to remove
particulates and the protein content was measured by the Bradford method
(Bio-Rad, Hercules, CA). Gelatin zymography was performed as previously
described (23). Briefly, SDS–PAGE gels were prepared containing copolymerized gelatin at a final concentration of 1.6 mg/ml. After electrophoresis,
the gels were washed in 2.5% Triton X-100 for 30 min to remove SDS and
incubated for 18 h at 37 C in collagenase buffer (40 mM Tris, 200 mM
NaCl, and 10 mM CaCl2, pH 7.5). Gels were then stained in 0.1% Coomassie
brilliant blue followed by destaining. The enzyme-digested regions were
observed as white bands against a blue background.
In vivo angiogenesis
We utilized the Matrigel sponge model of angiogenesis described previously
(24). VTH [100 ng/ml vascular epithelial growth factor (VEGF), 2 ng/ml
TNF-a and heparin] in combination with deguelin at different concentrations
was added to unpolymerized liquid Matrigel at 4 C to a final volume of
600 ml. The control group was treated with vehicle alone. The Matrigel
suspension was slowly injected subcutaneously (s.c.) into the flanks of C57/
bl6 male mice (Charles River, Lecco, Italy) with a cold syringe. The gel
quickly polymerizes in vivo to form a solid gel. After 4 days, gels from all
animals were collected and weighed. Samples were minced and diluted in
water to measure the hemoglobin content with a Drabkin reagent kit (Sigma,
Milano, Italy). Some samples were formalin-fixed, paraffin-embedded
sectioned at 2–4 mm thickness, and then stained with hematoxylin and
eosin for histological analysis or with anti-myeloperoxidase (DAKO,
Glostrup, Denmark) or anti-p65 NF-kB subunit (ZYMED, San Francisco,
CA) antibodies for immunochemistry.
Tumor growth in vivo
Kaposi’s sarcoma tumors were obtained by s.c. injection of 5 · 106 KS-IMM
cells mixed with liquid Matrigel (final volume 250 ml) in the flanks of
7-week-old nude nu/nu (CD1) mice (Charles River). Animals (10 in each
group) were treated by intraperitoneally (i.p.) injection of either deguelin
(4 mg/kg of body wt) or vehicle, three times per week, starting 6 days prior
to KS-IMM cell injection. The animals were weighed and tumor growth was
monitored at regular intervals by measuring two tumor diameters with
calipers and calculating the tumor volumes with the following formula:
(length · width)2/2. On Day 29, the animals were sacrificed and the tumors
were removed, weighed, fixed in paraformaldehyde and stained with
hematoxylin and eosin for histological examination.
Real-time PCR
Total RNAs were isolated from controls and cells treated 6 and 24 h with
100 nM deguelin and reverse transcribed with oligo(dT) primers. mRNA
expression was analyzed by quantitative real-time RT–PCR by using the
following primers: p21 sense 50 -GGACAGCAGAGGAAGAC and antisense
50 -GGCGTTTGGAGTGGTAGAAA; p53 sense 50 -CCAGCCAAAGAAGAAACCAC and antisense 50 -CTCATTCAGCTCTCGGAAC; survivin sense
50 -ACTGAGAACGAGCCAGACTT and antisense 50 CGGACGAATGCTTTTTATGT TC. The relative expression of each gene was assessed in
comparison with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase amplified with the following primers: sense 50 -GAAGGTGAAGGTCGGAGT and antisense 50 -CATGGGTGGAATCATATTGGAA.
cDNAs were amplified for 50 cycles using iQ Supermix (Bio-Rad,
Richmond, CA) containing the intercalating agent SYBR Green in a twostep amplification scheme (95 C, 15 s and 60 C, 30 s). Fluorescence was
measured during the annealing step on a Bio-Rad iCycler iQ instrument.
Blank controls that did not contain cDNA were run in parallel. All samples
were run in triplicate. Following amplification, melting curves with 80 steps
of 15 s and a 0.5 C temperature increase per step were done to control
for amplicon identity. Relative expression values with SEMs and statistical comparison (unpaired two-tailed t-test) were obtained using Qgene
software (25).
Nuclear and cell extracts and western blot analysis
To test for activation of the NF-kB pathway, HUVE cells were serum starved
for 16 h and then treated with 100 nM deguelin for 6 h in SFM. At 5 and
15 min, before the end of incubation, cells were stimulated with TNF-a
(10 ng/ml). Serum starved control cells and cells exposed to 100 nM
deguelin for different lengths of time were also utilized to analyze Akt
activation. For nuclear and cytoplasmic protein extracts, the pellets of control
and treated cells were re-suspended in cytoplasmic lysis buffer and incubated
on ice for 10 min, vortexed and centrifuged at 12 000 r.p.m. for 2 min at 4 C.
Supernatants containing the cytoplasmic proteins were kept separately and
the nuclei in the pellets were re-suspended in nuclear lysis buffer for 20 min
on ice and centrifuged at 12 000 r.p.m. for 2 min at 4 C. Protein
concentration was determined by using the DC Protein Assay kit (BioRad). Equal amounts of samples were resolved by SDS–PAGE, transferred to
nitrocellulose and probed at 4 C overnight with the following anti-human
405
R.Dell’Eva et al.
antibodies (Cell Signaling Technology, Beverly, MA): rabbit polyclonal antiphospho-Akt (Ser473), anti-phospho-IkB (Ser32) and anti-phospho
p65(Ser539). p21, p53 and survivin analyses were carried out on extracts
obtained from cells grown in complete medium and filters were probed with
the following anti-human antibodies (Santa Cruz Biotechnology, Santa Cruz,
CA): rabbit polyclonal anti-p21 and anti-p53 antibodies and a mouse
monoclonal anti-survivin antibody. After washing, the blots were incubated
for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated
secondary antibodies (Amersham, Cologno Monzese, Italy) and specific
complexes were revealed by enhanced chemiluminescence solution
(Amersham). An anti-GAPDH antibody conjugated to HRP (Novus
Biologicals, Littleton, CO) or a mouse monoclonal anti-b-tubulin antibody
(Sigma, Milano, Italy) were utilized as loading controls for all samples.
Nuclear protein extraction, NF-kB and IL-8 ELISA
HUVE cells (1.5 · 106) grown in regular medium were treated 6 h with or
without 100 nM deguelin. In some experiments the cells were stimulated, at
the end of the experiment, with 10 ng/ml TNF-a for 5–15 min and then
harvested. Nuclear protein extracts were prepared using the Nuclear Protein
extract kit (Active Motif, Carlsbad, CA) according to the manufacturer’s
instructions. Enzyme-linked immunosorbent assay (ELISA) assays for NFkB activity were performed using a commercially available kit (TransAM,
Active Motif) following the manufacturer’s instructions. Briefly, the
oligonucleotide containing the NF-kB consensus site (50 -GGGACTTTCC30 ) was immobilized on 96-well plates and 10 mg of HUVEC nuclear protein
extract were added to triplicate wells. Plates were washed to remove
unbound protein and anti-NF-kB detection antibody was added and labeled
with HRP-conjugated antibody. Plates were read at 450 nm.
To quantify interleukin-8 (IL-8) protein, viable cells (4 · 104) were
seeded in 24-well plates and treated with deguelin as indicated. Conditioned
media were removed after 16 and 24 h and IL-8 protein content was
determined using the commercial human IL-8 ELISA kit (Bender
MedSystems, Vienna, Austria).
Results
The effects of deguelin on endothelial cells in vitro
We first assessed the action of deguelin on endothelial cell
proliferation by treating HUVE cells with a range of
concentrations of the rotenoid. All the concentrations tested
inhibited HUVE cell growth, with statistically significant
differences after 72-h exposure (Figure 1A, two-tailed t-test,
P < 0.01, P < 0.001), with a maximal inhibition
achieved at 50 nM. Deguelin induction of apoptosis was
examined by determination of cytoplasmic histoneassociated-DNA-fragments. After 24 h at all tested concentrations deguelin significantly reduced cellular apoptosis
(Figure 1B, two-tailed t-test, P < 0.001), thus was clearly
anti-apoptotic for endothelial cells. To study whether the
growth inhibitory effects of deguelin were accompanied by
cell-cycle arrest, HUVE cells were grown as described above,
harvested, stained with Triton X-100/PI and analyzed by flow
cytometry for cell-cycle distribution. Deguelin treatment
resulted in an evident increase in G0–G1 arrest together
with a concomitant decrease in G2–M phases population
(Figure 1C). HUVE cells treated with 50 and 100 nM
deguelin for 24 h had 84 and 94% cells in G0–G1, as
Fig. 1. (A) The cytostatic effects of 72-h exposure to deguelin on growth of HUVE cells in vitro. (B) HUVE cell apoptosis in the presence of deguelin;
after 24 h of treatment, all concentrations significantly reduced apoptosis as compared with controls. (C) Flow cytometry distribution of Triton X-100/PI
stained HUVE cells after 24 h of deguelin treatment at different doses. Both concentrations induced G1 arrest and protected cells from apoptosis relative to
untreated cells. (D) Effect of deguelin on organization of HUVE cells in the Matrigel morphogenesis assay. HUVE cells organized into capillary-like
networks even at the highest concentration used, consistent with an absence of toxicity.
406
Deguelin inhibition of angiogenesis
Fig. 2. (A) Inhibition of HUVE cell migration and (B) inhibition of invasion by deguelin. Means ± SEM are shown; P < 0.001 with
respect to controls (two-tailed t-test). (C) Zymographic detection of secreted gelatinase activity, deguelin dose-dependently inhibited MMP-2 release.
compared with only 73% in the controls. Conversely, G2–M
phase population was decreased to 4 and 0.4% as compared
with 11% in the controls. The percentage of apoptotic cells
strongly decreases in deguelin treated cells, confirming its
anti-apoptotic effect and lack of toxicity on endothelial cells.
Consistent with the absence of toxicity, deguelin did not alter
the ability of endothelial cells to differentiate into capillarylike networks in the morphogenesis assay on Matrigel
(Figure 1D).
The effects of deguelin on endothelial cell migration and
invasion were then tested at various concentrations. Fibroblast conditioned medium (NIH3T3-CM), which contains a
mixture of molecules able to stimulate the migration of
invasive cells, was used as chemoattractant in these
experiments. HUVE cells migrated (Figure 2A) and invaded
through Matrigel (Figure 2B) in response to NIH3T3-CM,
while migration in the absence of a chemoattractanct (SFM)
was limited. The addition of deguelin in the upper chambers
had prominent effects on the migration and invasion of endothelial cells, with significant inhibition even at the lowest
concentration (10 nM, P < 0.001, two tailed t-test).
The HUVE cells stimulated to invade produce a characteristic gelatinase activity corresponding to the 72 kDa
activated form of gelatinase A (MMP-2), a molecule whose
synthesis is regulated by NF-kB. Deguelin did not have
direct effects on the enzymatic activity of MMP-2 as
determined by its addition to the buffer of the gelatin
zymography (data not shown). However, zymographic
evaluation performed on supernatants of cells obtained from
the invasion assays performed above, showed a marked
decrease in the MMP-2 activity produced by HUVE cells
with increasing concentrations of deguelin (Figure 2C).
These data suggest that deguelin inhibits metalloprotease
synthesis, which would be consistent with NF-kB repression,
or secretion.
Inhibition of angiogenesis and vascular tumor growth in vivo
The effects of deguelin on angiogenesis-associated endothelial cell functions observed in vitro were then confirmed
in vivo in the matrigel pellet angiogenesis assay. Matrigel
suspensions containing a cocktail (VTH) of VEGF
(100 ng/ml) and TNF-a (2 ng/ml) as angiogenic stimuli
were injected subcutaneously in mice. The presence of VTH
in the Matrigel sponges promoted a hemorrhagic vascularization of the gels within 4 days. Quantification of the extent
of angiogenesis by hemoglobin content measurement showed
a dose-dependent inhibition by deguelin, with significant
reduction at 50 nM (final concentration, P < 0.001,
Mann–Whitney) (Figure 3A). The angiogenic response was
essentially abolished in the presence of 100 nM deguelin
(Figure 3A). Histological analyses of the recovered gels
showed a strong infiltration with vessel formation in control
samples (Figure 3B), while deguelin-treated animals showed
only a minor cellular infiltrate in the intact largely acellular Matrigel (Figure 3C). Immunohistochemical staining
showed an intense myeloperoxidase positive cell population
[macrophages and polymorphonuclear leukocytes (PMN)]
(Figure 3D) as well as cells positive for the p65 NF-kB
subunit in the control samples (Figure 3F). In contrast,
only few myeloperoxidase or p65 positive cells were among
those infiltrating into deguelin treated samples (Figure 3E
and G).
Since these data indicated potential angioprevention
properties of deguelin, we investigated whether deguelin
was able to prevent vascular tumor growth in vivo in an
angioprevention setting. The immortalized KS-IMM Kaposi’s
sarcoma cell line forms highly angiogenic tumors when
injected s.c. in male nude mice; in those animals treated with
4 mg/kg body wt of deguelin the growth of tumors was
strongly and significantly (P < 0.001, two-way ANOVA)
reduced as compared with the controls (Figure 4A) from Day
24 on. Further deguelin-treated animals showed significantly lower tumor weights at the end of the experiment
(Figure 4A inset, P ¼ 0.0071, Mann–Whitney t-test).
Histological analysis indicated rapidly growing, vascularized
tumors in the controls, while tumors from the deguelin
treated animals showed fewer, smaller vessels and extensive
necrotic tissue (Figure 4B and C), consistent with repressed
angiogenesis. No differences were noted in the body weight
or general health parameters in the treated animals as
407
R.Dell’Eva et al.
Fig. 3. Inhibition of angiogenesis in vivo by deguelin. Subcutaneously injected Matrigel sponges containing angiogenic factors rapidly become vascularized
as estimated by measurement of the hemoglobin content of the gels. (A) Addition of deguelin to the gels significantly (P < 0.001, Mann–Whitney)
prevented vascularization. Means ± SEM are shown. (B and C) Hematoxylin and eosin staining of recovered gels from control (B) and deguelin treated
(C) animals. Intense cellular infiltration and vessel formation is apparent in control samples while the Matrigel is largely intact and acellular in the treated
samples. (D–G) Immunohistochemical staining for myeloperoxidase (D and E) and NF-kB p65 subunit (F and G) in control (D and F) and deguelin
treated animals (E and G).
compared with controls, indicating limited or no toxicity
of deguelin treatment, again consistent with the in vitro
observations.
The Akt pathway in vascular homeostasis and angiogenesis
Deguelin inhibits Akt activation with an up-regulation of
p21 and p53 and a decreased expression of survivin. The
Akt signaling axis is activated by a variety of stimuli in
endothelial cells and regulates multiple critical steps in
angiogenesis, including endothelial cell survival, migration
and invasion. The ability of deguelin to inhibit the Akt
signaling pathway in tumor cells has been previously
reported. On the basis of our results on endothelial cell
growth, migration and invasion, we examined whether
deguelin also inhibits Akt phosphorylation in endothelial
cells. Western blot analysis showed high basal levels of
phosphorylated Akt in HUVE cells. As expected, a 1-h
408
exposure to 100 nM deguelin reduced Akt phosphorylation
by >70% (Figure 5A).
Akt phosphorylates specific targets to promote cell
survival and proliferation and has been shown to influence
the cellular localization and functions of p21 (26). The Akt
pathway can also influence p53 expression and apoptosis (27)
and survivin expression in endothelial cells (28). We
examined if the growth inhibitory effect of deguelin was
accompanied by similar events. HUVE cells were exposed to
100 nM deguelin for 6 and 24 h, followed by RNA extraction
and real-time PCR validation of the expression of p53,
p21 and survivin. These analyses showed that at 6-h exposure
to deguelin significantly induced p21 and p53 expression
while survivin mRNA was suppressed (Figure 5B). The
modulation of the expression of these genes became even
more evident after 24-h treatment (Figure 5B). We then
investigated whether modulated mRNA species corresponded
Deguelin inhibition of angiogenesis
Fig. 4. Inhibition of tumor growth in vivo by deguelin. (A) Growth of highly
vascularized KS-IMM tumors in vivo was significantly reduced by treatment
with deguelin (P < 0.05, P < 0.01, P < 0.001, two-way ANOVA).
Inset: recovered tumor weights were significantly smaller in the animals
treated with deguelin (P ¼ 0.0071, Mann–Whitney t-test). (B) Histological
analysis of tumors from control vehicle treated animals showed vascularized
areas. (C) Tumors from deguelin treated animals showed more extensive
necrotic areas and fewer, smaller vessels than the controls.
to modulation of proteins expression. Western blotting
analysis of nuclear extracts from HUVE cells treated with
100 nM deguelin for 24 h showed a strong increase in p53
protein levels while p21 up-regulation was already evident
after 16 h (Figure 5C). Interestingly, the nuclear p21 increase
corresponded to a complete disappearance of the cytoplasmic
protein, consistent with changes in cellular localization of
p21 upon its activation. Deguelin also strongly decreased the
amount of survivin, causing an almost complete disappearance of the product from both nuclear and cytosolic fractions
as detected by western blotting (Figure 5C). Real-time PCR
validation showed that endothelial cells of different origin,
such as microvascular endothelial cells from adult dermis
(HMVEDad) and human aortic endothelial cells (HAEC),
showed the same pattern of gene modulation after exposure
to deguelin (Figure 5D), except that HAEC did not express
p21. Conversely, rapidly growing cells such as the leukemia
cell lines K562 and U937 responded to deguelin with a
strong growth inhibition associated with apoptosis (data not
shown), while expression patterns of survivin, p21 and p53
varied widely in these cells (Figure 5E). As previously noted
the U937 cells did not express p53.
Deguelin inhibits NF-kB translocation, activation and
expression of Interleukin 8. Activated Akt regulates NF-kB
activation (29,30) and cell survival. Blockade of NF-kB is
associated with suppression of metalloproteinase production,
angiogenesis, invasion and metastasis (31). As deguelin was
able to inhibit invasion and angiogenesis induced by a
cocktail containing VEGF and TNF-a (an angiogenic
cytokine known to induce activation and translocation of
NF-kB to the nucleus), and repressed MMP-2 production, we
examined whether deguelin could affect NF-kB activation.
Inactive NF-kB consists of a heterotrimer composed by the
p50 and p65 subunits together with the protein IkBa. The
phosphorylation, ubiquitination and degradation of IkBa
releases the p50–p65 heterodimer which translocates to the
nucleus to induce specific gene expression. ELISA for
activated NF-kB showed constitutively active levels in
HUVE cells, similar to the positive control Jurkat nuclear
extracts. A 6-h exposure to 100 nM deguelin significantly
decreased the basal NF-kB activity (Figure 6A, P ¼ 0.019,
two-tailed t-test). As expected, treatment of HUVE cells for 5
and 15 min with 10 ng/ml TNF-a produced a strong NF-kB
activation. Preincubation for 6 h in the presence of 100 nM
deguelin significantly inhibited this TNF-a induced NF-kB
activation (Figure 6A, P < 0.01, two-tailed t-test). Western
blot analysis confirmed that deguelin significantly repressed
the levels of nuclear phosphorylated p65 (Figure 6B), as well
as the levels of cytosolic phosphorylated IkBa (Figure 6B)
present in HUVE cells after stimulation with TNF-a. These
data indicate an inhibitory activity at or up-stream of the
protein kinase IKK, which phosphorylates IkBa, suggesting
that deguelin is able to interfere with the signaling pathways
leading to NF-kB activation.
IL-8 is a chemoattractant cytokine that can directly
enhance endothelial cell survival, proliferation and MMP
production (32) and possesses a promoter region containing
binding sites for NF-kB. We therefore tested whether
deguelin, by modulating NF-kB activity, could also regulate
IL-8 production. Conditioned media were collected from
HUVE cells treated 16 and 24 h with 25–100 nM deguelin
and analyzed by for IL-8 content ELISA. Deguelin, after 16 h
of treatment, significantly decreased IL-8 secretion
(Figure 6C; P < 0.001, two-tailed, t-test).
Discussion
Recent gains in the knowledge of endothelial cell physiology
and tumor angiogenesis are providing the necessary background to develop ever more effective anti-angiogenic
strategies for cancer therapy. Identification of new pharmacologically active compounds of natural origin and identification of their molecular mechanisms are opening new
perspectives in preventive oncology. The chemopreventive
rotenoid, deguelin, has been observed to inhibit tumor cell
growth in vitro through inhibition of Akt (11), as well as
repressing tumor growth in vivo (4,5). The serine-threonine
kinase Akt is a down-stream target of PI3K and both have
been implicated in a number of cellular functions including
cell adhesion, protein synthesis and cell survival (33).
Constitutively active PI3K and Akt signaling also induce
angiogenesis (34). The central finding of the present study is
that deguelin exhibits pleiotropic anti-angiogenic effects: in
addition to inhibiting Akt in endothelial cells, it negatively
regulates endothelial cell NF-kB activity both at the basal
level and in the presence of specific stimuli such as TNF-a.
Similar to the repression of Akt-ser473 phosphorylation,
409
R.Dell’Eva et al.
Fig. 5. Effects of deguelin on Akt activation and p21, p53 and survivin mRNAs and protein expression. (A) Western blot analysis demonstrating deguelin
repression of basal levels of phosphorylated Akt (Ser473) in HUVE cells. (B, D and E) Real-time reverse transcription–PCR for p21, p53 and survivin expression
in HUVEC (B), HMVECad and HAEC (D) and K562 and U937 leukemia cells (E). Deguelin modulates in a time-dependent manner all the three regulators of
cell-cycle progression. Amplification products were measured during the reaction, and mean normalized expression values were calculated by comparison with
the housekeeping gene glyceraldehyde-3-phosphate-dehydrogenase amplified in parallel. All amplifications were done in triplicate (P < 0.05, P < 0.01,
P < 0.001 , two-tailed t-test). (C) p21, p53 and survivin immunoblotting analyses of cytoplasmic and nuclear lysates from deguelin-treated HUVE cells.
Results strongly confirm real-time PCR data, and show different distribution of p21 upon deguelin exposure.
deguelin inhibition of NF-kB DNA binding activity was
accompanied by decreased phosphorylation of both p65 and
IkBa. Down-stream effects of these activities appear to be a
G1 arrest involving up-regulation of p21 and p53 and downregulation of survivin, but protection from apotosis. Consistent with these biochemical observations, deguelin inhibited
multiple properties associated with angiogenesis, including
endothelial cell migration, invasion, MMP-2 activity and IL8 secretion in vitro. While any one individual effect of
deguelin might not be sufficient for inhibition of angiogenesis, summed together they appear to produce the potent antiangiogenic effect observed on angiogenesis and vascular
tumor growth in vivo.
NF-kB is a target of Akt in anti-apoptotic signaling (35),
as NF-kB activation by TNF-a requires the Akt serinetheonine kinase (29). Targeting PI3K–Akt as well as NF-kB
may be potential mechanisms to control endothelial cell
growth and inhibit angiogenesis, as demonstrated by effects
similar to that observed with deguelin obtained with silibinin
(36) or xanthohumol (20). On stimulation by growth factors,
Akt detaches from the inner surface of the plasma membrane
and re-localizes to the nucleus, suggesting that Akt targets
may be also located in the nucleus. In this context, Akt has
been shown to influence the cellular localization and
functions of p21, which induces cell growth arrest by
inhibiting the functions of cyclin-dependent kinases in the
nucleus (26). p21 can also localize to the cell cytoplasm
where it was associated with anti-apoptotic activity (37). The
410
underlying mechanisms of Akt regulation of p21 activity
includes Akt association with and phosphorylation of p21 on
a consensus threonine residue (Thr145) in the nuclear
localization signal, leading to cytoplasmic localization (38).
Conversely, inhibition of Akt suppresses cell growth in a
manner that correlates with the nuclear localization of p21.
These observations well correlate with our results: under
basal conditions, where HUVE cells show constitutively
active Akt, p21 is distributed both in the cytoplasm and the
nucleus. Upon exposure to deguelin there was almost no
basal Akt activity, p21 disappeared from the cytoplasm and
was detected only at the nuclear level. Previous studies
suggest that the PI3K/Akt pathway can influence cell growth
by delaying the onset of p53-induced apoptosis (27) as Akt,
via IKK, induces nuclear translocation of the survival protein
NF-kB and targets the tumor suppressor gene p53 for
degradation by the proteasome (39). Moreover PI3K/Akt
inhibitors up-regulate p53 and block tumor-induced angiogenesis by acting on the tumor and endothelial compartment
as well (40). In this context, the tumor suppressor protein p53
can induce either growth arrest or apoptosis and the blockade
of the Akt pathway, through enhanced expression of p53, can
increase the cytotoxic effect of DNA-damaging drugs in
tumor cells (41). In normal cells, such as endothelial cells,
the p53-induced G1 cell-cycle arrest is also mediated by its
down-stream target p21 (42,43) as p53 binding in vivo to
consensus sites in the p21 promoter was described previously
(44). The strong increase in nuclear p53 protein we observed
Deguelin inhibition of angiogenesis
Fig. 6. The effects of deguelin on NF-kB activation. (A) ELISA analysis demonstrated that treatment with deguelin reduced the amount of active NF-kB
both in control and TNF-a (10 ng/ml) stimulated cells. Means ± SEM are shown (P < 0.05, P < 0.01 with respect to control, two-tailed t-test).
(B) Western blot analysis shows that deguelin repressed nuclear phosphorylated p65 and cytosolic IkBa levels in HUVE cells after stimulation with TNF-a.
The inhibition was evident soon after stimulation. (C) IL-8 protein in the culture supernatants determined by ELISA was expressed as ng/ml/16 h.
Deguelin suppressed IL-8 protein production; means ± SEM are shown (P < 0.01, P < 0.001, two-tailed t-test).
Fig. 7. Model of deguelin activities. Cell proliferation, angiogenesis/
inflammation, invasion and migration are mediated by Akt/NF-kB signaling
in endothelial cells. The constitutive activation of AKT (left side), along with
other signals, induces the constitutive activation of NF-kB. Deguelin
(right side), by repressing the AKT and NF-kB pathways, showed pleiotropic
anti-angiogenic effects. Activation of each of the components is indicated
in boldface.
after deguelin treatment, likely due to Akt inactivation, could
also contribute to up-regulation of the p21 protein.
A productive angiogenic response must couple to the
survival machinery of endothelial cells to preserve the
integrity of newly formed vessels. Activation of the survival
serine-threonine kinase Akt and NF-kB are associated with
up-regulation of the apoptosis inhibitor survivin as seen in
many tumors (45). Survivin plays an important role in cellcycle control (45), protects endothelial cells from the deathinducing stimuli (28) and its up-regulation, by preserving the
microtubule network, has been proposed as a mechanism
for endothelial cell drug ‘resistance’ (46). Tumor cell
survivin expression has been correlated with angiogenic
potential, here we extend this observation to endothelial cells,
as previously suggested (36). Survivin is up-regulated in
endothelial cells in response to VEGF (46,47) and survivin
vaccination has been found to inhibit angiogenesis (48),
suggesting a direct role for survivin in angiogenesis. As the
human SURVIVIN gene is negatively regulated by wild-type
p53 (49) at both mRNA and protein levels, the decreased
NF-kB and Akt activities associated with p53 induction
we observed in deguelin-treated endothelial cells may explain
the almost complete disappearance of survivin mRNA
and protein. The down-regulation of survivin by deguelin
was not associated with increased endothelial cell death,
but actually seemed to protect endothelial cells from
apoptosis. This is similar to that observed for other
angioprevention agents that also act on NF-kB (50), such as
NAC (51) and epigallocatechingallate (EGCG) (52). Similarly, EGCG is known to induce tumor cell apoptosis, but to
spare normal cells, the mechanism of this phenomenon
appears to be related to the ‘oncogene addiction’ paradigm,
where transformed cells show increased sensitivity to agents
411
R.Dell’Eva et al.
interrupting signal transduction as compared with normal
cells (53).
While NF-kB activity correlates with angiogenesis (54), its
blockade is associated with suppression of angiogenesis (31).
The NF-kB family of transcription factors, besides participating in the regulation of numerous genes required for cell
growth, survival and invasion, is also a pro-inflammatory
transcription factor that could promote tumorigenesis (55).
Inflammation-dependent angiogenesis appears to be a central
force in tumor growth and expansion (56) a concept
reinforced by evidence that inflammation inhibition prevents
angiogenesis (56). In our model system, endothelial cells
exposed to deguelin showed decreased levels of activated
NF-kB as compared with control cells, but, even more
interestingly deguelin was able to counteract the effects of
the pro-inflammatory cytokine TNF-a by inhibiting IkBa
and p65 phosphorylation and therefore NF-kB nuclear
translocation. These data indicate that deguelin interferes
with signaling events at or up-stream of IkBa and that it may
also harbor anti-inflammatory activities. These observations
are further strengthened by the inhibition of in vivo
angiogenesis generated by TNF-a. Together with the
histological analyses these data suggest deguelin has antiinflammatory properties as well. Interestingly, it has also
been associated with inhibition of COX-2 expression (10),
further suggesting repression of angiogenesis (57) and
inflammation.
Angiogenesis is also associated with expression of IL-8
(58,59). Since IL-8 is transcriptionally regulated by NF-kB
and inhibited by deguelin, one mechanism whereby deguelin
may function as an anti-angiogenic factor is through the
suppression of NF-kB regulated expression of IL-8 and
potentially other angiogenic factors. Besides being a proangiogenic agent, IL-8 has been identified as a modulator of
collagenase secretion (60) and IL-8 decreased secretion could
also explain the decreased MMP-2 production that may
contribute to reduced invasion upon deguelin treatment.
In summary, the pleiotropic anti-angiogenic effects of
deguelin observed in vivo involve growth inhibition associated with cell-cycle arrest and reduced cell migration and
invasion of endothelial cells. The associated molecular events
are down-regulation of the Akt and NF-kB survival signaling
pathways, as shown in Figure 7, resulting in modulation of
key regulators including p21, p53 and survivin. Deguelin has
been proposed as a chemopreventive agent in skin (5) and
lung (4) carcinogenesis. Its anti-angiogenic properties documented here suggest that this rotenoid could be a broad
spectrum chemopreventive compound since angiogenesis is
necessary for progression in the majority of tumors, and
provide a rationale for possible use of deguelin as an
angiopreventive/anti-angiogenic molecule.
Acknowledgements
We thank Dr U. Pfeffer for helpful discussion, A. Rapetti for administrative
assistance and T. Baffi for data management. This work was supported
by grants from the Associazione Italiana per la Ricerca sul Cancro, Istituto
Superiore di Sanità Progetto AIDS, Ministero della Salute Progetto
Finalizzato, Ministero dell’Istruzione, dell’Università e della Ricerca Progetto
Strategico and Progetto Fondo per gli Investimenti della Ricerca di Base and
the Compagnia di San Paolo. C. Ambrosini is a FIRC fellowship recipient.
Conflict of Interest Statement: None declared.
412
References
1. Kelloff,G.J., Crowell,J.A., Steele,V.E. et al. (2000) Progress in cancer
chemoprevention: development of diet-derived chemopreventive agents.
J. Nutr., 130, 467S–471S.
2. Pezzuto,J.M. (1997) Plant-derived anticancer agents. Biochem.
Pharmacol., 53, 121–133.
3. Gerhauser,C., Mar,W., Lee,S.K., Suh,N., Luo,Y., Kosmeder,J.,
Luyengi,L., Fong,H.H., Kinghorn,A.D., Moriarty,R.M. et al. (1995)
Rotenoids mediate potent cancer chemopreventive activity through
transcriptional regulation of ornithine decarboxylase. Nat. Med., 1,
260–266.
4. Lee,H.Y., Oh,S.H., Woo,J.K. et al. (2005) Chemopreventive effects of
deguelin, a novel Akt inhibitor, on tobacco-induced lung tumorigenesis.
J. Natl Cancer Inst., 97, 1695–1699.
5. Udeani,G.O., Gerhauser,C., Thomas,C.F., Moon,R.C., Kosmeder,J.W.,
Kinghorn,A.D., Moriarty,R.M. and Pezzuto,J.M. (1997) Cancer
chemopreventive activity mediated by deguelin, a naturally occurring
rotenoid. Cancer Res., 57, 3424–3428.
6. Murillo,G., Kosmeder,J.W.II, Pezzuto,J.M. and Mehta,R.G. (2003)
Deguelin suppresses the formation of carcinogen-induced aberrant crypt
foci in the colon of CF-1 mice. Int. J. Cancer, 104, 7–11.
7. Gerhauser,C., Lee,S.K., Kosmeder,J.W., Moriarty,R.M., Hamel,E.,
Mehta,R.G., Moon,R.C. and Pezzuto,J.M. (1997) Regulation of
ornithine decarboxylase induction by deguelin, a natural product cancer
chemopreventive agent. Cancer Res., 57, 3429–3435.
8. Murillo,G., Salti,G.I., Kosmeder,J.W.II, Pezzuto,J.M. and Mehta,R.G.
(2002) Deguelin inhibits the growth of colon cancer cells through the
induction of apoptosis and cell cycle arrest. Eur. J. Cancer, 38,
2446–2454.
9. Hail,N.Jr and Lotan,R. (2004) Apoptosis induction by the natural product
cancer chemopreventive agent deguelin is mediated through the inhibition
of mitochondrial bioenergetics. Apoptosis, 9, 437–447.
10. Lee,H.Y., Suh,Y.A., Kosmeder,J.W., Pezzuto,J.M., Hong,W.K. and
Kurie,J.M. (2004) Deguelin-induced inhibition of cyclooxygenase-2
expression in human bronchial epithelial cells. Clin. Cancer Res., 10,
1074–1079.
11. Chun,K.H., Kosmeder,J.W.II, Sun,S., Pezzuto,J.M., Lotan,R., Hong,W.K.
and Lee,H.Y. (2003) Effects of deguelin on the phosphatidylinositol
3-kinase/Akt pathway and apoptosis in premalignant human bronchial
epithelial cells. J. Natl Cancer Inst., 95, 291–302.
12. Tosetti,F.,
Ferrari,N.,
De
Flora,S.
and
Albini,A.
(2002)
‘Angioprevention’: angiogenesis is a common and key target for cancer
chemopreventive agents. FASEB J., 16, 2–14.
13. Jones,M.K., Wang,H., Peskar,B.M., Levin,E., Itani,R.M., Sarfeh,I.J. and
Tarnawski,A.S. (1999) Inhibition of angiogenesis by nonsteroidal antiinflammatory drugs: insight into mechanisms and implications for cancer
growth and ulcer healing. Nat. Med., 5, 1418–1423.
14. Cai,T., Fassina,G., Morini,M., Aluigi,M., Masiello,L., Fontanini,G.,
D’Agostini,F., DeFlora,S., Noonan,D. and Albini,A. (1999)
N-acetylcysteine inhibits endothelial cell invasion and angiogenesis.
Lab. Invest., 79, 1151–1159.
15. Garbisa,S., Biggin,S., Cavallarin,N., Sartor,L., Benelli,R. and Albini,A.
(1999) Tumor invasion: molecular shears blunted by green tea. Nat. Med.,
5, 1216.
16. Pages,G., Milanini,J., Richard,D.E., Berra,E., Gothie,E., Vinals,F. and
Pouyssegur,J. (2000) Signaling angiogenesis via p42/p44 MAP kinase
cascade. Ann. NY Acad. Sci., 902, 187–200.
17. Shiojima,I. and Walsh,K. (2002) Role of Akt signaling in vascular
homeostasis and angiogenesis. Circ. Res., 90, 1243–1250.
18. Ackah,E., Yu,J., Zoellner,S. et al. (2005) Akt1/protein kinase Balpha is
critical for ischemic and VEGF-mediated angiogenesis. J. Clin. Invest.,
115, 2119–2127.
19. Chen,J., Somanath,P.R., Razorenova,O., Chen,W.S., Hay,N., Bornstein,P.
and Byzova,T.V. (2005) Akt1 regulates pathological angiogenesis,
vascular maturation and permeability in vivo. Nat. Med., 11, 1188–1196.
20. Albini,A., Dell’eva,R., Vene,R., Ferrari,N., Buhler,D.R., Noonan,D.M.
and Fassina,G. (2005) Mechanisms of the antiangiogenic activity by the
hop flavonoid xanthohumol: NF-kB and Akt as targets. FASEB J., 20,
527–529.
21. Albini,A., Paglieri,I., Orengo,G. et al. (1997) The beta-core fragment of
human Chorionic Gonadotrophin (hCG) inhibits growth of Kaposi’s
sarcoma-derived cells and a new immortalized Kaposi’s sarcoma cell line.
AIDS, 11, 713–721.
22. Albini,A., Iwamoto,Y., Kleinman,H.K., Martin,G.R., Aaronson,S.A.,
Kozlowski,J.M. and McEwan,R.N. (1987) A rapid in vitro assay for
Deguelin inhibition of angiogenesis
quantitating the invasive potential of tumor cells. Cancer Res., 47,
3239–3245.
23. Albini,A., D’Agostini,F., Giunciuglio,D., Paglieri,I., Balansky,R.M. and
De Flora,S. (1995) Inhibition of invasion, gelatinase activity, tumor take
and metastasis of malignant cells by N-acetylcysteine. Int. J. Cancer, 61,
121–129.
24. Albini,A., Fontanini,G., Masiello,L., Tacchetti,C., Bigini,D., Luzzi,P.,
Noonan,D.M. and Stetler-Stevenson,W.G. (1994) Angiogenic potential
in vivo by Kaposi sarcoma cell-free supernatants and HIV1-tat product:
inhibition of KS-like lesions by TIMP-2. AIDS, 8, 1237–1244.
25. Muller,P.Y., Janovjak,H., Miserez,A.R. and Dobbie,Z. (2002) Processing
of gene expression data generated by quantitative real-time RT–PCR.
Biotechniques, 32, 1372–1374, 1376, 1378–1379.
26. Harper,J.W., Adami,G.R., Wei,N., Keyomarsi,K. and Elledge,S.J. (1993)
The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclindependent kinases. Cell, 75, 805–816.
27. Kumar,R. and Hung,M.C. (2005) Signaling intricacies take center stage in
cancer cells. Cancer Res., 65, 2511–2515.
28. Papapetropoulos,A., Fulton,D., Mahboubi,K., Kalb,R.G., O’Connor,D.S.,
Li,F., Altieri,D.C. and Sessa,W.C. (2000) Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J. Biol. Chem., 275,
9102–9105.
29. Ozes,O.N., Mayo,L.D., Gustin,J.A., Pfeffer,S.R., Pfeffer,L.M. and
Donner,D.B. (1999) NF-kappaB activation by tumour necrosis factor
requires the Akt serine-threonine kinase. Nature, 401, 82–85.
30. Jeong,S.J., Pise-Masison,C.A., Radonovich,M.F., Park,H.U. and
Brady,J.N. (2005) Activated AKT regulates NF-kappaB activation, p53
inhibition and cell survival in HTLV-1-transformed cells. Oncogene, 24,
6719–6728.
31. Huang,S., Pettaway,C.A., Uehara,H., Bucana,C.D. and Fidler,I.J. (2001)
Blockade of NF-kappaB activity in human prostate cancer cells is
associated with suppression of angiogenesis, invasion, and metastasis.
Oncogene, 20, 4188–4197.
32. Li,A., Dubey,S., Varney,M.L., Dave,B.J. and Singh,R.K. (2003) IL-8
directly enhanced endothelial cell survival, proliferation, and matrix
metalloproteinases production and regulated angiogenesis. J. Immunol.,
170, 3369–3376.
33. Toker,A. and Cantley,L.C. (1997) Signalling through the lipid products
of phosphoinositide-3-OH kinase. Nature, 387, 673–676.
34. Jiang,B.H.,
Zheng,J.Z.,
Aoki,M.
and
Vogt,P.K.
(2000)
Phosphatidylinositol 3-kinase signaling mediates angiogenesis and
expression of vascular endothelial growth factor in endothelial cells.
Proc. Natl Acad. Sci. USA, 97, 1749–1753.
35. Romashkova,J.A. and Makarov,S.S. (1999) NF-kappaB is a target of AKT
in anti-apoptotic PDGF signalling. Nature, 401, 86–90.
36. Singh,R.P., Dhanalakshmi,S., Agarwal,C. and Agarwal,R. (2005) Silibinin
strongly inhibits growth and survival of human endothelial cells via cell
cycle arrest and downregulation of survivin, Akt and NF-kappaB:
implications for angioprevention and antiangiogenic therapy. Oncogene,
24, 1188–1202.
37. Vivanco,I. and Sawyers,C.L. (2002) The phosphatidylinositol 3-Kinase
AKT pathway in human cancer. Nat. Rev. Cancer, 2, 489–501.
38. Zhou,B.P., Liao,Y., Xia,W., Spohn,B., Lee,M.H. and Hung,M.C. (2001)
Cytoplasmic localization of p21Cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat. Cell Biol., 3, 245–252.
39. Mayo,L.D. and Donner,D.B. (2001) A phosphatidylinositol 3-kinase/Akt
pathway promotes translocation of Mdm2 from the cytoplasm to the
nucleus. Proc. Natl Acad. Sci. USA, 98, 11598–11603.
40. Su,J.D., Mayo,L.D., Donner,D.B. and Durden,D.L. (2003) PTEN and
phosphatidylinositol 3’-kinase inhibitors up-regulate p53 and block tumorinduced angiogenesis: evidence for an effect on the tumor and endothelial
compartment. Cancer Res., 63, 3585–3592.
41. Zhou,B.P., Liao,Y., Xia,W., Zou,Y., Spohn,B. and Hung,M.C. (2001)
HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2
phosphorylation. Nat. Cell Biol, 3, 973–982.
42. el-Deiry,W.S., Harper,J.W., O’Connor,P.M. et al. (1994) WAF1/CIP1 is
induced in p53-mediated G1 arrest and apoptosis. Cancer Res., 54,
1169–1174.
43. el-Deiry,W.S., Tokino,T., Velculescu,V.E., Levy,D.B., Parsons,R.,
Trent,J.M., Lin,D., Mercer,W.E., Kinzler,K.W. and Vogelstein,B. (1993)
WAF1, a potential mediator of p53 tumor suppression. Cell, 75,
817–825.
44. Szak,S.T., Mays,D. and Pietenpol,J.A. (2001) Kinetics of p53 binding to
promoter sites in vivo. Mol. Cell. Biol., 21, 3375–3386.
45. Reed,J.C. (2001) The Survivin saga goes in vivo. J. Clin. Invest., 108,
965–969.
46. Tran,J., Master,Z., Yu,J.L., Rak,J., Dumont,D.J. and Kerbel,R.S. (2002)
A role for survivin in chemoresistance of endothelial cells mediated by
VEGF. Proc. Natl Acad. Sci. USA, 99, 4349–4354.
47. O’Connor,D.S., Schechner,J.S., Adida,C., Mesri,M., Rothermel,A.L.,
Li,F., Nath,A.K., Pober,J.S. and Altieri,D.C. (2000) Control of apoptosis
during angiogenesis by survivin expression in endothelial cells. Am. J.
Pathol., 156, 393–398.
48. Xiang,R., Mizutani,N., Luo,Y., Chiodoni,C., Zhou,H., Mizutani,M.,
Ba,Y., Becker,J.C. and Reisfeld,R.A. (2005) A DNA vaccine targeting
survivin combines apoptosis with suppression of angiogenesis in lung
tumor eradication. Cancer Res., 65, 553–561.
49. Mirza,A., McGuirk,M., Hockenberry,T.N. et al. (2002) Human survivin is
negatively regulated by wild-type p53 and participates in p53-dependent
apoptotic pathway. Oncogene, 21, 2613–2622.
50. Pfeffer,U.,
Ferrari,N.,
Dell’eva,R.,
Indraccolo,S.,
Morini,M.,
Noonan,D.M. and Albini,A. (2005) Molecular mechanisms of action of
angiopreventive anti-oxidants on endothelial cells: microarray gene
expression analyses. Mutat. Res., 591, 198–211.
51. Aluigi,M.G., De Flora,S., D’Agostini,F., Albini,A. and Fassina,G. (2000)
Antiapoptotic and antigenotoxic effects of N-acetylcysteine in human cells
of endothelial origin. Anticancer Res, 20, 3183–3187.
52. Fassina,G., Vene,R., Morini,M., Minghelli,S., Benelli,R., Noonan,D.M.
and Albini,A. (2004) Mechanisms of inhibition of tumor angiogenesis and
vascular tumor growth by epigallocatechin-3-gallate. Clin. Cancer Res.,
10, 4865–4873.
53. Troussard,A.A., McDonald,P.C., Wederell,E.D. et al. (2006) Preferential
dependence of breast cancer cells versus normal cells on integrin-linked
kinase for protein kinase B/Akt activation and cell survival. Cancer Res.,
66, 393–403.
54. Huang,S., DeGuzman,A., Bucana,C.D. and Fidler,I.J. (2000) Nuclear
factor-kappaB activity correlates with growth, angiogenesis, and
metastasis of human melanoma cells in nude mice. Clin. Cancer Res.,
6, 2573–2581.
55. Aggarwal,B.B. (2004) Nuclear factor-kappaB: the enemy within. Cancer
Cell, 6, 203–208.
56. Albini,A., Tosetti,F., Benelli,R. and Noonan,D.M. (2005) Tumor
inflammatory angiogenesis and its chemoprevention. Cancer Res., 65,
10637–10641.
57. Albini,A. and Noonan,D.M. (2005) Rescuing COX-2 inhibitors from the
waste bin. J. Natl. Cancer Inst., 97, 859–860.
58. Yoshida,S., Ono,M., Shono,T., Izumi,H., Ishibashi,T., Suzuki,H. and
Kuwano,M. (1997) Involvement of interleukin-8, vascular endothelial
growth factor, and basic fibroblast growth factor in tumor necrosis factor
alpha-dependent angiogenesis. Mol. Cell. Biol., 17, 4015–4023.
59. Koch,A.E., Polverini,P.J., Kunkel,S.L., Harlow,L.A., DiPietro,L.A.,
Elner,V.M., Elner,S.G. and Strieter,R.M. (1992) Interleukin-8 as a
macrophage-derived mediator of angiogenesis. Science, 258,
1798–1801.
60. Luca,M., Huang,S., Gershenwald,J.E., Singh,R.K., Reich,R. and
Bar-Eli,M. (1997) Expression of interleukin-8 by human melanoma
cells up-regulates MMP-2 activity and increases tumor growth and
metastasis. Am. J. Pathol., 151, 1105–1113.
Received February 1, 2006; revised July 25, 2006; accepted August 13, 2006
413