Journal of Medical Microbiology (2006), 55, 1549–1557 DOI 10.1099/jmm.0.46779-0 An improved multiple-locus variable number of tandem repeats analysis for Leptospira interrogans serovar Australis: a comparison with fluorescent amplified fragment length polymorphism analysis and its use to redefine the molecular epidemiology of this serovar in Queensland, Australia Andrew Slack, Meegan Symonds, Michael Dohnt and Lee Smythe Correspondence Andrew Slack [email protected] Received 13 June 2006 Accepted 27 July 2006 WHO/FAO/OIE Collaborating Centre for Reference and Research on Leptospirosis, Western Pacific Region, Centre for Public Health Sciences, Queensland Health Scientific Services, Brisbane, Australia In this study, an improved multiple-locus variable number of tandem repeats analysis (MLVA) method based upon a previously published method is described. Improvements to the method included redesigned primers and PCR conditions, combined with pooled capillary electrophoresis using multicolored dyes. Allele sizes were converted into an allele string, and each unique allele string was assigned a numerical MLVA type (MVT). The improved MLVA method was then applied to 96 previously characterized Leptospira interrogans serovar Australis isolates from human and animal sources. The improved MLVA was found to have between six and 13 alleles at each locus, compared with three to eight in the original. The mean Hunter–Gaston diversity index (HGDI) for the improved MLVA method was 0?654, compared with 0?599 in the original; this increase in diversity was largely due to changes in the analysis of the variable number of tandem repeat (VNTR) data. When the improved MLVA method was compared with the fluorescent amplified fragment length polymorphism (FAFLP) method, there was a high level of concordance between the profiles; however, the MLVA method produced an additional four unique profiles amongst the subset of 30 isolates tested. Given that the improved MLVA method was found to be superior to the original MLVA method, it was subsequently used to redefine the molecular epidemiology of L. interrogans serovar Australis in Queensland, Australia. Using cluster analysis, the authors were able to demonstrate clonal links amongst rodent isolates, rodent and human isolates, and rodent and canine isolates. These results highlight the role of rodents in the disease, and also the potential role of MLVA in defining the molecular epidemiology of L. interrogans. INTRODUCTION Leptospira interrogans is one of the causative agents of the disease leptospirosis. Leptospirosis is considered an emerging zoonotic disease with a worldwide distribution [Bharti et al., 2003; World Health Organization (WHO), 1999]. Molecular investigations into the epidemiology of Leptospira infections are important to determine whether an outbreak caused by a clonal source has occurred, and which Abbreviations: FAFLP, fluorescent amplified fragment length polymorphism; FAM, 6-carboxyfluorescein; HEX, 6-hexachlorofluorescein; HGDI, Hunter–Gaston diversity index; Ia, index of association; MLVA, multiple-locus variable number of tandem repeats analysis; MLST, multilocus sequence typing; MST, minimum spanning tree; MVT, MLVA type; NED, 2,7,8-benzo-5-fluoro-2,4,7-trichloro-5-carboxyfluorescein; SLV, single-locus variant; VNTR, variable number of tandem repeat. 46779 G 2006 SGM species of animal is the vector of the disease (Slack et al., 2005). Various molecular techniques have been described for studying the molecular epidemiology of Leptospira, including PFGE, and randomly amplified polymorphic DNA (RAPD) and fluorescent amplified fragment length polymorphism (FAFLP) analysis. All of these methods suffer from significant drawbacks, including low discriminatory power, poor reproducibility, and the high level of technical skill required to perform the method. As an alternative to these methods we have developed a multiple locus variable number of tandem repeats analysis (MLVA) based upon agarose gel electrophoresis. Whilst this method fulfils the aim of producing a technically simple method that is reproducible and suitable for any laboratory with the bare minimum of equipment, it does have several drawbacks, Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 Printed in Great Britain 1549 A. Slack and others Table 1. Primers and PCR conditions used in the L. interrogans MLVA method Locus V27 V29 V30 V36 V50 Forward primer Reverse primer HEX–AAGTTCGTCGGGTGAGC NED–TGGGTGCCGGGTTGT FAM–ATAGGTTCGGCGTTTAGTA HEX–TGGCGTCGAAGACAAA NED–CTTGTTGGATCACAATACGAACTATA TGATTTCTTTCGGTGGC ATGCCACATCTCATCCATTAC TTTAGATGTTTCGCTTTGG ACTCTACCAGGAGATTATCAAA GGTAAGGGACAAAGTAAGTGAAGC including a loss of resolution through the use of agarose gel electrophoresis and the rounding of repeats to whole numbers to simplify analysis (Slack et al., 2005). To improve resolution and accuracy in bacterial variable number of tandem repeat (VNTR) methods, capillary electrophoresis has become the preferred methodology, due to the availability of multiple fluorescent labels, and to greater accuracy and reproducibility (Lindstedt et al., 2004a, b; Lista et al., 2006). Whilst capillary electrophoresis is the preferred methodology, the expense of purchasing a DNA sequencer may prevent some laboratories from changing from agarose gel electrophoresis; however, this can be compensated by the other critical improvements to the method, such as the optimized PCR amplification reactions and reaction conditions. To further harness the power of capillary electrophoresis, we utilized pooled PCR products, and used three fluorescent dyes and a commercially available labelled DNA marker, which allowed the sizing of fragments of up to 1000 bp. The analysis of the MLVA data was also improved by using an allele designation system proven in several published MLVA articles (Lindstedt et al., 2004a; Whatmore et al., 2006) combined with the assignment of an MLVA type number similar to that used in multilocus sequence typing (MLST) experiments. To ascertain the effects of these changes, we applied the improved MLVA method to the L. interrogans serovar Australis strains that had been previously characterized by the original MLVA method, and present in this study a redefined epidemiological model of this serovar in Queensland, Australia. Furthermore, in this research, we established the relative value of the MLVA method as an epidemiological tool by comparing it with a previously published FAFLP method, using a subset of the L. interrogans serovar Australis isolates. METHODS L. interrogans serovar Australis strains. A total of 96 isolates of L. interrogans serovar Australis were obtained from the culture collection housed at the WHO/FAO/OIE Collaborating Centre for Reference and Research on Leptospirosis. Fifty-seven isolates were from human sources, whilst 39 were from non-human sources, such 1550 PCR conditions Number of cycles Annealing temperature (6C) 25 25 25 33 25 50 50 54 52 58 as rodents, dogs and native Australian animals. All isolates had been previously identified using standard serological methods, including the cross-agglutination absorption test (CAAT). All isolates had been previously characterized by MLVA (Slack et al., 2005). DNA extraction. Leptospira DNA was extracted by the following method: Ellinghausen McCullough Johnson Harris (EMJH) broth (500 ml) containing actively growing leptospires was centrifuged in a microcentrifuge tube at 12 000 g for 4 min. The supernatant was removed and the pellet resuspended in 200 ml PBS. This suspension was then extracted using the High Pure PCR Template Preparation kit (Roche) as per the manufacturer’s instructions. MLVA analysis. The VNTR loci used in this method have been previously described (Slack et al., 2005); however, the primers were redesigned to prevent the spurious PCR products that were evident in the previous version of the method. The primers were synthesized by Invitrogen or Applied Biosystems, and the 59 end of the forward primers was labelled with the fluorophores 6-carboxyfluorescein (FAM), 2,7,8-benzo-5-fluoro-2,4,7-trichloro-5-carboxyfluorescein (NED) or 6-hexachlorofluorescein (HEX) (Table 1). PCR amplification was performed in 25 ml final volumes. All reactions contained 16 PCR buffer, 2 mM MgCl2, 200 mM dNTPs, 12?5 pmol forward and reverse primer (Table 1), 1 U AmpliTaq Gold (Applied Biosystems), 2?0 ml template DNA, and double-distilled water (ddH2O) to make up the final volume. The PCR reactions were run on a PE9700 thermal cycler (Applied Biosystems) using the following conditions: 95 uC for 10 min, varying cycles of 94 uC for 30 s, annealing at varying temperatures (refer to Table 1) for 30 s, and extension at 72 uC for 1 min. The high-stringency conditions combined with the use of minimal thermal cycling prevented the formation of spurious PCR products that could interfere with the subsequent fragment sizing. Five microlitres of the PCR products from loci V27, V29 and V30 were pooled in a microcentrifuge tube, as were the products from V36 and V50. Both pooled PCR mixes were further diluted with 100 ml ddH2O, and 3 ml of each pooled PCR product was combined with 21?5 ml HiDi formamide (Applied Biosystems) and 0?5 ml X-rhodamine MapMarker 1000 XL (BioVenture). The samples were denatured at 95 uC for 5 min and cooled rapidly to 4 uC before being loaded onto the ABI 310 capillary sequencer (Applied Biosystems). Electrophoresis was performed using a 47 cm capillary filled with performance-optimized polymer 4 (Applied Biosystems) at 60 uC for 45 min with a running voltage of 15 kV, and an injection time of 10 s at an injection voltage of 15 kV. Each VNTR locus could be identified by colour and assigned a size by the GENESCAN software (Applied Biosystems). This size was then converted into an allele designation, as shown in Table 2, which in turn formed the allele string for the five loci. The allele string was Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 Journal of Medical Microbiology 55 Epidemiology of L. interrogans serovar Australis Table 2. Allele designation for L. interrogans serovar Australis Allele designation 1 2 3 4 5 6 7 8 9 10 11 12 13 Improvements to the published MLVA method Size (bp) of: V27 V29 V30 V36 V50 317 363 367 414 644 818 2 2 2 2 2 2 2 415 744 791 651 464 840 697 701 774 607 2 2 2 583 722 676 532 630 475 576 555 2 2 2 2 2 746 709 532 593 796 737 758 643 695 500 658 2 2 491 583 480 796 537 396 345 632 465 531 486 445 404 constructed in the following order: V27-V29-V30-V36-V50. Each unique allele string was given a unique MLVA type (MVT) number, using a process similar to that used in MLST experiments (Fig. 1). FAFLP analysis. FAFLP analysis was performed as described else- where, using the AFLP Microbial Fingerprinting kit (Applied Biosystems) (Vijayachari et al., 2004). One microlitre of the six selective PCR products generated by the kit was mixed with 23 ml HiDi formamide and 1 ml Geneflo-625 (CHIMERx), and denatured at 95 uC for 5 min. The products were then loaded onto the ABI 310 instrument, and injected into a 47 cm capillary filled with performance-optimized polymer 4 at 15 kV for 12 s. The fragments were separated at 13 kV for 35 min. The resulting electropherograms were manipulated using the Genotyper version 2.5 software (Applied Biosystems), and the combined allele sizes were exported into an Excel spreadsheet. An Excel macro described elsewhere (Rinehart, 2004) was used to convert the alleles into a binary sequence suitable for analysis, using Bionumerics software (Applied Maths). Each unique FAFLP binary pattern was assigned a letter code (e.g. AA, BB, CC) to allow easier referencing of the data. Phylogenetic and statistical data analysis. Phylogenetic analy- sis was performed using Bionumerics version 4.0 (Applied Maths). Dendrograms were constructed using the categorical MLVA combined with the Ward algorithm. Population modelling was performed using the minimum spanning tree (MST) algorithm with the highest number of single-locus variants (SLVs) as the priority rule and the creation of hypothetical types was disabled. The Hunter– Gaston diversity index (HGDI) was calculated as previously described (Hunter & Gaston, 1988), using the VNTR diversity and confidence extractor software (V-DICE) available at the Health Protection Agency bioinformatics tools website (http://www.hpabioinfotools.org.uk/cgi-bin/DICI/DICI.pl). The degree of linkage disequilibrium was determined using the index of association (Ia) using the software available at the MLST website (http://www.mlst.net). Ia is calculated by comparing the observed variance (Vo) in the distribution of allelic mismatches in all pair-wise comparisons of the allelic profiles with that of the expected variance (Ve) in a freely recombining population minus one [Ia=(Vo/Ve)21]. Significant linkage disequilibrium is established if the observed variance in the MLVA allele profiles is greater than the maximum variance observed with 1000 randomized allele profiles (P<0?001) (Smith et al., 1993). http://jmm.sgmjournals.org RESULTS AND DISCUSSION The improved MLVA method incorporated several notable changes from the original MLVA method (Slack et al., 2005). The first change was the redesign of the primers used to amplify the VNTR loci; the original primers for V27-V36 produced spurious products due to partial homology of the primer to the flanking regions of the target sequence. The primers used in this method were redesigned to prevent mispriming and thus produce a single band for each locus. In addition, the V8 locus used in the previous MLVA method (Slack et al., 2005) was not used in this study, as under capillary electrophoresis it produced two alleles in certain strains (A. T. Slack and others, unpublished data). Alhough the changes to the PCR primers and conditions increased the complexity of the method and would make multiplexing the PCR difficult, the priority of this study was to ensure that the correct PCR product could be identified during capillary electrophoresis, with no interference from background or spurious amplification products. To utilize the full potential of the ABI 310 instrument, we pooled the PCR products labelled with three spectrally separate fluorophores (FAM, HEX and NED) and employed filter set D to sort and size the VNTR products. This resulted in clear and interpretable electropherograms for analysis. MapMarker 1000 XL contains 23 single-stranded DNA bands from 50 to 1000 bp, and the use of this marker was critical to the study, given that there is no GENESCAN marker available to size fragments >500 bp. The final improvement to the method was the conversion of VNTR allele sizes into a numerical string that would ultimately be suitable for both the end-user and the analysis software. The method used was adapted from a previously published method (Lindstedt et al., 2004a). Briefly, the fragment sizes were assigned an allele designation as shown in Table 2; this designation was converted into an allele string in the following order: V27-V29-V30-V36-V50. To further simplify this allele string for both the end-user and also for discussion, we assigned an MVT number for every unique allele string present in the dataset, e.g. the allele string 1-1-1-1-1 was designated MVT1. This reduction of the allele string to an MVT brings the method into line with other common typing methods, such as PFGE and MLST, and allows easier interpretation of the result by nonspecialist end-users of the data. Comparison of MLVA data from the improved method with that from the original method When the improved MLVA method was applied to the previously characterized L. interrogans serovar Australis isolates, each VNTR locus was found to have between six (V27) and 13 (V50) different alleles (Table 3). This is an increase in the number of alleles found in the VNTR loci when compared with the original method, which had between three (V27) and eight (V50) alleles. The differences in the number of alleles found in the modified method could Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 1551 A. Slack and others Categorical MLVA _80 _60 _40 _20 0 20 40 80 100 ID A B C Location Year Source MVT Allele string (V27,V29,V30,V36,V50) LT1338 (a) 1552 60 Upper Darradgee 2002 Human 16 1 1 6 1 9 QHR 515 A Innisfail 2003 R. sordidus 17 1 1 7 1 9 LT1063 2000 Human 47 1 1 8 10 3 QHR 581 B Innisfail 2003 Rattus spp. 3 1 1 5 1 1 QHR 581 A Innisfail 2003 Rattus spp. 3 1 1 5 1 1 QHR 527 A Innisfail 2003 Rattus spp. 37 1 1 5 5 5 QHR 544 A Innisfail 2003 R. leucopus 45 1 1 4 9 12 LT1013 Tully 1999 Human 46 2 3 5 9 12 LT1577 Gordonvale 2004 Human 5 1 4 4 1 1 LT1586 Aloomba 2004 Human 5 1 4 4 1 1 LT1059 Cairns 2000 Human 13 1 4 4 1 3 QHR 132 Tully 1999 Rattus spp. 41 1 4 2 7 8 QHR 571 A Innisfail 2003 Rattus spp. 22 1 1 1 2 1 QHR 554 A Innisfail 2003 Rattus spp. 22 1 1 1 2 1 LT1238 2002 Human 34 1 1 2 4 1 QHR 214-2 Innisfail 2002 R. sordidus 19 1 1 1 1 11 QHR 525 B Innisfail 2003 R. leucopus 12 1 1 1 1 3 LT738 Innisfail 1995 Human 1 1 1 1 1 1 LT1068 Innisfail 2000 Human 1 1 1 1 1 1 LT1318 Innisfail 2002 Human 1 1 1 1 1 1 LT1328 South Johnstone 2002 Human 1 1 1 1 1 1 LT1334 Innisfail 2002 Human 1 1 1 1 1 1 LT1336 Innisfail 2002 Human 1 1 1 1 1 1 LT1573 Innisfail 2004 Human 1 1 1 1 1 1 LT1614 Innisfail 2004 Human 1 1 1 1 1 1 QHR 250 Innisfail 2002 R. fuscipes 1 1 1 1 1 1 QHR 253 A Innisfail 2002 R. sordidus 1 1 1 1 1 1 QHR 137 1999 Rattus spp. 1 1 1 1 1 1 QHR 520 A Innisfail 2003 R. lorf 1 1 1 1 1 1 QHR 550 B Innisfail 2003 R. lorf 1 1 1 1 1 1 LT1007 1999 Human 1 1 1 1 1 1 QHR 253 B Innisfail 2002 R. sordidus 1 1 1 1 1 1 QHR 246 2002 R. leucopus 1 1 1 1 1 1 QHR 604 B Innisfail 2003 Rattus spp. 1 1 1 1 1 1 QHR 468 B Unknown 2003 Rattus spp. 1 1 1 1 1 1 QHR 534 B Innisfail 2003 Rattus spp. 1 1 1 1 1 1 QHR 514 A Innisfail 2003 R. sordidus 1 1 1 1 1 1 QHR 534 Innisfail 2003 Rattus spp. 1 1 1 1 1 1 LT1022 Innisfail 1999 Human 1 1 1 1 1 1 LT992 Innisfail 1999 Human 1 1 1 1 1 1 LT1626 Unknown 2004 Human 8 3 5 1 1 1 QHR 536 Innisfail 2002 R. leucopus 8 3 5 1 1 1 QHR 525 A Innisfail 2002 R. leucopus 8 3 5 1 1 1 QHR 126 Tully 1999 Uromys spp. 20 3 5 1 1 11 QHR 214 Innisfail 2002 R. sordidus 44 3 5 1 9 1 QHR 347 Innisfail 2002 Rattus spp. 44 3 5 1 9 1 LT1044 Nerada 2000 Human 44 3 5 1 9 1 LT1622 Innisfail 2004 Human 40 3 5 1 6 1 QHR 536 Innisfail 2003 R. leucopus 39 3 5 5 5 10 Innisfail Sarina Palmerston Innisfail Innisfail Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 Journal of Medical Microbiology 55 Epidemiology of L. interrogans serovar Australis (b) D E F G LT1171 Tully 2001 Human 2 1 1 3 1 1 LT1196 Cardwell 2001 Human 49 1 3 3 1 1 LT743 Mossman 1995 Human 4 1 2 3 1 1 LT860 Mossman 1997 Human 4 1 2 3 1 1 LT1168 Tully 2000 Human 9 3 5 3 1 1 LT1243 Cardwell 2002 Human 10 3 8 3 1 1 QHR 415 B Tully 2003 Rattus spp. 18 2 4 3 1 9 LT979 Tully 1999 Human 21 6 10 3 1 13 LT1624 Tully 2004 Human 14 4 6 3 1 6 LT1625 Tully 2004 Human 15 4 6 3 1 7 LT1505 Tully 2003 Human 11 4 6 3 1 1 QHR 371 A Mackay 2003 R. sordidus 26 4 6 3 2 1 LT1169 Innisfail 2001 Human 33 4 6 5 3 4 LT1535 Tully 2003 Human 24 2 3 3 2 1 LT1538 Tully 2003 Human 24 2 3 3 2 1 LT1535 Tully 2003 Human 24 2 3 3 2 1 QHR 472 A Tully 2003 Rattus spp. 48 2 3 3 11 1 LT1167 Tully 2000 Human 29 2 3 3 2 2 LT958 Tully 1999 Human 30 2 9 3 2 2 LT1180 Mourilyan 2001 Human 6 2 3 1 1 1 LT1241 Silkwood 2002 Human 6 2 3 1 1 1 LT1170 Tully 2001 Human 7 2 3 3 1 1 LT1653 Tully 2004 Human 7 2 3 3 1 1 LT1539 Tully 2003 Human 7 2 3 3 1 1 LT1021 Mackay 1999 Canine 23 1 3 3 2 1 QHR 136 Tully 1999 Rattus spp. 23 1 3 3 2 1 LT1581 Cairns 2004 Human 43 1 3 3 9 1 LT930 Gordonvale 1998 Human 50 1 3 2 2 1 LT985 Innisfail 1999 Human 50 1 3 2 2 1 LT1508 Murray Upper 2003 Human 35 5 7 2 4 1 LT1504 Tully 2003 Human 36 5 7 2 4 6 LT1197 Rockhampton 2001 Human 27 5 7 3 2 1 LT1340 Miallo 2002 Human 38 1 7 2 5 5 LT1506 Tully 2003 Human 42 5 7 2 8 5 LT1337 Tully 2002 Human 32 3 8 3 2 2 LT1395 Murray Upper 2002 Human 32 3 8 3 2 2 LT1244 Tully 2002 Human 31 3 5 3 2 2 QHR 142 Tully 1999 Rattus spp. 25 3 8 3 2 1 LT1057 Tully 2000 Human 28 1 4 3 2 2 LT1342 Tully 2002 Human 28 1 4 3 2 2 QHR 115 Palmerston 1999 Melomys sp. 28 1 4 3 2 2 74-962 Tully 1999 Rattus spp. 28 1 4 3 2 2 QHR 143 Tully 1999 Rattus spp. 28 1 4 3 2 2 LT973 Tully 2003 Human 28 1 4 3 2 2 QHR 141 Tully 1999 Rattus spp. 28 1 4 3 2 2 74-629 Tully 1999 Rattus spp. 28 1 4 3 2 2 QHR 143 Tully 1999 Rattus spp. 28 1 4 3 2 2 Fig. 1. (a, b) Clustering analysis of L. interrogans serovar Australis using improved MLVA data. R. sordidus, Rattus sordidus; R. leucopus, Rattus leucopus; R. fuscipes, Rattus fuscipes; R. Iorf, Rattus lorf. be attributed to the change in the data analysis: every unique size was given a unique allele designation, whereas in the original method the size was converted to a repeat unit and was further rounded to a whole number. http://jmm.sgmjournals.org In addition to the changes in the number of alleles present in the VNTR loci, there was also a change in the diversity index for each locus. The diversity index is usually modelled on the mathematical equations of Nei (Weir, 1990), Simpson Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 1553 A. Slack and others Table 3. Comparison of data between the original (Slack et al., 2005) and modified MLVA methods Locus V27 V29 V30 V36 V50 Original MLVA method Modified MLVA method HDGI (n=96)* Confidence intervalD Number of different repeats present at each locus Max (pi)d HDGI (n=96)* Confidence intervalD Number of different repeats present at each locus Max (pi)d 0?098 0?817 0?763 0?642 0?674 0?060–0?135 0?799–0?835 0?745–0?780 0?617–0?667 0?648–0?699 3 8 7 5 6 0?949 0?323 0?333 0?475 0?424 0?594 0?794 0?689 0?633 0?563 0?548–0?640 0?769–0?819 0?663–0?715 0?595–0?671 0?510–0?616 6 10 8 11 13 0?604 0?375 0?396 0?542 0?646 *HGDI (Hunter & Gaston, 1988) as calculated by the V-DICE software (http://www.hpa-bioinfotools.org.uk/cgi-bin/DICI/DICI.pl). DConfidence interval: the precision of the HGDI, expressed as the 95 % upper and lower boundaries. dMax (pi): the proportion of samples (expressed as a decimal) that possess the most frequently found repeat at the VNTR locus. (Simpson, 1949) or Hunter and Gaston (Hunter & Gaston, 1988), and is based on the probability of two unrelated strains being characterized as the same type. These indexes may be used to compare typing methods and select the most discriminatory system (Hunter & Gaston, 1988). For this study we used the HGDI, as calculated by the V-DICE software. With the exception of V27, all other loci showed a drop in the HGDI when compared with the results of the original MLVA method. However, this drop in the HGDI at the individual locus must be tempered by the change in the mean diversity across the five loci, given that the allele string is analysed rather than individual loci. The modified method had a mean diversity of 0?654 and the original had a mean diversity of 0?599. The reason for positive change in mean diversity is that the V27 locus had an increase in diversity from 0?098 in the original method to 0?549 in the modified method (Table 3). The Ia for the modified MLVA data was 0?827 (P<0?001); this result shows that there was significant linkage disequilibrium, which implies a low rate of recombination between the alleles (Smith et al., 1993). Comparison of the improved MLVA method with FAFLP analysis FAFLP analysis was performed on 30 MLVA-typed L. interrogans serovar Australis isolates, and clustering analysis was performed using Bionumerics for comparison with the modified MLVA (Fig. 2). Sixteen FAFLP profiles (AA–PP) were present amongst the 30 isolates. FAFLP type PP was the most prevalent type in the dataset (9/30 profiles, 30 %). The results from the comparison show that the FAFLP results were comparable with those obtained by MLVA. To highlight the concordance of the two methods, we have linked the two cluster analyses using a series of connecting solid and dashed lines and roman numeral designations (i–v). MVT clones such as MVT1 (FAFLP type PP), MVT32 (LL) MVT50 (NN), MVT5 (OO) and MVT6 (MM) were grouped together with the respective isolates by FAFLP. The majority of the remaining MVTs had unique FAFLP profiles 1554 (AA–KK), with the exception of the following two isolates: QHR581B (MVT3) belonged to profile PP by FAFLP (the same FAFLP profile as MVT1) and LT1342 (MVT28) was found to have profile OO (the same as MVT5) in the FAFLP analysis (Fig. 2). Overall, the two methods were found to be comparable with each other; however, the MLVA method produced a greater number of unique patterns than the FAFLP method. A larger comparison study using other serovars may need to be conducted to establish which of the two methods has the highest resolution for the typing of L. interrogans strains. MLVA and FAFLP required equivalent levels of technical skill and equipment to perform the method; however, the data analysis for the MLVA method was easier to perform, given that it involves only five alleles compared with the 150–200 alleles produced by the FAFLP method. A further advantage of the MLVA method over FAFLP analysis is that the MLVA method could be applied in a non-culture-based situation, i.e. it could be possible to type an organism directly from a Leptospira PCR-positive DNA extract. Redefining the molecular epidemiology of L. interrogans serovar Australis in Queensland, Australia, using the improved MLVA method As the improved MLVA method was found to be superior to the original MLVA method, we used the data generated from the improved method to redefine the molecular epidemiology of L. interrogans serovar Australis in Queensland, Australia. Fifty MVTs were found in the 96 isolates tested in this study (Fig. 1a, b). When clustering analysis was applied to the isolates, it revealed eight clades (A–G), each containing isolates from both human and nonhuman sources (Fig. 1a, b). Clades A, B and C contained mostly the isolates from the Innisfail region (36/49, 73 %), and clades D, E, F and G contained mostly isolates from the Tully region (30/46, 65 %). Clade B was the largest group, containing 28 isolates, the majority of which were from the Innisfail area (24/28 isolates, 86 %). In the Innisfail region, MVT1 was the dominant clone (20/39, 51 %) (Fig. 3), and in the Tully region, MVT28 (8/32, 25 %) was the dominant Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 Journal of Medical Microbiology 55 Epidemiology of L. interrogans serovar Australis Categorical MLVA _50 0 50 100 Isolate ID MLVA type Categorical FAFLP _50 0 Isolate 50 100 ID FAFLP type LT1170 7 LT1170 AA LT1535 24 LT1238 BB LT1180 6 LT1244 CC LT1241 6 LT1622 DD LT1622 40 LT1197 EE LT1196 49 LT1581 FF LT1581 43 LT1243 10 LT1243 GG LT1197 27 LT1171 HH LT1624 14 LT1535 II LT1337 32 iii LT1340 JJ LT1395 32 LT1338 KK LT1244 31 LT1337 LL LT1342 28 LT1395 LL LT1171 2 LT1180 MM LT1241 MM LT930 NN LT985 NN LT1196 NN LT1342 OO LT1577 OO LT1586 OO LT738 PP LT1318 PP LT1328 PP LT1336 PP 5 LT1573 PP 50 LT1614 PP PP i ii iii iv QHR 581 B 3 LT738 1 LT1318 1 LT1328 1 LT1334 1 LT1336 1 LT1573 1 LT1614 1 QHR 250 1 LT1338 16 LT1577 5 LT1586 LT930 i ii v iv iv v ii LT985 50 QHR 250 LT1238 34 QHR 581 B PP LT1340 38 LT1334 PP Fig. 2. Clustering analysis of FAFLP data in comparison with that of the improved MLVA method. clone (Fig. 4). Similarities in the clustering analysis were present between the improved and the original MLVA method, such as the geographical specificity of certain MVTs to either the Innisfail or the Tully areas. The two dominant clones, MVT1 and MVT28, showed remarkable geographical specificity for the Innisfail and Tully regions (Figs 2 and 3). The improved MLVA method allowed the examination of the epidemiological links between the animal and human Fig. 3. Distribution of MVTs in the Innisfail region. http://jmm.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 1555 A. Slack and others Fig. 4. Distribution of MVTs in the Tully region. isolates of L. interrogans serovar Australis. Using the clustering analysis we could demonstrate strain clonality between rodent isolates, human and rodent isolates, and also rodent and canine isolates (Fig. 1a, b). When population modelling was performed using the MST algorithm (Fig. 5), all MVTs, with the exception of MVT21, 33, 39, 41 and 45, clustered together. MVT1 was considered to be the progenitor clone, given that it had the highest number of SLV isolates within the dataset. The population modelling using MST paralleled the geographical proximity of the isolates, with the majority of MVTs belonging to a single, albeit quite diverse, complex (Fig. 5). In conclusion, in this study we have described an improved MLVA method for L. interrogans that utilizes novel primers Fig. 5. MST population modelling of L. interrogans serovar Australis based upon MLVA data. The numbers shown are the MVT numbers. 1556 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 Journal of Medical Microbiology 55 Epidemiology of L. interrogans serovar Australis and optimized PCR conditions for VNTR amplification, and multiple fluorescent dye capillary electrophoresis to sort and size the PCR products. This improved method was found to be superior to the original method, and produced a greater number of unique profiles when compared with FAFLP analysis. Additionally, we were able to use the improved MLVA method to redefine the molecular epidemiology of L. interrogans serovar Australis, and through clustering analysis we were able to demonstrate strain clonality amongst rodent, canine and human isolates. using PCR multiplexing and multi-colored capillary electrophoresis. J Microbiol Methods 58, 213–222. Lista, F., Faggioni, G., Valjevac, S. & 13 other authors (2006). Genotyping of Bacillus anthracis strains based on automated capillary 25-loci multiple locus variable-number tandem repeats analysis. BMC Microbiol 6, 33. Rinehart, T. A. (2004). AFLP analysis using GeneMapper software and an Excel macro that aligns and converts output to binary. Biotechniques 37, 186–188. Simpson, E. H. (1949). Measurement of diversity. Nature 163, 688. Slack, A. T., Dohnt, M. F., Symonds, M. L. & Smythe, L. D. (2005). ACKNOWLEDGEMENTS The authors wish to thank Mr Shane Byrne for critically reviewing this manuscript. Development of a multiple-locus variable number of tandem repeat analysis (MLVA) for Leptospira interrogans and its application to Leptospira interrogans serovar Australis isolates from Far North Queensland, Australia. Ann Clin Microbiol Antimicrob 4, 10. Smith, J. M., Smith, N. H., O’Rourke, M. & Spratt, B. G. (1993). How clonal are bacteria? Proc Natl Acad Sci U S A 90, 4384–4388. REFERENCES Vijayachari, P., Ahmed, N., Sugunan, A. P., Ghousunnissa, S., Rao, K. R., Hasnain, S. E. & Sehgal, S. C. (2004). Use of fluorescent Bharti, A. R., Nally, J. E., Ricaldi, J. N. & 8 other authors (2003). amplified fragment length polymorphism for molecular epidemiology of leptospirosis in India. J Clin Microbiol 42, 3575–3580. Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis 3, 757–771. Hunter, P. R. & Gaston, M. A. (1988). Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol 26, 2465–2466. Weir, B. S. (1990). Genetic Data Analysis: Methods for Discrete Population Genetic Data Analysis. Sunderland, MA: Sinauer Associates. Lindstedt, B. A., Vardund, T., Aas, L. & Kapperud, G. (2004a). Multiple- Whatmore, A. M., Shankster, S. J., Perrett, L. L., Murphy, T. J., Brew, S. D., Thirlwall, R. E., Cutler, S. J. & MacMillan, A. P. (2006). locus variable-number tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis. J Microbiol Methods 59, 163–172. Identification and characterization of variable-number tandemrepeat markers for typing of Brucella spp. J Clin Microbiol 44, 1982–1993. Lindstedt, B. A., Vardund, T. & Kapperud, G. (2004b). Multiple-locus WHO (1999). Leptospirosis worldwide, 1999. Wkly Epidemiol Rec 74, variable-number tandem-repeats analysis of Escherichia coli O157 237–242. http://jmm.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 28 Jul 2017 15:06:13 1557
© Copyright 2026 Paperzz