CHAPTER8
Gene expression
• Three aspects in transcription
- Enzyme: DNA-dependent RNA polymerase
- Signals for start and stop
- The types of transcription products
Prokaryotic RNA Polymerase Activation Complex
Enzymatic synthesis of RNA
• Ribonucleoside triphosphates (rNTP)
• Complementary to DNA base sequence
• Polymerization of rNTP to 3’-OH (5’ → 3’)
• Antiparallel DNA-RNA
• 5’-end terminates with a triphosphate
• RNA polymerase of E. coli
– no primer is needed
– Five subunits  → Holo-enzyme
– Core-enzyme : 
sense, coding strand
template, antisense, non-coding strand
• RNA synthesis stage
– Binding of RNA pol to a specific site: promoter
– Initiation
– Chain elongation
– Chain termination and release
Transcription signal
• RNA pol-binding site called promoter
• E. coli, 10 and 35 bp before transcription initiation site
• Sigma () factor binds this site.
• -10 region: TATAAT
• -35 region: TTGACA
• Gene activator protein – helps RNA polymerase
• Open-promoter complex
• Template strand
• Terminator: transcription termination
– Intrinsic terminator (Fig. 8-8)
– -factor terminator (rho-dependent)
Classes of RNA molecules
• mRNA, tRNA, rRNA
• mRNA
– Codon: Triplet, start & stop
– Cistron: start and stop signal for AA synthesis + polypeptide segment
– Monocistronic mRNA & Polycistronic mRNA
– Leader sequence: upper non-translated region, 5’-UTR
• Including attenuator
– Spacer: between cistrons in polycistron, non-translated region
– 3’-UTR: often contains regulatory regions (post-transcription)
• translation efficiency, localization, and stability of the mRNA
• Stable RNA: rRNA and tRNA
– no ability of AA to line up against the mRNA
– Primary transcript – RNA processing by post-transcriptional modification
– 5’-monophosphate (5’-NMP) rather than triphosphate (5’-NTP)
– Unusual bases: pseudouridine (), 2-isopentenyladenosine (2ipA), 2-omethylguanosine (2mG), 4-thiouridine (4tU)
– Single primary transcript contains several different molecules (Fig. 8-9)
• rRNA:
– in 70S ribosome (prokaryote) : 23S, 5S,16S
– In 80S ribosome (eukaryote) : 28S, 5.8S, 18S, 5S
Transcription in Eukaryotes
• 3 RNA polymerases: RNA pol I, II, III
– RNA polymerase I (nucleolus, rRNA)
– RNA polymerase II, (nucleoplasm, mRNA)
– RNA polymerase III, (nucleoplasm, tRNA, 5S RNA)
• Many mRNA molecules are very long lived.
• 5’-cap and 3’-poly A tail
• Intron (Exon)
• Monocistronic
• Initiation: TATAAAA centered at –29
– Upstream activation sequence, enhancer
– Binding by transcription factors (TF, usually protein)
• 5’-cap: 7-methylguanosine
– (7-MeG)-5’-PPP-5’-(G or A, with possibly methylated ribose)-3’-P
2
1
3
6
4
5
9
7
8
The biological significance of capping has not yet been unambiguously established, but it is
believed that it is required for efficient protein synthesis.
• 3’-tail: poly(A)
- Transcription normally passes the site of poly A
- Endonucleolytic cleavage before adding (A)
- AAUAAA site: 10~25 bases upstream from the poly(A)
- Some primary transcripts contains 2 sites, differentially terminated
depending on life cycle
- Length can be 50 to 250
- stability
• Intervening sequences (introns)
• RNA splicing: excision and joining
↓
↓
5’-(A/C)AGGU(A/G)AGU---intron---(Py)X6CAGG(G/U)-3’
Intron Sequence:
5’GU---nucleotides---AG3’
ATGCCGCCTCAGGGAGGCTCAAGGAAGATTTCCTTTAACGTCTCAGATCAATATGAGATTCAAGACGTCATTGGTGAAGGCGCCTATGGTGTTGTTTGGT
GAGAATAACGGTGTAAACCATGCCGGTTATTTACTGATTTTTCCCAGCTCTGCTATCCACAAGCCCTCTGGCCAGAAGGTAGCCATCAAGAAGATCACCC
CCTTTGACCATTCGATGTTTTGCCTGCGAACCCTACGAGAGATGAAGCTGCTCCGCTACTTCAACCATGAGAATATCATCTCCATTTTGGACATCCAGAG
GCCGCGAAACTATGAGAGTTTCAACGAAGTCTACCTCATTCAGGTAAATTGCACTAGTGCGGCGCACATCTGAGAGCCGGCTGATTGATTGGTACTGTAG
GAATTGATGGAAACAGATATGCACCGCGTTATCCGCACGCAAGACCTGTCAGATGACCACTGCCAGTACTTTATTTACCAAACTTTGCGTGCGCTGAAGG
CCATGCACTCCGCTAACGTCCTCCACCGTGATCTCAAACCATCGAACCTTCTCCTCAATGCAAATTGTGACCTGAAGGTCTGCGACTTTGGTCTAGCTCG
ATCTGCGGCTTCGACTGACGATAATTCTGGTTTCATGACGGAATACGTGGCGACGCGCTGGTACCGTGCACCTGAAATCATGTTGACGTTCAAGGAATAC
ACAAAGGCAATTGATGTGTGGAGTGTGGGCTGCATTCTTGCAGAGATGCTGAGCGGGAAGCCCTTGTTCCCTGGAAAGGACTGTAGGTACTCTATTGGTG
GTTGGTGGAGAAATGCGGGCTAACGCATGGCAGATCACCATCAATTGACTCTAATTCTGGATGTTCTTGGAACACCTACCATGGAAGACTACTACGGAAT
CAAGTCCCGACGGGCTCGGGAGTACATCCGTTCTCTCCCATTCAAGAAGAAGATTCCGTTCAAGGCACTGTTCCCTAAGAGCAACGACCTAGCTCTGGAT
CTGCTAGAGAAGCTTTTGGCCTTCAACCCGACGAAGCGAATCACCGTGGAGGAGGCTCTGCGTCACCCGTACCTGGAACCATATCATGATCCAGATGACG
AGCCAACAGCGCCCCCAATCCCGGAAGGCTTCTTTGACTTCGACAAGAATAAGGATGCTCTCAGCAAAGAGCAGTTGAAAAGTAAGTATCTGGCGCCAAT
CGACTCCATAAGTTATGCGACAATCAACTAA
• Why intron?
– In evolutionary aspect, almost no intron in prokaryote
* Recombination altered by prokaryotic DNA
– Interrupted genes originally exists then lost
– Differential splicing can produce different molecules
Means Studying Intracellular RNA
• DNA-DNA hybridization: Southern blotting
• DNA-RNA hybridization: Northern blotting
• Probe: labeled DNA with radioisotope, usually P32
CHAPTER9
• Decoding process of genetic information
– Initiation
– Elongation: peptide bonding
– Termination
– Release with folding and modification
Outline of translation
• On ribosome
– in prokaryotes, 3 RNAs and 55 protein molecules
• Enzymes to form peptide bond between AAs
• A site for binding mRNA
• AAs themselves are not interact with ribosome and cannot
recognize bases in mRNA
– Require carrier molecules – tRNA: anticodon
• In prokaryotes, transcription and translation occur
simultaneously, but not in eukaryotes
• Direction in synthesis
non
The Genetic Code
• Genetic code: codon
- Specifying the bases unit of each AA.
- 20 AAs requires at least 20 codons, > 42=16, 43=64 triplets, possible codons
• General properties:
- Three bases
- Do not overlap
• UUU – phe, UUUUUU – phe, UUUUUUUUG - leu
• Most amino acids have more than one codons
– Met and Trp have only a single codon
– Codon is redundant or degenerate – GGU, GGC, GGA and GGG → Gly
– Stop codon – UAA, UAG, UGA
– Start codon – AUG
• Exception: in some bacteria GUG instead of AUG
• The same codon-amino acid relation for all organisms
– viruses, prokaryotes, and eukaryotes
– Universal
• Exceptions: mitochondria, nuclear codon of certain yeast and ciliates,
chloroplasts
tRNA and Aminoacyl Synthetases
• Aminoacyl-tRNA synthetase – attach AA to tRNA
• tRNA: 73 to 93 nt, 3’-OH and 5’-monophosphate
• Anticodon loop, no anticodon complementary to any of the stop codons
UAG, UGA, UAA
• AA attach site: 3’-OH at the end of CCA
• Different aminoacyl-tRNA synthetase for 20 AA
– tRNAphe, uncharged
– Phe-tRNA, charged or acylated
– Sometimes mischarged
The Wobble Hypothesis
• 3rd base of codon can bind to 1st base of anticodon with irregularity
- A – U or I, G – C or U, U – G, I or A, C – G or I
Polycistronic mRNA
• Start, protein 1, stop – start, protein 2, stop – start, protein 3, stop.
• Spacer of from 5 to 20 bases
Overlapping Gene
• Reading frame is overlapped
• x174
Polypeptide synthesis
• Initiation, elongation, termination
• Ribosome, Prokaryotes
– 70S = 30S + 50S
– 30S: 16S rRNA, 21 different protein molecules
– 50S: 23S, 5S rRNA, 33 different protein molecules
• Ribosome, eukaryotes
– 80S = 40S + 60S
– 40S: 18S rRNA, 30 different protein molecules
– 60S: 28S, 5.8S, 5S rRNA, 50 proteins
Peptide synthesis in prokaryotes
• N-formylmethionine: tRNAmet
• 30S pre-initiation complex
– 30S, mRNA, fMet-tRNA, 3 proteins
• Ribosome binding site (RBS)
– Shine-Dagarno sequence
• Join 50S subunit – form 70S initiation complex
• A (aminoacyl) site and P (peptidyl) site in 50S
• Peptidyl transferase: peptide bond
• Translocation:
– Movement of peptidyl-tRNA from the A site to the P site.
– Requires elongation factor EF-G and GTP
• On termination codons, releasing factor
Complex translation units
• Polysome (polyribosome)
• Coupled transcription-translation
• Eukaryotic translation
– Poly A
– Cap: 7-methylguanosine: protect from exonuclease