Biochemical and Biophysical Research Communications 396 (2010) 265–271
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
Characterisation and differential regulation of MAFbx/Atrogin-1
a and b transcripts in skeletal muscle of Atlantic salmon (Salmo salar)
Neil I. Bower *, Daniel Garcia de la serrana, Ian A. Johnston
Scottish Oceans Institute, School of Biology, University of St. Andrews, St. Andrews, Fife KY16 8LB, UK
a r t i c l e
i n f o
Article history:
Received 23 March 2010
Available online 24 April 2010
Keywords:
MAFbx
Atrogin-1
Atlantic salmon
Alternative splicing
a b s t r a c t
MAFbx is an E3 ubiquitin ligase which plays important roles in myogenesis and muscle atrophy. We characterised the Atlantic salmon MAFbx gene, identifying two alternatively spliced MAFbx isoforms. The
mRNA sequence of Atlantic salmon MAFbx-a is 1698 nucleotides long including a 134 bp 50 UTR and
1065 bp coding sequence which encodes a 355 amino acid protein with a predicted mass of 41,657 Da
and pI 8.74. Two different 30 UTRs were identified of 495 and 314 bp in length. MAFbx-b is produced
by the removal of the 116 bp exon 2 from MAFbx-a, resulting in a frame shift mutation and introduction
of a premature stop codon. In contrast to mammals, MAFbx-a and b were ubiquitously expressed in all
salmon tissues examined. In vivo, expression was 600-fold (MAFbx-a) and 200-fold (MAFbx-b) higher in
fasted individuals than following 21 days refeeding to satiation. In primary myogenic cell cultures,
MAFbx-a mRNA was highest in differentiated myotubes while MAFbx-b mRNA had peak expression in
mono-nucleated cells. Starving cells of serum and amino acids resulted in a 6-fold increase in MAFbxa, whereas MAFbx-b remained similar to control levels. In starved cells, MAFbx-a mRNA levels declined
in response to amino acid, IGF-I and IGF-II treatments whereas MAFbx-b levels only decreased in response
to IGF-I. Addition of amino acids and IGF or insulin to starved cells increased MAFbx-b levels after 12 and
24 h. These results indicate that regulation of MAFbx in Atlantic salmon occurs at both the transcriptional
and post-transcriptional level through production of the alternatively spliced MAFbx-b, which is a likely
target for non-sense mediated decay.
Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction
In mammals, loss of muscle mass primarily occurs through increased protein degradation through the ubiquitin proteasome
pathway. Covalent linking a chain of ubiquitin molecules to target
proteins marks them for degradation by the 26S proteasome. Three
components are required in the formation of ubiquitin–protein
complexes, a ubiquitin activation enzyme (E1), a ubiquitin conjugating enzyme (E2) and a ubiquitin ligase (E3) [1]. The ubiquitin ligase is
a key enzyme responsible for transferring activated ubiquitin to a
lysine residue on the target protein. Different E3 ligases have specific
targets, with the F-box motif responsible for providing substrate
Abbreviations: A.U., arbitrary units; AKT, protein kinase B; Des, desmin; DMEM,
Dulbecco’s modified eagle’s media; cDNA, complimentary DNA; Ef1a, eukaryote
elongation factor 1a; Hprt1, hypoxanthine phosphoribosyl transferase 1; IGF-I,
insulin-like growth factor-I; IGF-II, insulin-like growth factor-II; MRFs, myogenic
regulatory factors; mTOR, mammalian target of rapamycin; mTORC1, mammalian
target of rapamycin complex 1; Myf5, myogenic factor 5; myoD1, myoblast
determination factor; Myog, myogenin; NMD, non-sense mediated decay; RACE,
rapid amplification of cDNA ends; PBS, phosphate buffered saline; PI3K, phosphoinositide-3 kinase; Ppia, prolylpeptidyl isomerase A; PTC, premature termination
codon; UTR, untranslated region.
* Corresponding author. Fax: +44 1334 463443.
E-mail address: [email protected] (N.I. Bower).
0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2010.04.076
specificity [2]. The muscle specific F-box protein MAFbx/Atrogin-1
is highly expressed in muscle undergoing catabolism in several
experimental models such as cancer, diabetes, fasting and limb
immobilisation [3]. Mice deficient in MAFbx are resistant to muscle
atrophy induced via denervation and overexpression of MAFbx results in atrophy of skeletal muscle myotubes [4]. Several targets
for MAFbx have recently been identified and include myoblast
determination factor (MyoD) [5] and eukaryotic initiation factor 3
subunit 5 (eIF3-f) [6], linking MAFbx expression to processes regulating muscle wasting and muscle hypertrophy, respectively.
MAFbx mRNA expression is controlled by the FOXO family of
transcription factors, which are regulated through the PI3K/AKT/
mTOR pathway, a key pathway which regulates muscle atrophy
and hypertrophy [7]. IGF-I stimulation of this pathway leads to
phosphorylation of AKT which negatively regulates FOXO transcription factors by phosphorylating them and promoting their nuclear export into the cytoplasm [7]. Conversely, under atrophying
conditions, decreases in PI3K/Akt activity lead to nuclear import
of the FOXO3A transcription factor and increased transcription of
MAFbx [8]. MAFbx upregulation also occurs through TNFa stimulation of the stress activated protein kinase p38 MAPK signalling
pathway [9] and through Foxo4 nuclear import in inflammatory
catabolic states [10].
266
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
In addition to being regulated through transcription factors,
mRNA abundance can also be influenced by post-transcriptional
mechanisms. Alternative splicing can have dramatic effects on protein function, and affect the stability of mRNA [11–13]. In some instances, alternative splicing results in the inclusion of a premature
termination codon (PTC) due to a frameshift. Production of unproductive transcripts decreases the abundance of productive mRNA
species, down regulating protein expression [13]. Also, unproductive mRNA species are targets for non-sense mediated decay
(NMD), a mechanism that regulates transcript abundance [11,12]
and is conserved in fish [14]. MicroRNA sites within the 30 UTR
can effect mRNA abundance by inhibiting translation or through
degradation of target mRNAs as components of the RNA induced
silencing complex (RISC) [15].
Currently, salmonid MAFbx DNA sequences are poorly represented in dbEST (http://www.ncbi.nlm.nih.gov/dbEST/dbEST_summary.html, December 2009) [16], with only one EST from Atlantic
salmon and a total of three from salmonid species. We report the
full length mRNA for Atlantic salmon MAFbx, identifying an alternatively spliced isoform which is distinctly regulated and a likely
target for NMD. We also identified two mRNAs which differ in
the length of the 30 UTR. The expression of the different splice variants was examined in vivo across various tissues in a fastingrefeeding experiment and in vitro during myotube maturation, cell
starvation and in response to amino acid and IGF stimulation.
2. Materials and methods
solution, 9 mM NaHCO3, 20 mM HEPES (pH 7.4), supplemented
with 2 g/l glucose, 1 vitamins, 1 antibiotics) (Sigma, Gillingham,
Dorset, UK), and then grown for 72 h in starve media. Control cells
were grown in complete media. RNA was extracted from the cells
at 0, 6, 12, 24, 36, 48 and 72 h following treatment.
Cells starved for 72 h were then grown for 24 h in either starve
media, starve media supplemented with IGF-I (recombinant salmon protein, GroPep, Adelaide, Australia) (100 ng/ml) or IGF-II (recombinant salmon protein, GroPep, Adelaide, Australia) (100 ng/
ml), amino acid media (DMEM, 9 mM NaHCO3, 20 mM HEPES
(pH 7.4), 1 antibiotics), amino acid media with IGF-I (100 ng/
ml), IGF-II (100 ng/ml) or IGF-I + IGF-II (100 ng/ml each), and amino acid media with 1 lM insulin (Sigma, Gillingham, Dorset, UK).
RNA was extracted from cells at 0, 3, 6, 12 and 24 h following
treatment.
2.6. Quantitative real-time PCR experiments
The following procedures were performed in order to comply
with the Minimum Information for Publication of Quantitative
Real-Time PCR experiments MIQE guidelines [19].
2.7. cDNA synthesis for quantitative PCR
RNA extraction and cDNA synthesis was performed as previously described [17,18].
2.1. Ethical approval
2.8. Quantitative PCR
All experiments were approved by the University of St. Andrews
Animal Ethics and Welfare Committee. Fish were humanely killed
following Schedule 1 of the Animals (Scientific Procedures) Act
1986 (Home Office Code of Practice. HMSO: London January 1997).
50 and 30 RACE reactions, cloning and sequencing was performed
as previously described [17]. Primers to amplify the coding sequence and 30 and 50 UTRs were designed based on DN165813
and EV378009 EST sequences. Primers for 50 and 30 RACE were as
follows: 30 RACE forward 1: GTGCAGGATATGGGGAAGTC, 30 RACE
nested: ACATCATGGAGCGTCTGTCA, 50 RACE forward 1: GCACCAGACCACACAGAGAC, 50 RACE nested: CTGGGACTTGGCAATGAGC.
qPCR was performed using a Stratagene MX3005P QPCR system
(Stratagene, La Jolla, CA, USA) with Brilliant II SYBR (Stratagene, La
Jolla, CA, USA) as described previously[18]. Primers for qPCR were
as follows (50 –30 ): MAFbx-a forward CGAGTGCTTCCAGGAGAATC,
MAFbx-a reverse GGAATCTTTGCGTTGTTGTTC, MAFbx-b forward
GGTCAGAGCTGGGTTAAAACTG, MAFbx-b reverse TCTCTTTGTGG
AAATCTCACG, Rpl13 CGCTCCAAGCTCATCCTCTTCCC forward, Rpl13
CCATCTTGAGTTCCTCCTCAGTGC reverse, Rps29 forward GGGTCATCAGCAGCTCTATTGG, Rps29 AGTCCAGCTTAACAAAGCCGATG reverse. The specificity of MAFbx-a and MAFbx-b primers was
confirmed by qPCR using cloned MAFbx-a and MAFbx-b plasmid as
template. Primers were used at a final concentration of 500 nM. Primer sequences for EF1alpha, PPPIA and HPRT1 have been published
previously [18].
2.3. Refeeding experiment
2.9. qPCR data analysis
One hundred and fifty Atlantic salmon (Salmo salar L.
59.8 ± 7.9 g, n = 150, mean ± SD) were fed a maintenance diet
(25% normal ration) for 21 days, fasted for 7 days, and fed to satiation with a commercial feed (EWOS Innovation). Fish were reared
in tanks with an average temperature of 10.6 °C. Sampling of fish
occurred at 0 day (fasted), 1, 3 5, 8, 15 and 21 days following satiation feeding with fast muscle sampled from six fish at each time
point. Slow muscle, heart, liver, brain, kidney, gill, skin, gut and
eye tissues were dissected from three fish at 0, 8 and 21 days.
GeNorm Analysis [20] revealed Rps29 and Rpl13 to be the most
stable genes in all tissues of refed fish and in the starved and treated cell culture so GeNorm normalisation was performed using
these genes, and values are shown as arbitrary units. Analysis of
qPCR data for myotube maturation in cell culture was performed
as previously described [18]. Statistical analysis was performed
with Minitab (Minitab Inc.). When data conformed to parametric
assumptions, ANOVA using Fisher’s individual error post hoc test
was used to identify significant differences. A, Kruskal–Wallis test
was used when parametric assumptions were not met.
2.2. PCR amplification and cloning of Atlantic salmon MAFbx
2.4. Isolation of myogenic progenitor cells and cell culture
2.10. Bioinformatics
Myogenic progenitor cells were isolated and cultured as previously described [18].
2.5. Cell starvation and treatments
Cells were grown until day 9 of culture, and then washed once
with amino acid deprived (starve) media (Earle’s balanced salt
Predictions for size, pI and potential N-glycosylation sites were
performed from deduced amino acid sequences using the ExPaSy
proteomics server of the Swiss Institute of Bioinformatics (http://
www.expasy.ch) and microRNA binding sites were predicted using
Micro Inspector [21]. Multiple amino acid alignments were performed using T-coffee clustal W software [22].
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
267
Fig. 1. Complete mRNA and deduced amino acid sequence for Atlantic salmon MAFbx-a. Nucleotides are numbered 50 –30 and the 30 stop codon indicated by an asterisk. The
exon 2 which is removed from MAFbx-b is shown in bold. Amino acid sequences predicted to target the protein to the nucleus are underlined, as are the two alternative
polyadenylation sites in the 30 UTR.
3. Results and discussion
3.1. Sequence analysis
Homology based searches against Atlantic salmon ESTs within
dbEST revealed the presence of a single EST (DN165813), 545
nucleotides in length, with significant homology to mammalian
MAFbx sequences. This EST only partially represented the coding
sequence, missing both 30 and 50 coding sequence and UTRs so primers were designed for both 50 and 30 RACE based on this sequence.
The 1698 bp complete mRNA sequence of Atlantic salmon
MAFbx-a (GenBank ID: HM015586) comprises a 50 UTR of 134 bp,
and a coding sequence of 1065 nucleotides (Fig. 1). Two different
30 UTR sequences were obtained from the 30 RACE reactions. The
268
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
longer (495 bp) and shorter (314 bp) have polyadenylation signals
(ATTAAA) 478 and 295 nucleotides after the stop codon, respectively (Fig. 1). A putative microRNA binding site was identified
24 bp following the stop codon. The binding site has 100% homology through the seed region with fugu and puffer fish miRNA 25
(TTTGTACATACAGAACTGTTTATAGTGCAATC), which is also present
112–119 bp following the stop codon in both fugu and puffer fish
MAFbx genes respectively. As microRNA sites within the 30 UTRs
of genes can function as regulators of translation and mRNA degradation, this conserved microRNA site may have important functions in the regulation of the MAFbx protein abundance in
teleosts [23].
Amplification of the coding sequence revealed the presence of
two cDNAs which represented alternative splice variants and were
termed MAFbx-a (long variant) and MAFbx-b (short variant, GenBank ID: HM015587). The open reading frame of MAFbx-a encodes
a protein of 355 amino acids (Fig. 1), with a predicted molecular
mass of 41,657 Da and pI 8.74. Atlantic salmon MAFbx-a is highly
conserved having 84% identity with zebrafish, 74% with gallus,
and 73% with human MAFbx (Fig. 2). The characteristic F-box motif
is present from amino acids 222–269 (Fig. 2). The PDZ binding domain located at amino acids 345–355 is 80% identical to its mammalian counterpart. During amino acid withdrawal from
developing myotubes, MAFbx shuttling from the cytoplasm to
the nucleus occurs [6]. In Atlantic salmon MAFbx, amino acids
60–69 (KKRRK) are predicted to target the protein to the nucleus
and a bipartite nuclear localisation signal (KRLCQYHFTDRQIRKRL)
is present at amino acids 267–283 (Fig. 1).
The MAFbx-b splice variant is missing 116 nucleotides at a position 113 bp from the ATG start codon (Fig. 1). Comparison of Atlantic salmon MAFbx-b with sequences obtained from ensembl
(http://www.ensembl.org/index.html) reveals that the deletion
corresponds with exon 2 from other fish species and mammalian
MAFbx genes, and is therefore likely due to splicing of this exon
from the mature mRNA. This splicing event results in a frame shift
mutation and introduction of a PTC 157 nucleotides after the start
codon. This could lead to post-transcriptional regulation of the
MAFbx gene, as PTC recognition activates NMD resulting in the targeted degradation of non-productive mRNAs [11,12]. Due to the
conserved nature of the MAFbx nucleotide sequence, removal of
exon 2 from other fish MAFbx genes also results in the introduction
of a premature stop codon at amino acid 49 in Stickleback and
Fugu, 48 in Tetraodon, 44 in zebrafish and 80 in Medaka. Thus,
NMD of MAFbx mRNA may be an evolutionary conserved mechanism for the post-transcriptional regulation of teleost MAFbx.
3.2. MAFbx expression in refeeding Atlantic salmon
Both MAFbx-a and b and are expressed at high levels in fasted
fish, and decrease significantly within 1 day upon refeeding
(Fig. 3A, P < 0.01), although it should be noted that MAFbx-a declined 600-fold and MAFbx-b 200-fold after 21 days of feeding.
Overall MAFbx-a levels were 98-fold higher than MAFbx-b, however, nutritional status of the fish clearly has significant effects
on relative transcript abundance (P < 0.001), e.g., MAFbx-a was
187-fold higher in fasted fish but only 53-fold higher than
MAFbx-b following 21 days refeeding to satiation (Fig. 3B). If
MAFbx-b is a target for NMD, then the actual levels of this mRNA
species immediately after splicing may be higher than we are
detecting.
3.3. Tissue distribution
MAFbx-a and b mRNA was ubiquitously expressed in all tissues
examined (Fig. 3C). Highest levels of expression were found in
fasted samples from fast and slow muscle, followed by skin and
heart. Mammalian MAFbx mRNA is expressed specifically in heart
and skeletal muscle [4,24], which provided strong evidence that
Fig. 2. Amino acid alignment of MAFbx protein sequences from Atlantic salmon, zebrafish, human, seagull and frog. Conserved residues are indicated by an asterisk below the
alignment. The F-box (residues 226–274) is indicated by a box, and the PDZ binding domain is underlined (residues 350–360).
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
269
Fig. 3. (A) Expression of MAFbx-a and b during refeeding of fasted Atlantic salmon. (B) Ratio of MAFbx-a to MAFbx-b during refeeding of fasted Atlantic salmon showing
overall ratio at all time points, and the significant differences in ratio (P < 0.001) between fasted fish (0 day) and fish fed to satiation for 21 days. (C) Distribution of MAFbx-a
and MAFbx-b (log transformed) across Atlantic salmon tissue in fasted fish (0 d, grey bar) and fish fed for 8 d (white bar) and 21 d (black bar) (B, brain; E, eye; G, gill; GT, gut;
H, heart; K, kidney; L, liver; SM, slow muscle; SK, skin; FM, fast muscle). (D) Expression of MAFbx-a and b during maturation of myotubes in Atlantic salmon myogenic cell
culture.
this E3 Ub ligase was involved specifically in muscle atrophy
processes. In contrast, MAFbx is expressed in other tissues in zebrafish such as kidney and liver [25]. The ubiquitous expression of
MAFbx-a mRNA suggests that in Atlantic salmon MAFbx has targets
in multiple tissues as well as cardiac and skeletal muscle.
3.4. Expression during myogenesis
To gain further insights into the transcriptional regulation of
MAFbx, we examined the expression of MAFbx-a in myogenic
cell culture from 2 days, when mono-nucleated cells predominate through to 20 days, when the culture largely consists of differentiated myotubes. MAFbx-a expression was unchanged from
2 to 11 days, however, mRNA levels increased from 11 to
20 days (P < 0.05, Fig. 3D) as differentiated predominated. The
ubiquitin proteasome system has been implicated in muscle cell
differentiation where its role in cell cycle exit and differentiation
has been demonstrated through proteolysis of myogenic regulatory factors such as MyoD [26,6] and Myf5 [27]. Based on the
expression pattern we observe, it seems likely that in Atlantic
salmon, MAFbx plays some role in myogenic cell differentiation.
In contrast to MAFbx-a, MAFbx-b levels were highest at 2 days
and decreased 3.5-fold to their lowest levels at 8 days (P < 0.01),
and then remained at levels 2-fold less than at the start of the cul-
ture (P < 0.05, Fig. 3D). It is interesting that we observe lowest levels of MAFbx-b at 8 days, which corresponds to peak expression of
the myogenic regulatory factors myogenin, myoD1b and myoD1c
(Bower and Johnston, unpublished results). These results suggest
that alternative splicing and NMD could play an important role
in Atlantic salmon myogenesis by altering levels of productive
MAFbx-a mRNA.
3.5. Expression in starved cells
MAFbx gene expression is nutritionally regulated through the
PI3K/AKT/mTOR pathway [4,7]. Starving cells of serum and amino
acids for 72 h clearly slowed the development of myotubes
(Fig. 4A) and resulted in an 8-fold increase in MAFbx-a mRNA levels
by 6 h (P < 0.05, Fig. 4B). Levels then declined, to values only 2- to
3-fold higher than controls at 12 and 24 h, and then increased
again to levels 4- to 6-fold higher than in controls at 36–72 h
(P < 0.05).
MAFbx-b mRNA levels also increased at 6 h in starved cells
(P < 0.05, Fig. 4B), however, MAFbx-b declined to levels not different to controls at 12–72 h (Fig. 4B). The similar mRNA levels in
control and starved cells for MAFbx-b is unsurprising, as removal
of serum and amino acids should lead to an atrophy response,
which would require intact MAFbx-a mRNA.
270
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
Fig. 4. (A) Development of myogenic cell culture from 9 days (left panel), after 72 h amino acid and serum withdrawal (middle panel) or 72 h complete media (right panel).
Bar indicates 50 lm. (B) Expression of MAFbx-a and b in 9 days myogenic cells in complete media (triangle) or amino acid and serum deprived media (square). For ease of
interpretation, values at time 0 h were transformed so that the mean value is equal to 1. Values represent mean ± SE, three independent cell cultures. Significant differences in
expression are indicated by an asterisk (P < 0.05). (C). Expression profiles for MAFbx-a and b in day 9 myogenic cells starved for 72 h, then treated with various combinations
of amino acids, IGFs and insulin or starve media (starve media, no amino acid or serum). cDNA was synthesised from RNA extracted 0, (black bar) 3 (diagonal stripe), 6
(horizontal stripe), 12 (white bar) and 24 h (sigmoidal stripe) following treatment. For ease of interpretation of the cell treatments, the 72 h starved cell values were
transformed so that the mean value is equal to 1. Values represent mean ± SE, three samples per point. Changes in expression were considered significant if they were
different to both the 72 h starved value and the control treatment. Significant differences in expression are indicated by an asterisk (P < 0.05).
3.6. Treatment of starved cells with amino acids and IGF hormones
As IGF-I, IGF-II and amino acids are known to stimulate the
PI3K/Akt/mTOR pathway and affect MAFbx expression [28,29], we
examined expression in starved cells in response to amino acids,
IGFs and insulin. MAFbx-a mRNA levels rapidly declined in response to amino acids, IGF-I or IGF-II (P < 0.05), similar to that reported for other species including birds, mammals and fish [30–
32]. The decline in mRNA levels was greatest when amino acids
were present, where maximum decreases over 6-fold were observed, whereas mRNA levels only fell 2- to 3-fold when IGF-I or
IGF-II alone were the stimulus (Fig. 4C).
MAFbx-b levels also declined in response to amino acid or IGF
treatment, however, only the IGF-I treatment was statistically significant (P < 0.05). In contrast, when amino acids and IGF-I, IGF-II
or insulin were the combined stimulus, levels of MAFbx-b increased
at 12–24 h (P < 0.05, Fig. 4D). The requirement for both amino acids
and IGFs or insulin to be present for this response, suggests that
the combined stimuli may influence the abundance of splicing factors which can alter the production of alternative splice variants
[13]. Interestingly, Upf1, which is part of the NMD machinery
[33], is regulated by a rapamycin and wortmannin sensitive PI3 kinase related signalling pathway [34].
In conclusion, unlike mammalian MAFbx which has an expression pattern restricted to skeletal and cardiac muscle, Atlantic salmon MAFbx was ubiquitously expressed in all the tissues
examined. Increased MAFbx-a expression occurs through serum
and amino acid withdrawal and its expression is regulated by
IGF-I, IGF-II and amino acids. Alternative splicing of MAFbx-a
results in the production of MAFbx-b which is likely a target for
NMD. The differential regulation of MAFbx-a and b in vivo and
in vitro, suggests that Atlantic salmon MAFbx regulation occurs at
both the transcriptional and post-transcriptional level.
Acknowledgments
All Atlantic salmon were provided by Landcatch, Lochgilphead,
UK. Primers for Rpl13 and Rps29 were kindly provided by Dr. Daniel Macqueen.
Role of funding source: This work was supported in part by a
Grant from the Biotechnology and Biological Research Council
Grant (BB/D015391/1). The research leading to these results has
also received funding from the European Community’s Seventh
Framework Programme (FP7/2007-2013) under Grant Agreement
No. 222719 – LIFECYCLE. The funding sources had no involvement
in the preparation of the manuscript.
N.I. Bower et al. / Biochemical and Biophysical Research Communications 396 (2010) 265–271
References
[1] A. Ciechanover, The ubiquitin–proteasome pathway: on protein death and cell
life, EMBO J. 17 (1998) 7151–7160.
[2] D. Skowyra, K.L. Craig, M. Tyers, et al., F-box proteins are receptors that recruit
phosphorylated substrates to the SCF ubiquitin–ligase complex, Cell 91 (1997)
209–219.
[3] J.M. Sacheck, J.P.K. Hyatt, A. Raffaello, R.T. Jagoe, R.R. Roy, V.R. Edgerton, S.H.
Lecker, A.L. Goldberg, Rapid disuse and denervation atrophy involve
transcriptional changes similar to those of muscle wasting during systemic
diseases, FASEB J. 21 (2007) 140–155.
[4] S.C. Bodine, E. Latres, S. Baumhueter, et al., Identification of ubiquitin ligases
required for skeletal muscle atrophy, Science 294 (2001) 1704–1708.
[5] J. Lagirand-Cantaloube, K. Cornille, A. Csibi, et al., PLoS One 4 (2009) e4973,
doi:10.1371/journal.pone.0004973.
[6] J. Lagirand-Cantaloube, N. Offner, A. Csibi, et al., The initiation factor eIF3-f is a
major target for Atrogin1/MAFbx function in skeletal muscle atrophy, EMBO J.
27 (2008) 1266–1276.
[7] T.N. Stitt, D. Drujan, B.A. Clarke, et al., The IGF-1/PI3K/Akt pathway prevents
short article expression of muscle atrophy-induced ubiquitin ligases by
inhibiting FOXO transcription factors, Mol. Cell 14 (2004) 395–403.
[8] M. Sandri, C. Sandri, A. Gilbert, et al., Foxo transcription factors induce the
atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy,
Cell 117 (2004) 399–412.
[9] Y.P. Li, Y.L. Chen, J. John, et al., TNF-alpha acts via p38 MAPK to stimulate
expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle, FASEB J.
19 (2005) 362–370.
[10] J.S. Moylan, J.D. Smith, M.A. Chamber, et al., TNF induction of atrogin-1/MAFbx
mRNA depends on Foxo4 expression but not AKT-Foxo1/3 signaling, Am. J.
Physiol. Cell Physiol. 295 (2008) C986–C993.
[11] E. Nagy, L.E. Maquat, A rule for termination-codon position within introncontaining genes: when nonsense affects RNA abundance, Trends Biochem.
Sci. 23 (1998) 198–199.
[12] M.W. Hentze, A.E. Kulozik, A perfect message: RNA surveillance and nonsensemediated decay, Cell 96 (1999) 307–310.
[13] D.A.W. Soergel, L.F. Lareau, S.E. Brenner, Regulation of gene expression by
coupling of alternative splicing and NMD, in: Nonsense-mediated mRNA
Decay, Madame Curie Bioscience Database, Landes Bioscience and Springer
Science+Business Media, Austin. 2006, pp. 175–196. Available from: <http://
www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=eurekah&part=A63813>.
[14] N. Wittkopp, E. Huntzinger, C. Weiler, et al., Nonsense-mediated mRNA decay
effectors are essential for zebrafish embryonic development and survival, Mol.
Cell. Biol. 29 (2009) 3517–3528.
[15] R.I. Gregory, T.P. Chendrimada, N. Cooch, et al., Human RISC couples microRNA
biogenesis and posttranscriptional gene silencing, Cell 123 (2005) 631–640.
[16] M.S. Boguski, T.M.J. Lowe, C.M. Tolstoshev, Dbest – database for expressed
sequence tags, Nat. Genet. 4 (1993) 332–333.
[17] N.I. Bower, X.J. Li, R. Taylor, et al., Switching to fast growth: the insulin-like
growth factor (IGF) system in skeletal muscle of Atlantic salmon, J. Exp. Biol.
211 (2008) 3859–3870.
[18] N.I. Bower, I.A. Johnston, Selection of reference genes for expression studies
with fish myogenic cell cultures, BMC Mol. Biol. 10 (2009), doi:10.1186/14712199-10-80.
271
[19] S.A. Bustin, V. Benes, J.A. Garson, et al., The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments, Clin.
Chem. 55 (2009) 611–622.
[20] J. Vandesompele, K. De Preter, F. Pattyn, et al., Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of multiple internal
control genes, Genome Biol. 3 (2002) RESEARCH0034.
[21] V. Rusinov, V. Baey, I. Nikiforov, et al., MicroInspector: a web tool for detection
of miRNA binding sites in an RNA sequence, Nucleic Acids Res. 33 (2005)
W696–W700.
[22] C. Notredame, D.G. Higgins, J. Heringa, T-coffee: a novel method for fast and
accurate multiple sequence alignment, J. Mol. Biol. 302 (2000) 205–217.
[23] E.C. Lai, Micro RNAs are complementary to 30 UTR sequence motifs that
mediate negative post-transcriptional regulation, Nat. Genet. 30 (2002) 363–
364.
[24] M.D. Gomes, S.H. Lecker, R.T. Jagoe, et al., Atrogin-1, a muscle-specific F-box
protein highly expressed during muscle atrophy, Proc. Natl. Acad. Sci. USA 98
(2001) 14440–14445.
[25] J.I. Hanai, P. Cao, P. Tanksale, et al., The muscle-specific ubiquitin ligase
atrogin-1/MAFbx mediates statin-induced muscle toxicity, J. Clin. Invest. 117
(2007) 3940–3951.
[26] L.A. Tintignac, J. Lagirand, S. Batonnet, et al., Degradation of MyoD mediated by
the SCF (MAFbx) ubiquitin ligase, J. Biol. Chem. 280 (2005) 2847–2856.
[27] C. Lindon, O. Albagli, P. Domeyne, et al., Constitutive instability of muscle
regulatory factor Myf5 is distinct from its mitosis-specific disappearance,
which requires a D-box-like motif overlapping the basic domain, Mol. Cell.
Biol. 20 (2000) 8923–8932.
[28] C. Rommel, S.C. Bodine, B.A. Clarke, et al., Mediation of IGF-1-induced skeletal
myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways,
Nat. Cell Biol. 3 (2001) 1009–1013.
[29] E.H. Herningtyas, Y. Okimura, A.E. Handayaningsih, et al., Branched-chain
amino acids and arginine suppress MaFbx/atrogin-1 mRNA expression via
mTOR pathway in C2C12 cell line, Biochim. Biophys. Acta 1780 (2008) 1115–
1120.
[30] S. Tesseraud, S. Metayer-Coustard, S. Boussaid, et al., Insulin and amino acid
availability regulate atrogin-1 in avian QT6 cells, Biochem. Biophys. Res.
Commun. 357 (2007) 181–186.
[31] J.M. Sacheck, A. Ohtsuka, S.C. McLary, A.L. Goldberg, IGF-I stimulates muscle
growth by suppressing protein breakdown and expression of atrophy-related
ubiquitin ligases, atrogin-1 and MuRF1, Am. J. Physiol. Endocrinol. Metab. 287
(2004) E591–E601.
[32] B.M. Cleveland, G.M. Weber, Effects of insulin-like growth factor-I, insulin, and
leucine on protein turnover and ubiquitin ligase expression in rainbow trout
primary myocytes, Am. J. Physiol. Regul. Integr. Comp. Physiol. 298 (2010)
R341–R350.
[33] P. Leeds, S.W. Peltz, A. Jacobson, et al., The product of the yeast Upf1 gene is
required for rapid turnover of messenger-RNAs containing a premature
translational termination codon, Genes Dev. 5 (1991) 2303–2314.
[34] M. Pal, Y. Ishigaki, E. Nagy, et al., Evidence that phosphorylation of human Upf1
protein varies with intracellular location and is mediated by a wortmanninsensitive and rapamycin-sensitive PI 3-kinase-related kinase signaling
pathway, RNA 7 (2001) 5–15.