1
Stephen DiMaria
Rong-Chien Lin
Dr. Mark Rausher
Investigating the role of a polymorphism in the sequence of MYB7 and the evolution of flower
color in the Clarkia clade Rhodanthos.
Introduction
Understanding the genetic basis of the evolution of novel morphological traits is a main
objective of evolutionary biology (Reed et al. 2011). There are various ways in which patterns of
coloration can differ among species. Specifically, the positions of different colors and patterns
could differ (Kodandaramaiah, 2009) and a pattern may be present in one species but absent in a
second (Ellis et al., 2013). Previous research has investigated pattern evolution in Drosophila
biarmipes, Sticklebacks (Gasterosteus aculeatus), and mice and has shown that cis-regulatory
regions are responsible for gain or loss of pattern elements over the course of evolution (Gompel
et al. 2005, Miller et al. 2007, Wittkopp & Kalay, 2012). On the other hand, much less is known
about not only how these traits arise in plants, but how they diversify throughout a clade of
species. It is currently unknown whether these shifts involve many or few genes, whether there is
a gain of function or loss of function of a specific gene, or if the changes occur in regulatory or
coding regions. The genus Clarkia presents an ideal system for addressing these questions. In
this study, these questions will be addressed by analyzing the evolution of pigment patterning on
the corolla in the Clarkia clade Rhodanthos. Specifically, the appearance of novel white sector
morphology and basal spots will be investigated.
There are six species in this clade: C. lassenensis, C. arcuata, C. franciscana, C.
rubicunda, C. amoena, and C. gracilis. The phenotypes of interest can be divided into three
types: Type A, Type B, and Type C (Fig. 1). Type A individuals have basal pigmentation but no
white sector present. Type B individuals have both basal pigmentation and a white sector
present, whereas Type C individuals only have the white sector morphology present. It has been
shown that species in the genus Clarkia produce anthomcyanin pigments, which are derivatives
of malvidin and cyanidin (Soltis, 1986). The biosynthetic pathway along with the core enzymes
involved in the production of anthocyanin are shown in Figure 2. A complex of transcription
factors is responsible for controlling expression of the genes that encode the enzymes in this
pathway. These transcription factors include R2R3Myb, a WDR, and a bHLH protein. It has been
demonstrated that spot formation is activated by the R2R3Myb transcription factor (CgMyb1)
and that different alleles of CgMyb1 were expressed in different spatial domains, which lead to
spot formation in different petal locations (Martins et al. 2016). It has also been shown that the
shift from basal to central spot (thus removing basal pigmentation) within C. gracilis is
controlled by a single locus with two alleles (Gottlieb & Ford, 1988).
Transcription factors (TFs) are master regulators of cellular processes and research into
these transcription factors could shed light into important signaling pathways. MYB transcription
factors have been implicated as key components in regulatory networks responsible for plant
responses to abiotic stressors (Li et al., 2015; Mengiste et al., 2003; Narasuke et al., 2003).
MYB TFs are characterized by the MYB domain, which is involved in the binding of
DNA. Classifying MYB proteins is determined through the number of repeats present in their
2
sequences, which varies from one to four. Each repeat consists of approximately 52 amino acid
residues which form three alpha-helices (Baldoni et al. 2015; Dubos et al., 2010).
Much work remains to fully characterize the roles of MYB proteins in regulatory
network. Unfortunately, this task is complicated due to the partially overlapping functional
redundancies and difficulties in analyzing the functions of TFs when they are produced at low
levels (Dubos et al. 2010). The MYB family of proteins is large, functionally diverse and
represented in all eukaryotes (Dubos et al. 2010). Elucidation of MYB protein function will help
shed light onto function of MYB proteins in eukaryotes.
The petal spots in C. gracilis have been investigated previously. It was found that there
exists a male fitness advantage for spotted plants over the whole range of phenotypic frequencies
observed in natural populations (Jones, 1996). In addition, it was found that negative frequencydependent selection foraging for floral resources by Clarkia xantiana ssp. xantiana, which
contributes to flower color variation (Eckhart et al. 2006).
Myb TFs have been shown in the anthocyanin pathway (Allan et al. 2008). Anthocyanins
belong to a diverse group of prevalent secondary metabolites known as flavanols. In plants,
flavinols have been shown to have a vast array of functions, such as defense, whereas the
pigmented anthocyanin compounds are involved in reproduction as attractants in plant and
animal interactions (Dubos et al. 2010). The spatial expression of the MYB transcription factors
directly determines spot position, either basal or central (Ramsay & Glover, 2005). A change in
the level of expression could occur, mediated through changes in cis-regulatory elements, could
lead to a lack of basal pigmentation.
In order to determine which MYB transcription factor to analyze, MYB transcription
factors in Arabidopsis were used as reference. It has been shown that in Arabidopsis, three MYB
transcription factors have been demonstrated to regulate anthocyanin production: AtMYB90,
AtMYB113, and AtMYB114 (Qi et al. 2011, Gonzalez et al. 2008). Through a BLAST search
(described in methods) we found that MYB7 in Clarkia had the high sequence homology to these
three MYB transcription factors in Arabidopsis. Therefore, MYB7 was investigated to determine
its involvement in the evolution of basal pigmentation and white spot morphology in Clarkia.
Ultimately, the main objectives are to determine if MYB7 is implicated in differences in basal
pigmentation and white cup morphology (where a white spot forms on the base of the corolla) in
different species and subspecies of Clarkia.
Figure 1: Type A: Individuals with basal pigmentation and no white sector. Type B represents
individuals with both basal pigmentation and white cup morphology. Type C represents samples
with no basal pigmentation and white cup morphology. White cup morphology is a polymorphism
within the species Clarkia gracilis sonomensis. Types A, B, and C represent F2 individuals from a
cross of two C. g. sonomensis individuals.
3
Figure 2: Simplified pathway demonstrating the production of anthocyanin. The dehydratase is
putative and is thus written in brackets, F3'H is flavonoid 3'-hydroxylase, C4H is Cinnamate 4hydroxylase; 4CL is 4-coumarate COA ligase; MT is methyltransferase (Boss et al. 1996).
Methods
BLAST results of MYB7 and putative regulators of anthocyanin production in Arabidopsis
To determine which MYB transcription factor to investigate, sequences encoding MYB
transcription factors in Clarkia gracilis sonomensis were compared to MYB sequences in
Arabidopsis through a BLAST search. MYB7 was found to have high sequence homology to
three MYB transcription factors found in Arabidopsis which are involved in anthocyanin
production: AtMYB90, AtMYB113, and AtMYB114. The results of the BLAST search are
shown in Figure 3.
*
*
*
Figure 3: BLAST results comparing the sequence of MYB7 to ATMYB90,
ATMYB113, and ATMYB114. (Right): The asterisks in the right-most
column indicate the Arabidopsis MYBs of interest
4
To minimize the impact of questionable matches, a BLAST E-value threshold of e ≤10−10
was utilized to identify relevant matches in the BLAST database (Nilsson et al. 2006). Due to the
high sequence homology (as represented by the very low E-value) between MYB7 in Clarkia
and the three MYB transcription factors of interest in Arabidopsis, MYB7 was hypothesized as a
candidate transcription factor to be involved in anthocyanin production in Clarkia.
Plant Materials
Two C. g. sonomensis parents, one of Type A and one of Type C, were crossed. Between
the two parents, a “GA” insertion in the intron of MYB7 DNA template sequence was found
(Figure 5). The Type A parent did not contain the “GA” insertion while the Type C individual
was homozygous for the “GA” insertion. The two individuals were bred to produce a hybrid F1
with a GA/GA- heterozygote. This F1 was then selfed to produce an F2 mapping population
which produced individuals of all three phenotypes. N = 31 total plant samples form the F2
mapping populations were phenotyped and genotyped to determine if MYB7 is involved in
anthocyanin production in plants.
Extraction of DNA
N = 31 individuals from the F2 population were sampled. DNA extraction was run
utilizing the cetyltrimethylammoniumbromide (CTAB) genomic DNA extraction protocol in
order to conduct genotype analysis of the samples (Murray & Thompson, 1980). The CTAB
extraction buffer consisted of a 50 mL mixture of 5mL 1.0M Tris pH 8.0, 2 mL 0.5M EDTA,
4.15g NaCL, 1g CTAB, 1g PVP (polyvinylpyrrolidone) and ddH2O to fill to 50mL. After
completion of DNA extraction, DNA quality and concentration was assessed using a ND-1000
Nanodrop Spectrophotometer. Samples of isolated DNA were diluted to 50 ng/µL.
PCR and DNA Sequencing
Primers were created which flanked the MYB7 DNA sequence of interest, where the
“GA” insertion is. The primers created are shown in Figure 4, and the primers used were the
5F/1R primers. For sequencing reactions, the 2F/1R primers were used.
Figure 4: MYB7 DNA template and the portion of the MYB7 DNA template that each primer covers. The “GA”
insertion was found to be in the region covered by the 5F/1R primers and were the primers used in this study. The
first and last black markers on the template represent the stop and start codons, respectively. The two markers in
the middle of the template are the places of the intron/exon junctions.
5
Each PCR reaction consisted of a 12.5 µL mixture consisting of 9.9µL distilled water,
1.25 µL10X Standard Taq reaction buffer, 0.5 µL of 10mM DNTPs, 0.5 µL of 10mM 5F primer,
0.5 µL of 10mM 1R primer, and 0.5 µL DNA. PCR was conducted utilizing the
“TouchdownNEB” program on the BioRad Thermocycler. This program allows for an increased
specificity for PCR reactions since the cycling programs begins at an initial annealing
temperature that is several degrees above the Tm of the primers. Specifically, there are two
phases in the program. The first phase uses a Tm that is 10°C above the calculated Tm. The
temperature is reduced by 1°C every successive cycle until the calculated Tm is reached. This is
done for a total of 10-15 cycles. The second phase then follows generic PCR amplification of up
to 20-25 cycles using the final annealing temperature (Korbie & Mattick, 2008). A no-template
negative control and a template positive control were included in every PCR reaction.
Sequencing of the parents and of individual samples was completed using the PCR
products amplified with the MYB7 2F/1R primers. Prior to the sequencing reactions, gel
electrophoresis on 1% agarose using a 1kb ladder was conducted to ensure PCR was successful.
Sequencing reactions were performed on the purified PCR products with a 10 µl final volume
containing 1µl of BigDye (BigDye Terminator cycle sequencing kit; Applied Biosystems), 3 µl
of BigDye Buffer, 1µl of 10mM primer, 2µl of distilled water, and 3µl of purified PCR product.
The sequence fragments were assembled using Sequencher (Gene Code corporations).
PCR-RFLP
PCR-RFLP was conducted as a way to genotype the individuals for the “GA” insertion.
The sequence of the parents are shown below in Figure 5 to show the “GA” insertion of interest
along with the sequence that each primer contains. The “GA” insertion is colored in green.
CgsMYB7[P1]
cMYB7-5F
AGCTACATTCGGTCAAACATATTtTA
AGCTACATTCGGTCAAACATATTGTATGAAAATTACAATTAACCCAACAATTTAATCATGATTCATCTTTTTACTCTATATATATA
GGTGGTCTTTGATTGCCGGTAGGTTGCCAGGTCGAACTGATAATGAGGTGAAAAACTACTGGAATTCACATTTGAGCAAGAGAATG
AACGGTAAACAGAAATCGAGTTTGGGATTAAAGCCGGCGCAATTAGAGGCAAATGACAAATCCATCAACACGACACAAGAAGAGAA
AAAGCAGCAGTTGGAAACAACCCAGATTACAACAGTGTCGTCGACTGAGCAAGCTGTCACCTCCTTATCCTCCTTTAATACAGATG
ATGATTTCTTTGATTTCTCAAATGAAAACCCTCTAAATCT
TGAGTGGGTCACCAGATTCTTGAACTAGATCATCAAAGAAGAAGGCAAGGTGTGATTGA
TGAGTGGGTCACCAGATTCTTGAACTAGATCATCAAAGAAGAAGGCAAGGTGTGATTGA
TGAGTGGGTCACCAGATTCTTGAACTAGATCATC
AAcMYB7-1R
CgsMYB7[P2]
cMYB7-5F
AGCTACATTCGGTCAAACATATTtTA
AGCTACATTCGGTCAAACATATTGTA
TAAATTACAATTAACCCAACAATTTAATCATGATTCATCTTTTTACTCTATATATATAGGTGGTCTTTGATTGCCGGTAGGTTGCC
AGGTCGAACTGATAATGAGGTGAAAAACTACTGGAATTCACATTTGAGCAAGAGAATGAACGGTAAACAGAAATCGAGTTTGGGAT
TAAAGCCGGCGCAATTAGAGGCAAATGACAAATCCATCAACACGACACAAGAAGAGAAAAAGCAGCAGTTGGAAACAACCCAGATT
ACAACAGTGTCGTCGACTGAGCAAGCTGTCACCTCCTTATCCTCCTTTAATACAGATGATGATTTCTTTGATTTCTCAAATGAAAA
CCCTCTAAATCTTGAGTGGGTCACCAGATTCTTGAACTAGATCATCAAAGAAGAAGGCAAGGTGTGATTGA
TGGTGGGTCACCAGATTCTTGAACTAGATCATC
AcMYB7-1R
Figure 5: Sequences of parents: P1 is Type C with the “GA” insertion where P2 is type A without the “GA” insertion.
This polymorphism was used as a way to genotype individuals without having to sequence all of them individually. The
boxes indicate the sequences covered by each of the primers used for PCR.
6
The PCR-RFLP protocol in this study was adapted slightly from the protocol described in
Ota et al. 2007. This procedure first involves amplifying the DNA segment of interest using
PCR. Next, the PCR products are run on a 1% agarose gel using a 1kb ladder as a way to ensure
that the PCR was successful. In order to differentiate between whether or not the individual
contained the “GA” insertion, mismatch PCR-RFLP was conducted, since there was not a
restriction enzyme with a perfect cleavage site available to distinguish between the samples.
Mismatch PCR-RFLP uses a primer containing an artificial restriction site (an additional
mismatched base or bases) adjacent to the SNP site (Love-Gregory et al. 2001). In this study, the
restriction enzyme PsiI was utilized, which recognizes the sequence TTA_^TAA. This sequence
is present in the template DNA without the “GA” insertion and is not present in the template
DNA with the “GA” insertion, allowing for PCR-RFLP to be feasible. Finally, a 4% agarose gel
electrophoresis with a 100bp marker was run. The genotyping mixture consisted of a 10µL final
mixture of 2µL H2O, 6µL of purified PCR product, 1µL CutSmart Buffer, and 1µL PsiI
restriction enzyme, and the digestion was run on the “PsiI” program of the BioRad
Thermocycler. Since template DNA without a “GA” insertion would be cut, this template DNA
is expected to be smaller than DNA with a “GA” insertion and thus travel farther down the gel.
Furthermore, heterozygotes are expected to have a double band. Based on the results from gel
electrophoresis, the genotype of individuals was determined at a much more efficient rate as a
way to ascertain if the “GA” insertion in the template DNA encoding MYB7 is associated with
anthocyanin production in Clarkia.
Results
In order to determine if the “GA” insertion in the MYB7 template DNA is associated
with anthocyanin production, n = 31 samples were phenotyped from the progeny of selfing the
F1 in the greenhouse and were genotyped using either sequencing or PCR RFLP. A mosaic plot
showing the distribution of genotypes and phenotypes is shown in Figure 5 and a contingency
table depicting the data collections is shown in Table 1.
Figure 7 depicts the results of a genotyping experiment with 4 samples in order to
determine the presence of the “GA” insertion. After each genotyping experiment was run, the
position of each band was analyzed to obtain genotype information, and was recorded in Table 1.
Genotype information was then matched to phenotype information, which was collected prior to
the conduction of the genotyping test. After collecting this data, a Fisher’s exact test was
conducted in order to determine if the “GA” insertion is independent of phenotype (Type A,
Type B, and Type C). The Fisher’s exact test was utilized since the sample size did not meet the
criteria to conduct a chi-square analysis. The results of this test are shown in Table 1. Most of the
genotypes were homozygotes: either GA-/ GA- or GA/GA, which is expected since the F1
population was selfed. Selfing homogenizes the population and reduces variety in the alleles
present, leading to an increased prevalence of homozygous genotypes in the F2 generation.
In order to test if PCR of the desired sequence of interest was successful, gel
electrophoresis on a 1% agarose gel was run and is shown in Figure 6. Furthermore, gel
electrophoresis was run on a 4% agarose gel and the bands were analyzed to determine the
phenotype of the individual. One genotyping gel that was run is shown in Figure 7.
7
Figure 5: Mosaic plot showing the
distribution of genotypes and
phenotypes in the F2 generation of
Clarkia.
Genotype
GA-/ GAGA/GAGA/GA
Total
Fisher’s
Exact Test
A
5
9
1
15
P = 0.773
Phenotype
B
5
5
1
11
Total
C
1
3
1
5
11
17
3
31
Table 1: Contingency table of
genotype and phenotype data
Figure 6: Example gel
showing bands, indicating a
successful PCR.
1 2 3 4 5 6 7
Figure 7: Genotyping gel
1. 100 bp marker
2. Negative control
3. Positive control (Type A): (GA-/GA-)
4. Type C: GA/GA
5. Type B: GA/GA6. Type B: GA/GA
7. Type A: GA/GA
8
Discussion
Based on the p-value from the Fisher’s exact test, the data do not provide convincing
evidence that the “GA” insertion is associated with phenotype. Therefore, these data provide
evidence that the “GA” insertion in the MYB7 template DNA sequence is not significantly
associated with anthocyanin production in Clarkia. These results are contrary to what was
expected at the conduction of the study. The data were expected to provide convincing evidence
that the MYB7 transcription factor was significantly associated with anthocyanin production and
Clarkia phenotype since, according to the BLAST results depicted in Figure 3, there was
extensive sequence homology between MYB7 and putative regulators of anthocyanin production
in Arabidopsis. However, consistent with others’ findings, there are significant differences in the
ways very similar proteins function in different species and also within the same organism (Jin &
Martin, 1999). Many MYB proteins share an extended degree of sequence similarity, especially
within the highly conserved MYB domain. However, it is unclear if this apparent structural
redundancy also accounts for functional similarity (Du et al., 2009). Despite the large number of
MYB protiens in plants, it is unlikely that many are precisely redundant in their functions, but
more likely they share overlapping function (Jin & Martin, 1999). For example, the structurally
closely related proteins AtMYB68 and AtMYB84 from Arabidopsis (Feng et al., 2004),
PhMYBAN2 from Petunia hybrida (Quattrocchio et al. 1993), and AmMYBROSEA from
Antirrhinum majus (Scwinn et al., 2006) belong to the MYB protein family controlling
anthocyanin biosynthesis. However, these factors display slightly different target gene
specificities, indicating no complete functional homology between these closely related MYB
proteins. A specific reason why this difference in function occurs has been investigated. For
example, AmMYB308 and AmMYB330 are very similar in their DNA binding domains (94%
sequence homology), suggesting they may bind the same target DNA motifs. On the other hand,
these transcription factors show no conservation of sequences in their C-termini (Tamagnone et
al., 1998). As a result, these structural features provide evidence that AmMYB308 and
AmMYB330 can recognize very similar (or perhaps the same) sequence motifs. However, due to
the divergence in sequence similarity in their C-termini, these two transcription factors may have
distinct functions in the regulation of transcription. In fact, AmMYB330 is expressed in
Antirrhinum plants where AmMYB330 is expressed mainly in mature flowers. Therefore,
looking at the function of each segment of the sequences, in lieu of the sequences as a whole,
could provide key insight into differential functions of MYB proteins with similar sequence
homology but different functions.
One potential limitation of our BLAST search is that perhaps MYB7 in Clarkia has
closer sequence homology to another MYB in Arabidopsis that has not been functionally
characterized. No functional data are available for most of the 125 R2R3- AtMYB genes are
available and so it is possible we had perhaps missed a better MYB gene candidate in Clarkia to
search for (Stracke 2001, Jiang 2004).
Future research should investigate differences in sequence homology at different
segments of the DNA template, such as the N-termini and C-termini, in order to help explain a
difference in the functions of transcription factors. Furthermore, future research should continue
elucidating the roles of MYB transcription factors to better understand the role of MYB
transcription factors and how they contribute to the biology of eukaryotes in general. Much work
still remains to characterize fully the roles of all MYB proteins in regulatory networks (Dubos et
al., 2010).
9
Ultimately, it has been shown that the data do not provide convincing evidence that the
“GA” polymorphism present in the MYB7 DNA template in Clarkia is not associated with
anthocyanin production. We hope this research spurs further investigation into the function of
MYB transcription factors and helps shed light onto the evolution of color transition and the
evolution of novel morphologies in Clarkia and in other species.
References:
1. Allan, Andrew C., Roger P. Hellens, and William A. Laing. "MYB transcription factors
that colour our fruit." Trends in plant science 13.3 (2008): 99-102.
2. Baldoni, Elena, Annamaria Genga, and Eleonora Cominelli. "Plant MYB transcription
factors: their role in drought response mechanisms." International journal of molecular
sciences 16.7 (2015): 15811-15851.
3. Boss, Paul K., Christopher Davies, and Simon P. Robinson. "Analysis of the expression
of anthocyanin pathway genes in developing Vitis vinifera L. cv Shiraz grape berries and
the implications for pathway regulation." Plant Physiology 111.4 (1996): 1059-1066.
4. Du, Hai, et al. "Biochemical and molecular characterization of plant MYB transcription
factor family." Biochemistry (Moscow) 74.1 (2009): 1-11.
5. Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L. Trends Plant Sci.
2010 Oct; 15(10):573-81.
6. Dubos, Christian, et al. "MYB transcription factors in Arabidopsis." Trends in plant
science 15.10 (2010): 573-581.
7. Dubos, Christian, et al. "MYB transcription factors in Arabidopsis." Trends in plant
science 15.10 (2010): 573-581.
8. Ellis AG, Johnson SD. 2010. Floral mimicry enhances pollen export: the evolution of
pollination by sexual deceit outside of the Orhidacae. American Naturalist 176: E143151.
9. Feng, Caiping, et al. "Arabidopsis MYB68 in development and responses to
environmental cues." Plant Science 167.5 (2004): 1099-1107.
10. Gompel, Nicolas, et al. "Chance caught on the wing: cis-regulatory evolution and the
origin of pigment patterns in Drosophila." Nature 433.7025 (2005): 481-487.
11. Gonzalez, Antonio, et al. "Regulation of the anthocyanin biosynthetic pathway by the
TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings." The Plant
Journal 53.5 (2008): 814-827.
12. Gottlieb, L. D., and V. S. Ford. "Genetic studies of the pattern of floral pigmentation in
Clarkia gracilis." Heredity 60.2 (1988): 237-246.
13. Jiang, Cizhong, et al. "Ordered origin of the typical two-and three-repeat Myb
genes." Gene 326 (2004): 13-22.
14. Jin, Hailing, and Cathie Martin. "Multifunctionality and diversity within the plant MYBgene family." Plant molecular biology 41.5 (1999): 577-585.
15. Jones, Kristina Niovi. "Pollinator behavior and postpollination reproductive success in
alternative floral phenotypes of Clarkia gracilis (Onagraceae)." International Journal of
Plant Sciences (1996): 733-738.
16. Kodandaramaiah U. 2009. Eyespot evolution: phylogenetic insights from Junonia and
related butterfly genera (Nymphalidae: Junoniini). Evolution and Develoopment 11: 489497.
10
17. Li C., Ng C.K.-Y., Fan L.-M. MYB transcription factors, active players in abiotic stress
signaling. Environ. Exp. Bot. 2015;114:80–91. doi: 10.1016/j.envexpbot.2014.06.014.
18. Love-Gregory, L.D., Dyer, J.A., Grasela, J., Hillman, R.E. & Phillips, C.L. Carrier
detection and rapid newborn diagnostic test for the common Y393N maple syrup urine
disease allele by PCR-RFLP: culturally permissible testing in the Mennonite community.
J. Inherit. Metab. Dis. 24, 393–403 (2001).
19. Martins, Talline R., Peng Jiang, and Mark D. Rausher. "How petals change their spots:
cis-regulatory re-wiring in Clarkia (Onagraceae)." New Phytologist (2016).
20. Mengiste T, Chen X, Salmeron J, Dietrich R. The BOTRYTIS SUSCEPTIBLE1 gene
encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic
stress responses in Arabidopsis. Plant Cell. 2003;15:2551–2565. doi:
10.1105/tpc.014167.
21. Miller, Craig T., et al. "cis-Regulatory changes in Kit ligand expression and parallel
evolution of pigmentation in sticklebacks and humans." Cell 131.6 (2007): 1179-1189.
22. Murray, M. G., and W. Fm Thompson. "Rapid isolation of high molecular weight plant
DNA." Nucleic acids research 8.19 (1980): 4321-4326.
23. Narasuka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M,
Shinozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting
elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in
response to dehydration and high-salinity stresses. Plant J 34:137–148
24. Ota, Masao, et al. "Single nucleotide polymorphism detection by polymerase chain
reaction-restriction fragment length polymorphism." Nature protocols2.11 (2007): 28572864.
25. Qi, Tiancong, et al. "The Jasmonate-ZIM-domain proteins interact with the WDRepeat/bHLH/MYB complexes to regulate Jasmonate-mediated anthocyanin
accumulation and trichome initiation in Arabidopsis thaliana." The Plant Cell 23.5
(2011): 1795-1814.
26. Quattrocchio, Francesca, et al. "Regulatory genes controlling anthocyanin pigmentation
are functionally conserved among plant species and have distinct sets of target
genes." The Plant Cell 5.11 (1993): 1497-1512.
27. Ramsay, Nicola A., and Beverley J. Glover. "MYB–bHLH–WD40 protein complex and
the evolution of cellular diversity." Trends in plant science 10.2 (2005): 63-70.
28. Reed RD, Papa R, Martin A, Hines H, Counterman BA, Pardo-Diaz C, Jiggins C,
Chamberlain NL, Kronforst MR, Chen R et al. 2011. Optix drives the repeated
convergent evolution of butterfly wing pattern mimicry. Science 333: 1137-1141.
29. Schwinn, Kathy, et al. "A small family of MYB-regulatory genes controls floral
pigmentation intensity and patterning in the genus Antirrhinum." The Plant Cell 18.4
(2006): 831-851.
30. Soltis, Pamela S., and William L. Bloom. "Genetic variation and estimates of gene flow
in Clarkia speciosa subsp. polyantha (Onagraceae)." American journal of botany (1986):
1677-1682.
31. Stracke, Ralf, Martin Werber, and Bernd Weisshaar. "The R2R3-MYB gene family in
Arabidopsis thaliana." Current opinion in plant biology 4.5 (2001): 447-456.
32. Tamagnone, Lodovico, et al. "The AmMYB308 and AmMYB330 transcription factors
from Antirrhinum regulate phenylpropanoid and lignin biosynthesis in transgenic
tobacco." The Plant Cell 10.2 (1998): 135-154.
11
33. Wittkopp, Patricia J., and Gizem Kalay. "Cis-regulatory elements: molecular mechanisms
and evolutionary processes underlying divergence." Nature Reviews Genetics 13.1
(2012): 59-69.
34. Eckhart M, Rushing S, Hart M. 2006. Frequency dependent pollinator foraging in
polymorphic Clarkia xantiana ssp. Xantiana populations: implications for flower colour
evolution and pollinator interactions. Oikos 112: 412-421.
35. Korbie, Darren J., and John S. Mattick. "Touchdown PCR for increased specificity and
sensitivity in PCR amplification." Nature protocols 3.9 (2008): 1452-1456.